- Email: [email protected]
TOR pathway
Accepted Manuscript In vitro stimulation of vitellogenin expression by insulin in the mud crab, Scylla paramamosain, mediated through PI3K/Akt/TOR pathway Xiaoshuai Huang, Biyun Feng, Huiyang Huang, Haihui Ye PII: DOI: Reference:
S0016-6480(17)30214-9 http://dx.doi.org/10.1016/j.ygcen.2017.06.013 YGCEN 12667
To appear in:
General and Comparative Endocrinology
Received Date: Revised Date: Accepted Date:
22 March 2017 14 June 2017 20 June 2017
Please cite this article as: Huang, X., Feng, B., Huang, H., Ye, H., In vitro stimulation of vitellogenin expression by insulin in the mud crab, Scylla paramamosain, mediated through PI3K/Akt/TOR pathway, General and Comparative Endocrinology (2017), doi: http://dx.doi.org/10.1016/j.ygcen.2017.06.013
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
In vitro stimulation of vitellogenin expression by insulin in the mud crab, Scylla paramamosain, mediated through PI3K/Akt/TOR pathway
Xiaoshuai Huang 1, Biyun Feng 1, Huiyang Huang 1, Haihui Ye 1,2,*
1
College of Ocean and Earth Sciences, Xiamen University, Xiamen 361102, China
2
Collaborative Innovation Center for Development and Utilization of Marine Biological
Resources, Xiamen 361102, China
*
Corresponding authors: [email protected] (H. Ye)
Keywords: insulin-like peptide; vitellogenin; in vitro experiments; RNAi; Scylla paramamosain
1
Abstract: Vitellogenin (vtg) synthesis, known as vitellogenesis, is one of most important processes in the ovarian development of oviparous animals. Recently, multiple insulin-like peptides (ILPs) have been reported in crustacean species due to the application of transcriptome sequencing. In this context, the present study reports that the addition of an exogenous ILP, bovine insulin, stimulates vtg (termed Sp-vtg) expression in hepatopancreatic explants from the mud crab, Scylla paramamosain, by in vitro experiments. Homologous genes of key factors in ILP signaling, Sp-PI3K, Sp-Akt, Sp-Rheb and Sp-TOR, have been isolated in S. paramamosain based on a transcriptome database. Further experiments reveal that the RNAimediated Sp-Akt gene knockdown and the inhibitors of Sp-PI3K and Sp-TOR block the stimulation of Sp-vtg expression by insulin. The combined results implicate the endogenous ILP and its corresponding signaling in the regulation of Sp-vtg synthesis in S. paramamosain.
2
1. Introduction Vitellogenesis is a hormone-regulated reproductive process in the ovarian development of oviparous animals, known as the process of yolk proteins production and their accumulation in ovary (Wiegand, 1996). The vitellogenin (vtg), precursor of the major yolk protein vitellin (vn), is synthesized primarily under hormonal control during maturation of oocytes (Wahli et al., 1981; Subramoniam, 2011). In addition, vtg genes are subject to specific regulation by sex, tissue, developmental stage and seasonal variation (MacMorris et al, 1992; Thongda et al., 2015). Vtg synthesis takes place in the liver of vertebrates (Byrne et al., 1989), the fat body of insects (Sappington and Raikhel, 1998) and the intestine of nematodes (Nakamura et al., 1999). Decapod crustaceans utilize two different tissues for vtg synthesis: the hepatopancreas and ovary (Subramoniam, 2011). Nevertheless, it is suggested that the hepatopancreas is the main site for vtg synthesis in Pleocyamata species including brachyurans (Zmora et al., 2007; Subramoniam, 2011; Girish et al., 2014). However, the percentage of each tissue that contributes to vitellogenesis has not been fully studied. Regulation of vtg synthesis is highly diverse in decapod crustaceans. It’s widely recognized that the members of crustacean hyperglycemic hormone (CHH) family, various neuromodulators, the ecdysone and the methyl farnesoate (MF) play important roles in this process (Nagaraju, 2011). The insulin-like peptide (ILP) superfamily is a group of peptides structurally homologous to insulin. Various ILPs have been widely identified in invertebrates and they are associated with a set of functions in regulating growth, metabolism and reproduction (Nagasawa et al., 1986; Krieger et al., 2004; Ventura et al., 2009; Rosen et al., 2010; Marquez et al., 2011; Chung, 2014; Huang et al., 2014). However, in crustaceans, there is only one ILP, the insulin-like androgenic gland factor (IAG), that has been identified, which is a male-specific ILP that controls the sexual differentiation and maintains male secondary sex characteristics (Ventura et al., 2009; Rosen et al., 2010; Ventura et al., 2011). More recently, multiple ILPs have been reported in both sexes of crustacean species due to the application of transcriptome sequencing (Chandler et al., 2015; 3
Veenstra, 2015; Veenstra, 2016). In this context, it is necessary and significant to explore the function of ILPs in female reproduction of crustaceans including vitellogenesis. The ILP signaling pathway is generally conserved in eukaryotic organisms (Garofalo, 2002; Wu and Brown, 2006). In mammals and insects, ILP signals regulate protein synthesis through stimulation of target of rapamycin (TOR), which requires primarily the activation of phosphatidylinositol-3-kinase/protein kinase B (PI3K/Akt) pathway. The Ras homolog enriched in brain (Rheb) acts as a key activator of TOR by binding to GTP, while this process is inhibited by Rheb-GTPase-activating protein (GAP) (Aspuria and Tamanoi, 2004). Akt inactivates RhebGAP, thus maintaining TOR in the active state. In crustaceans, by contrast, very little information is available regarding the response mechanism of ILPs. In this paper, we report that exogenous insulin stimulates vtg (termed Sp-vtg) expression in hepatopancreatic explants from the mud crab, Scylla paramamosain, by in vitro experiments. Several homologous genes of key factors in ILP signaling, PI3K, Akt, Rheb and TOR (termed Sp-PI3K, Sp-Akt, Sp-Rheb and Sp-TOR, respectively), are isolated in S. paramamosain based on a transcriptome database. Further experiments reveal that the RNAi-mediated Sp-Akt gene knockdown and the inhibitors of PI3K and TOR can block the stimulation of Sp-vtg expression by insulin.
2. Materials and methods 2.1. Animals, tissue sampling and the in vitro explant culture system Animal experiments in this study were conducted in accordance with the international, national and institutional rules. All experimental protocols were approved by the Review Committee for the Use of Human or Animal Subjects of Xiamen University. Adult S. paramamosain females at intermolt stage with the carapace width ranging from 85.0-125.0 mm were purchased from a local fish market in Xiamen, Fujian Province, China. The animals were reared separately in rectangular tanks with seawater at a temperature of 27 ± 1 °C 4
and a salinity of 26 ppt for three days. Ovarian stages were determined using the criteria as described in Huang et al. (2014). Females at early vitellogenic stage were placed on ice for anesthetization and then dissected for the following tissues: the brain, ovary, hepatopancreas, hemocytes and muscle. The in vitro explant culture system that has been established previously (Gong et al., 2015; Huang et al., 2015) was used in this study. Briefly, the hepatopancreas sample is dissected from the anesthetized female crab at early vitellogenic stage, rinsed nine times with a crab saline solution containing penicillin G at 300 IU/ml and streptomycin at 300 μg/ml (Sigma-Aldrich Co.), and then divided into small pieces (~ 20 mg). Each piece is placed in a well of the 24-well plate containing 0.2 ml of 2 x L15 medium (Gibco) for preincubation at 25 °C.
2.2. Total RNA extraction and cDNA synthesis Total RNA was extracted from each tissue using TRIzol® Reagent (Invitrogen) and quantified with an ND-2000 NanoDrop UV spectrophotometer (NanoDrop Technologies). Genomic DNA contamination was eliminated using RNase-free DNase I (Fermentas). One μg resultant total RNA of each tissue was used for cDNA synthesis using the RevertAid First Strand cDNA Synthesis Kit (Fermentas) following the manufacturer's protocol.
2.3. Levels of Sp-vtg expression in the ovary and hepatopancreas of S. paramamosain at early vitellogenic stage The cDNA samples derived from the ovary and hepatopancreas of three females at early vitellogenic stage were examined for Sp-vtg expression using a quantitative real-time PCR (qPCR) with primers Sp-vtgQF and Sp-vtgQR (Jia et al., 2013) listed in Table 1. The qPCR conditions kept the same as described (Huang et al., 2015). Amplification of the β-actin with primers β-actinF and β-actinR (Table 1) was concurrently carried out as the internal control. The hepatopancreas was determined as the major site of Sp-vtg synthesis and used for the 5
following in vitro culture experiments.
