- Email: [email protected]
In vitro replication of hepatitis C virus in a human lymphoid cell line (H9)
Journal of Hepatology 1994; 20:437 Printed in Denmark. All rights reserved Munksgaard. Copenhagen
Copyright © Joun~alof Hepatology 1994
Journal of Hepatology ISSN 0168-8278
Letter to the Editor
In vitro replication of hepatitis C virus in a human lymphoid cell line (H9) We were interested to read the article "Infection of peripheral mononuclear blood cells by hepatitis C virus" (1). These findings suggest that lymphocytes could be a site for extrahepatic viral replication during the natural course of infection, h~ vitro replication of hepatitis C virus (HCV) in MOLT-4 cells inoculated with serum of HCV-infected patients has been demonstrated (2). The development of in vitro systems for the propagation of hepatitis C virus could be an important tool in diagnosis, production of virus vaccines and studies of pathogenesis of HCV infection. We tested the H9 cell line, a derivate of the human T-cell line HT, for their ability to support HCV replication in vitro. Serum obtained from an HCV-infected patient after transplantation was used as inoculum. A cell suspension of about 4× 106 cells per ml was mixed with the undiluted inoculum, incubated for 2 h at 37°C and then diluted to 4x 10s cells per ml. The cells were maintained in RPMI 1640 medium (SERVA, Heidelberg) with 10% fetal calf serum and suitable antibiotics were added. The occurrence of minus- and plusstrand viral RNA in the extensive washed H9-cells and in the supernatant was detected at various times during the culture period by reverse transcription followed by 40 cycles of amplification by polymerase chain reaction (PCR). One primer pair designed to detect the
5' noncoding region of the HCV genome was used in the cDNA/ PCR, using the sense primer 1 (5'GGCGACACTCCACCATAGAT) to prime cDNA synthesis from minus-strand HCV RNA, and antisense primer 2 (5'GGTGCACGGTCTACGAGACC) for cDNA synthesis from plus-strand RNA. Specificity of the amplified product of 324 bp length (nt position -324 to - 1 according to the nucleotide numbering of Choo et al. (3)) was confirmed by nonradioactive Southern blot hybridization using a digoxigenin-labeled internal PCR probe (nt -305 to -39). RNA from uninfected H9 cells served as a negative control in each reaction step. Cell suspensions wereharvested 2 h after inoculation and on days 3, 5, 7, 10, 14, 17, 19 and 21 (Table 1). Minus-strand RNA was detected in the H9 cells 3-10 days after inoculation, with a maximum level on day 5. In contrast to all other PCR results, a clearly visible minus RNA product was obtained only after nested PCR using an internal primer pair. In the supernatant, minus-strand RNA occurred between day 3 and 12, with a maximum level on day 10. Intracellular plus-strand viral RNA was detected at the same time. In the supernatant plus-strand RNA occurred between day 12 and 21, reaching a maximum level on day 14. The low level of viral plus-strand RNA detected during the first 10 days was probably due to the viral content of the inoculum. The growth of cells is not influenced by virus replication. Reinfection of H9 cells, h~ situ hybridization, and localization of virus particles in cultivated cells will be done in future.
TABLE 1 Detection of HCV plus and minus strand RNA in H9 cell cultures by cDNA/PCR Time after inoculation
Minus-strand RNA
Plus-strand RNA
Cells
Supernatant
Cells
Supernatant
2 hours 3 days 5 days 7 days 10 days 12 days 14 days 17 days 19 days 21 days
+ ++ + +/-
+/+/+ ++ + +/+/-
+ + + +/+/+
+/+ +/+ + ++ + +/+
-: no signal; + / - : weak signal; +: medium signal; + + : strong signal in the Southern blot hybridization. PCR=polymerase chain reaction.
Eberhard Nissen, Maria H6hne and Eckart Schreier Department o f hlfection Epidemiology, Robert Koeh-h~stitute o f the Federal Health Office, Britzer Str. 1-3, 0-1190 Berlin, Germal o,
References I. Zignego AL, Macchia D, Monti M, et al. Infection of peripheral mononuclear blood cells by hepatitis C virus. J Hepatol 1992; 15: 382-6. 2. Shimizu YK, Iwamoto A, Hijikata M, Purcell RH, Yoshikura, H. Evidence for in vitro replication of hepatitis C virus genome in a human T-cell line. Proc Natl Acad Sci USA 1992; 89: 5477-81. 3. Choo QL, Richman KG, Han JH, et al. Genetic organization and diversity of the hepatitis C virus. Proc Natl Acad Sci USA 1991; 88: 2451-5.
