- Email: [email protected]
In vitro transdifferentiation of human cultured CD34+ stem cells into oligodendrocyte precursors using thyroid hormones
G Model
ARTICLE IN PRESS
NSL 31018 1–6
Neuroscience Letters xxx (2014) xxx–xxx
Contents lists available at ScienceDirect
Neuroscience Letters journal homepage: www.elsevier.com/locate/neulet
Research article
1
2
3
Q1
4
Q2
5 6 7 8 9 10
Q3
In vitro transdifferentiation of human cultured CD34+ stem cells into oligodendrocyte precursors using thyroid hormones Katari Venkatesh a , Lokanathan Srikanth a , Bhuma Vengamma b , Chodimella Chandrasekhar c , Bodapati Chandra Mouleshwara Prasad d , Potukuchi Venkata Gurunadha Krishna Sarma a,∗ a
Department of Biotechnology, Sri Venkateswara Institute of Medical Sciences, Stem cell Laboratory, Tirupati, Andhra Pradesh 517507, India Department of Neurology, Sri Venkateswara Institute of Medical Sciences, Tirupati, Andhra Pradesh 517507, India c Department of Hematology, Sri Venkateswara Institute of Medical Sciences, Tirupati, Andhra Pradesh 517507, India d Department of Neurosurgery, Sri Venkateswara Institute of Medical Sciences, Tirupati, Andhra Pradesh 517507, India. b
11
12 13 14 15 16
h i g h l i g h t s • Transplantation of OPCs may hasten the next step of differentiation at target site. • Myelinating cells at demyelinating lesions may used to treat CNS disorders. • Patient specific olig cells have greater importance in regular clinical practice.
17
18 32
a r t i c l e
i n f o
a b s t r a c t
19 20 21 22 23 24 25
Article history: Received 30 July 2014 Received in revised form 15 December 2014 Accepted 24 December 2014 Available online xxx
26
31
Keywords: CD34+ stem cells Oligodendrocytes Thyroid hormones Oligodendrocyte differentiation medium
33
1. Introduction
27 28 29 30
34 35 36 37 38 39
The extent of myelination on the axon promotes transmission of impulses in the neural network, any disturbances in this process results in the neurodegenerative condition. Transplantation of oligodendrocyte precursors that supports in the regeneration of axons through myelination is an important step in the restoration of damaged neurons. Therefore, in the present study, the differentiation of human CD34+ stem cells into oligodendrocytes was carried out. The pure human CD34+ culture developed from the stem cells obtained from a peripheral blood of a donor were subjected to oligodendrocyte differentiation medium (ODM). The ODM at a concentration of 40 ng/ml thyroxine, 40 ng/ml 3,3 ,5-tri-iodo-thyronine showed distinct morphological changes from day 6 to 9 with cells exhibiting conspicuous stellate morphology and extensive foot processes. The real-time PCR analysis showed prominent expression of Olig2, CNPase, PDGFR␣ and PLP1/DM20 in the differentiated cells confirming the formed cells are oligodendrocyte precursors. The expression of these genes increased from days 6 to 9 corresponding to the morphological changes observed with almost no expression of GFAP+ cells. The distinct CNPase activity was observed in these differentiated cells compared to normal CD34+ stem cells correlating with results of real-time PCR conclusively explains the development of oligodendrocytes from human CD34+ stem cells. © 2014 Published by Elsevier Ireland Ltd.
Hematopoietic stem cells are multipotent stem cells that can differentiate into multiple cell lineages and are largely found in bone marrow-2%, than in immobilized peripheral blood and umbilical cord blood ∼0.2% and 1%, respectively [1]. These cells are identified through the presence of cell surface receptors CD34+ and CD133+ [2]. The transdifferentiation of HSCs, producing various multiple
∗ Corresponding author. Tel.: +91 9550882641x2394, 2395/8772287777. E-mail address: [email protected] (P.V.G.K. Sarma).
progenitors and lineage committed precursor’s prior formation of terminally differentiated cells. It is now very well established that human embryonic stem cells derived oligoprogenitor cells when transplanted immediately to injured spinal cord showed faster differentiation into oligodendrocytes producing active myelin basic protein quicker replacement of damaged tissue and improved neural network [3,4]. The signals that regulate oligogliogenesis, has gained more importance to develop new ways of treating remyelination processes in central nervous system (CNS). Among them, thyroid hormones (TH) have a wide control in the development and maturation of the glial cells in the CNS. The thyroid hormone binds to
http://dx.doi.org/10.1016/j.neulet.2014.12.050 0304-3940/© 2014 Published by Elsevier Ireland Ltd.
Please cite this article in press as: K. Venkatesh, et al., In vitro transdifferentiation of human cultured CD34+ stem cells into oligodendrocyte precursors using thyroid hormones, Neurosci. Lett. (2014), http://dx.doi.org/10.1016/j.neulet.2014.12.050
40 41 42 43 44 45 46 47 48 49 50 51
G Model NSL 31018 1–6
ARTICLE IN PRESS K. Venkatesh et al. / Neuroscience Letters xxx (2014) xxx–xxx
2
72
specific receptors called thyroid hormone receptors (THRs) which are encoded by two distinct isoforms; ˛ and ˇ. The interaction complex of TH–THRs stimulates to form heterodimer (THR␣–THR) and helps in binding to specific DNA sequences located at target site and influence the transcription rate of olig-specific genes [5]. Oligodendrocytes, a sub-type of glial cells found in the CNS which produces myelin that provides insulation around axons of nerve fibers. The myelin sheath is an intermodal fatty insulator, ensures membrane depolarization and promotes the rapid transmission of electrical impulses along with myelinated axons [6]. Myelination is essential for the normal functioning of the CNS and its disruption through injury or pathological degeneration leads to severe functional deficits [7]. Expression of olig-specific genes contribute in the remyelination process that promote the cross-talk between neighboring axons in the formation of neural network [8,9]. Therefore, in the present study, we examined the potential abilities of human CD34+ cells into oligodendrocytes by inducing with oligodendrocyte differentiation medium. In the monolayer of derived oligodendrocytes the kinetics of CNPase and expression of Olig2, CNPase, PDGFR␣ and PLP1/DM20 were assessed using realtime polymerase chain reaction.
73
2. Materials and methods
74
2.1. Cell culture
52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71
86
Human peripheral blood stem cells (PBSCs) were isolated from a donor male using automated blood cell separator AS.TEC 204 system (Fresenius-Kabi, Germany) upon induction with granulocyte colony stimulating factor of 5 g/kg/day for up to three successive days. The research protocol was approved by Institutional Ethics Committee (IEC NO: 288/11-02-2013), Sri Venkateswara Institute of Medical Sciences University, Tirupati, India. These isolated cells were expanded in DMEM growth medium supplemented with 10% fetal bovine serum. All cultures were incubated at 37 ◦ C, 5% CO2 in a 95% humidified CO2 incubator (Binder, Germany) [10]. The morphological assessment of CD34+ stem cells was performed using Leishman’s stain.
87
2.2. Immunophenotyping of human CD34+ stem cells
75 76 77 78 79 80 81 82 83 84 85
99
These PBSCs were seeded at a density of 1 × 103 cells/cm2 in serum free DMEM medium, and cells were harvested after 85% confluency into a sterile 1.5 ml microcentrifuge tube and centrifuged at 600 rpm for 5 min at 4 ◦ C. The pellet was resuspended into a fresh DMEM medium and subjected to enumeration and purification of human CD34+ cells using fluorescence activated cell sorting (FACS) (FACS CaliburTM , Becton Dickinson, USA) as performed earlier and dead CD34+ cells were eliminated using 7-amino-actinomycin D fluorescent dye that assists in viable CD34+ events. Further, these cells were examined for the presence of CD34+ cell surface marker by immunocytochemical staining using anti-human CD34 monoclonal antibody (QBEND 10 clone, Dako) [11].
