In vivo electroporation for genetic manipulations of whole Hydra polyps

C Blackwell Verlag 2002

Differentiation (2002) 70:140–147

Thomas C. G. Bosch ¡ Rene´ Augustin ¡ Klaus Gellner Konstantin Khalturin ¡ Jan U. Lohmann

In vivo electroporation for genetic manipulations of whole Hydra polyps

Accepted in revised form: 12 February 2002

Abstract In vivo electroporation is used to study gene regulation and gene function in the freshwater polyp Hydra. Although this approach has been used successfully by several investigators, efficacy and handling continue to present a problem. Here we show technical aspects of in vivo electroporation for introducing fluorescent dyes, plasmid DNA and double stranded RNA into Hydra polyps. We describe the fundamentals of the electroporation delivery system, discuss recent studies where this approach has been used successfully, compare it to alternative transfection methods such as lipofection, and identify future directions. Key words Hydra ¡ gene transfer ¡ electroporation ¡ lipofection ¡ double-stranded RNA mediated interference (RNAi)

Introduction Hydra has long served as a model system to address developmental questions because of its tissue simplicity, continuous capacity for de novo pattern formation, and accessibility for a variety of experimental analyses at the tissue, cell, and molecular level (reviewed in Bosch, 1998). With the recent interest to understand the evolutionary origin of genetic mechanisms regulating embryonic development, Hydra became an attractive model

✉

T. C. G. Bosch ( ) ¡ R. Augustin ¡ K. Khalturin Zoological Institute, Christian-Albrechts-University, Olshausenstrasse 40, 24098 Kiel, Germany e-mail: tbosch/zoologie.uni.kiel.de Tel: π49 431 880 4169, Fax: π49 431 880 4747 K. Gellner Epidauros Biotechnologie AG, Bernried, Germany J. U. Lohmann The Salk Institute for Biological Studies La Jolla, USA U. S. Copyright Clearance Center Code Statement:

to trace the evolution of development. More than 100 genes have been identified from Hydra, and well over 80 have been isolated and characterized. Most are homologues of genes found in bilaterians, while several appear to be unique to Hydra (reviewed in Galliot, 2000; Bosch and Khalturin, 2002). The homologues include transcription factors, receptors, signal transduction components, cell cycle genes, and caspases. Their characterization has shown that the molecular basis of developmental processes is highly conserved from Hydra to higher metazoans. Furthermore, it has emerged that most of the molecules controlling pattern formation in Hydra are localized in epithelial cells (Bosch, 1998). To study the function of Hydra genes several methods have been developed. Four approaches prevail: (1) Many of the hydra genes studied have simple expression patterns and their RNAs localize to a particular region of the adult. These expression patterns can be used to draw first conclusions about the role of a gene during patterning and cell differentiation. (2) More precise indications of gene function can be obtained by comparing expression patterns in wild type and mutant polyps that have altered development. A prominent example is the reg16 mutant of Hydra magnipapillata, which has a strongly reduced potential for head regeneration (Sugiyama and Fujisawa, 1977). For instance, it has been established that the peptide encoding gene HEADY is intimately connected with head induction since expression of the gene is activated after decapitation in wild-type, but not induced in decapitated reg16 polyps (Lohmann and Bosch, 2000). (3) The role of Hydra genes as carriers, transducers, or targets of positional information can be tested by treating polyps with chemicals known to increase or decrease the positional value of the tissue. For example, the formation of ectopic tentacles and complete heads along the body column (high positional value) can be induced by treating animals with diacylglycerol or PKC activators (Mueller, 1989; Hassel, 1998),

