In vivo modified organic matrix for testing biomineralization-related protein functions in differentiated Dictyostelium on calcite

Journal of Structural Biology xxx (2016) xxx–xxx

Contents lists available at ScienceDirect

Journal of Structural Biology journal homepage: www.elsevier.com/locate/yjsbi

In vivo modified organic matrix for testing biomineralization-related protein functions in differentiated Dictyostelium on calcite Magdalena Eder 1,2, Marcus Koch 1, Christina Muth, Angela Rutz, Ingrid M. Weiss ⇑ INM – Leibniz Institute for New Materials, Campus D2.2, 66123 Saarbrücken, Germany

a r t i c l e

i n f o

Article history: Received 28 January 2016 Received in revised form 29 February 2016 Accepted 15 March 2016 Available online xxxx Keywords: Biomineralization Dictyostelium Ax3-Orf+ Extracellular matrix ECM Perlucin OC-17 n16 GFP

a b s t r a c t This work reports an in vivo approach for identifying the function of biomineralization-related proteins. Synthetic sequences of n16N, OC-17 and perlucin with signal peptides are produced in a novel Gateway expression system for Dictyostelium under the control of the [ecmB] promoter. A fast and easy scanning electron microscopic screening method was used to differentiate on the colony level between interplay effects of the proteins expressed in the extracellular matrix (ECM). Transformed Dictyostelium, which migrated as multicellular colonies on calcite crystals and left their ECM remnants on the surface were investigated also by energy-dispersive X-ray spectroscopy (EDX). Calcium minerals with and without phosphorous accumulated very frequently within the matrix of the Dictyostelium colonies when grown on calcite. Magnesium containing phosphorous granules were observed when colonies were exposed on silica. The absence of calcium EDX signals in these cases suggests that the external calcite crystals but not living cells represent the major source of calcium in the ECM. Several features of the system provide first evidence that each protein influences the properties of the matrix in a characteristic mode. Colonies transformed with perlucin produced a matrix with cracks on the length scale of a few microns throughout the matrix patch. For colonies with OC-17, almost no cracks were observed, regardless of the length scale. The non-transformed Dictyostelium (Ax3-Orf+) produced larger cracks. The strategy presented here develops the first step toward an efficient eukaryotic screening system for the combinatorial functionalization of materials by bioengineering in close analogy to natural biomineralization concepts. Ó 2016 Elsevier Inc. All rights reserved.

1. Introduction Organisms from all kingdoms of live are, in principle, capable to perform biomineralization (Dove et al., 2003). It remains, however, unclear why a number of organisms developed strategies to prevent the mineralization of their extracellular matrix (ECM). One prominent example is Dictyostelium discoideum (Annesley and Fisher, 2009; Raper, 1984; Raper and Fennell, 1952), a slime mold with a relatively primitive signaling system, though still capable to form multicellular aggregates with a defined morphology based on an extracellular support matrix made of cellulose (Bonner and Savage, 1947; Raper and Fennell, 1952). Sophisticated mineralized support matrices produced by various multicellular organisms may require the evolution of control mechanisms to guide and fine-tune mineral precipitation by a concerted interaction of proteins and ⇑ Corresponding author. E-mail address: [email protected] (I.M. Weiss). Both authors contributed equally to this work. Present address: Carl Zeiss AG, Carl-Zeiss-Straße 22, 73447 Oberkochen, Germany. 1 2