100
2.3. Cell viability assay
88 89 90 91 92 93 94 95 96 97 98
104
Equal volume of CD34+ cell suspension and 0.4% Trypan blue dye (w/v) were mixed and counted in improved Neubauer hemocytometer. The sample with ≥85% viability was considered as acceptable criterion for further differentiation steps [12].
105
2.4. Oligodendrocyte differentiation assay
101 102 103
106 107 108
The differentiation of oligodenrocytes from human CD34+ cells was performed in two-steps: first using neurobasal medium (NBM) (Step-I) and followed by oligodendrocyte differentiation medium
(ODM) (Step-II). The NBM contained DMEM supplemented with 1 M retinoic acid, 20 ng/ml epidermal growth factor, 20 ng/ml fibroblast growth factor, 25 g/ml insulin and ODM contained DMEM supplemented with 40 ng/ml thyroxine, 40 ng/ml 3,3 ,5tri-iodo-thyronine, 30 nM/ml selenium. The cultured monolayer of CD34+ cells were seeded at density of 2 × 103 cells/cm2 in DMEM for 3 days [10,11] and the medium changed to NBM on 3rd day and further allowed to grow for 72 h. On 6th day, the medium was replaced and optimized with various combinations of ODM constituents (Table 1). The specific markers were analyzed to characterize the differentiated cells, and these cells were subjected to FACS analysis to evaluate % CD34+ cells. 2.5. Scanning electron microscopy The cells from the ODM were fixed on a glass slide of 1 cm2 diameter with 3% glutaraldehyde in 0.1 M phosphate buffer (pH 7.4) at 37 ◦ C for 15 min, the slides were rinsed with phosphate buffer saline (PBS) (pH 7.2) for three times. Then the slides were post-fixed with osmium tetraoxide for 30 min and rinsed with PBS for five times. The slides were gradually dehydrated using ethanol series (30–100%) for 30 s each, till critical point of drying was achieved. The samples were mounted on aluminium stubs with two-sided adhesive tape, sputter-coated with 2 nm gold/palladium (Au/Pd) and examined with a field emission scanning electron microscope (EVO MA15, Carl Zeiss, Germany) [13]. 2.6. CNPase kinetic assay Cell lysate of differentiated oligodendrocytes was prepared by using lysis buffer [10,11] and incubated for 10 min at 37 ◦ C and centrifuged at 13,000 rpm for 30 min at 4 ◦ C. Thus, obtained cytosolic fraction was used as enzyme source for CNPase assay [14]. The kinetics CNPase was determined by using reaction mixture;100 mM Tris–HCl pH 7.0, 30 mM MgCl2 , 0.1–2.5 M cNADP, 5 mM glucose-6-phosphate and 1U glucose-6-phosphate dehydrogenase (SRL, India) and absorbance recorded at 340 nm in a Cyber lab spectrophotometer, USA. The activity of CNPase was measured as amount of NADPH formed in 1 min. Standard curve of NADPH was plotted by taking the absorbance at 340 nm on Y-axis and different concentrations of NADPH on X-axis. The protein concentration in all steps was determined by Barford method [15]. 2.7. Immunocytochemistry The cells were harvested and washed for 3 times with phosphate-buffered saline (PBS), fixed on a sterile glass slide with 4% paraformaldehyde and blocked with 3% gelatin for 30 min at room temperature and internal peroxidase was blocked using 3% H2 O2 . The cells were incubated with anti-human Olig2 antibodies (Clontech Laboratories, Inc., USA) at 1:200 dilutions for 1 h at 37 ◦ C. The cells were washed with PBS containing Tween-20 and incubated with anti-rabbit HRPO secondary antibody at 1:400 dilutions (Merck Biosciences, Nottingham, UK). The slide was developed with 3,3 -diaminobenzidine tetrahydrochloride in presence of substrate H2 O2 the reaction was stopped by keeping slides in distilled water and observed under microscope. 2.8. RNA isolation and qPCR analysis The total RNA was isolated from both oligodendrocyte culture and CD34+ stem cells by following manufacturer’s protocol using total RNA minipreps kit (Medox Biotech Pvt. Ltd., India) [16]. The isolated RNA was solubilized in RNase-free water and quantified by taking the readings at 260 nm in a cyber lab spectrophotometer, USA (OD260 nm × 40 ng/l × dilution factor). The first strand
Please cite this article in press as: K. Venkatesh, et al., In vitro transdifferentiation of human cultured CD34+ stem cells into oligodendrocyte precursors using thyroid hormones, Neurosci. Lett. (2014), http://dx.doi.org/10.1016/j.neulet.2014.12.050
109 110 111 112 113 114 115 116 117 118 119 120
121
122 123 124 125 126 127 128 129 130 131 132
133
134 135 136 137 138 139 140 141 142 143 144 145 146
147
148 149 150 151 152 153 154 155 156 157 158 159
160
161 162 163 164 165 166
G Model
ARTICLE IN PRESS
NSL 31018 1–6
K. Venkatesh et al. / Neuroscience Letters xxx (2014) xxx–xxx
3
Table 1 Oligodendrocyte differentiation medium (ODM) standardization. S. no
ODM combinations
T3 (40 ng/ml) (l)
T4 (40 ng/ml) (l)
Se (30 nM/ml) (l)
Volume of cells 2 × 103 (l)
1 2 3 4 5 6 7 8 9
T3 T4 Se T3 + T4 T4 + Se T3 + Se T3 + T4 + Se Medium control Cell control
40 –
– 40 – 40 40 – 40 – –
– – 40 – 40 40 40 – –
100 100 100 100 100 100 100 – 100
40 – 40 40 – –
DMEM (l) 860 860 860 820 820 820 780 1000 900
Table 2 List of primer used in real-time polymerase chain reaction. S. no
Gene name
Gene symbol
Accession no.
Forward primer (5 -> 3 )
Reverse primer (5 -> 3 )
Tm (◦ C)
1 2 3 4 5 6 7
Oligdendrocyte transcription factor2 2’,3’-Cyclic nucleotide 3’ phosphodiesterase Platelet derived growth factor receptor alpha Proteolipid protein 1 Glial fibrillary acidic protein Glyceraldehyde 3-phosphate dehydrogenase Cell surface receptor, CD marker
Olig2 CNPase PDGFRA PLP1 GFAP GAPDH CD34
NM NM NM NM NM NM NM
GCGCGCAACTACATCCTCAT GCCGCCGGGACATCA CCTGGTGCTGTTGGTGATTGT CCAGAGGCCAACATCAAGCT GAGATCCGCACGCAGTATGA GACCTGACCTGCCGTCTAGAAA CTCCAGAAACGGCCATTCAG
CGCTCACCAGTCGCTTCAT ACTGGTCGGCCATTTCAAAG TCATACCTCGGTTTCTGTTTCCA TCGGGATGTCCTAGCCATTT ACTTGGAGCGGTACCACTCTTC CCTGCTTCACCACCTTCTTGA CCCACCTAGCCGAGTCACAA
56.5 56.6 56.62 55.69 55.62 56.31 56.72
005806.3 033133.4 006206.4 001025101.1 002055.4 002046.4 001025109.1
182
of cDNA was synthesized using random hexamers and multiscribe reverse transcriptase using thermal programme: 25 ◦ C for 10 min, 37 ◦ C for 120 min, 85 ◦ C 5 min and hold at 4 ◦ C. The above reaction mixture was used as template in the real-time PCR to estimate the expression of Olig-specific markers Olig2, CNPase, PDGFR␣, PLP1/DM20 using the primers as mentioned in Table 2. The expression of these markers was normalized by using GAPDH gene expression (endogenous control). Relative quantification of Olig-specific markers was carried out using the ABI Prism 7300 sequence detection system, and assay mixtures were prepared using SYBR® Select Master Mix for 40 cycles as per manufacturer’s instructions (Applied Biosystems, Foster City, CA). The expression levels of Olig2, CNPase, PDGFR␣ and PLP1/DM20 were calculated by using the formula Ct = Ctr (differentiated) – Ctcb (undifferentiated) relative expression was calculated using the expression N = 2−Ct [17].