2.4. In vitro effects of insulin on Sp-vtg expression After the preincubation for 1 hour, the culture medium was substituted with 0.5 ml 2 x L15 medium that contains bovine insulin (Sigma) at different concentrations. The hepatopancreatic explants were treated with six concentrations 0, 50,100, 200, 400 and 800 ng/ml in triplicate and incubated at 25 °C for 6 h. The explants were subsequently collected for total RNA extraction and cDNA synthesis before the qPCR analysis of vtg expression as mentioned above. The dosage of insulin at 200 ng/ml was adopted for the following in vitro experiments.
2.5. Molecular cloning of the key factors in ILP signaling Partial cDNA sequences of Sp-PI3K (GenBank accession no. KY681017), Sp-Akt (GenBank accession no. KY681018), Sp-Rheb (GenBank accession no. KY681019) and SpTOR (GenBank accession no. KY681020) were obtained from a transcriptome database of the brain in S. paramamosain (data not shown). Primer pairs: Sp-PI3KF and R, Sp-AktF and R, SpRhebF and R, and Sp-TORF and R (Table 1), were designed to cloning the corresponding genes using a template of the brain tissue. The putative functional domains were predicted by SMART program (http://smart.embl-heidelberg.de). Tissue distribution analyses were carried out with cDNA samples derived from various tissues using a reverse transcription PCR (RT-PCR) at the following PCR conditions: 94 °C for 3 min followed by 32 cycles of 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 2 min and the final extension at 72 °C for 10 min. As a reference gene, the amplification of β-actin with primers: βactinF and β-actinR (Table 1), was carried out using the same tissue cDNA samples. The PCR products were separated on 1.5% agarose gels and visualized using ethidium bromide.
2.6. In vitro RNAi knockdown experiments 6
The Sp-Akt-dsRNA was synthesized in vitro by the T7 and SP6 polymerase (Fermentas) as described previously (Gong et al., 2015) using the Sp-Akt DNA template amplified with primers Sp-AktdsF and Sp-AktdsR (Table 1). As a control, the green fluorescent protein (GFP)-dsRNA was synthesized in the same way using the GFP DNA template amplified with primers GFPdsF and GFPdsR (Table 1) from the pSicoR-EGFP vector (Gong et al., 2015). In order to examine the effects of Sp-Akt-dsRNA on Sp-Akt expression, three groups of preincubation with different culture media were used in in vitro culture of hepatopancreatic explants: 1) Control group: 2 x L15 medium; 2) GFP-dsRNA group: 2 x L15 medium containing 1 μg/ml GFP-dsRNA; 3) Sp-Akt-dsRNA group: 2 x L15 medium containing 1 μg/ml Sp-Akt-dsRNA. The hepatopancreatic explants were subsequently collected at 30 min and 60 min, respectively. Each treatment was carried out in triplicate. The samples were used for total RNA extraction and cDNA synthesis before the qPCR analysis of Sp-Akt expression with primers Sp-AktQF and Sp-AktQR (Table 1). To examine the effect of Sp-Akt silencing on Sp-Rheb and Sp-vtg expression, four treatments were designed in the following experiments: 1) Control group: 30 min preincubation with 2 x L15 medium and then 6 h incubation with 2 x L15 medium; 2) Insulin group: 30 min preincubation with 2 x L15 medium and then 6 h incubation with 2 x L15 medium containing 200 ng/ml insulin; 3) GFP-dsRNA + insulin group: 30 min preincubation with 2 x L15 medium containing 1 μg/ml GFP-dsRNA and then 6 h incubation with 2 x L15 medium containing 200 ng/ml insulin; 4) Sp-Akt-dsRNA + insulin group: 30 min preincubation with 2 x L15 medium containing 1 μg/ml Sp-Akt-dsRNA and then 6 h incubation with 2 x L15 medium containing 200 ng/ml insulin. The hepatopancreatic explants were sampled for total RNA extraction and cDNA synthesis before the qPCR analysis of Sp-Rheb expression with primers Sp-RhebQF and QR (Table 1), and Sp-vtg expression with primers Sp-vtgQF and QR (Table 1).
2.7. In vitro inhibitor studies 7
For inhibitor studies, the hepatopancreatic explants were cultured with 2 x L15 medium containing either 20 μM LY294002 (PI3K-inhibitor, Abcam) or 150 nM rapamycin (TOR-inhibitor, Abcam) for 30 min preincubation. After that, the culture medium was substituted with 2 x L15 medium that contains 200 ng/ml insulin for 6 h incubation. The hepatopancreatic explants were sampled for total RNA extraction, cDNA synthesis and qPCR analysis of Sp-vtg expression as mentioned above.
2.8. Statistical analyses The qPCR data were calculated using 2-ΔΔCt method (Livak and Schmittgen, 2001) and then performed statistical analyses with SPSS 17.0 software. Data were tested for homogeneity of variances using the Levene's test. One-way analysis of variance (ANOVA) and Student's t-test were used to determine the statistical significance, which was indicated with a “*” (P < 0.05).
3. Results 3.1. Insulin stimulates Sp-vtg expression in vitro The hepatopancreas is the major site of Sp-vtg synthesis in S. paramamosain (Fig. 1A). The ovary, serving as a minor site, produces Sp-vtg less than 1% of that in hepatopancreas. Given this, the hepatopancreas was further used in in vitro culture system for the following studies. As shown in Fig. 1B, the levels of Sp-vtg expression were increased with higher dosages of insulin at 200, 400 and 800 ng/ml. Low concentrations of insulin at 0, 50 and 100 ng/ml had no effect on Sp-vtg expression.
3.2. Characterization of cDNAs encoding key factors in ILP signaling Partial cDNAs of Sp-PI3K, Sp-Akt, Sp-Rheb and Sp-TOR, corresponding lengths of 1874, 1037, 970 and 920 bp, respectively, were cloned from the brain of a female S. paramamosain at early vitellogenic stage. The putative 799 aa Sp-PI3K has in order the p85-binding domain 8
(PI3K_p85B), Ras-binding domain PI3K_rbd, C2 domain (PI3K_C2) and accessory domain (PI3Ka). The putative 410 aa Sp-Akt consists of the Serine/Threonine protein kinases catalytic domain (S_TKc) and Ser/Thr-type protein kinases domain (S_TK_X), respectively. The putative 182 aa Sp-Rheb includes a RAS small GTPases domain (RAS), and the putative 920 aa SpTOR has a Pfam domain (FAT) (Fig. 2A). Transcripts of Sp-PI3K, Sp-Akt, Sp-Rheb and Sp-TOR were observed in all examined tissues. The highest levels of Sp-Akt, Sp-Rheb and Sp-TOR were found in ovary and hepatopancreas. For Sp-PI3K, the hemocytes and hepatopancreas contained the highest levels (Fig. 2B).
3.3. Knockdown of Sp-Akt blocks the stimulation of Sp-vtg expression by insulin The levels of Sp-Akt expression in hepatopancreatic explants were effectively reduced to 55 % and 45 % respectively by preincubation with Sp-Akt-dsRNA for 30 and 60 min (Fig. 3A). The levels of Sp-Akt showed no difference in control group and GFP-dsRNA group. Further, addition of Sp-Akt-dsRNA significantly blocked the insulin-induced Sp-vtg expression in hepatopancreatic explants (Fig. 3B). Interestingly, the level of Sp-vtg showed a slight decrease in GFP-dsRNA group when compared with the insulin group. On the other hand, the levels of Sp-Rheb expression showed no difference in all treatment groups.
3.4. Inhibitors of PI3K and TOR block the stimulation of Sp-vtg expression by insulin The effects of the PI3K-inhibitor LY294002 and TOR-inhibitor rapamycin on insulin-induced Sp-vtg expression were determined by preincubation with the inhibitors before insulin incubation. Both LY294002 and rapamycin treatments significantly reduced the Sp-vtg expression which was stimulated by insulin (Fig. 4).