carbohydrates (Ashby, 2008; Weiss, 2012; Weiss and Marin, 2008). Few decades ago, it turned out that many different proteins are involved in biomineralization processes (Dauphin, 2001; Mann et al., 2012; Marin et al., 2007; Weiner and Traub, 1984). However, it still remains unclear how all these particularly different proteins synergisticly interact with each other, with minerals, and with cells. In a sense, ‘‘synergisticly” implies that multiple and complex interactions finally lead to a material with a genetically encoded structure. This challenged us to explore the extent to which one can ‘‘teach” Dictyostelium how to mineralize its ECM. Different stages in the formation of a mineral phase can be distinguished (Weiner and Addadi, 2011), and in many cases the very first stage is the biosynthesis of an organic matrix. The spatial organization of such a matrix requires the concerted assembly of biopolymers from a complex mixture of proteins, glycoproteins and polysaccharides (Addadi et al., 2006; Levi-Kalisman et al., 2001; Weiss, 2012). Certain proteins such as N16, Pif97 and Pif80 from pearl oyster shells interact with each other and the matrix (Samata et al., 1999; Suzuki et al., 2009). They may contribute to align inorganic crystals with respect to the matrix fibers (Weiner et al., 1983; Weiss, 2010). The eggshell C-type lectin-like

http://dx.doi.org/10.1016/j.jsb.2016.03.015 1047-8477/Ó 2016 Elsevier Inc. All rights reserved.

Please cite this article in press as: Eder, M., et al. In vivo modified organic matrix for testing biomineralization-related protein functions in differentiated Dictyostelium on calcite. J. Struct. Biol. (2016), http://dx.doi.org/10.1016/j.jsb.2016.03.015

2

M. Eder et al. / Journal of Structural Biology xxx (2016) xxx–xxx

ovocleidin-17 (OC-17) from Gallus gallus (Hincke et al., 1995; Lakshminarayanan et al., 2005; Mikšík et al., 2010; Reyes-Grajeda et al., 2004), the nacre C-type lectin perlucin with mannose and galactose specificity isolated originally from the gastropod Haliotis spec. (Blank et al., 2003; Heinemann et al., 2011; Mann et al., 2000; Weiss et al., 2000), and the so-called ‘intrinsically disordered’ peptide n16N (Keene et al., 2010; Kim et al., 2004; Metzler et al., 2010; Samata et al., 1999) are but a few prominent examples. The peptide n16N was derived from the 30 amino acid long N-terminal sequence of the pearl oyster nacre protein N16 (Bivalvia: Pinctada fucata). The synthetic peptide interacts with calcium carbonate (CaCO3) as a function of the polymeric template in vitro (Kim et al., 2004). It presumably promotes the formation of lamellar aragonite composites (Metzler et al., 2010). Even common proteins with carboxylate groups such as GFP (Tsien, 1998) interfere with the precipitation of calcium carbonate (Weber et al., 2012b), thus making recombinant GFP-fusion proteins an interesting target for designing fluorescent composite mineral precipitates in vitro (Weber et al., 2012a). Weber and Pokroy reported that recombinant perlucin-GFP, but not GFP, induces lattice distortions in synthetic calcite (Weber et al., 2014). In order to extract functional information directly from biomineralization genes without the need to purify the protein of interest from the expression host, we developed a simplified in vivo model system: The key step is to synthesize analogs of biomineralization related proteins (BRPs) directly into the extracellular organic matrix of the model organism Dictyostelium (Bonner and Savage, 1947; Eichinger and Rivero-Crespo, 2006; Eichinger et al., 2005; Harper, 1926; Manstein et al., 1995; Raper and Fennell, 1952). During the life cycle of Dictyostelids, a slug of
104 to 105 accumulated cells differentiates into so-called pre-spore and pre-stalk cells (Morrissey et al., 1984; Williams, 2006) which form different types of extracellular matrices (ECM) (Blanton, 1993; Blanton et al., 2000). One part of the cells then forms a highly symmetrical stalk which is stabilized by cellulose. This process is also induced upon starvation (Blanton et al., 2000; Gerisch, 1959; Grimson and Blanton, 2006; Grimson et al., 1996; Harper, 1926). The Dictyostelium cellulose is associated with other biopolymers, for example the ecmB (formerly PsB) multiprotein complex which contains specific cellulose binding domains (Ceccarelli et al., 1991; Jermyn and Williams, 1991; McGuire and Alexander, 1996; McRobbie et al., 1988). The ecmB multiprotein complex plays a major role in organizing the extracellular matrix. The expression of the ecmB genes is under control of the so-called [ecmB] promoter (Jermyn and Williams, 1991). The respective gene products accumulate during differentiation at the basal disc and later within the cell wall of stalk cells and the stalk tube (Ceccarelli et al., 1991; Jermyn and Williams, 1991). Other compounds of the Dictyostelium ECM are, for example, gel-like proteoglycans, glycoproteins and lipoproteins (McGuire and Alexander, 1996; Ti et al., 1995). The urea/SDS insoluble fraction of the Dictyostelium ECM consists further of proteins with 20 mol% of aspartic acid and non-cellulosic heteropolymers composed of mannose, galactose, fucose, xylose and N-acetylglucosamine (Freeze and Loomis, 1978). Due to its high proportion of aspartic acid, Dictyostelium ECM represents an even closer biomimetic model for the biomineralization of mollusc shells (Gotliv et al., 2003; Weiner, 1979; Weiner and Addadi, 2011). The cellulose fraction of Dictyostelium contains about 95% glucose and 5% mannose (Freeze and Loomis, 1978) which offers high-affinity binding sites for certain C-type lectins, for example with D-mannose specificity such as perlucin (Mann et al., 2000). Amoebozoa such as Dictyostelium evolved apparently before animals and fungi diverged (Baldauf et al., 2000; Bonner, 2001; Douzery et al., 2004; Schaap et al., 1996). Dictyostelium is further an appealing model organism for the perception of chemical and mechanical signals (Bonner and Savage, 1947; Bozzaro et al., 2004; Eichinger et al.,