183
3. Results
184
3.1. Immunophenotyping of CD34+ stem cells
167 168 169 170 171 172 173 174 175 176 177 178 179 180 181
6th (Fig. 2e–g). Further these neurospheres were induced with ODM containing 40 ng/ml thyroxine, 40 ng/ml 3,3 ,5-tri-iodo-thyronine and morphological changes of oligodendrocytes were recorded day to day. On day 9 cells with stellate morphology with distinct foot processes was observed. The Leishman staining results showed cells with stellate morphology and foot processes were distributed throughout the culture medium. The SEM analysis clearly revealed the earlier observations with distinct characteristic features of oligodendrocytes in the ODM with axo-glial network formation (Fig. 2h–j). The immunocyto chemical analysis of differentiated cells using anti-human Olig2 antibodies conclusively explains the expression of oligodendrocyte specific transcription factor Olig2. Further, the expression of Olig2, CNPase, PDGFR␣ PLP1/DM20 in the differentiated culture using real-time PCR method corroborated the ICC results (Fig. 3c). 3.3. Real-time PCR analysis of oligodendrocytes
196
The collection of peripheral blood stem cells was successfully achieved on inducing with G-CSF at a dose of 5 g/kg/day. The FACS analysis showed pure CD34+ stem cell population was 82 cells/L (Fig. 1a–c). Further, on morphological examination using Leishman stain and scanning electron microscopy the CD34+ cells showed conspicuous presence of nucleus with round morphology cells respectively. The presence of CD34+ antigen was evaluated by immunocytochemical studies, the cultured monolayer of CD34+ cells showed 98% positive reaction to anti-human CD34 monoclonal antibodies (Dako, USA) (Fig. 1b). The pure monolayer culture was generated and adopted in serum free DMEM at 37 ◦ C with 95% relative humidity for further differentiation studies.
197
3.2. Oligodendrocyte differentiation studies
185 186 187 188 189 190 191 192 193 194 195
198 199 200 201
The obtained monolayer pure CD34+ cells were subjected to oligodendrocyte induction studies in two stage method with NBM and followed by ODM (Fig. 2a–d). Induction with NBM stimulates the human CD34+ stem cells into neurospheres formation on day
Total mRNA was isolated from the both cultured human CD34+ stem cells and differentiated oligodendrocyte cells and presence of Olig2, CNPase, PDGFR␣ PLP1/DM20 (oligodendrocyte specific markers) mRNA were analyzed. The qPCR results indicated the high expression of oligodendrocyte markers Olig2 (60%), CNPase (71.25%), PDGFR␣ (82.5%) and PLP1/DM20 (30%) and GFAP (0%) in differentiated culture compared with control CD34+ culture. More than 85% of differentiated culture showed expression of oligspecific markers; Olig2, CNPase, PDGFR␣ and PLP1 (Fig. 3a and b). In these cells absence of GFAP expression indicated that no GFAP+ cells were observed. Further, FACS analysis revealed presence of only 4CD34+ cells/l in the differentiated culture (Fig. 3d). In the differentiated oligodendrocytes, very high CNPase activity was observed with almost no activity detected in the control CD34+ stem cells explains the presence of oligodendrocytes in the ODM (Fig. 3e). The comparative analysis of olig-specific markers proteolipid protein 1 which is expressing 2–3 folds lower in the differentiated culture suggests that the differentiated oligodendrocytes are at precursor stage and not terminally differentiated on day 9 in ODM. These results conclusively explain the successful differentiation of human CD34+ cells into oligodendrocyte precursors in the ODM.
Please cite this article in press as: K. Venkatesh, et al., In vitro transdifferentiation of human cultured CD34+ stem cells into oligodendrocyte precursors using thyroid hormones, Neurosci. Lett. (2014), http://dx.doi.org/10.1016/j.neulet.2014.12.050
202 203 204 205 206 207 208 209 210 211 212 213 214 215 216
217
218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239
G Model NSL 31018 1–6 4
ARTICLE IN PRESS K. Venkatesh et al. / Neuroscience Letters xxx (2014) xxx–xxx
Fig. 1. Immunophenotyping of CD34+ stem cells. (a) Monolayer culture of CD34+ stem cells, (b) immunocytochemical staining of CD34+ stem cells and, (c) flow cytometric analysis of cultured human CD34+ stem cells.
Fig. 2. Human CD34+ stem cells can be directed into Olig fate. (a) A schematic protocol for directed differentiation of human CD34+ stem cells into oligodendrocytes, (b) monolayer culture of CD34+ stem cells, (c) leishman staining of CD34+ stem cells, (d) SEM analysis of CD34+ stem cells, (e) neurospheres generation of HSCs upon induction with NBM medium on day 6, (f) leishman staining of neurospheres formed on day 6, (g) SEM analysis of neurospheres formed on day 6, (h) differentiation of oligodendrocytes from the neurospheres by inducing with ODM medium day 9 showing extensive foot processes, (i) Leishman staining oligodendrocyte precursor culture on day 9 and, (j) SEM examination of oligodendrocyte morphological structure with foot processes.
Please cite this article in press as: K. Venkatesh, et al., In vitro transdifferentiation of human cultured CD34+ stem cells into oligodendrocyte precursors using thyroid hormones, Neurosci. Lett. (2014), http://dx.doi.org/10.1016/j.neulet.2014.12.050
G Model NSL 31018 1–6
ARTICLE IN PRESS K. Venkatesh et al. / Neuroscience Letters xxx (2014) xxx–xxx
5
Fig. 3. Expression analysis of Olig-specific markers using Real-time PCR. (a) Percentage of cells expressing the oligodendrocyte specific markers (Olig2, CNPase, PDGFR␣ and PLP1) on time-course (DIV 0–9) dependent manner upon induction with ODM medium, (b) proportion of Olig2+ , CNPase+ , PDGFR␣+ PLP1+ cells in the differentiation culture at DIV 9, (c) immunocytochemical studies of HSC-derived oligodendrocytes, (d) flow cytometric analysis of CD34+ expression from the oligodendrocyte culture, (e) enzymatic activity of CNPase in differentiated oligodendrocyte culture from DIV0 to 9 in time dependent manner and showing decrement of CD34+ expression in the differentiate culture determined using flowcytometry.
Fig. 4. Schematic representation of remyelination programme by using oligodendrocyte transplantation therapy at damaged sites of spinal cord injuries and multiple sclerosis patients.