Copyright © Joun~alof Hepatology 1994
Journal of Hepatology ISSN 0168-8278
Letter to the Editor
In vitro replication of hepatitis C virus in a human lymphoid cell line (H9) We were interested to read the article "Infection of peripheral mononuclear blood cells by hepatitis C virus" (1). These findings suggest that lymphocytes could be a site for extrahepatic viral replication during the natural course of infection, h~ vitro replication of hepatitis C virus (HCV) in MOLT-4 cells inoculated with serum of HCV-infected patients has been demonstrated (2). The development of in vitro systems for the propagation of hepatitis C virus could be an important tool in diagnosis, production of virus vaccines and studies of pathogenesis of HCV infection. We tested the H9 cell line, a derivate of the human T-cell line HT, for their ability to support HCV replication in vitro. Serum obtained from an HCV-infected patient after transplantation was used as inoculum. A cell suspension of about 4× 106 cells per ml was mixed with the undiluted inoculum, incubated for 2 h at 37°C and then diluted to 4x 10s cells per ml. The cells were maintained in RPMI 1640 medium (SERVA, Heidelberg) with 10% fetal calf serum and suitable antibiotics were added. The occurrence of minus- and plusstrand viral RNA in the extensive washed H9-cells and in the supernatant was detected at various times during the culture period by reverse transcription followed by 40 cycles of amplification by polymerase chain reaction (PCR). One primer pair designed to detect the
5' noncoding region of the HCV genome was used in the cDNA/ PCR, using the sense primer 1 (5'GGCGACACTCCACCATAGAT) to prime cDNA synthesis from minus-strand HCV RNA, and antisense primer 2 (5'GGTGCACGGTCTACGAGACC) for cDNA synthesis from plus-strand RNA. Specificity of the amplified product of 324 bp length (nt position -324 to - 1 according to the nucleotide numbering of Choo et al. (3)) was confirmed by nonradioactive Southern blot hybridization using a digoxigenin-labeled internal PCR probe (nt -305 to -39). RNA from uninfected H9 cells served as a negative control in each reaction step. Cell suspensions wereharvested 2 h after inoculation and on days 3, 5, 7, 10, 14, 17, 19 and 21 (Table 1). Minus-strand RNA was detected in the H9 cells 3-10 days after inoculation, with a maximum level on day 5. In contrast to all other PCR results, a clearly visible minus RNA product was obtained only after nested PCR using an internal primer pair. In the supernatant, minus-strand RNA occurred between day 3 and 12, with a maximum level on day 10. Intracellular plus-strand viral RNA was detected at the same time. In the supernatant plus-strand RNA occurred between day 12 and 21, reaching a maximum level on day 14. The low level of viral plus-strand RNA detected during the first 10 days was probably due to the viral content of the inoculum. The growth of cells is not influenced by virus replication. Reinfection of H9 cells, h~ situ hybridization, and localization of virus particles in cultivated cells will be done in future.
TABLE 1 Detection of HCV plus and minus strand RNA in H9 cell cultures by cDNA/PCR Time after inoculation
Minus-strand RNA
Plus-strand RNA
Cells
Supernatant
Cells
Supernatant
2 hours 3 days 5 days 7 days 10 days 12 days 14 days 17 days 19 days 21 days
+ ++ + +/-
+/+/+ ++ + +/+/-
+ + + +/+/+
+/+ +/+ + ++ + +/+
-: no signal; + / - : weak signal; +: medium signal; + + : strong signal in the Southern blot hybridization. PCR=polymerase chain reaction.
Eberhard Nissen, Maria H6hne and Eckart Schreier Department o f hlfection Epidemiology, Robert Koeh-h~stitute o f the Federal Health Office, Britzer Str. 1-3, 0-1190 Berlin, Germal o,
References I. Zignego AL, Macchia D, Monti M, et al. Infection of peripheral mononuclear blood cells by hepatitis C virus. J Hepatol 1992; 15: 382-6. 2. Shimizu YK, Iwamoto A, Hijikata M, Purcell RH, Yoshikura, H. Evidence for in vitro replication of hepatitis C virus genome in a human T-cell line. Proc Natl Acad Sci USA 1992; 89: 5477-81. 3. Choo QL, Richman KG, Han JH, et al. Genetic organization and diversity of the hepatitis C virus. Proc Natl Acad Sci USA 1991; 88: 2451-5.