4. Discussion 9
As one of the most expansively studied peptides, ILP distributes widely across the animal kingdom and plays critical roles in the regulation of growth, metabolism, reproduction, and other behavioral and physiological processes (Nagasawa et al., 1986; Krieger et al., 2004; Ventura et al., 2009; Rosen et al., 2010; Marquez et al., 2011; Chung, 2014; Huang et al., 2014). In decapod crustaceans, studies of ILP are mainly focused on the insulin-like androgenic gland factor (IAG) that is specific to males, since IAG is the only ILP identified in decapod species and it’s responsible for sexual differentiation and maintenance of male secondary sex characteristics (Ventura et al., 2009; Rosen et al., 2010; Katayama et al., 2014). In recent years, with the application of transcriptomic analysis, multiple ILPs have been reported in both sexes of a single species (Chandler et al., 2015; Veenstra, 2015; Veenstra, 2016), such as the two ILPs identified from the red swamp crayfish, Procambarus clarkii (Veenstra, 2015). More recently, an ILP gene that differs from IAG has been identified based on our recent transcriptome data from the nervous tissues of S. paramamosain (data not published). These findings challenge us to explore the additional functions of crustacean ILPs. Specifically, the IAG found in S. paramamosain does show a significant up-regulation in female ovary at mature stage (Huang et al., 2014). The present study examines the effect of bovine insulin addition on Sp-vtg synthesis in S. paramamosain. The results here suggest that the endogenous ILP and its corresponding signaling may be involved in the regulation of Sp-vtg synthesis in S. paramamosain. There is growing evidence that vtg synthesis takes place mainly in the hepatopancreas of brachyuran crabs, lobsters, and probably other representative species under the suborder Pleocyamata (Zmora et al., 2007; Subramoniam, 2011; Girish et al., 2014). Consistent with this, the Sp-vtg expression analysis clearly indicates that the hepatopancreas, the main site of vtg synthesis, produces over ~1000 times of Sp-vtg than the ovary in S. paramamosain. Similarly, in the blue crab, Callinectes sapidus, the levels of vtg expression are generally ~3000 times higher in the hepatopancreas than in the ovary (Zmora et al., 2007). In vitro addition of insulin stimulates the Sp-vtg expression in hepatopancreatic explants, 10
thereby implicating the endogenous ILP in the regulation of Sp-vtg expression. Our result corresponds with the findings in the red flour beetle, Tribolium castaneum, where the injection of bovine insulin into the previtellogenic female adults increased vtg mRNA and protein levels (Sheng et al., 2011). Further, the ILP signaling pathway-mediated vtg expression is suggested to be the downstream effect of juvenile hormone signal (Sheng et al., 2011). In the yellow fever mosquito, Aedes aegypti, the stimulation of vtg expression by insulin occurs only when the 20hydroxyecdysone (20E) exists by in vitro fat body culture (Roy et al., 2007). Overall, the endocrine regulation of vtg synthesis by insulin is complex. It will be interesting to see if the ecdysone signaling affects insulin-stimulated vtg expression in crustaceans. It should be noted that, for S. paramamosain, the bovine insulin is an exogenous ILP that comes from a mammal. The requirement for such high concentrations of insulin (200-800 ng/ml) to generate a response of Sp-vtg expression suggests that the mammalian insulin and the endogenous crab ILP are poorly homologous. The ILP signaling pathway is evolutionarily conserved among eukaryotic organisms. PI3K, Akt, Rheb, and TOR are four of key proteins involved in this pathway (Garofalo, 2002; Wu and Brown, 2006). Here, partial cDNA sequences of Sp-PI3K, Sp-Akt, Sp-Rheb and Sp-TOR have been isolated from the brain of S. paramamosain. The broad tissue distribution confirms that ILP signaling is quite conserved. RNAi-mediated knockdown of Sp-Akt significantly blocks the stimulation of Sp-vtg expression by insulin, suggesting that Sp-Akt is a middle link between insulin signal and Sp-vtg synthesis. Moreover, both the PI3K-inhibitor LY294002 and TORinhibitor rapamycin can inhibit the stimulation of Sp-vtg synthesis by insulin. These clues together indicate that the conserved PI3K/Akt/TOR pathway is involved in the regulation of insulin-stimulated Sp-vtg synthesis. The addition of GFP-dsRNA seems to also have an inhibitory effect on insulin-stimulated Sp-vtg expression, most probably because of somehow off-target effect (Lew-Tabor et al., 2011). On the other hand, the suppression of Sp-vtg expression by GFP-dsRNA strongly suggests that 11
factors, other than insulin, may be involved in the control of hepatopancreatic vtg synthesis. What’s more, Sp-Akt-dsRNA addition lowers the Sp-vtg expression to the levels below that in the control group. Active ILP may exist in the hepatopancreas, and in this case, the addition of Sp-Akt-dsRNA could diminish the stimulations of Sp-vtg expression by both the insulin and endogenous ILP. Interestingly, the levels of Sp-Rheb expression keep stable after insulin stimulation with or without the Sp-Akt-dsRNA preincubation. The response of gene expression usually varies by different time points post stimulations including hormone administration and bacteria challenge (Li et al., 2012; Gong et al., 2015). If the assumed role of Sp-Rheb exists, an increase of Sp-Rheb expression is supposed to be seen earlier than 6 h after incubation. However, this needs to be validated by further studies. As alluded to in insects, TOR signaling has been reported as a crucial pathway in regulating vtg gene expression in the fat body, which functions via activation of the ribosomal protein S6 kinase (Umemiya-Shirafuji et al., 2012). It needs to be further illustrated about the Sp-TOR downstream effector that controls Sp-vtg synthesis. In conclusion, the present study reveals a stimulating effect of insulin on Sp-vtg synthesis mediated through PI3K/Akt/TOR pathway. The combined results implicate the endogenous ILP and its corresponding signaling in the regulation of Sp-vtg synthesis in S. paramamosain.
Acknowledgments This work was supported by the National Natural Science Foundation of China (No. 31472261, 41476119), the Spark Plan Project in Fujian Province (No. 2016S0055) and the Xiamen Southern Oceanographic Center (No. 14GZY56HJ26).
Author Contributions 12
X.H., H.Y. and H.H. conceived and designed the experiments; X.H. performed the experiments; H.Y. helped in analyzing the data; X.H. and B.F. contributed materials; X.H. wrote the original draft while edited by H.Y. and H.H..
References Aspuria, P.J., Tamanoi, F., 2004. The Rheb family of GTP-binding proteins. Cell Signal. 16, 1105–1112. Byrne, B.M., Gruber, M., Ab, G., 1989. The evolution of egg yolk proteins. Prog. Biophys. Mol. Biol. 53, 33. Chandler, J.C., Aizen, J., Elizur, A., Hollander-Cohen, L., Battaglene, S.C., Ventura, T., 2015. Discovery of a novel insulin-like peptide and insulin binding proteins in the Eastern rock lobster Sagmariasus verreauxi. Gen. Comp. Endocrinol. 215, 76–87. Chung, J.S., 2014. An insulin-like growth factor found in hepatopancreas implicates carbohydrate metabolism of the blue crab Callinectes sapidus. Gen. Comp. Endocrinol. 199, 56–64. Garofalo, R.S., 2002. Genetic analysis of insulin signaling in Drosophila. Trends Endocrinol. Metab. 13, 156–162. Girish, B.P., Swetha, C.H., Reddy, P.S., 2014. Hepatopancreas but not ovary is the site of vitellogenin synthesis in female fresh water crab, Oziothelphusa senex senex. Biochem. Biophys. Res. Commun. 447, 323–327. Gong, J., Ye, H., Xie, Y., Yang, Y., Huang, H., Li, S., Zeng, C., 2015. Ecdysone receptor in Scylla paramamosain: a possible role in promoting ovarian development. J. Endocrinol. 224, 273– 287. Huang, X., Ye, H., Feng, B., Huang, H., 2015. Insights into insulin-like peptide system in invertebrates from studies on IGF binding domain-containing proteins in the female mud crab, Scylla paramamosain. Mol. Cell. Endocrinol. 416, 36–45. 13