2005; Gerisch, 1959). The perception of mechanical properties of the extracellular matrix are also discussed in the context of the evolution of controlled biomineralization (Schönitzer et al., 2011; Weiss, 2012). The complete genome sequence of Dictyostelium revealed a large number of G-protein-coupled receptors (Eichinger et al., 2005). In contrast to animals (Metazoa) with
110 SH2 domains, Dictyostelium lacks classical receptor tyrosine kinases and has only 13 SH2 domains, which are well characterized (Insall, 2005; Langenick et al., 2008; Liu et al., 2006; Pincus et al., 2008). Therefore, Dictyostelids eventually tolerate mechanical stress arising from the mineralization of their extracellular matrix, which likely causes serious cell signaling and differentiation problems in more complex metazoan model organisms. According to previous reports, Dictyostelids do not produce any structured, macroscopic minerals in vivo (Lowenstam, 1981; Lowenstam and Weiner, 1989). It is therefore unlikely that they synthesize ‘‘synergisticly interacting” biomineralization-inducing proteins. In contrast, they may have efficient mechanisms in order to prevent the precipitation of minerals in their environment nearby. The fast and easy GatewayTM cloning systems (Veltman et al., 2009; Walhout et al., 2000) enable an extended screening of a vast number of different biomineralization proteins, pure and in combination. In principle, entire cDNA libraries containing thousands of ORF (open reading frame) fragments could be easily transferred into either one specific vector or an archive of GatewayTM entry clones. The big question of ‘‘synergistic protein interference” in biomineralization (Weiss and Marin, 2008) has been hardly targeted on the level of gene sequences in previous studies. In the following, we present the roadmap for an efficient biotechnological approach and some first results from genetically ECM modified Dictyostelids growing on calcite crystals to demonstrate the principal feasibility for our new experimental concept. Here, we combined several electron microscopic analytical modes for performing an efficient routine screening of the Dictyostelium matrix and demonstrated the feasibility of our approach to detect protein-induced morphological and compositional alterations of mineral precipitates in the matrix as a function of protein expression as well as materials substrates for growth. This very fast and easy cloning and screening procedure also bears some potential for future combinatorial studies for identifying ‘‘synergistic protein function” in biomineralization. 2. Materials and methods All chemicals used were of ACS grade unless otherwise specified. Standard protocols for molecular cloning and protein analysis were performed as described (Sambrook et al., 2001) and according to manufacturers instructions. The gel-purification kit (MachereyNagel, Düren, Germany) and the plasmid mini purification kit (Hamburg, Germany) were used for DNA purification. Sequencing was performed by Eurofins MWG Operon (Ebersberg, Germany). The PhusionÒ DNA-polymerase (New England Biolabs, Frankfurt, Germany) and DreamTaq polymerase (Thermo Scientific, St. Leon-Rot, Germany) were used for PCR cloning and standard PCR amplifications, respectively. The software packages Ape (http: //biologylabs.utah.edu/jorgensen/wayned/ape/), pDRAW32 (www. acaclone.com), the ExPASy ProtParam tool (http://web.expasy. org/protparam/) and NetPhos 2.0 (http://www.expasy.org/ http:// www.cbs.dtu.dk/services/NetPhos/) were used for sequence analyses. 2.1. Cultivation of Dictyostelium cell lines The D. discoideum Ax3-Orf+ cell line (DictyBase strain ID: DBS0235546) (Manstein et al., 1995) was cultivated in HL5 liquid