Please cite this article in press as: K. Venkatesh, et al., In vitro transdifferentiation of human cultured CD34+ stem cells into oligodendrocyte precursors using thyroid hormones, Neurosci. Lett. (2014), http://dx.doi.org/10.1016/j.neulet.2014.12.050
G Model NSL 31018 1–6
K. Venkatesh et al. / Neuroscience Letters xxx (2014) xxx–xxx
6 240
ARTICLE IN PRESS
4. Discussion
275
Human CD34+ cells have the ability to differentiate into all cell types of three germ layers when subjected to specified conditions [18]. Therefore, in the present study, differentiation of human CD34+ stem cells into oligodendrocytes was carried out in two steps; first by inducing with NBM and followed by ODM. In the NBM CD34+ cells differentiated only to become neurospheres (Figs. 1 and 2). At 40 ng/ml thyroxine, 40 ng/ml 3,3 ,5-tri-iodo-thyronine in ODM increased level of oligodendrocytes formation was observed (Table 1). TH binds to TR␣ and TR, and formed heterodimers bind at the site of regulatory regions of TH response elements (TREs). The morphological changes brought about by ODM were observed, subjecting the cultured cells to Leishman stain showed distinct stellate morphology with foot processes elucidates successful differentiation of human CD34+ stem cells into oligodendrocytes [19]. The SEM and immune reactivity results clearly showed formation of oligodendrocyte neural network with foot processes (Figs. 2 and 3) which is the key step in the axo-glial junction formation [20]. The high expression of Olig2, CNPase, PDGFR␣ PLP1/DM20 in differentiated oligodendrocytes compared to CD34+ stem cells in qPCR (Fig. 3a–d) conclusively accentuates the formation of oligodendrocytes from human CD34+ stem cells. Studies so far carried out only using embryonic stem cells and induced pluripotent stem cells, this is the first report wherein the differentiation capabilities of CD34+ stem cells into various types of glial cells is explained [11]. Formation of oligodendrocytes by gene suppression, knockout and from stem cells studies have accentuated the utility of these cells in the remyelination process at paranodal axo-glial junctions to improve conduction velocities [21–23] (Fig. 4) however, in all these studies either they used human embryonic stem cells or induced pluripotent stem cells which may be deleterious on transplantation due to their inheritant property of teratoma formation [24]. This study opens up possible use of autologous oligodendrocyte precursors generated from the patient’s stem cells in the remyelination of axons in various neurodegenerative diseases.
276
5. Conclusion
241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274
284
This study to the best of our knowledge is the first of its kind provides generation of definitive population of pure human oligodendrocytes from human CD34+ stem cells. Using such differentiated oligodendrocyte precursor cells in transplantation in the demyelinated lesions/scars may help in the remyelination which probably can aid in the regeneration of spinal nerves/neurons to correct various spinal cord injuries and neurological disorders.
285
Conflict of interest
277 278 279 280 281 282 283
286
287 288 289 290 291
None declared. Acknowledgment We acknowledge Sri Venkateswara Institute of Medical Sciences (SVIMS University) for providing facilities to carry out the work. This paper forms a part of Ph.D. thesis work going to be submitted to SVIMS University, Tirupati, Andhra Pradesh, India and G7 Synergon Pvt. Ltd. for helping in the FACS analysis.
References [1] P.D. Conrad, S.G. Emerson, Ex vivo expansion of hematopoietic cells from umbilical cord blood for clinical transplantation, J. Leukocyte Biol. 64 (1998) 147–155. [2] A.C. Drake, M. Khoury, I. Leskov, B.P. Iliopoulou, M. Fragoso, H. Lodish, et al., Human CD34+ CD133+ hematopoietic stem cells cultured with growth factors including Angptl5 efficiently engraft adult NOD-SCID Il2ry-/- (NSG) mice, PLoS One 6 (2011) e18382. [3] G.I. Nistor, M.O. Totoiu, N. Haque, M.K. Carpenter, H.S. Keirstead, Human embryonic stem cells differentiate into oligodendrocytes in high purity and myelinate after spinal cord transplantation, Glia 49 (2005) 385–396. [4] A.H. All, F.A. Bazley, S. Gupta, N. Pashai, C. Hu, A. Pourmorteza, et al., Human embryonic stem cell-derived oligodendrocyte progenitors aid in functional recovery of sensory pathways following contusive spinal cord injury, PLoS One 7 (2012) e47645. [5] N. Billon, Normal timing of oligodendrocyte development depends on thyroid hormone receptor alpha 1 (TRalpha1), EMBO J. 21 (2002) 6452–6460, http://dx.doi.org/10.1093/emboj/cdf662. [6] C.C. Thompson, Thyroid hormone action in neural development, Cereb. Cortex. 10 (2000) 939–945. [7] D. Karussis, I. Kassis, The potential use of stem cells in multiple sclerosis: an overview of the preclinical experience, Clin. Neurol. Neurosurg. 110 (2008) 889–896. [8] W.D. Richardson, Oligodendrocyte specification, in: L.R. Squire (Ed.), Encyclopedia of Neuroscience, Academic Press, Oxford, 2008, pp. 209–215. [9] A. Aschner, M.A. Philbert, Comprehensive toxicology, in: Glial Cells, second ed., Elsevier Press, 2010, pp. 199–219 (Chapter 13.12). [10] P.V.G.K. Sarma, G. Subramanyam, In vitro cardiogenesis can be initiated in human CD34+ cells, Indian Heart J. 60 (2008) 95–100. [11] K. Venkatesh, L. Srikanth, B. Vengamma, C. Chandrasekhar, A. Sanjeevkumar, B.C. Mouleshwara Prasad, et al., In vitro differentiation of cultured human CD34+ cells into astrocytes, Neurol. India 61 (2013) 383–388. [12] W. Strober, Trypan blue exclusion test of cell viability., Curr. Protoc. Immunol. Appendix 3 (2001) Appendix 3B. [13] J.J. Bozzola, Conventional specimen preparation techniques for scanning electron microscopy of biological specimens, Methods Mol. Biol. 1117 (2014) 133–150. [14] M. Myllykoski, P. Kursula, Expression, purification, and initial characterization of different domains of recombinant mouse 2 ,3 -cyclic nucleotide 3 -phosphodiesterase, an enigmatic enzyme from the myelin sheath, BMC Res. Notes 3 (2010) 12. [15] M.M. Bradford, A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding, Anal. Biochem. 72 (1976) 248–254. [16] S. Majumder, M. Ilayaraja, H.R. Seerapu, S. Sinha, J.H. Siamwala, S. Chatterjee, Chick embryo partial ischemia model: a new approach to study ischemia ex vivo, PLoS One 5 (2010) e10524. [17] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2(-delta delta C(T)) method, Methods 25 (2001) 402–408. [18] X. Jiang, T. Fujisaki, F. Nicolini, M. Berger, T. Holyoake, W. Eisterer, C. Eaves, A. Eaves, Autonomous multi-lineage differentiation in vitro of primitive CD34+ cells from patients with chronic myeloid leukemia, Leukemia 14 (2000) 1112–1121. [19] M. Bradl, H. Lassmann, Oligodendrocytes: biology and pathology, Acta Neuropathol. 119 (2010) 37–53. [20] D.L. Sherman, P.J. Brophy, Mechanisms of axon ensheathment and myelin growth, Nat. Rev. Neurosci. 6 (2005) 683–690. [21] H.S. Keirstead, G. Nistor, G. Bernal, M. Totoiu, F. Cloutier, K. Sharp, et al., Human embryonic stem cell-derived oligodendrocyte progenitor cell transplants remyelinate and restore locomotion after spinal cord injury, J. Neurosci. 25 (2005) 4694–4705. [22] C.L. Kerr, B.S. Letzen, C.M. Hill, G. Agrawal, N.V. Thakor, J.L. Sterneckert, et al., Efficient differentiation of human embryonic stem cells into oligodendrocyte progenitors for application in a rat contusion model of spinal cord injury, Int. J. Neurosci. 120 (2010) 305–313. [23] W. Yin, B. Hu, Knockdown of Lingo1b protein promotes myelination and oligodendrocyte differentiation in zebrafish, Exp. Neurol. 251 (2014) 72–83. [24] T.A. Prokhorova, L.M. Harkness, U. Frandsen, N. Ditzel, H.D. Schrøder, J.S. Burns, et al., Teratoma formation by human embryonic stem cells is site dependent and enhanced by the presence of Matrigel, Stem Cells Dev. 18 (2009) 47–54.