Huang, X., Ye, H., Huang, H., Yang, Y., Gong, J., 2014. An insulin-like androgenic gland hormone gene in the mud crab, Scylla paramamosain, extensively expressed and involved in the processes of growth and female reproduction. Gen. Comp. Endocrinol. 204, 229–238. Jia, X., Chen, Y., Zou, Z., Lin, P., Wang, Y., Zhang, Z., 2013. Characterization and expression profile of vitellogenin gene from Scylla paramamosain. Gene 520, 119–130. Katayama, H., Kubota, N., Hojo, H., Okada, A., Kotaka, S., Tsutsui, N., Ohira, T., 2014. Direct evidence for the function of crustacean insulin-like androgenic gland factor (IAG): total chemical synthesis of IAG. Bioorg. Med. Chem. 22, 5783–5789. Krieger, M.J.B., Jahan, N., Riehle, M.A., Cao, C., Brown, M.R., 2004. Molecular characterization of insulin-like peptide genes and their expression in the African malaria mosquito, Anopheles gambiae. Insect Mol. Biol. 13, 305–315. Lew-Tabor, A.E., Kurscheid, S., Barrero, R., Gondro, C., Moolhuijzen, P.M., Rodriguez Valle, M., Morgan, J.A.T., Covacin, C., Bellgard, M.I., 2011. Gene expression evidence for off-target effects caused by RNA interference-mediated gene silencing of Ubiquitin-63E in the cattle tick Rhipicephalus microplus. Int. J. Parasitol. 41, 1001–1014. Li, N., Zhang, Z., Zhang, L., Wang, S., Zou, Z., Wang, G., Wang, Y., 2012. Insulin-like growth factor binding protein 7, a member of insulin-like growth factor signal pathway, involved in immune response of small abalone Haliotis diversicolor. Fish Shellfish Immunol. 33, 229– 242. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real time quantitative PCR and the 2-ΔΔCt method. Methods 25, 402–408. MacMorris, M., Broverman, S., Greenspoon, S., Lea, K., Madej, C., Blumenthal, T., Spieth, J., 1992. Regulation of vitellogenin gene expression in transgenic Caenorhabditis elegans: short sequences required for activation of the vit-2 promoter. Mol. Cell. Biol. 12, 1652–1662. Marquez, A.G., Pietri, J.E., Smithers, H.M., Nuss, A., Antonova, Y., Drexler, A.L., Riehle, M.A., Brown, M.R., Luckhart, S., 2011. Insulin-like peptides in the mosquito Anopheles stephensi: 14
identification and expression in response to diet and infection with Plasmodium falciparum. Gen. Comp. Endocrinol. 173, 303–312. Nagaraju, G.P.C., 2011. Reproductive regulators in decapod crustaceans: an overview. J. Exp. Biol. 214, 3–16. Nagasawa, H., Kataoka, H., Isogai, A., Tamura, S., Suzuki, A., Mizoguchi, A., Fujiwara, Y., Suzuki, A., Takahashi, S.Y., Ishizaki, H., 1986. Amino acid sequence of a prothoracicotropic hormone of the silkworm Bombyx mori. Proc. Natl. Acad. Sci. USA 83, 5840–5843. Nakamura, A., Yasuda, K., Adachi, H., Sakurai, Y., Ishii, N., Goto, S., 1999. Vitellogenin-6 is a major carbonylated protein in aged nematode, Caenorhabditis elegans. Biochem. Biophys. Res. Commun. 264, 580–583. Rosen, O., Manor, R., Weil, S., Gafni, O., Linial, A., Aflalo, E.D., Ventura, T., Sagi, A., 2010. A sexual shift induced by silencing of a single insulin-like gene in crayfish: ovarian upregulation and testicular degeneration. PLoS ONE 5, e15281. Roy, S.G., Hansen, I.A., Raikhel, A.S., 2007. Effect of insulin and 20-hydroxyecdysone in the fat body of the yellow fever mosquito, Aedes aegypti. Insect Biochem. Mol. Biol. 37, 1317– 1326. Sappington, T.W., Raikhel, A.S., 1998. Molecular characteristics of insect vitellogenins and vitellogenin receptors. Insect Biochem. Mol. Biol. 28, 277–300. Sheng, Z., Xu, J., Bai, H., Zhu, F., Palli, S.R., 2011. Juvenile hormone regulates vitellogenin gene expression through insulin-like peptide signaling pathway in the red flour beetle, Tribolium castaneum. J. Biol. Chem. 286, 41924–41936. Subramoniam, T., 2011. Mechanisms and control of vitellogenesis in crustaceans. Fish. Sci. 77, 1–21. Thongda, W., Chung, J.S., Tsutsui, N., Zmora, N., Katenta, A., 2015. Seasonal variations in reproductive activity of the blue crab, Callinectes sapidus: vitellogenin expression and levels of vitellogenin in the hemolymph during ovarian development. Comp. Biochem. Physiol. A 15
179, 35–43. Umemiya-Shirafuji, R., Boldbaatar, D., Liao, M., Battur, B., Rahman, M.M., Kuboki, T., Galay, R.L., Tannka, T., Fujisaki, K., 2012. Target of rapamycin (TOR) controls vitellogenesis via activation of the S6 kinase in the fat body of the tick, Haemaphysalis longicornis. Int. J. Parasitol. 42, 991–998. Veenstra, J.A., 2015. The power of next-generation sequencing as illustrated by the neuropeptidome of the crayfish Procambarus clarkii. Gen. Comp. Endocrinol. 224, 84–95. Veenstra, J.A., 2016. Similarities between decapod and insect neuropeptidomes. PeerJ 4, e2043. Ventura, T., Manor, R., Aflalo, E.D., Weil, S., Raviv, S., Glazer, L., Sagi, A., 2009. Temporal silencing of an androgenic gland-specific insulin-like gene affecting phenotypical gender differences and spermatogenesis. Endocrinology 150, 1278–1286. Ventura, T., Rosen, O., Sagi, A., 2011. From the discovery of the crustacean androgenic gland to the insulin-like hormone in six decades. Gen. Comp. Endocrinol. 173, 381–388. Wahli, W., Dawid, I.B., Ryffel, G.U., Weber, R., 1981. Vitellogenesis and the vitellogenin gene family. Science 212, 298–304. Wiegand, M.D., 1996. Composition, accumulation and utilization of yolk lipids in teleost fish. Rev. Fish Biol. Fish. 6, 259–286. Wu, Q., Brown, M.R., 2006. Signaling and function of insulin-like peptides in insects. Annu. Rev. Entomol. 51, 1–24. Zmora, N., Trant, J., Chan, S.M., Chung, J.S., 2007. Vitellogenin and its messenger RNA during ovarian development in the female blue crab, Callinectes sapidus: gene expression, synthesis, transport, and cleavage. Biol. Reprod. 77, 138–146.
16
Tables Table 1. List of primers used in this study. Name
Sequence (5'- 3')
Sp-PI3KF
CTGTTTGGTATGCTGCACGAC
Sp-PI3KR
AACCGAATGGACACTGAAGGTA
Sp-AktF
TTGAGATCCAGGAGTTCAGTAGAGT
Sp-AktR
TTCCACATGGTCAGGTGGTGT
Sp-AktQF
CCAAACCAATGATCGCCTCT
Sp-AktQR
TGCCCATCAGCATCCAGTAA
Sp-AktdsF
ACAGGGAGTCATGGATGGAAG
Sp-AktdsR
TGATGGCATAGAAATGGTTGC
GFPdsF
TGGGCGTGGATAGCGGTTTG
GFPdsR
GGTCGGGGTAGCGGCTGAAG
Sp-RhebF
CGTATGGACCACTGACCACG
Sp-RhebR
AATTCCTCAAAGCCAGACCC
Sp-RhebQF
CATGAACATCCACGGCTACG
Sp-RhebQR
GTTTCCCACCAACACCACAG
Sp-TORF
TCATGGAGCACTGTGATAAGGG
Sp-TORR
CTTGTGGGACAGGGCAAGG
Sp-vtgQF
CGCAACCGCCACTGAAGAT
Sp-vtgQR
CCACCATGCTGCTCACGACT
β-actinF
CCACACCAGGAAGGTCTTGT
β-actinR
TGCGTTGGATGCGAAGTGACAAAG
17
Figure legends Figure 1. (A) The levels of Sp-vtg expression in the ovary and hepatopancreas of S. paramamosain females at early vitellogenic stage. (B) Effects of insulin administration on Sp-vtg expression in the hepatopancreatic explants from S. paramamosain females at early vitellogenic stage. Data are presented as mean ± SE (n=3). “*” indicates the statistical significance at P < 0.05.
Figure 2. (A) Schematic diagram of putative domain structures of amino acid sequences of SpPI3K, Sp-Akt, Sp-Rheb and Sp-TOR predicted using SMART. Numbers of amino acids are shown at the top. (B) Spatial distribution of Sp-PI3K, Sp-Akt, Sp-Rheb and Sp-TOR in different tissues from S. paramamosain females at early vitellogenic stage. Tissues include 1: brain; 2: ovary; 3: hepatopancreas; 4: hemocytes and 5: muscle. Lane 6: negative control is a PCR reaction performed without adding template. Amplification of the β-actin is carried out as the internal control.
Figure 3. (A) Effects of Sp-Akt-dsRNA addition on the levels of Sp-Akt expression in the hepatopancreatic explants of S. paramamosain at early vitellogenic stage. (B) Effects of Sp-AktdsRNA on Sp-Rheb and insulin-induced Sp-vtg expression in the hepatopancreatic explants of S. paramamosain at early vitellogenic stage. The samples were collected after the 30 min preincubation and 6 h incubation. Data are presented as mean ± SE (n=3). “*” indicates the statistical significance at P < 0.05.
Figure 4. Effects of PI3K-inhibitor LY294002 and TOR-inhibitor rapamycin on insulin-induced Sp-vtg expression in the hepatopancreatic explants of S. paramamosain at early vitellogenic stage. The samples were collected after the 30 min preincubation and 6 h incubation. Data are presented as mean ± SE (n=3). “*” indicates the statistical significance at P < 0.05. 18
1) The hepatopancreas is the major site of Sp-vtg synthesis in S. paramamosain. 2) Key factors in ILP signaling are conserved in S. paramamosain. 3) Knockdown of Sp-Akt blocks the stimulation of Sp-vtg expression by insulin. 4) Inhibitors of PI3K and TOR block the stimulation of Sp-vtg expression by insulin.