Please cite this article in press as: Eder, M., et al. In vivo modified organic matrix for testing biomineralization-related protein functions in differentiated Dictyostelium on calcite. J. Struct. Biol. (2016), http://dx.doi.org/10.1016/j.jsb.2016.03.015

M. Eder et al. / Journal of Structural Biology xxx (2016) xxx–xxx

medium as described in www.dictybase.org (Fey et al., 2007). For stalk and spore differentiation experiments, cells were grown in Erlenmeyer flasks in a shaking incubator (New Brunswick Scientific, Edison, USA) at 22 °C and 180 rpm to a final cell density of 2  106 cells ml1. Cells were washed twice in MES containing 0.2 mM CaCl2 and 2 mM MgCl2 by centrifugation at 500g for 5 min at 18 °C and concentrated to a final density 0.8  106 cells ml1. Cells were homogeneously distributed on MES agar (15 ml in Ø 10 cm petridishes; containing 20 mM MES [2-(NMorpholino)-ethansulfonic acid], 0.2 mM CaCl2, 2 mM MgCl2), dried for 10 min under sterile conditions and incubated for 2– 4 days at room temperature in darkness. For some assays, MES plates were adjusted to 5–50 mM CaCl2. Colonization experiments were performed on MES agar plates in the presence of calcite or silicon particles. Calcite particles were prepared from calcite crystals of about 1 cm3, which were split into smaller pieces by smashing in a mortar. Silica pieces were prepared by simple breaking. Particles of a defined size range were obtained by sieving and collecting the fractions between mesh sizes in the range of 0.5–1 mm. The particle fractions were washed 5 in 25 ml sterile H2O in a 50 ml sterile tube. Particles were allowed to dry under sterile conditions in an empty petri dish. For colonization assays, 500 ll cell suspension of each cell line containing 108 cells in MES buffer were plated on a MES agar plate. After seeding the cells, 5 individual calcite crystals or silicon particles were carefully placed with a pair of tweezers on top of each MES agar plate. The plates were gently dried for 10 min. under the sterile hood, covered with the lid and incubated upside-down at 22° in dark conditions for 1–2 days. Experiments were stopped by incubating the open plates for 2 h with UV light in a sterile hood. Individual calcite and silicon particles were picked with tweezers and mounted on a SEM stub with a carbon pad. For replica experiments, particles with Dictyostelium slugs on top were placed once upside-down on the pad, immediately removed from the surface, and mounted right-side up on the same stub. In this way, sticky parts of the Dictyostelium slugs are mounted in an inverted manner. In an ideal experiment, the matrix interface previously exposed to the particle surface is exposed for inspection. Samples were stored at room temperature in a desiccator. 2.2. GatewayTM destination vector pDM353_ecmB_SigP_att_GFP The vector pDM353 (Veltman et al., 2009) was obtained from www.dictybase.org and served as the starting point for generating a suitable expression system based on gateway cloning technology (Walhout et al., 2000). The Act15 promoter of the pDM353 gateway destination vector was replaced using T4-DNA ligase (Thermo Scientific, St Leon-Rot, Germany) by an XhoI and BglII terminated insert as described in the following: The [ecmB] promoter was obtained from the EcmB-Gal vector (Jermyn and Williams, 1991) (obtained from www.dictybase.org) by PCR cloning (68 °C elongation temperature) using the primers ‘‘ME_XhoI_PecmB_for2” and ‘‘ME_PecmB_Nco_rev” (Table 1). A synthetic linker ‘‘ME_ecmB_Sig P_for” (Eurofins MWG Operon, Ebersberg, Germany) was designed for introducing (i) an NcoI restriction site, (ii) the Kozak-sequence for Dictyostelium (Eichinger and Rivero-Crespo, 2006), (iii) the ATG start codon and, (iv) part of the ecmB gene encoding the EcmB signal peptide into the destination vector. The [ecmB] promoter and the synthetic linker were PCR ligated using the primers ‘‘ME_ Xho_PecmB_for2” and ‘‘ME_ecmSP_Bgl_rev”. Amplifications during these PCR reactions did not exceed 40 cycles in total. The XhoI and BglII terminated DNA fragment was phosphorylated using T4-polynucleotide kinase (Fermentas, St Leon-Rot, Germany) and subcloned (molar ratio of insert: vector = 4:1; T4-ligase, Fermentas) into a SmaI digested and dephosphorylated pBluescript SK- vector (GenBank: X52330.1; Stratagene/Thermo Scientific) as