0301–4681/2002/7004–140 $ 15.00/0

141

while ectopic feet (low positional value) can be induced by treatment with LiCl (Hassel and Berking, 1990). If genes are involved in or dependent on the positional signaling system, their expression pattern will follow the changes in the positional value of the tissue. Examples of this sort of functional analysis include the tentacle gene ks1 (Weinziger et al., 1994), the Hydra brachyury homologue HyBra1 (Technau and Bode, 1999), and the goosecoid homologue Cngsc (Broun et al., 1999). (4) Finally, for directly testing the evolutionary conservation of their function, Hydra genes can be introduced to a number of invertebrate (e.g. Drosophila) and vertebrate (e.g. Xenopus) embryos. For example, Cngsc and HybCat have been shown to induce a second axis when injected into the ventral side of Xenopus embryos (Broun et al., 1999; Hobmayer et al., 2000). Similarly, Cnash, a hydra member of the achaete – scute class of bHLH genes, will rescue a Drosophila mutant lacking both achaete and scute (Grens et al., 1995). Despite these efforts, however, there are limitations to the functional analysis of genes in Hydra. A difficulty is, for example, that methods for targeted mutagenesis and transgenic studies are not available yet. Recently, in vivo electroporation, a new approach to manipulate gene expression and analyzing the subsequent effects on developmental pathways in Hydra has been successfully used. Electroporation involves the application of short-duration (10 ms–100 msec) high intensity electric field pulses (50 – 1500 V/cm), traditionally between two plate electrodes in an electroporation cuvette. Large external electric fields induce high transmembrane potentials, leading to the formation of minute pores (20 – 120 nm diameter) and permeabilization of the cell membrane (Neumann et al., 1999). During the electric pulse, charged macromolecules, including DNA, are actively transported across the cell membrane by electrophoresis through these pores (Neumann et al., 1996). Noncharged molecules can also enter through the pores by passive diffusion (Neumann et al., 1998). Upon pulse termination, pores reseal within milliseconds (Ho and Mittal, 1996). Electroporation now is a widespread means of introducing macromolecules including DNA, RNA, dyes, and proteins into cells (Neumann et al., 1999). The application of electroporation to whole Hydra polyps was made feasible by modifying the parameters used for electroporating tissue culture cells. It has been successfully used to deliver plasmid DNA, modified antisense oligonucleotides, and double stranded RNA (dsRNA) into living Hydra polyps. The first published account of use of electroporation for gene delivery into Hydra tissue was a study directed at elucidating the heat shock response. Plasmid DNA containing the luciferase gene under control of the Hydra hsp70 heat shock promoter was transfected into polyps of two different Hydra species, and the activity of the reporter gene was assayed (Brennecke et al., 1998). Subsequently, similar electroporation procedures have been used by several in-

vestigators to introduce double-stranded RNA (Lohmann et al., 1999; Lohmann and Bosch, 2000; Smith et al., 2000) or modified antisense oligonucleotides (Leontovich et al., 2000; Yan et al., 2000) into whole polyps. Despite the potential of this novel technology, efficacy, cytotoxic complications, and handling of electroporated polyps continue to present a problem. Here we report a method for pulse-mediated delivery of macromolecules including plasmid DNA and dsRNA into cells of whole Hydra polyps which is simple, robust, and generally applicable. Potential advantages and drawbacks of this technology are discussed and compared to alternative transfection methods.