19
S0016-6480(17)30214-9 http://dx.doi.org/10.1016/j.ygcen.2017.06.013 YGCEN 12667
To appear in:
General and Comparative Endocrinology
Received Date: Revised Date: Accepted Date:
22 March 2017 14 June 2017 20 June 2017
Please cite this article as: Huang, X., Feng, B., Huang, H., Ye, H., In vitro stimulation of vitellogenin expression by insulin in the mud crab, Scylla paramamosain, mediated through PI3K/Akt/TOR pathway, General and Comparative Endocrinology (2017), doi: http://dx.doi.org/10.1016/j.ygcen.2017.06.013
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
In vitro stimulation of vitellogenin expression by insulin in the mud crab, Scylla paramamosain, mediated through PI3K/Akt/TOR pathway
Xiaoshuai Huang 1, Biyun Feng 1, Huiyang Huang 1, Haihui Ye 1,2,*
1
College of Ocean and Earth Sciences, Xiamen University, Xiamen 361102, China
2
Collaborative Innovation Center for Development and Utilization of Marine Biological
Resources, Xiamen 361102, China
*
Corresponding authors: [email protected] (H. Ye)
Keywords: insulin-like peptide; vitellogenin; in vitro experiments; RNAi; Scylla paramamosain
1
Abstract: Vitellogenin (vtg) synthesis, known as vitellogenesis, is one of most important processes in the ovarian development of oviparous animals. Recently, multiple insulin-like peptides (ILPs) have been reported in crustacean species due to the application of transcriptome sequencing. In this context, the present study reports that the addition of an exogenous ILP, bovine insulin, stimulates vtg (termed Sp-vtg) expression in hepatopancreatic explants from the mud crab, Scylla paramamosain, by in vitro experiments. Homologous genes of key factors in ILP signaling, Sp-PI3K, Sp-Akt, Sp-Rheb and Sp-TOR, have been isolated in S. paramamosain based on a transcriptome database. Further experiments reveal that the RNAimediated Sp-Akt gene knockdown and the inhibitors of Sp-PI3K and Sp-TOR block the stimulation of Sp-vtg expression by insulin. The combined results implicate the endogenous ILP and its corresponding signaling in the regulation of Sp-vtg synthesis in S. paramamosain.
2
1. Introduction Vitellogenesis is a hormone-regulated reproductive process in the ovarian development of oviparous animals, known as the process of yolk proteins production and their accumulation in ovary (Wiegand, 1996). The vitellogenin (vtg), precursor of the major yolk protein vitellin (vn), is synthesized primarily under hormonal control during maturation of oocytes (Wahli et al., 1981; Subramoniam, 2011). In addition, vtg genes are subject to specific regulation by sex, tissue, developmental stage and seasonal variation (MacMorris et al, 1992; Thongda et al., 2015). Vtg synthesis takes place in the liver of vertebrates (Byrne et al., 1989), the fat body of insects (Sappington and Raikhel, 1998) and the intestine of nematodes (Nakamura et al., 1999). Decapod crustaceans utilize two different tissues for vtg synthesis: the hepatopancreas and ovary (Subramoniam, 2011). Nevertheless, it is suggested that the hepatopancreas is the main site for vtg synthesis in Pleocyamata species including brachyurans (Zmora et al., 2007; Subramoniam, 2011; Girish et al., 2014). However, the percentage of each tissue that contributes to vitellogenesis has not been fully studied. Regulation of vtg synthesis is highly diverse in decapod crustaceans. It’s widely recognized that the members of crustacean hyperglycemic hormone (CHH) family, various neuromodulators, the ecdysone and the methyl farnesoate (MF) play important roles in this process (Nagaraju, 2011). The insulin-like peptide (ILP) superfamily is a group of peptides structurally homologous to insulin. Various ILPs have been widely identified in invertebrates and they are associated with a set of functions in regulating growth, metabolism and reproduction (Nagasawa et al., 1986; Krieger et al., 2004; Ventura et al., 2009; Rosen et al., 2010; Marquez et al., 2011; Chung, 2014; Huang et al., 2014). However, in crustaceans, there is only one ILP, the insulin-like androgenic gland factor (IAG), that has been identified, which is a male-specific ILP that controls the sexual differentiation and maintains male secondary sex characteristics (Ventura et al., 2009; Rosen et al., 2010; Ventura et al., 2011). More recently, multiple ILPs have been reported in both sexes of crustacean species due to the application of transcriptome sequencing (Chandler et al., 2015; 3
Veenstra, 2015; Veenstra, 2016). In this context, it is necessary and significant to explore the function of ILPs in female reproduction of crustaceans including vitellogenesis. The ILP signaling pathway is generally conserved in eukaryotic organisms (Garofalo, 2002; Wu and Brown, 2006). In mammals and insects, ILP signals regulate protein synthesis through stimulation of target of rapamycin (TOR), which requires primarily the activation of phosphatidylinositol-3-kinase/protein kinase B (PI3K/Akt) pathway. The Ras homolog enriched in brain (Rheb) acts as a key activator of TOR by binding to GTP, while this process is inhibited by Rheb-GTPase-activating protein (GAP) (Aspuria and Tamanoi, 2004). Akt inactivates RhebGAP, thus maintaining TOR in the active state. In crustaceans, by contrast, very little information is available regarding the response mechanism of ILPs. In this paper, we report that exogenous insulin stimulates vtg (termed Sp-vtg) expression in hepatopancreatic explants from the mud crab, Scylla paramamosain, by in vitro experiments. Several homologous genes of key factors in ILP signaling, PI3K, Akt, Rheb and TOR (termed Sp-PI3K, Sp-Akt, Sp-Rheb and Sp-TOR, respectively), are isolated in S. paramamosain based on a transcriptome database. Further experiments reveal that the RNAi-mediated Sp-Akt gene knockdown and the inhibitors of PI3K and TOR can block the stimulation of Sp-vtg expression by insulin.
2. Materials and methods 2.1. Animals, tissue sampling and the in vitro explant culture system Animal experiments in this study were conducted in accordance with the international, national and institutional rules. All experimental protocols were approved by the Review Committee for the Use of Human or Animal Subjects of Xiamen University. Adult S. paramamosain females at intermolt stage with the carapace width ranging from 85.0-125.0 mm were purchased from a local fish market in Xiamen, Fujian Province, China. The animals were reared separately in rectangular tanks with seawater at a temperature of 27 ± 1 °C 4
and a salinity of 26 ppt for three days. Ovarian stages were determined using the criteria as described in Huang et al. (2014). Females at early vitellogenic stage were placed on ice for anesthetization and then dissected for the following tissues: the brain, ovary, hepatopancreas, hemocytes and muscle. The in vitro explant culture system that has been established previously (Gong et al., 2015; Huang et al., 2015) was used in this study. Briefly, the hepatopancreas sample is dissected from the anesthetized female crab at early vitellogenic stage, rinsed nine times with a crab saline solution containing penicillin G at 300 IU/ml and streptomycin at 300 μg/ml (Sigma-Aldrich Co.), and then divided into small pieces (~ 20 mg). Each piece is placed in a well of the 24-well plate containing 0.2 ml of 2 x L15 medium (Gibco) for preincubation at 25 °C.
2.2. Total RNA extraction and cDNA synthesis Total RNA was extracted from each tissue using TRIzol® Reagent (Invitrogen) and quantified with an ND-2000 NanoDrop UV spectrophotometer (NanoDrop Technologies). Genomic DNA contamination was eliminated using RNase-free DNase I (Fermentas). One μg resultant total RNA of each tissue was used for cDNA synthesis using the RevertAid First Strand cDNA Synthesis Kit (Fermentas) following the manufacturer's protocol.
2.3. Levels of Sp-vtg expression in the ovary and hepatopancreas of S. paramamosain at early vitellogenic stage The cDNA samples derived from the ovary and hepatopancreas of three females at early vitellogenic stage were examined for Sp-vtg expression using a quantitative real-time PCR (qPCR) with primers Sp-vtgQF and Sp-vtgQR (Jia et al., 2013) listed in Table 1. The qPCR conditions kept the same as described (Huang et al., 2015). Amplification of the β-actin with primers β-actinF and β-actinR (Table 1) was concurrently carried out as the internal control. The hepatopancreas was determined as the major site of Sp-vtg synthesis and used for the 5
following in vitro culture experiments.