3

previously described (Schönitzer et al., 2011). Positive Escherichia coli XL1 Blue transformants were identified by colony PCR using the primers ‘‘ME_ Xho_PecmB_for2” and ‘‘ME_ecmSP_Bgl_rev” and the ‘‘DreamTaq”-polymerase (Fermentas) at an elongation temperature of 68 °C. Inserts of isolated plasmids were confirmed by sequencing prior to restriction cloning into pDM353 using XhoI and BglII restriction enzymes. The modified vector was transformed in E. coli (XL1 Blue, Agilent, Böblingen, Germany) and positive transformants were selected by colony PCR (elongation at 68 °C) using the primers ‘‘ME_ Xho_PecmB_for2” and ‘‘ME_ecmS P_Bgl_rev”. The inserted regions of isolated plasmids were sequenced (Eurofins MWG Operon, Ebersberg Germany). 2.3. pENTRTM/D-TOPOÒ_X entry vectors (X = n16N, OC17, perlucin) Synthetic genes were obtained from Entelechon (Regensburg, Germany). Slightly modified DNA sequences of n16N (GeneBank accession number: AB023251.1), OC-17 (UniProtKB/Swiss-Prot: Q9PRS8.2), and perlucin (GeneBank: FN674445.1) with topocloning compatible flanking regions were generated by PCR using PhusionÒ DNA-polymerase (New England Biolabs, Frankfurt, Germany) and the primers ME_CACC_Per_for1, Perlucin_rev, ME_n16N_for1, Ext3-n16N_Rev, ME_OC17_for1, Ext3-OC17_Rev (see Table 1). Purified PCR products (Nucleo Spin II-Kit; Macherey-Nagel, Düren, Germany) were inserted into the pENTRTM/D-TOPOÒ vector (Life Technologies, Darmstadt, Germany) according to the manufacturer’s instructions. The vector was heatshock transformed into One ShotÒ E. coli cells (TOP10, Life Technologies). Transformants containing the entry vectors pENTRTM/ D-TOPOÒ_n16N, pENTRTM/D-TOPOÒ_OC17, pENTRTM/D-TOPOÒ _perlucin were selected on LB plates supplemented with kanamycin and verified by colony-PCR (Dream-Taq polymerase, Thermo Scientific) using appropriate primers for each insert (Table 1). Inserts of isolated plasmids were verified by sequencing prior to use for Gateway LR cloning (Life Technologies). 2.4. Expression vectors (gateway LR-reaction) The insertion of synthetic genes from pENTRTM/D-TOPOÒ_X entry vectors into the modified pDM353_ecmB_SigP_att_GFP vector was performed based on enzymatic recombination in vitro using LR-clonase (Thermo Scientific, Karlsruhe, Germany) according to the manufacturer’s instructions. The reaction was transformed into E. coli (Mach1TM, Thermo Scientific, Karlsruhe, Germany) and subjected to ampicillin selection. Selected clones were verified by colony PCR and sequencing. According to sequencing, all selected E. coli clones (2 per insert) contained a pDM353_ecmB_SigP_X_GFP Dictyostelium expression vector which encoded for the expected protein sequence with respect to n16N, OC17 and perlucin including flanking regions (Supporting Information 1). 2.5. Transformation of D. discoideum The expression vectors pDM353_ecmB_SigP_X_GFP (X = n16N, OC17, perlucin) were transformed into D. discoideum AX3-Orf+ cells by electroporation and chemical methods. Electroporation of AX3-Orf+ cells was performed in a MicropulserTM (BioRad, Munich, Germany) according to the supplier’s protocol with slight modifications. A culture containing 2  106 cells ml1 was washed twice in ice-cold H-50 buffer (pH7.0, 20 mM HEPES, 50 mM KCl, 10 mM NaCl, 1 mM MgSO4, 5 mM NaHCO3, 1 mM NaH2PO4) and adjusted to a concentration of 2  107 cells ml1. The cell suspension (800 ll) was transferred to a pre-cooled electroporation cuvette containing 10 lg plasmid. Cells were twice electroporated at 0.85 kV and 25lF with a break of 0.5sec between pulses. Cells were