Methods Animals Hydra magnipapillata polyps were cultured according to standard procedures at 18 æC in hydra medium (1 mM CaCl2, 0.1 mM MgCl2, 0.1 mM KCl, 1 mM NaH2CO3, pH 7.8). Fluorescent dyes To visualize uptake of macromolecules by Hydra cells, polyps were electroporated with fluorescein dextran (Sigma, 70 000 MW) at a concentration of 2 mM in Hydra medium. Plasmids and production of dsRNA For plasmid transfection, two promoter fusion vectors have been used. Plasmid phsp70Luc containing the Hydra magnipapillata hsp70 promoter and the firefly luciferase gene has been described previously (Brennecke et al., 1998). PCR amplification of the promoter – reporter gene construct (see Fig. 3A) was performed using oligonucleotide hsp70Prom1 (TCCCGGATCCAAGCTTGCTAATTTTCTA) and LUC1 (CTTCATAGCCTTATGCA). For lipofection, plasmid pactLuc was used containing the firefly luciferase gene driven by a Hydra vulgaris actin promoter (kindly provided by Dr. Hans Bode, Irvine). PCR amplification of the luciferase sequence was performed as described previously (Brennecke et al., 1998). Plasmids were propagated in E. coli strain DH5a and purified on endotoxin-free Qiagen columns (Qiagen, Chatsworth, CA). For transfection of double stranded RNA, a DNA template was generated by PCR using the T3 and T7 primers and a vector containing the ks1 coding region. After gel purification, sense and antisense RNA were produced from the PCR template by in vitro transcription and annealed as described (Lohmann et al., 1999). In vivo electroporation Whole polyps were pulsed with a Bio-Rad Gene PulserTM (BioRad). 20 polyps were placed in chilled electroporation cuvettes with 0.2 or 0.4 cm gap. Electroporation was carried out as described below in either Hydra medium (supercoiled plasmid DNA) or 200 ml DEPC-H2O (dsRNA). Immediately after electroporation, the polyps were transferred into 10 ml of Hydra medium which was supplemented with 20 % hyperosmotic dissociation medium (pH 6.9) containing 6 mM CaCl2, 1.2 mM MgSO4, 3.6 mM KCl, 12.5 mM N-tris [hydroxymethyl]methyl-2aminoethanesulfonic acid (TES), 6 mM sodium pyruvate, 6 mM sodium citrate, 6 mM glucose, and 50 mg/ml rifampicin (Gierer et al., 1972). 24 hours after electroporation the medium was exchanged for standard hydra medium.

142 Lipofection of single cells Lipofection of reporter gene constructs was performed using the cationic lipopolyamide TransfectamTM (Promega) according to manufacturer’s instructions with minor modifications. Briefly, 20 mg of plasmid pactLuc DNA containing the Hydra vulgaris actin promotor fused to the luciferase reporter gene was resuspended in 20 ml H2O and mixed with 40 ml TransfectamTM. After 5 – 15 minutes of incubation at room temperature in order to allow DNAlipid complexation, the mixture was kept on ice. Following dissociation of polyps according to standard procedure (Gierer et al., 1972), the lipoplexes were added to the cells (2 ¿ 106 cells / ml) and allowed to incubate for 3 h at 21 æ C under constant shaking. After lipofection, cells were reaggregated by centrifugation as described (Gierer et al., 1972). Molecular techniques Nucleic acid isolation was carried out following standard procedures. PCR amplification of the genomic Hydra magnipapillata hsp70 sequence was performed using oligonucleotides hsp70C114 (TCATTCTACCCAGAGGA) and hsp70N16 (CTGCAGGAAATCTTCACCGCCAAG). The PCR was performed in a 50 ml reaction (1xTaq polymerase buffer (BRL/Gibco), 400 mM of each ndNTP, and 1 U Taq polymerase (BRL/Gibco). Amplification conditions were 25 – 30 cycles at 94 æC for 15 sec, 50 æC for 30 sec, 72 æC for 90 sec and 72 æC for 15 min. The PCR products were assayed by agarose gel electrophoresis. Quantification of the amount of cDNA present was done by using primers act34 (AAGCTCTTCCCTCGAGAAATC) and act35 (CAAAATAGATCCTCCGATCC) directed to Hydra actin sequences (Fisher and Bode, 1989).

Results and Discussion Principles of in vivo electroporation of Hydra polyps To develop an in vivo electroporation system for Hydra polyps, the first key issue we addressed was to determine whether a large fluorescent dye, such as FITC dextran70000, can be delivered into cells within intact Hydra tissue. The ability to directly visualize fluorescent dyes is of great use to evaluate pulse-efficacy when setting up an in vivo electroporation system. Once the parameters are optimized for the fluorescent dyes, they can then be easily modified for use with plasmid DNA or RNA. Using the Bio-Rad Gene PulserTM set to 25 mF and 250 V, whole polyps were pulsed as schematically shown in Figure 1A. 20 polyps were chilled to 4 æC for 1 h and then placed in 200 ml ice-cold hydra medium containing 2mM fluorescently (FITC) labeled dextran-70000 in a plastic cuvette of 0.2 cm gap. One pulse was applied which lasted 4 msec. Figure 1B and C show that 2 days after electroporation many ectodermal epithelial cells contain the tracer dye. FITC-dextran is localized uniformly along the whole body column demonstrating that electroporation delivers macromolecules into Hydra cells, regardless of the tissue position. Ectodermal epithelial cells appear to be completely filled with the marker molecule (Fig. 1B and C), while soaking of pol-