Please cite this article in press as: K. Venkatesh, et al., In vitro transdifferentiation of human cultured CD34+ stem cells into oligodendrocyte precursors using thyroid hormones, Neurosci. Lett. (2014), http://dx.doi.org/10.1016/j.neulet.2014.12.050
292
293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363
ARTICLE IN PRESS
NSL 31018 1–6
Neuroscience Letters xxx (2014) xxx–xxx
Contents lists available at ScienceDirect
Neuroscience Letters journal homepage: www.elsevier.com/locate/neulet
Research article
1
2
3
Q1
4
Q2
5 6 7 8 9 10
Q3
In vitro transdifferentiation of human cultured CD34+ stem cells into oligodendrocyte precursors using thyroid hormones Katari Venkatesh a , Lokanathan Srikanth a , Bhuma Vengamma b , Chodimella Chandrasekhar c , Bodapati Chandra Mouleshwara Prasad d , Potukuchi Venkata Gurunadha Krishna Sarma a,∗ a
Department of Biotechnology, Sri Venkateswara Institute of Medical Sciences, Stem cell Laboratory, Tirupati, Andhra Pradesh 517507, India Department of Neurology, Sri Venkateswara Institute of Medical Sciences, Tirupati, Andhra Pradesh 517507, India c Department of Hematology, Sri Venkateswara Institute of Medical Sciences, Tirupati, Andhra Pradesh 517507, India d Department of Neurosurgery, Sri Venkateswara Institute of Medical Sciences, Tirupati, Andhra Pradesh 517507, India. b
11
12 13 14 15 16
h i g h l i g h t s • Transplantation of OPCs may hasten the next step of differentiation at target site. • Myelinating cells at demyelinating lesions may used to treat CNS disorders. • Patient specific olig cells have greater importance in regular clinical practice.
17
18 32
a r t i c l e
i n f o
a b s t r a c t
19 20 21 22 23 24 25
Article history: Received 30 July 2014 Received in revised form 15 December 2014 Accepted 24 December 2014 Available online xxx
26
31
Keywords: CD34+ stem cells Oligodendrocytes Thyroid hormones Oligodendrocyte differentiation medium
33
1. Introduction
27 28 29 30
34 35 36 37 38 39
The extent of myelination on the axon promotes transmission of impulses in the neural network, any disturbances in this process results in the neurodegenerative condition. Transplantation of oligodendrocyte precursors that supports in the regeneration of axons through myelination is an important step in the restoration of damaged neurons. Therefore, in the present study, the differentiation of human CD34+ stem cells into oligodendrocytes was carried out. The pure human CD34+ culture developed from the stem cells obtained from a peripheral blood of a donor were subjected to oligodendrocyte differentiation medium (ODM). The ODM at a concentration of 40 ng/ml thyroxine, 40 ng/ml 3,3 ,5-tri-iodo-thyronine showed distinct morphological changes from day 6 to 9 with cells exhibiting conspicuous stellate morphology and extensive foot processes. The real-time PCR analysis showed prominent expression of Olig2, CNPase, PDGFR␣ and PLP1/DM20 in the differentiated cells confirming the formed cells are oligodendrocyte precursors. The expression of these genes increased from days 6 to 9 corresponding to the morphological changes observed with almost no expression of GFAP+ cells. The distinct CNPase activity was observed in these differentiated cells compared to normal CD34+ stem cells correlating with results of real-time PCR conclusively explains the development of oligodendrocytes from human CD34+ stem cells. © 2014 Published by Elsevier Ireland Ltd.
Hematopoietic stem cells are multipotent stem cells that can differentiate into multiple cell lineages and are largely found in bone marrow-2%, than in immobilized peripheral blood and umbilical cord blood ∼0.2% and 1%, respectively [1]. These cells are identified through the presence of cell surface receptors CD34+ and CD133+ [2]. The transdifferentiation of HSCs, producing various multiple
∗ Corresponding author. Tel.: +91 9550882641x2394, 2395/8772287777. E-mail address: [email protected] (P.V.G.K. Sarma).
progenitors and lineage committed precursor’s prior formation of terminally differentiated cells. It is now very well established that human embryonic stem cells derived oligoprogenitor cells when transplanted immediately to injured spinal cord showed faster differentiation into oligodendrocytes producing active myelin basic protein quicker replacement of damaged tissue and improved neural network [3,4]. The signals that regulate oligogliogenesis, has gained more importance to develop new ways of treating remyelination processes in central nervous system (CNS). Among them, thyroid hormones (TH) have a wide control in the development and maturation of the glial cells in the CNS. The thyroid hormone binds to
http://dx.doi.org/10.1016/j.neulet.2014.12.050 0304-3940/© 2014 Published by Elsevier Ireland Ltd.
Please cite this article in press as: K. Venkatesh, et al., In vitro transdifferentiation of human cultured CD34+ stem cells into oligodendrocyte precursors using thyroid hormones, Neurosci. Lett. (2014), http://dx.doi.org/10.1016/j.neulet.2014.12.050
40 41 42 43 44 45 46 47 48 49 50 51
G Model NSL 31018 1–6
ARTICLE IN PRESS K. Venkatesh et al. / Neuroscience Letters xxx (2014) xxx–xxx
2
72
specific receptors called thyroid hormone receptors (THRs) which are encoded by two distinct isoforms; ˛ and ˇ. The interaction complex of TH–THRs stimulates to form heterodimer (THR␣–THR) and helps in binding to specific DNA sequences located at target site and influence the transcription rate of olig-specific genes [5]. Oligodendrocytes, a sub-type of glial cells found in the CNS which produces myelin that provides insulation around axons of nerve fibers. The myelin sheath is an intermodal fatty insulator, ensures membrane depolarization and promotes the rapid transmission of electrical impulses along with myelinated axons [6]. Myelination is essential for the normal functioning of the CNS and its disruption through injury or pathological degeneration leads to severe functional deficits [7]. Expression of olig-specific genes contribute in the remyelination process that promote the cross-talk between neighboring axons in the formation of neural network [8,9]. Therefore, in the present study, we examined the potential abilities of human CD34+ cells into oligodendrocytes by inducing with oligodendrocyte differentiation medium. In the monolayer of derived oligodendrocytes the kinetics of CNPase and expression of Olig2, CNPase, PDGFR␣ and PLP1/DM20 were assessed using realtime polymerase chain reaction.
73
2. Materials and methods
74
2.1. Cell culture
52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71
86
Human peripheral blood stem cells (PBSCs) were isolated from a donor male using automated blood cell separator AS.TEC 204 system (Fresenius-Kabi, Germany) upon induction with granulocyte colony stimulating factor of 5 g/kg/day for up to three successive days. The research protocol was approved by Institutional Ethics Committee (IEC NO: 288/11-02-2013), Sri Venkateswara Institute of Medical Sciences University, Tirupati, India. These isolated cells were expanded in DMEM growth medium supplemented with 10% fetal bovine serum. All cultures were incubated at 37 ◦ C, 5% CO2 in a 95% humidified CO2 incubator (Binder, Germany) [10]. The morphological assessment of CD34+ stem cells was performed using Leishman’s stain.
87
2.2. Immunophenotyping of human CD34+ stem cells
75 76 77 78 79 80 81 82 83 84 85
99
These PBSCs were seeded at a density of 1 × 103 cells/cm2 in serum free DMEM medium, and cells were harvested after 85% confluency into a sterile 1.5 ml microcentrifuge tube and centrifuged at 600 rpm for 5 min at 4 ◦ C. The pellet was resuspended into a fresh DMEM medium and subjected to enumeration and purification of human CD34+ cells using fluorescence activated cell sorting (FACS) (FACS CaliburTM , Becton Dickinson, USA) as performed earlier and dead CD34+ cells were eliminated using 7-amino-actinomycin D fluorescent dye that assists in viable CD34+ events. Further, these cells were examined for the presence of CD34+ cell surface marker by immunocytochemical staining using anti-human CD34 monoclonal antibody (QBEND 10 clone, Dako) [11].