Please cite this article in press as: Eder, M., et al. In vivo modified organic matrix for testing biomineralization-related protein functions in differentiated Dictyostelium on calcite. J. Struct. Biol. (2016), http://dx.doi.org/10.1016/j.jsb.2016.03.015

4

M. Eder et al. / Journal of Structural Biology xxx (2016) xxx–xxx

Table 1 Oligonucleotides used for pECM353 Dictyostelium vectors. Name

Sequence

ME_XhoI_PecmB_for2 ME_PecmB_Nco_rev ME_ecmB_SigP_for ME_ecmSP_Bgl_rev ME_n16N_for1 Ext3_n16N_rev ME_OC17_for1 Ext3_OC17_rev ME_CACC_Per_for1 Perlucin_rev

50 -CTCGAGGATCTTTATGATAATGAAGAGTCTAGTTC 50 -ATTCATTTTTTCCATGGGATTGCAATTTTAATAAATAAATATTTGATTGG 50 -CAATCCCATGGAAAAAATGAATAAAATATATTTAATATTAATTTTATTCACTTTTGTTGGTATAATTTTAGCCAGATCT 50 -AGATCTGGCTAAAATTATACCAAC 50 -CACCGCATACCACAAGAAATGCG 50 -GCACTTTTTATCCCCGTTGTCGTATC 50 -CACCGACCCTGACGGCTGTGGAC 50 -CGCCGCCGCTTTGCAAACGAAGGCG 50 -CACCGGATGTCCTTTGGGTTTTCACC 50 -TCTTTGTTGCAGATTGGCGTGAAGC