Fig. 1 In vivo electroporation technique for delivery of macromolecules including tracer dyes, plasmids and RNA in Hydra polyps. (A) Schematic illustration of the experimental setup. Electrodes ( π, ª) are part of the electroporation cuvette. (B) and (C), Fluorescence images of polyps 2 days after electroporation of FITC dextran-70000. The dye is localized to ectodermal epithelial cells. (D) In the absence of an electric pulse, no dye is transferred to cells.

yps in FITC dextran without applying a voltage pulse does not result in uptake of the dye (Fig. 1D). The macromolecules can be detected in hydra polyps for at least 7 days after electroporation. These initial experiments indicated that a single pulse was effective to deliver FITC dextran to a large number of epithelial cells in intact Hydra tissue. To ensure sufficient delivery of the effector molecule, the electroporation parameters field strength (kV/cm),

143

Fig. 2 Optimization of in vivo electroporation parameters in Hydra polyps. Survival of polyps after electric pulses in electroporation cuvettes with 0.2 cm gap.

capacitance (mF), and resistance (W) as well as the number of pulses applied need to be adjusted for each individual application. Electroporating mammalian cells indicated that delivery of macromolecules is most successful if 30 to 50 % of cells do not survive the pulse (Chu et al., 1987) and the electric field strength is above 1 kV/ cm (Shigekawa and Dower, 1988). To optimize electroporation conditions for Hydra polyps, we first analyzed the effect of voltage setting and number of pulses on the uptake of fluorescent dextran. We observed an increase of dye uptake with increasing voltage up to 250 V. Administration of over 300 V resulted in a marked decrease of dye transfer and cell damage. Furthermore, we found that a sequence of three to five individual pulses with an interval of ⬵ 1 sec was not more effective in FITC dextran delivery than a single pulse but resulted in severe tissue damage. To further enhance efficacy of the electroporation procedure, we assessed the survival rate of polyps under capacitance settings of 3, 25, 125, 500 and 960 mFd, combined with different voltages. Figure 2 indicates that for obtaining an electric field strength greater than 1 kV/ cm and more than 50 % survival of polyps, the electroporator had to be set to 25 mFd and 250 V. Under these conditions, one pulse lasted for about 4 msec. Changes in the electroporation conditions such as the solution used to deliver the macromolecules or the gap distances of the cuvettes strongly affect the percentage of surviving polyps and call for adjustment of the parameters discussed above.

Electroporation of single Hydra cells Intact polyps can be dissociated into single cells and kept in suspension for several hours. When reaggregated

by centrifugation these cells regenerate into intact polyps within a few days by de novo axis formation (Gierer et al., 1972). To examine whether macromolecules can be delivered not only to cells within intact tissue but also to single cells, polyps were dissociated according to standard conditions. Single cells were submitted to various electroporation conditions in the presence or absence of FITC dextran. To assay the transfer of the dye and to examine cell damage, the cells were examined under the fluorescence microscope 2 hours after the electric pulse and before reaggregation. About 50 % of the single cells, both from the epithelial and the interstitial cell lineage, were stained. No obvious differences could be observed in cell shape and structure when compared to control cells. However, in contrast to control cells, electroporated cells could not be reaggregated and, therefore, did not regenerate into intact tissue. This was independent of the presence of FITC dextran (Gellner and Bosch, personal observation). Although the molecular basis of this phenomenon is not known, it appears that cell damage caused by electroporation is too extensive for reaggregation to occur. We show below (Fig. 4) that an alternative delivery system, lipofection, can be used to transfer reporter gene constructs into single hydra cells.