100
2.3. Cell viability assay
88 89 90 91 92 93 94 95 96 97 98
104
Equal volume of CD34+ cell suspension and 0.4% Trypan blue dye (w/v) were mixed and counted in improved Neubauer hemocytometer. The sample with ≥85% viability was considered as acceptable criterion for further differentiation steps [12].
105
2.4. Oligodendrocyte differentiation assay
101 102 103
106 107 108
The differentiation of oligodenrocytes from human CD34+ cells was performed in two-steps: first using neurobasal medium (NBM) (Step-I) and followed by oligodendrocyte differentiation medium
(ODM) (Step-II). The NBM contained DMEM supplemented with 1 M retinoic acid, 20 ng/ml epidermal growth factor, 20 ng/ml fibroblast growth factor, 25 g/ml insulin and ODM contained DMEM supplemented with 40 ng/ml thyroxine, 40 ng/ml 3,3 ,5tri-iodo-thyronine, 30 nM/ml selenium. The cultured monolayer of CD34+ cells were seeded at density of 2 × 103 cells/cm2 in DMEM for 3 days [10,11] and the medium changed to NBM on 3rd day and further allowed to grow for 72 h. On 6th day, the medium was replaced and optimized with various combinations of ODM constituents (Table 1). The specific markers were analyzed to characterize the differentiated cells, and these cells were subjected to FACS analysis to evaluate % CD34+ cells. 2.5. Scanning electron microscopy The cells from the ODM were fixed on a glass slide of 1 cm2 diameter with 3% glutaraldehyde in 0.1 M phosphate buffer (pH 7.4) at 37 ◦ C for 15 min, the slides were rinsed with phosphate buffer saline (PBS) (pH 7.2) for three times. Then the slides were post-fixed with osmium tetraoxide for 30 min and rinsed with PBS for five times. The slides were gradually dehydrated using ethanol series (30–100%) for 30 s each, till critical point of drying was achieved. The samples were mounted on aluminium stubs with two-sided adhesive tape, sputter-coated with 2 nm gold/palladium (Au/Pd) and examined with a field emission scanning electron microscope (EVO MA15, Carl Zeiss, Germany) [13]. 2.6. CNPase kinetic assay Cell lysate of differentiated oligodendrocytes was prepared by using lysis buffer [10,11] and incubated for 10 min at 37 ◦ C and centrifuged at 13,000 rpm for 30 min at 4 ◦ C. Thus, obtained cytosolic fraction was used as enzyme source for CNPase assay [14]. The kinetics CNPase was determined by using reaction mixture;100 mM Tris–HCl pH 7.0, 30 mM MgCl2 , 0.1–2.5 M cNADP, 5 mM glucose-6-phosphate and 1U glucose-6-phosphate dehydrogenase (SRL, India) and absorbance recorded at 340 nm in a Cyber lab spectrophotometer, USA. The activity of CNPase was measured as amount of NADPH formed in 1 min. Standard curve of NADPH was plotted by taking the absorbance at 340 nm on Y-axis and different concentrations of NADPH on X-axis. The protein concentration in all steps was determined by Barford method [15]. 2.7. Immunocytochemistry The cells were harvested and washed for 3 times with phosphate-buffered saline (PBS), fixed on a sterile glass slide with 4% paraformaldehyde and blocked with 3% gelatin for 30 min at room temperature and internal peroxidase was blocked using 3% H2 O2 . The cells were incubated with anti-human Olig2 antibodies (Clontech Laboratories, Inc., USA) at 1:200 dilutions for 1 h at 37 ◦ C. The cells were washed with PBS containing Tween-20 and incubated with anti-rabbit HRPO secondary antibody at 1:400 dilutions (Merck Biosciences, Nottingham, UK). The slide was developed with 3,3 -diaminobenzidine tetrahydrochloride in presence of substrate H2 O2 the reaction was stopped by keeping slides in distilled water and observed under microscope. 2.8. RNA isolation and qPCR analysis The total RNA was isolated from both oligodendrocyte culture and CD34+ stem cells by following manufacturer’s protocol using total RNA minipreps kit (Medox Biotech Pvt. Ltd., India) [16]. The isolated RNA was solubilized in RNase-free water and quantified by taking the readings at 260 nm in a cyber lab spectrophotometer, USA (OD260 nm × 40 ng/l × dilution factor). The first strand
Please cite this article in press as: K. Venkatesh, et al., In vitro transdifferentiation of human cultured CD34+ stem cells into oligodendrocyte precursors using thyroid hormones, Neurosci. Lett. (2014), http://dx.doi.org/10.1016/j.neulet.2014.12.050
109 110 111 112 113 114 115 116 117 118 119 120
121
122 123 124 125 126 127 128 129 130 131 132
133
134 135 136 137 138 139 140 141 142 143 144 145 146
147
148 149 150 151 152 153 154 155 156 157 158 159
160
161 162 163 164 165 166
G Model
ARTICLE IN PRESS
NSL 31018 1–6
K. Venkatesh et al. / Neuroscience Letters xxx (2014) xxx–xxx
3
Table 1 Oligodendrocyte differentiation medium (ODM) standardization. S. no
ODM combinations
T3 (40 ng/ml) (l)
T4 (40 ng/ml) (l)
Se (30 nM/ml) (l)
Volume of cells 2 × 103 (l)
1 2 3 4 5 6 7 8 9
T3 T4 Se T3 + T4 T4 + Se T3 + Se T3 + T4 + Se Medium control Cell control
40 –
– 40 – 40 40 – 40 – –
– – 40 – 40 40 40 – –
100 100 100 100 100 100 100 – 100
40 – 40 40 – –
DMEM (l) 860 860 860 820 820 820 780 1000 900
Table 2 List of primer used in real-time polymerase chain reaction. S. no
Gene name
Gene symbol
Accession no.
Forward primer (5 -> 3 )
Reverse primer (5 -> 3 )
Tm (◦ C)
1 2 3 4 5 6 7
Oligdendrocyte transcription factor2 2’,3’-Cyclic nucleotide 3’ phosphodiesterase Platelet derived growth factor receptor alpha Proteolipid protein 1 Glial fibrillary acidic protein Glyceraldehyde 3-phosphate dehydrogenase Cell surface receptor, CD marker
Olig2 CNPase PDGFRA PLP1 GFAP GAPDH CD34
NM NM NM NM NM NM NM
GCGCGCAACTACATCCTCAT GCCGCCGGGACATCA CCTGGTGCTGTTGGTGATTGT CCAGAGGCCAACATCAAGCT GAGATCCGCACGCAGTATGA GACCTGACCTGCCGTCTAGAAA CTCCAGAAACGGCCATTCAG
CGCTCACCAGTCGCTTCAT ACTGGTCGGCCATTTCAAAG TCATACCTCGGTTTCTGTTTCCA TCGGGATGTCCTAGCCATTT ACTTGGAGCGGTACCACTCTTC CCTGCTTCACCACCTTCTTGA CCCACCTAGCCGAGTCACAA
56.5 56.6 56.62 55.69 55.62 56.31 56.72
005806.3 033133.4 006206.4 001025101.1 002055.4 002046.4 001025109.1
182
of cDNA was synthesized using random hexamers and multiscribe reverse transcriptase using thermal programme: 25 ◦ C for 10 min, 37 ◦ C for 120 min, 85 ◦ C 5 min and hold at 4 ◦ C. The above reaction mixture was used as template in the real-time PCR to estimate the expression of Olig-specific markers Olig2, CNPase, PDGFR␣, PLP1/DM20 using the primers as mentioned in Table 2. The expression of these markers was normalized by using GAPDH gene expression (endogenous control). Relative quantification of Olig-specific markers was carried out using the ABI Prism 7300 sequence detection system, and assay mixtures were prepared using SYBR® Select Master Mix for 40 cycles as per manufacturer’s instructions (Applied Biosystems, Foster City, CA). The expression levels of Olig2, CNPase, PDGFR␣ and PLP1/DM20 were calculated by using the formula Ct = Ctr (differentiated) – Ctcb (undifferentiated) relative expression was calculated using the expression N = 2−Ct [17].