2.4. In vitro effects of insulin on Sp-vtg expression After the preincubation for 1 hour, the culture medium was substituted with 0.5 ml 2 x L15 medium that contains bovine insulin (Sigma) at different concentrations. The hepatopancreatic explants were treated with six concentrations 0, 50,100, 200, 400 and 800 ng/ml in triplicate and incubated at 25 °C for 6 h. The explants were subsequently collected for total RNA extraction and cDNA synthesis before the qPCR analysis of vtg expression as mentioned above. The dosage of insulin at 200 ng/ml was adopted for the following in vitro experiments.
2.5. Molecular cloning of the key factors in ILP signaling Partial cDNA sequences of Sp-PI3K (GenBank accession no. KY681017), Sp-Akt (GenBank accession no. KY681018), Sp-Rheb (GenBank accession no. KY681019) and SpTOR (GenBank accession no. KY681020) were obtained from a transcriptome database of the brain in S. paramamosain (data not shown). Primer pairs: Sp-PI3KF and R, Sp-AktF and R, SpRhebF and R, and Sp-TORF and R (Table 1), were designed to cloning the corresponding genes using a template of the brain tissue. The putative functional domains were predicted by SMART program (http://smart.embl-heidelberg.de). Tissue distribution analyses were carried out with cDNA samples derived from various tissues using a reverse transcription PCR (RT-PCR) at the following PCR conditions: 94 °C for 3 min followed by 32 cycles of 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 2 min and the final extension at 72 °C for 10 min. As a reference gene, the amplification of β-actin with primers: βactinF and β-actinR (Table 1), was carried out using the same tissue cDNA samples. The PCR products were separated on 1.5% agarose gels and visualized using ethidium bromide.
2.6. In vitro RNAi knockdown experiments 6
The Sp-Akt-dsRNA was synthesized in vitro by the T7 and SP6 polymerase (Fermentas) as described previously (Gong et al., 2015) using the Sp-Akt DNA template amplified with primers Sp-AktdsF and Sp-AktdsR (Table 1). As a control, the green fluorescent protein (GFP)-dsRNA was synthesized in the same way using the GFP DNA template amplified with primers GFPdsF and GFPdsR (Table 1) from the pSicoR-EGFP vector (Gong et al., 2015). In order to examine the effects of Sp-Akt-dsRNA on Sp-Akt expression, three groups of preincubation with different culture media were used in in vitro culture of hepatopancreatic explants: 1) Control group: 2 x L15 medium; 2) GFP-dsRNA group: 2 x L15 medium containing 1 μg/ml GFP-dsRNA; 3) Sp-Akt-dsRNA group: 2 x L15 medium containing 1 μg/ml Sp-Akt-dsRNA. The hepatopancreatic explants were subsequently collected at 30 min and 60 min, respectively. Each treatment was carried out in triplicate. The samples were used for total RNA extraction and cDNA synthesis before the qPCR analysis of Sp-Akt expression with primers Sp-AktQF and Sp-AktQR (Table 1). To examine the effect of Sp-Akt silencing on Sp-Rheb and Sp-vtg expression, four treatments were designed in the following experiments: 1) Control group: 30 min preincubation with 2 x L15 medium and then 6 h incubation with 2 x L15 medium; 2) Insulin group: 30 min preincubation with 2 x L15 medium and then 6 h incubation with 2 x L15 medium containing 200 ng/ml insulin; 3) GFP-dsRNA + insulin group: 30 min preincubation with 2 x L15 medium containing 1 μg/ml GFP-dsRNA and then 6 h incubation with 2 x L15 medium containing 200 ng/ml insulin; 4) Sp-Akt-dsRNA + insulin group: 30 min preincubation with 2 x L15 medium containing 1 μg/ml Sp-Akt-dsRNA and then 6 h incubation with 2 x L15 medium containing 200 ng/ml insulin. The hepatopancreatic explants were sampled for total RNA extraction and cDNA synthesis before the qPCR analysis of Sp-Rheb expression with primers Sp-RhebQF and QR (Table 1), and Sp-vtg expression with primers Sp-vtgQF and QR (Table 1).
2.7. In vitro inhibitor studies 7
For inhibitor studies, the hepatopancreatic explants were cultured with 2 x L15 medium containing either 20 μM LY294002 (PI3K-inhibitor, Abcam) or 150 nM rapamycin (TOR-inhibitor, Abcam) for 30 min preincubation. After that, the culture medium was substituted with 2 x L15 medium that contains 200 ng/ml insulin for 6 h incubation. The hepatopancreatic explants were sampled for total RNA extraction, cDNA synthesis and qPCR analysis of Sp-vtg expression as mentioned above.
2.8. Statistical analyses The qPCR data were calculated using 2-ΔΔCt method (Livak and Schmittgen, 2001) and then performed statistical analyses with SPSS 17.0 software. Data were tested for homogeneity of variances using the Levene's test. One-way analysis of variance (ANOVA) and Student's t-test were used to determine the statistical significance, which was indicated with a “*” (P < 0.05).
3. Results 3.1. Insulin stimulates Sp-vtg expression in vitro The hepatopancreas is the major site of Sp-vtg synthesis in S. paramamosain (Fig. 1A). The ovary, serving as a minor site, produces Sp-vtg less than 1% of that in hepatopancreas. Given this, the hepatopancreas was further used in in vitro culture system for the following studies. As shown in Fig. 1B, the levels of Sp-vtg expression were increased with higher dosages of insulin at 200, 400 and 800 ng/ml. Low concentrations of insulin at 0, 50 and 100 ng/ml had no effect on Sp-vtg expression.
3.2. Characterization of cDNAs encoding key factors in ILP signaling Partial cDNAs of Sp-PI3K, Sp-Akt, Sp-Rheb and Sp-TOR, corresponding lengths of 1874, 1037, 970 and 920 bp, respectively, were cloned from the brain of a female S. paramamosain at early vitellogenic stage. The putative 799 aa Sp-PI3K has in order the p85-binding domain 8
(PI3K_p85B), Ras-binding domain PI3K_rbd, C2 domain (PI3K_C2) and accessory domain (PI3Ka). The putative 410 aa Sp-Akt consists of the Serine/Threonine protein kinases catalytic domain (S_TKc) and Ser/Thr-type protein kinases domain (S_TK_X), respectively. The putative 182 aa Sp-Rheb includes a RAS small GTPases domain (RAS), and the putative 920 aa SpTOR has a Pfam domain (FAT) (Fig. 2A). Transcripts of Sp-PI3K, Sp-Akt, Sp-Rheb and Sp-TOR were observed in all examined tissues. The highest levels of Sp-Akt, Sp-Rheb and Sp-TOR were found in ovary and hepatopancreas. For Sp-PI3K, the hemocytes and hepatopancreas contained the highest levels (Fig. 2B).
3.3. Knockdown of Sp-Akt blocks the stimulation of Sp-vtg expression by insulin The levels of Sp-Akt expression in hepatopancreatic explants were effectively reduced to 55 % and 45 % respectively by preincubation with Sp-Akt-dsRNA for 30 and 60 min (Fig. 3A). The levels of Sp-Akt showed no difference in control group and GFP-dsRNA group. Further, addition of Sp-Akt-dsRNA significantly blocked the insulin-induced Sp-vtg expression in hepatopancreatic explants (Fig. 3B). Interestingly, the level of Sp-vtg showed a slight decrease in GFP-dsRNA group when compared with the insulin group. On the other hand, the levels of Sp-Rheb expression showed no difference in all treatment groups.
3.4. Inhibitors of PI3K and TOR block the stimulation of Sp-vtg expression by insulin The effects of the PI3K-inhibitor LY294002 and TOR-inhibitor rapamycin on insulin-induced Sp-vtg expression were determined by preincubation with the inhibitors before insulin incubation. Both LY294002 and rapamycin treatments significantly reduced the Sp-vtg expression which was stimulated by insulin (Fig. 4).