Electrotransfer of promotor fusion vectors into Hydra To study the activity of regulatory DNA regions in Hydra, promotor fusion vectors need to be delivered into cells. Once we had shown that macromolecules could be transferred to Hydra polyps by electroporation (Fig. 1), the next step, therefore, was to examine the delivery of a vector containing a transcriptional fusion of the Hydra magnipapillata hsp70 promoter and the firefly luciferase coding sequence (Fig. 3A). After electroporation, we isolated genomic DNA and assayed for the presence of the plasmid by PCR (Fig. 3B). As shown in Figure 3C, the fusion vector is detectable at least up to 5 days after electroporation. The PCR signal decreases in intensity over time, probably due to tissue turnover. Similar experiments with another plasmid containing the human EF1a promotor fused to firefly luciferase indicated the presence of intact plasmid DNA even 10 days after electroporation (data not shown). These results demonstrate that plasmid DNA can efficiently be delivered into Hydra polyps by electroporation and that the foreign DNA is transiently maintained within the cells for at least one week with unaffected integrity. We subsequently adapted this approach for use in a transient expression system for directly studying promotor activity in Hydra. As described by Brennecke et al. in 1998, this system was successfully applied to determine promotor activity of heat shock genes in several Hydra species. By analyzing luciferase expression under the controll of hsp70 regulatory regions, we have found that the reduced stress tolerance of Hydra oligactis is not due

144 Fig. 3 Gene transfer to living Hydra polyps using in vivo electroporation. (A) Schematic representation of the promotor fusion vectors used in this study. Hydra ghsp70, genomic structure of the Hydra hsp70 gene. Arrows indicate annealing sites for sequence specific primers C114 and N16. phsp70LUC, luciferase expression vector containing Hydra magnipapillata hsp70 upstream flanking sequence fused to firefly luciferase gene. Arrows indicate annealing sites for primers Prom1 and LUC1. (B) Outline of experimental procedure of gene transfection by electroporation and assay of persistence of intact plasmid DNA by PCR using genomic DNA as template. (C) Persistence of promotor fusion vector in Hydra cells several days after electroporation. The promotor fusion vector specific PCR product of 600 bp is detectable in polyps at least up to 5 days post electroporation.

to reduced promotor activity but to reduced stability of hsp70 mRNA (Brennecke et al., 1998). Since reporter enzyme activity in Hydra was below detection limits of conventional methods, until recently reporter gene activity could only be evaluated at the transcriptional level by using reverse-transcription-PCR with reporter gene specific primers (Brennecke et al., 1998). Recently, however, investigators at the University of Geneva made a big step towards the direct detection of reporter gene products. By coupling injection of a plasmid encoding enhanced green fluorescent protein

(GFP) into the gastric cavity of intact Hydra polyps with electroporation, they succeeded to observe strong GFP activity in numerous cells of the endoderm after pulsing of the animals (Miljkovic and Galliot, pers. communication).

Lipid-mediated gene transfection into single Hydra cells Since electroporation could not be used to transfer reporter gene constructs into single Hydra cells, we

145 Fig. 4 Lipid-mediated gene transfection into single Hydra cells. (A) Outline of the experimental procedure of tissue dissociation and gene transfection by lipofection. (B) Comparison of luciferase expression in electroporated polyps (E) and lipofected cells (L) four days after transfection. Simultaneously to the detection of luciferase derived mRNA (white arrowhead) by reversetranscription PCR using 22– 27 cycles as described in Methods actin mRNA (grey arrowhead) was determined to quantify the amount of cDNA present. (C) Persistence of luciferase expression in aggregates produced from single Hydra vulgaris cells. The luciferase specific amplification product is detectable by reverse-transcription PCR (30 cycles) at least up to 7 days after lipofection.

looked for alternative transfection methods and tested several lipofection reagents. Best results were obtained with the TransfectamTM (Behr et al., 1989) reagent. Single Hydra cells were incubated for 3 hours in a solution containing the promotor fusion vector pactLuc (see Methods) and TransfectamTM. As shown schematically in Figure 4A, cells subsequently were reaggregated by centrifugation. In contrast to electroporated cells, lipofected cell pellets regenerated into complete polyps within few days. Promotor driven transcription of the reporter gene was assayed as described (Brennecke et al., 1998) by reverse-transcription PCR and luciferase-specific primers. In mRNA from lipofected cell aggregates a luciferase – specific amplification product could be observed four days after transfection (Fig. 4B). In comparison to RNA from electroporated polyps (E in Fig. 4B), signal intensity was much stronger indicating that lipid-based transfection not only offers a means for gene delivery into single Hydra cells but also can lead to extensive expression of foreign genes by Hydra cells. As shown in Fig. 4C, luciferase transcripts could be detected for

more than 7 days after reaggregation. Thus, gene transfer efficiency of in vivo lipofection of single cells appears to be equivalent to or even superior to that of in vivo electroporation of intact polyps.