183
3. Results
184
3.1. Immunophenotyping of CD34+ stem cells
167 168 169 170 171 172 173 174 175 176 177 178 179 180 181
6th (Fig. 2e–g). Further these neurospheres were induced with ODM containing 40 ng/ml thyroxine, 40 ng/ml 3,3 ,5-tri-iodo-thyronine and morphological changes of oligodendrocytes were recorded day to day. On day 9 cells with stellate morphology with distinct foot processes was observed. The Leishman staining results showed cells with stellate morphology and foot processes were distributed throughout the culture medium. The SEM analysis clearly revealed the earlier observations with distinct characteristic features of oligodendrocytes in the ODM with axo-glial network formation (Fig. 2h–j). The immunocyto chemical analysis of differentiated cells using anti-human Olig2 antibodies conclusively explains the expression of oligodendrocyte specific transcription factor Olig2. Further, the expression of Olig2, CNPase, PDGFR␣ PLP1/DM20 in the differentiated culture using real-time PCR method corroborated the ICC results (Fig. 3c). 3.3. Real-time PCR analysis of oligodendrocytes
196
The collection of peripheral blood stem cells was successfully achieved on inducing with G-CSF at a dose of 5 g/kg/day. The FACS analysis showed pure CD34+ stem cell population was 82 cells/L (Fig. 1a–c). Further, on morphological examination using Leishman stain and scanning electron microscopy the CD34+ cells showed conspicuous presence of nucleus with round morphology cells respectively. The presence of CD34+ antigen was evaluated by immunocytochemical studies, the cultured monolayer of CD34+ cells showed 98% positive reaction to anti-human CD34 monoclonal antibodies (Dako, USA) (Fig. 1b). The pure monolayer culture was generated and adopted in serum free DMEM at 37 ◦ C with 95% relative humidity for further differentiation studies.
197
3.2. Oligodendrocyte differentiation studies
185 186 187 188 189 190 191 192 193 194 195
198 199 200 201
The obtained monolayer pure CD34+ cells were subjected to oligodendrocyte induction studies in two stage method with NBM and followed by ODM (Fig. 2a–d). Induction with NBM stimulates the human CD34+ stem cells into neurospheres formation on day
Total mRNA was isolated from the both cultured human CD34+ stem cells and differentiated oligodendrocyte cells and presence of Olig2, CNPase, PDGFR␣ PLP1/DM20 (oligodendrocyte specific markers) mRNA were analyzed. The qPCR results indicated the high expression of oligodendrocyte markers Olig2 (60%), CNPase (71.25%), PDGFR␣ (82.5%) and PLP1/DM20 (30%) and GFAP (0%) in differentiated culture compared with control CD34+ culture. More than 85% of differentiated culture showed expression of oligspecific markers; Olig2, CNPase, PDGFR␣ and PLP1 (Fig. 3a and b). In these cells absence of GFAP expression indicated that no GFAP+ cells were observed. Further, FACS analysis revealed presence of only 4CD34+ cells/l in the differentiated culture (Fig. 3d). In the differentiated oligodendrocytes, very high CNPase activity was observed with almost no activity detected in the control CD34+ stem cells explains the presence of oligodendrocytes in the ODM (Fig. 3e). The comparative analysis of olig-specific markers proteolipid protein 1 which is expressing 2–3 folds lower in the differentiated culture suggests that the differentiated oligodendrocytes are at precursor stage and not terminally differentiated on day 9 in ODM. These results conclusively explain the successful differentiation of human CD34+ cells into oligodendrocyte precursors in the ODM.
Please cite this article in press as: K. Venkatesh, et al., In vitro transdifferentiation of human cultured CD34+ stem cells into oligodendrocyte precursors using thyroid hormones, Neurosci. Lett. (2014), http://dx.doi.org/10.1016/j.neulet.2014.12.050
202 203 204 205 206 207 208 209 210 211 212 213 214 215 216
217
218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239
G Model NSL 31018 1–6 4
ARTICLE IN PRESS K. Venkatesh et al. / Neuroscience Letters xxx (2014) xxx–xxx
Fig. 1. Immunophenotyping of CD34+ stem cells. (a) Monolayer culture of CD34+ stem cells, (b) immunocytochemical staining of CD34+ stem cells and, (c) flow cytometric analysis of cultured human CD34+ stem cells.
Fig. 2. Human CD34+ stem cells can be directed into Olig fate. (a) A schematic protocol for directed differentiation of human CD34+ stem cells into oligodendrocytes, (b) monolayer culture of CD34+ stem cells, (c) leishman staining of CD34+ stem cells, (d) SEM analysis of CD34+ stem cells, (e) neurospheres generation of HSCs upon induction with NBM medium on day 6, (f) leishman staining of neurospheres formed on day 6, (g) SEM analysis of neurospheres formed on day 6, (h) differentiation of oligodendrocytes from the neurospheres by inducing with ODM medium day 9 showing extensive foot processes, (i) Leishman staining oligodendrocyte precursor culture on day 9 and, (j) SEM examination of oligodendrocyte morphological structure with foot processes.
Please cite this article in press as: K. Venkatesh, et al., In vitro transdifferentiation of human cultured CD34+ stem cells into oligodendrocyte precursors using thyroid hormones, Neurosci. Lett. (2014), http://dx.doi.org/10.1016/j.neulet.2014.12.050
G Model NSL 31018 1–6
ARTICLE IN PRESS K. Venkatesh et al. / Neuroscience Letters xxx (2014) xxx–xxx
5
Fig. 3. Expression analysis of Olig-specific markers using Real-time PCR. (a) Percentage of cells expressing the oligodendrocyte specific markers (Olig2, CNPase, PDGFR␣ and PLP1) on time-course (DIV 0–9) dependent manner upon induction with ODM medium, (b) proportion of Olig2+ , CNPase+ , PDGFR␣+ PLP1+ cells in the differentiation culture at DIV 9, (c) immunocytochemical studies of HSC-derived oligodendrocytes, (d) flow cytometric analysis of CD34+ expression from the oligodendrocyte culture, (e) enzymatic activity of CNPase in differentiated oligodendrocyte culture from DIV0 to 9 in time dependent manner and showing decrement of CD34+ expression in the differentiate culture determined using flowcytometry.
Fig. 4. Schematic representation of remyelination programme by using oligodendrocyte transplantation therapy at damaged sites of spinal cord injuries and multiple sclerosis patients.