4. Discussion 9
As one of the most expansively studied peptides, ILP distributes widely across the animal kingdom and plays critical roles in the regulation of growth, metabolism, reproduction, and other behavioral and physiological processes (Nagasawa et al., 1986; Krieger et al., 2004; Ventura et al., 2009; Rosen et al., 2010; Marquez et al., 2011; Chung, 2014; Huang et al., 2014). In decapod crustaceans, studies of ILP are mainly focused on the insulin-like androgenic gland factor (IAG) that is specific to males, since IAG is the only ILP identified in decapod species and it’s responsible for sexual differentiation and maintenance of male secondary sex characteristics (Ventura et al., 2009; Rosen et al., 2010; Katayama et al., 2014). In recent years, with the application of transcriptomic analysis, multiple ILPs have been reported in both sexes of a single species (Chandler et al., 2015; Veenstra, 2015; Veenstra, 2016), such as the two ILPs identified from the red swamp crayfish, Procambarus clarkii (Veenstra, 2015). More recently, an ILP gene that differs from IAG has been identified based on our recent transcriptome data from the nervous tissues of S. paramamosain (data not published). These findings challenge us to explore the additional functions of crustacean ILPs. Specifically, the IAG found in S. paramamosain does show a significant up-regulation in female ovary at mature stage (Huang et al., 2014). The present study examines the effect of bovine insulin addition on Sp-vtg synthesis in S. paramamosain. The results here suggest that the endogenous ILP and its corresponding signaling may be involved in the regulation of Sp-vtg synthesis in S. paramamosain. There is growing evidence that vtg synthesis takes place mainly in the hepatopancreas of brachyuran crabs, lobsters, and probably other representative species under the suborder Pleocyamata (Zmora et al., 2007; Subramoniam, 2011; Girish et al., 2014). Consistent with this, the Sp-vtg expression analysis clearly indicates that the hepatopancreas, the main site of vtg synthesis, produces over ~1000 times of Sp-vtg than the ovary in S. paramamosain. Similarly, in the blue crab, Callinectes sapidus, the levels of vtg expression are generally ~3000 times higher in the hepatopancreas than in the ovary (Zmora et al., 2007). In vitro addition of insulin stimulates the Sp-vtg expression in hepatopancreatic explants, 10
thereby implicating the endogenous ILP in the regulation of Sp-vtg expression. Our result corresponds with the findings in the red flour beetle, Tribolium castaneum, where the injection of bovine insulin into the previtellogenic female adults increased vtg mRNA and protein levels (Sheng et al., 2011). Further, the ILP signaling pathway-mediated vtg expression is suggested to be the downstream effect of juvenile hormone signal (Sheng et al., 2011). In the yellow fever mosquito, Aedes aegypti, the stimulation of vtg expression by insulin occurs only when the 20hydroxyecdysone (20E) exists by in vitro fat body culture (Roy et al., 2007). Overall, the endocrine regulation of vtg synthesis by insulin is complex. It will be interesting to see if the ecdysone signaling affects insulin-stimulated vtg expression in crustaceans. It should be noted that, for S. paramamosain, the bovine insulin is an exogenous ILP that comes from a mammal. The requirement for such high concentrations of insulin (200-800 ng/ml) to generate a response of Sp-vtg expression suggests that the mammalian insulin and the endogenous crab ILP are poorly homologous. The ILP signaling pathway is evolutionarily conserved among eukaryotic organisms. PI3K, Akt, Rheb, and TOR are four of key proteins involved in this pathway (Garofalo, 2002; Wu and Brown, 2006). Here, partial cDNA sequences of Sp-PI3K, Sp-Akt, Sp-Rheb and Sp-TOR have been isolated from the brain of S. paramamosain. The broad tissue distribution confirms that ILP signaling is quite conserved. RNAi-mediated knockdown of Sp-Akt significantly blocks the stimulation of Sp-vtg expression by insulin, suggesting that Sp-Akt is a middle link between insulin signal and Sp-vtg synthesis. Moreover, both the PI3K-inhibitor LY294002 and TORinhibitor rapamycin can inhibit the stimulation of Sp-vtg synthesis by insulin. These clues together indicate that the conserved PI3K/Akt/TOR pathway is involved in the regulation of insulin-stimulated Sp-vtg synthesis. The addition of GFP-dsRNA seems to also have an inhibitory effect on insulin-stimulated Sp-vtg expression, most probably because of somehow off-target effect (Lew-Tabor et al., 2011). On the other hand, the suppression of Sp-vtg expression by GFP-dsRNA strongly suggests that 11
factors, other than insulin, may be involved in the control of hepatopancreatic vtg synthesis. What’s more, Sp-Akt-dsRNA addition lowers the Sp-vtg expression to the levels below that in the control group. Active ILP may exist in the hepatopancreas, and in this case, the addition of Sp-Akt-dsRNA could diminish the stimulations of Sp-vtg expression by both the insulin and endogenous ILP. Interestingly, the levels of Sp-Rheb expression keep stable after insulin stimulation with or without the Sp-Akt-dsRNA preincubation. The response of gene expression usually varies by different time points post stimulations including hormone administration and bacteria challenge (Li et al., 2012; Gong et al., 2015). If the assumed role of Sp-Rheb exists, an increase of Sp-Rheb expression is supposed to be seen earlier than 6 h after incubation. However, this needs to be validated by further studies. As alluded to in insects, TOR signaling has been reported as a crucial pathway in regulating vtg gene expression in the fat body, which functions via activation of the ribosomal protein S6 kinase (Umemiya-Shirafuji et al., 2012). It needs to be further illustrated about the Sp-TOR downstream effector that controls Sp-vtg synthesis. In conclusion, the present study reveals a stimulating effect of insulin on Sp-vtg synthesis mediated through PI3K/Akt/TOR pathway. The combined results implicate the endogenous ILP and its corresponding signaling in the regulation of Sp-vtg synthesis in S. paramamosain.
Acknowledgments This work was supported by the National Natural Science Foundation of China (No. 31472261, 41476119), the Spark Plan Project in Fujian Province (No. 2016S0055) and the Xiamen Southern Oceanographic Center (No. 14GZY56HJ26).
Author Contributions 12
X.H., H.Y. and H.H. conceived and designed the experiments; X.H. performed the experiments; H.Y. helped in analyzing the data; X.H. and B.F. contributed materials; X.H. wrote the original draft while edited by H.Y. and H.H..
References Aspuria, P.J., Tamanoi, F., 2004. The Rheb family of GTP-binding proteins. Cell Signal. 16, 1105–1112. Byrne, B.M., Gruber, M., Ab, G., 1989. The evolution of egg yolk proteins. Prog. Biophys. Mol. Biol. 53, 33. Chandler, J.C., Aizen, J., Elizur, A., Hollander-Cohen, L., Battaglene, S.C., Ventura, T., 2015. Discovery of a novel insulin-like peptide and insulin binding proteins in the Eastern rock lobster Sagmariasus verreauxi. Gen. Comp. Endocrinol. 215, 76–87. Chung, J.S., 2014. An insulin-like growth factor found in hepatopancreas implicates carbohydrate metabolism of the blue crab Callinectes sapidus. Gen. Comp. Endocrinol. 199, 56–64. Garofalo, R.S., 2002. Genetic analysis of insulin signaling in Drosophila. Trends Endocrinol. Metab. 13, 156–162. Girish, B.P., Swetha, C.H., Reddy, P.S., 2014. Hepatopancreas but not ovary is the site of vitellogenin synthesis in female fresh water crab, Oziothelphusa senex senex. Biochem. Biophys. Res. Commun. 447, 323–327. Gong, J., Ye, H., Xie, Y., Yang, Y., Huang, H., Li, S., Zeng, C., 2015. Ecdysone receptor in Scylla paramamosain: a possible role in promoting ovarian development. J. Endocrinol. 224, 273– 287. Huang, X., Ye, H., Feng, B., Huang, H., 2015. Insights into insulin-like peptide system in invertebrates from studies on IGF binding domain-containing proteins in the female mud crab, Scylla paramamosain. Mol. Cell. Endocrinol. 416, 36–45. 13