Transfer of dsRNA in whole polyps by in vivo electroporation For understanding the roles of developmental genes, functional genetic tests are indispensable. We previously have reported that in vivo electroporation can be used to introduce double-stranded RNA (dsRNA) into Hydra tissue to selectively disrupt the activity of a number of developmentally regulated genes (Lohmann et al., 1999; Lohmann and Bosch, 2000). Crucial for the success of the approach is the successful delivery and the quality of the dsRNA introduced. Below, we briefly summarize the delivery system and discuss results obtained by other investigators who have modified this approach to deliver dsRNA to precise regions along the Hydra body column by localized electroporation (LEP).

146

For transfection of dsRNA in whole polyps, electroporation is carried out by placing polyps in 200 ml DEPC-H2O containing 10 mg dsRNA in chilled electroporation cuvettes with 0.4 cm gap. To minimize the possibility of degradation, dsRNA is added to the polyps just before electroporation. Whole polyps are pulsed with a Bio-Rad Gene PulserTM (Bio-Rad) adjusted to 250 V and 25 mF capacitance, resulting in an electric field strength of 0.95 kV/cm and 7–9 ms pulse-duration. Effects of gene silencing were examined 4 to 6 days after electroporation. Using this procedure, electrotransfer of dsRNA corresponding to the head specific gene ks1 caused strong depletion of ks1 transcripts (Lohmann et al., 1999). ks1 loss-of-function polyps exhibited severe defects in head formation indicating an important role of ks1 in Hydra head development. Using the same experimental approach, efficient gene silencing has also been achieved after introduction of dsRNA corresponding to the peptide encoding gene Heady (Lohmann and Bosch, 2000).

Transfer of dsRNA in localized region of the polyp using local electroporation (LEP) While electroporation in general is a promising delivery technique, precise targeting is not feasible using the traditional, large electrodes. To localize transfection and target dsRNA molecules to a smaller population of cells or distinct tissues within the animal, Bode and coworkers (Smith et al., 2000) recently made use of a micropipette electroporation technique, termed local electroporation (LEP). By targeting dsRNA to the bud region of Hydra, selected developmental genes have been silenced in this tissue using LEP. Typically, a micropipette is placed against the body column tissue surrounding the bud. One electrode is threaded through the micropipette into the dsRNA solution at the tip of the micropipette, while the second electrode is inserted into the hydra medium surrounding the polyp (Smith et al., 2000). Using the BioRad Gene Pulser with a Capacitance Extender, dsRNA was delivered into the bud tissue using conditions of 100 V and 250 mFd. Silencing of the HyAlx gene in the developing bud caused a significant delay in tentacle formation (Smith et al., 2000). In another example, the localized electroporation strategy was recently used to introduce dsRNA corresponding to peptide encoding gene Hym-301 (Bode, pers. communication). LEP has also been used in Hydra to deliver modified antisense oligonucleotides to a matrix metalloproteinase into the endoderm (Leontovich et al., 2000; Yan et al., 2000). The main advantage of local electroporation compared to electroporation of whole polyps is the ability to target macromolecules such plasmid DNA, antisense oligonucleotides, fluorescent dyes and drugs to distinct tissue regions along the body column. In addition to its versatility, this micropipette approach

appears to cause much less tissue damage than whole polyp electroporation.