incubated for 5 min on ice and then transferred to HL5 medium. The day after transformation, G418 (10–30 lg ml1) was added in liquid culture and individual clones were separated after 2 weeks. Chemical transformation was performed according to the calcium–phosphate precipitation protocol (Neuhaus and Soldati, 1999) described at www.dictybase.org. Both transformation methods lead to similar results. The presence of expression plasmids was verified by PCR using the primers ME_Col_ecmB_for 1 (50 -GTTGCAATAGCTTCCAATAGTAG-30 ) and ME_GFP_seq_rev2 (50 -GTGCCCATTAACATCACCATC-30 ) and PCR reactions (30 95°, 30 0.50 95 °C/0.50 56 °C/2.50 68 °C; 100 68 °C) were analyzed by agarose gel electrophoresis (Sambrook et al., 2001). 2.6. Protein characterization by Western blot After differentiation on MES-agar plates, the organic matrix (e.g. stalks) produced by Dictyostelium was harvested with a spatula and shock-frozen in liquid nitrogen, followed by potter homogenization in liquid nitrogen. The sample was allowed to thaw on ice and 100–200 ll of extraction buffer containing 100 mM Tris, pH 7.4, 10 mM EDTA, 40 mM NaCl, 4% SDS and 10 mM bmercaptoethanol were added. The sample was vigorously stirred (vortex stirring) for 2 min and centrifuged at 13,000g for 15 min at 4 °C. The protein concentration of the supernatant was determined according to the Bradford protein assay (Sigma). Protein extracts and SDS–PAGE MW marker (Spectra multicolor broad range protein ladder, Thermo Scientific) were separated by SDS– PAGE using a 12% standard Mini-gel (75V for 20 min and 135 for about 70 min) and tank-blotted on a PVDF membrane at 100 V for 75 min. The PVDF membrane was blocked in skimmed milk overnight. After 2 washing steps in TBST (13 mM Tris, pH 7.4, 150 mM NaCl, 0.1% Tween), the primary antibody (anti-GFP, monoclonal, # 11814460001, Roche, Grenzach, Germany) was applied for 120 min. After 3 washing steps, the secondary antibody (antimouse IgG, peroxidase conjugated, # A9044, Sigma) for 60 min, followed by another 3 washing steps prior to detection using the Immun-StarTM WesternCTM chemiluminiscent kit (# 170–5070, BioRad) with an ECL-hyperfilm (Amersham, Glattbrugg, Switzerland). 2.7. Light microscopy and fluorescence microscopy A Leica M165C (Leica, Wetzlar, Germany) stereomicroscope was used for phenotype screening, manipulation of crystalline substrate materials and Dictyostelium colonies, and overview analyses of ECM assays. Images were taken with a DFC 290 digital camera equipped with the Leica application suite software. Cell lines were investigated using an inverted light microscope Cell Observer Z1 equipped with a Colibri LED fluorescence excitation system and the objectives A-Plan 10/0.25Ph1 and LD Plan Neofluar 40/0.6Korr Ph2 (Zeiss, Göttingen, Germany). Electronic images were recorded with an Axiocam MRm Camera and Axiovision 4.8 software. Transmitted light microscopy images were taken at auto-

matic exposure times. Fluorescence microscopy images were taken at a fixed exposure time of 10 s using a band pass filter (excitation 470/40, emission 525/50) at 50% Colibri LED intensity. Control fluorescence images were acquired using non-transformed Ax3-Orf+ samples with the same exposure settings (excitation, gain etc.). 2.8. Scanning electron microscopy For scanning electron microscopy (SEM) a FEI (Hilsboro, OR, USA) Quanta 400 FEG equipped with an EDAX (Mahwah, NJ, USA) Genesis V6.04 energy-dispersive X-ray spectroscopy (EDX) was used. Specimens involving calcite were investigated in low vacuum mode (water vapor pressure p = 100 Pa) at an accelerating voltage of 20 kV. Morphological features were imaged by secondary electrons (SE) using a large field detector (LFD). The compositional differences inside the Dictyostelium were analyzed by back scattered electrons (BSE) imaging using a two-channel solid state detector (SSD) in A + B mode. To verify the compositional differences visible by BSE imaging, EDX point analyses were performed (measurement time 100 s, X-ray spectral energy resolution 127 eV). Elements were analyzes according to K-Alpha values (C: 0.277 keV, N: 0.392 keV, O: 0.525 keV, Mg: 1.253 keV, Si: 1.739 keV, P: 2.013 keV, S: 2.307 keV, K, 3.312 keV und Ca: 3.690 keV, values from ’The periodic table of the elements – WDXRF’, PANalytical, Germany). The phosphorous contents of precipitates and the phosphorous contents of the matrix were determined relative to each other, taking into account that the local resolution of EDX point analysis in low vacuum mode is restricted due to the beam spreading near to the sample surface (Stokes, 2008). Areas of about 1 lm2 each were analyzed in different locations within the same specimen. The local resolution of EDX point analysis was improved by partly coating the specimen with carbon using a JEOL (Akishima, Japan) JFC-530 auto carbon coater (coating time 5 s, current 5 A). The analysis was performed in high vacuum mode using an Everhart–Thornley (ETD), solid state (SSD) and EDX detector. In some cases the accelerating voltage was set to 8 kV to reduce the penetration depth of the primary electrons without losing the ability to detect Ca (Kalpha = 3.69 keV) by EDX analysis. The penetration depth R of electrons into the Dictyostelium was estimated according to the formula of Kanaya and Okayama (Kanaya and Okayama, 1972):