Huang, X., Ye, H., Huang, H., Yang, Y., Gong, J., 2014. An insulin-like androgenic gland hormone gene in the mud crab, Scylla paramamosain, extensively expressed and involved in the processes of growth and female reproduction. Gen. Comp. Endocrinol. 204, 229–238. Jia, X., Chen, Y., Zou, Z., Lin, P., Wang, Y., Zhang, Z., 2013. Characterization and expression profile of vitellogenin gene from Scylla paramamosain. Gene 520, 119–130. Katayama, H., Kubota, N., Hojo, H., Okada, A., Kotaka, S., Tsutsui, N., Ohira, T., 2014. Direct evidence for the function of crustacean insulin-like androgenic gland factor (IAG): total chemical synthesis of IAG. Bioorg. Med. Chem. 22, 5783–5789. Krieger, M.J.B., Jahan, N., Riehle, M.A., Cao, C., Brown, M.R., 2004. Molecular characterization of insulin-like peptide genes and their expression in the African malaria mosquito, Anopheles gambiae. Insect Mol. Biol. 13, 305–315. Lew-Tabor, A.E., Kurscheid, S., Barrero, R., Gondro, C., Moolhuijzen, P.M., Rodriguez Valle, M., Morgan, J.A.T., Covacin, C., Bellgard, M.I., 2011. Gene expression evidence for off-target effects caused by RNA interference-mediated gene silencing of Ubiquitin-63E in the cattle tick Rhipicephalus microplus. Int. J. Parasitol. 41, 1001–1014. Li, N., Zhang, Z., Zhang, L., Wang, S., Zou, Z., Wang, G., Wang, Y., 2012. Insulin-like growth factor binding protein 7, a member of insulin-like growth factor signal pathway, involved in immune response of small abalone Haliotis diversicolor. Fish Shellfish Immunol. 33, 229– 242. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real time quantitative PCR and the 2-ΔΔCt method. Methods 25, 402–408. MacMorris, M., Broverman, S., Greenspoon, S., Lea, K., Madej, C., Blumenthal, T., Spieth, J., 1992. Regulation of vitellogenin gene expression in transgenic Caenorhabditis elegans: short sequences required for activation of the vit-2 promoter. Mol. Cell. Biol. 12, 1652–1662. Marquez, A.G., Pietri, J.E., Smithers, H.M., Nuss, A., Antonova, Y., Drexler, A.L., Riehle, M.A., Brown, M.R., Luckhart, S., 2011. Insulin-like peptides in the mosquito Anopheles stephensi: 14
identification and expression in response to diet and infection with Plasmodium falciparum. Gen. Comp. Endocrinol. 173, 303–312. Nagaraju, G.P.C., 2011. Reproductive regulators in decapod crustaceans: an overview. J. Exp. Biol. 214, 3–16. Nagasawa, H., Kataoka, H., Isogai, A., Tamura, S., Suzuki, A., Mizoguchi, A., Fujiwara, Y., Suzuki, A., Takahashi, S.Y., Ishizaki, H., 1986. Amino acid sequence of a prothoracicotropic hormone of the silkworm Bombyx mori. Proc. Natl. Acad. Sci. USA 83, 5840–5843. Nakamura, A., Yasuda, K., Adachi, H., Sakurai, Y., Ishii, N., Goto, S., 1999. Vitellogenin-6 is a major carbonylated protein in aged nematode, Caenorhabditis elegans. Biochem. Biophys. Res. Commun. 264, 580–583. Rosen, O., Manor, R., Weil, S., Gafni, O., Linial, A., Aflalo, E.D., Ventura, T., Sagi, A., 2010. A sexual shift induced by silencing of a single insulin-like gene in crayfish: ovarian upregulation and testicular degeneration. PLoS ONE 5, e15281. Roy, S.G., Hansen, I.A., Raikhel, A.S., 2007. Effect of insulin and 20-hydroxyecdysone in the fat body of the yellow fever mosquito, Aedes aegypti. Insect Biochem. Mol. Biol. 37, 1317– 1326. Sappington, T.W., Raikhel, A.S., 1998. Molecular characteristics of insect vitellogenins and vitellogenin receptors. Insect Biochem. Mol. Biol. 28, 277–300. Sheng, Z., Xu, J., Bai, H., Zhu, F., Palli, S.R., 2011. Juvenile hormone regulates vitellogenin gene expression through insulin-like peptide signaling pathway in the red flour beetle, Tribolium castaneum. J. Biol. Chem. 286, 41924–41936. Subramoniam, T., 2011. Mechanisms and control of vitellogenesis in crustaceans. Fish. Sci. 77, 1–21. Thongda, W., Chung, J.S., Tsutsui, N., Zmora, N., Katenta, A., 2015. Seasonal variations in reproductive activity of the blue crab, Callinectes sapidus: vitellogenin expression and levels of vitellogenin in the hemolymph during ovarian development. Comp. Biochem. Physiol. A 15
179, 35–43. Umemiya-Shirafuji, R., Boldbaatar, D., Liao, M., Battur, B., Rahman, M.M., Kuboki, T., Galay, R.L., Tannka, T., Fujisaki, K., 2012. Target of rapamycin (TOR) controls vitellogenesis via activation of the S6 kinase in the fat body of the tick, Haemaphysalis longicornis. Int. J. Parasitol. 42, 991–998. Veenstra, J.A., 2015. The power of next-generation sequencing as illustrated by the neuropeptidome of the crayfish Procambarus clarkii. Gen. Comp. Endocrinol. 224, 84–95. Veenstra, J.A., 2016. Similarities between decapod and insect neuropeptidomes. PeerJ 4, e2043. Ventura, T., Manor, R., Aflalo, E.D., Weil, S., Raviv, S., Glazer, L., Sagi, A., 2009. Temporal silencing of an androgenic gland-specific insulin-like gene affecting phenotypical gender differences and spermatogenesis. Endocrinology 150, 1278–1286. Ventura, T., Rosen, O., Sagi, A., 2011. From the discovery of the crustacean androgenic gland to the insulin-like hormone in six decades. Gen. Comp. Endocrinol. 173, 381–388. Wahli, W., Dawid, I.B., Ryffel, G.U., Weber, R., 1981. Vitellogenesis and the vitellogenin gene family. Science 212, 298–304. Wiegand, M.D., 1996. Composition, accumulation and utilization of yolk lipids in teleost fish. Rev. Fish Biol. Fish. 6, 259–286. Wu, Q., Brown, M.R., 2006. Signaling and function of insulin-like peptides in insects. Annu. Rev. Entomol. 51, 1–24. Zmora, N., Trant, J., Chan, S.M., Chung, J.S., 2007. Vitellogenin and its messenger RNA during ovarian development in the female blue crab, Callinectes sapidus: gene expression, synthesis, transport, and cleavage. Biol. Reprod. 77, 138–146.
16
Tables Table 1. List of primers used in this study. Name
Sequence (5'- 3')
Sp-PI3KF
CTGTTTGGTATGCTGCACGAC
Sp-PI3KR
AACCGAATGGACACTGAAGGTA
Sp-AktF
TTGAGATCCAGGAGTTCAGTAGAGT
Sp-AktR
TTCCACATGGTCAGGTGGTGT
Sp-AktQF
CCAAACCAATGATCGCCTCT
Sp-AktQR
TGCCCATCAGCATCCAGTAA
Sp-AktdsF
ACAGGGAGTCATGGATGGAAG
Sp-AktdsR
TGATGGCATAGAAATGGTTGC
GFPdsF
TGGGCGTGGATAGCGGTTTG
GFPdsR
GGTCGGGGTAGCGGCTGAAG
Sp-RhebF
CGTATGGACCACTGACCACG
Sp-RhebR
AATTCCTCAAAGCCAGACCC
Sp-RhebQF
CATGAACATCCACGGCTACG
Sp-RhebQR
GTTTCCCACCAACACCACAG
Sp-TORF
TCATGGAGCACTGTGATAAGGG
Sp-TORR
CTTGTGGGACAGGGCAAGG
Sp-vtgQF
CGCAACCGCCACTGAAGAT
Sp-vtgQR
CCACCATGCTGCTCACGACT
β-actinF
CCACACCAGGAAGGTCTTGT
β-actinR
TGCGTTGGATGCGAAGTGACAAAG
17
Figure legends Figure 1. (A) The levels of Sp-vtg expression in the ovary and hepatopancreas of S. paramamosain females at early vitellogenic stage. (B) Effects of insulin administration on Sp-vtg expression in the hepatopancreatic explants from S. paramamosain females at early vitellogenic stage. Data are presented as mean ± SE (n=3). “*” indicates the statistical significance at P < 0.05.
Figure 2. (A) Schematic diagram of putative domain structures of amino acid sequences of SpPI3K, Sp-Akt, Sp-Rheb and Sp-TOR predicted using SMART. Numbers of amino acids are shown at the top. (B) Spatial distribution of Sp-PI3K, Sp-Akt, Sp-Rheb and Sp-TOR in different tissues from S. paramamosain females at early vitellogenic stage. Tissues include 1: brain; 2: ovary; 3: hepatopancreas; 4: hemocytes and 5: muscle. Lane 6: negative control is a PCR reaction performed without adding template. Amplification of the β-actin is carried out as the internal control.
Figure 3. (A) Effects of Sp-Akt-dsRNA addition on the levels of Sp-Akt expression in the hepatopancreatic explants of S. paramamosain at early vitellogenic stage. (B) Effects of Sp-AktdsRNA on Sp-Rheb and insulin-induced Sp-vtg expression in the hepatopancreatic explants of S. paramamosain at early vitellogenic stage. The samples were collected after the 30 min preincubation and 6 h incubation. Data are presented as mean ± SE (n=3). “*” indicates the statistical significance at P < 0.05.
Figure 4. Effects of PI3K-inhibitor LY294002 and TOR-inhibitor rapamycin on insulin-induced Sp-vtg expression in the hepatopancreatic explants of S. paramamosain at early vitellogenic stage. The samples were collected after the 30 min preincubation and 6 h incubation. Data are presented as mean ± SE (n=3). “*” indicates the statistical significance at P < 0.05. 18
1) The hepatopancreas is the major site of Sp-vtg synthesis in S. paramamosain. 2) Key factors in ILP signaling are conserved in S. paramamosain. 3) Knockdown of Sp-Akt blocks the stimulation of Sp-vtg expression by insulin. 4) Inhibitors of PI3K and TOR block the stimulation of Sp-vtg expression by insulin.
19