Damage induced by electroporation As discussed above, the quantity of macromolecules introduced into a cell by electroporation is correlated to the field strength (Neumann et al., 1999). As the voltage applied to the sample chamber increases, the number of cells surviving the electric pulse decreases (Knutson and Yee, 1987). Thus, effective electroporation parameters must balance the requirements for temporary pore formation against the damaging effects of strong electric fields. To minimize cell damage and facilitate polyp survival after electroporation, we pre-chilled polyps to 4 æC before pulsing them in chilled solution and chilled cuvettes. After the electric pulse polyps are immediately transferred into 10 ml of chilled hydra medium which is supplemented with 20 % hyperosmotic dissociation medium (see Methods). To facilitate recovery, polyps are kept at 10 æC for up to three days. 24 h after electroporation the medium is exchanged for standard hydra medium. In contrast to other animal model systems, the damage caused by the electric pulses may be of minor importance in Hydra due to the remarkable regeneration capacity of the polyps.

Future directions and challenges Reliable DNA vector and RNA transfer techniques are prerequisite for genetic studies. As shown above, electroporation is an effective method for introducing DNA and RNA into Hydra polyps. Alternative gene delivery systems such as retroviral-mediated gene transfer (Bode, pers. communication), Ca phosphat precipitation (Gellner and Bosch, unpublished), or the biolistic approach, where gold particles coated with plasmid DNA are shot into Hydra tissue (David, pers. communication), have been tried but, so far, without proven success. Electroporation has many advantages over the more common transfection methods. It lacks the potentially toxic effects of viruses and the intense physical damage produced by biolistic gene gun technology. In contrast to viruses, which are often limited by species specific infection, electroporation seems generally applicable to all species and strains of Hydra. However, electroporation still causes substantial tissue damage and requires researchers to retune the experimental parameters to suit their application. The availability of a reliable protocol for in vivo electroporation of macromolecules into Hydra cells in conjunction with LEP opens the potential for new applications in drug delivery to distinct cell populations, gene transfer to the nucleus, the ability to manipulate the intercellular environment, apoptosis induction, and the

147

potential to modify intracellular structures. Local electroporation in principle also allows coelectroporation of two plasmids. Since coexpression of multiple genes is often required to study the interaction of multiple proteins, this would allow unprecedented spatial and temporal control over gene delivery and protein expression in Hydra. In conclusion, in vivo electroporation is a highly efficient and simple method for gene transfer and manipulation of gene expression in Hydra. Acknowledgements We thank Drs. Brigitte Galliot (Geneva) and Hans Bode (Irvine) for sharing unpublished results and expertise regarding the instrumentation used for in vivo electroporation of polyps. The work in the laboratory is supported by grants from the Deutsche Forschungsgemeinschaft (DFG) (to T.C.G.B.). K.K. was supported by a graduate fellowship from the DAAD.

References Behr, J.P., Demeneix, B., Loeffler, J.P. and Mutul, J.P. (1989) Efficient gene transfer into mammalian primary endocrine cells with lipopolyamide-coated DNA. Proc Natl Acad Sci USA 86:6982–6986. Bosch, T.C.G. (1998) ‘‘Hydra’’. In: Ferretti, P. and Ge´raudie, J. (eds) Cellular and molecular basis of regeneration: from invertebrates to humans. Wiley & Sons Ltd., Sussex. ISBN 047197271-1, pp 111–134. Bosch, T.C.G. and Khalturin, K. (2002) Patterning and cell differentiation in Hydra: novel genes and the limits to conservation. Can J Zoology (in press). Brennecke, T., Gellner, K. and Bosch, T.C.G. (1998) The lack of a stress response in Hydra oligactis is due to reduced hsp70 mRNA stability. Eur J Biochem 255:703–70. .Broun, M., Sokol, S. and Bode, H. (1999) Cngsc, a homologue of goosecoid, participates in the patterning of the head, is expressed in the organizer region of Hydra. Development 126:5245–5254. Chu, G., Hayakawa, H. and Berg, P. (1987) Electroporation for the efficient transfection of mammalian cells with DNA. Nucleic Acid Res 15:1311–1325. Fisher, D.A. and Bode, H.R. (1989) Nucleotide sequence of an actin-encoding gene from Hydra attenuata: structural characteristics and evolutionary implications. Gene 84:55–64. Galliot, B. (2000) Conserved and divergent genes in apex and axis development of cnidarians. Current Opinion in Genetics & Development 10:629–637. Gierer, A., Berking, S., Bode, H., David, C.N., Flick, K., Hansmann, G., Schaller, H. and Trenkner, E. (1972) Regeneration of hydra from reaggregated cells. Nat New Biol 239:98–101. Grens, A., Mason, E., Marsh, J.L. and Bode, H.R. (1995) Evolutionary conservation of a cell fate specification gene: the Hydra achaete-scute homolog has proneural activity in Drosophila. Development 121:4027–4035.