Please cite this article in press as: K. Venkatesh, et al., In vitro transdifferentiation of human cultured CD34+ stem cells into oligodendrocyte precursors using thyroid hormones, Neurosci. Lett. (2014), http://dx.doi.org/10.1016/j.neulet.2014.12.050
G Model NSL 31018 1–6
K. Venkatesh et al. / Neuroscience Letters xxx (2014) xxx–xxx
6 240
ARTICLE IN PRESS
4. Discussion
275
Human CD34+ cells have the ability to differentiate into all cell types of three germ layers when subjected to specified conditions [18]. Therefore, in the present study, differentiation of human CD34+ stem cells into oligodendrocytes was carried out in two steps; first by inducing with NBM and followed by ODM. In the NBM CD34+ cells differentiated only to become neurospheres (Figs. 1 and 2). At 40 ng/ml thyroxine, 40 ng/ml 3,3 ,5-tri-iodo-thyronine in ODM increased level of oligodendrocytes formation was observed (Table 1). TH binds to TR␣ and TR, and formed heterodimers bind at the site of regulatory regions of TH response elements (TREs). The morphological changes brought about by ODM were observed, subjecting the cultured cells to Leishman stain showed distinct stellate morphology with foot processes elucidates successful differentiation of human CD34+ stem cells into oligodendrocytes [19]. The SEM and immune reactivity results clearly showed formation of oligodendrocyte neural network with foot processes (Figs. 2 and 3) which is the key step in the axo-glial junction formation [20]. The high expression of Olig2, CNPase, PDGFR␣ PLP1/DM20 in differentiated oligodendrocytes compared to CD34+ stem cells in qPCR (Fig. 3a–d) conclusively accentuates the formation of oligodendrocytes from human CD34+ stem cells. Studies so far carried out only using embryonic stem cells and induced pluripotent stem cells, this is the first report wherein the differentiation capabilities of CD34+ stem cells into various types of glial cells is explained [11]. Formation of oligodendrocytes by gene suppression, knockout and from stem cells studies have accentuated the utility of these cells in the remyelination process at paranodal axo-glial junctions to improve conduction velocities [21–23] (Fig. 4) however, in all these studies either they used human embryonic stem cells or induced pluripotent stem cells which may be deleterious on transplantation due to their inheritant property of teratoma formation [24]. This study opens up possible use of autologous oligodendrocyte precursors generated from the patient’s stem cells in the remyelination of axons in various neurodegenerative diseases.
276
5. Conclusion
241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274
284
This study to the best of our knowledge is the first of its kind provides generation of definitive population of pure human oligodendrocytes from human CD34+ stem cells. Using such differentiated oligodendrocyte precursor cells in transplantation in the demyelinated lesions/scars may help in the remyelination which probably can aid in the regeneration of spinal nerves/neurons to correct various spinal cord injuries and neurological disorders.
285
Conflict of interest
277 278 279 280 281 282 283
286
287 288 289 290 291
None declared. Acknowledgment We acknowledge Sri Venkateswara Institute of Medical Sciences (SVIMS University) for providing facilities to carry out the work. This paper forms a part of Ph.D. thesis work going to be submitted to SVIMS University, Tirupati, Andhra Pradesh, India and G7 Synergon Pvt. Ltd. for helping in the FACS analysis.
References [1] P.D. Conrad, S.G. Emerson, Ex vivo expansion of hematopoietic cells from umbilical cord blood for clinical transplantation, J. Leukocyte Biol. 64 (1998) 147–155. [2] A.C. Drake, M. Khoury, I. Leskov, B.P. Iliopoulou, M. Fragoso, H. Lodish, et al., Human CD34+ CD133+ hematopoietic stem cells cultured with growth factors including Angptl5 efficiently engraft adult NOD-SCID Il2ry-/- (NSG) mice, PLoS One 6 (2011) e18382. [3] G.I. Nistor, M.O. Totoiu, N. Haque, M.K. Carpenter, H.S. Keirstead, Human embryonic stem cells differentiate into oligodendrocytes in high purity and myelinate after spinal cord transplantation, Glia 49 (2005) 385–396. [4] A.H. All, F.A. Bazley, S. Gupta, N. Pashai, C. Hu, A. Pourmorteza, et al., Human embryonic stem cell-derived oligodendrocyte progenitors aid in functional recovery of sensory pathways following contusive spinal cord injury, PLoS One 7 (2012) e47645. [5] N. Billon, Normal timing of oligodendrocyte development depends on thyroid hormone receptor alpha 1 (TRalpha1), EMBO J. 21 (2002) 6452–6460, http://dx.doi.org/10.1093/emboj/cdf662. [6] C.C. Thompson, Thyroid hormone action in neural development, Cereb. Cortex. 10 (2000) 939–945. [7] D. Karussis, I. Kassis, The potential use of stem cells in multiple sclerosis: an overview of the preclinical experience, Clin. Neurol. Neurosurg. 110 (2008) 889–896. [8] W.D. Richardson, Oligodendrocyte specification, in: L.R. Squire (Ed.), Encyclopedia of Neuroscience, Academic Press, Oxford, 2008, pp. 209–215. [9] A. Aschner, M.A. Philbert, Comprehensive toxicology, in: Glial Cells, second ed., Elsevier Press, 2010, pp. 199–219 (Chapter 13.12). [10] P.V.G.K. Sarma, G. Subramanyam, In vitro cardiogenesis can be initiated in human CD34+ cells, Indian Heart J. 60 (2008) 95–100. [11] K. Venkatesh, L. Srikanth, B. Vengamma, C. Chandrasekhar, A. Sanjeevkumar, B.C. Mouleshwara Prasad, et al., In vitro differentiation of cultured human CD34+ cells into astrocytes, Neurol. India 61 (2013) 383–388. [12] W. Strober, Trypan blue exclusion test of cell viability., Curr. Protoc. Immunol. Appendix 3 (2001) Appendix 3B. [13] J.J. Bozzola, Conventional specimen preparation techniques for scanning electron microscopy of biological specimens, Methods Mol. Biol. 1117 (2014) 133–150. [14] M. Myllykoski, P. Kursula, Expression, purification, and initial characterization of different domains of recombinant mouse 2 ,3 -cyclic nucleotide 3 -phosphodiesterase, an enigmatic enzyme from the myelin sheath, BMC Res. Notes 3 (2010) 12. [15] M.M. Bradford, A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding, Anal. Biochem. 72 (1976) 248–254. [16] S. Majumder, M. Ilayaraja, H.R. Seerapu, S. Sinha, J.H. Siamwala, S. Chatterjee, Chick embryo partial ischemia model: a new approach to study ischemia ex vivo, PLoS One 5 (2010) e10524. [17] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2(-delta delta C(T)) method, Methods 25 (2001) 402–408. [18] X. Jiang, T. Fujisaki, F. Nicolini, M. Berger, T. Holyoake, W. Eisterer, C. Eaves, A. Eaves, Autonomous multi-lineage differentiation in vitro of primitive CD34+ cells from patients with chronic myeloid leukemia, Leukemia 14 (2000) 1112–1121. [19] M. Bradl, H. Lassmann, Oligodendrocytes: biology and pathology, Acta Neuropathol. 119 (2010) 37–53. [20] D.L. Sherman, P.J. Brophy, Mechanisms of axon ensheathment and myelin growth, Nat. Rev. Neurosci. 6 (2005) 683–690. [21] H.S. Keirstead, G. Nistor, G. Bernal, M. Totoiu, F. Cloutier, K. Sharp, et al., Human embryonic stem cell-derived oligodendrocyte progenitor cell transplants remyelinate and restore locomotion after spinal cord injury, J. Neurosci. 25 (2005) 4694–4705. [22] C.L. Kerr, B.S. Letzen, C.M. Hill, G. Agrawal, N.V. Thakor, J.L. Sterneckert, et al., Efficient differentiation of human embryonic stem cells into oligodendrocyte progenitors for application in a rat contusion model of spinal cord injury, Int. J. Neurosci. 120 (2010) 305–313. [23] W. Yin, B. Hu, Knockdown of Lingo1b protein promotes myelination and oligodendrocyte differentiation in zebrafish, Exp. Neurol. 251 (2014) 72–83. [24] T.A. Prokhorova, L.M. Harkness, U. Frandsen, N. Ditzel, H.D. Schrøder, J.S. Burns, et al., Teratoma formation by human embryonic stem cells is site dependent and enhanced by the presence of Matrigel, Stem Cells Dev. 18 (2009) 47–54.
Please cite this article in press as: K. Venkatesh, et al., In vitro transdifferentiation of human cultured CD34+ stem cells into oligodendrocyte precursors using thyroid hormones, Neurosci. Lett. (2014), http://dx.doi.org/10.1016/j.neulet.2014.12.050
292
293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363