Hassel, M. (1998) Upregulation of a Hydra vulgaris cPKC gene is tightly coupled to the differentiation of head structures. Dev Genes Evolution 207:489–501. Hassel, M. and Berking, S. (1990) Lithium ions interfere with pattern control in Hydra vulgaris. Roux’s Arch Dev Biol 198:382– 388. Ho, S.Y. and Mittal, G.S. (1996) Electroporation of cell membranes: a review. Crit Rev Biotechnol 16:349–362. Hobmayer, B., Rentzsch, F., Kuhn, K., Happel, C.M., Cramer von Laue, C., Snyder, P., Rothbächer, U. and Holstein, T.W. (2000) WNT signalling molecules act in axis formation in the diploblastic metazoan Hydra. Nature 407:186–189. Knutson, J.C. and Yee, D. (1987) Electroporation: Parameters affecting transfer of DNA into mammalian cells. Anal Biochem 164:44–52. Leontovich, A.A., Zhang, J., Shimokawa, K., Nagase, H. and Sarras, M.P. (2000) A novel hydra matrix metalloproteinase (HHMP) functions in extracellular matrix degradation, morphogenesis and the maintenance of differentiated cells in the foot process. Development 127:907–920. Lohmann, J.U. and Bosch, T.C.G. (2000) The novel peptide HEADY specifies apical fate in a simple, radially symmetric metazoan. Genes and Development 14:2771–2777. Lohmann, J.U., Endl, I. and Bosch, T.C.G. (1999) Silencing of developmental genes in Hydra. Developmental Biology 214:211– 214. Müller, W.A. (1989) Diacylglycerol-induced multihead formation in Hydra. Development 105:309–316. Neumann, E., Kakorin, S. and Toensing, K. (1999) Fundamentals of electroporative delivery of drugs and genes. Bioelectrochem Bioenerg 48:3–16. Neumann, E., Kakorin, S., Tsoneva, I., Nikolova, B. and Tomov, T. (1996) Calcium-mediated DNA adsorption to yeast cells and kinetics of cell transformation by electroporation. Biophys J 71:868–877. Neumann, E., Toensing, K., Kakorin, S., Budde, P. and Frey, J. (1998) Mechanism of electroporative dye uptake by mouse B cells. Biophys J 74:98–108. Shigekawa, K. and Dower, W.J. (1988) Electroporation of eukaryotes and prokaryotes: a general approach to the introduction of macromolecules into cells. BioTechniques 6:742–750. Smith, K.M., Gee, L. and Bode, H.R. (2000) HyAlx, an aristalessrelated gene, is involved in tentacle formation in hydra. Development 127:4743–4752. Sugiyama, T. and Fujisawa, T. (1977) Genetic analysis of developmental mechanisms in hydra. Sexual reproduction of Hydra magnipapillata and isolation of mutants. Dev Growth Differ 19:187–200. Technau, U. and Bode, H.R. (1999) HyBra1, a brachyury homologue, acts during head formation in Hydra. Development 126:999–1010. Weinziger, R., Salgado, L.M., David, C.N. and Bosch, T.C.G. (1994) Ks1, an epithelial cell specific gene, responds to early signals of head formation in Hydra. Development 120:2511–2517. Yan, L., Fei, K., Zhang, J., Dexter, S. and Sarras, M.P. (2000) Identification and characterization of hydra metalloproteinase 2 (HMP2): a meprin-like astacin metalloproteinase that functions in foot morphogenesis. Development 127:129–141.