R ¼ ð0:0276AE1:67 Þ=ðqZ 0:89 Þ Assuming a medium atomic number A of 7 (the main components of Dictyostelium are C and O), an average atomic weight Z of 14, and a density q of 2 g/cm3 for the organic matrix after drying, we find a penetration depth R = 0.30 lm for primary electrons with an accelerating voltage U of 8 kV and R = 1.37 lm for 20 kV. As pointed out by Reimer (Reimer, 1998) the information limit of back scattered electrons is approximately half of the primary electron beam penetration depth and generally smaller than the X-ray

Please cite this article in press as: Eder, M., et al. In vivo modified organic matrix for testing biomineralization-related protein functions in differentiated Dictyostelium on calcite. J. Struct. Biol. (2016), http://dx.doi.org/10.1016/j.jsb.2016.03.015

M. Eder et al. / Journal of Structural Biology xxx (2016) xxx–xxx

5

information limit. For Dictyostelium samples as previously described, we can expect to detect phosphorous containing precipitates in a depth of less than 700 nm for 20 kV, and less than 150 nm for 8 kV accelerating voltage by BSE electron imaging.

3. Results and discussion 3.1. Gateway expression system for extracellular targeting of biomineralization-related genes in multicellular Dictyostelium The aim of this work was to develop a fast and easy transformation and screening system for testing the potential effects of proteins originating from different biomineral producing organisms. Some characteristic features of multicellular Dictyostelids and their extracellular matrix were exploited for identifying some of the complex functions of biomineralization gene products. Complexity arises with respect to protein interactions with each other, with minerals and with cells. As a first approach, only individual biomineralization genes were tested on the level of colonies formed by individually transformed cell lines. Nevertheless, colonies formed by selective or random accumulation of several transformed cell lines, which express selectively or randomly inserted sequences (‘‘biomineralomic libraries”), offer tremendous opportunities to study and screen more complex systems. Synthetic sequences of n16N, OC-17 and perlucin were cloned into modified GatewayTM expression systems for Dictyostelium derived from destination vectors such as pDM353 (see Materials & Methods, (Veltman et al., 2009)), but under the control of the [ecmB] promoter. By introducing a suitable signal peptide, the proteins are exported into the extracellular matrix while it is formed. During starvation, Dictyostelids aggregate into colonies that migrate as a multicellular slug more or less randomly on their substrate, which is usually an aqueous hydrogel. We tested the preference of non-transformed and transformed Ax3-Orf+ strains seeded on MES agar plates whether or not they are able to cope with dry mineral surfaces as a substrate and colonize the materials. Calcite was arbitrarily chosen because it could potentially act as a reservoir for calcium ions as long as the Dictyostelium ECM keeps supplying an aqueous interface. Silica substrates were taken for control experiments. The solid substrates were randomly placed on top of the regular starvation agar plate. As a matter of fact, any Dictyostelium colony (=aggregates of multiple cells) observed a few hours later on the solid substrate must have actively migrated toward this place on the substrate. Remnants of extracellular matrix indicate that a colony which occupied the substrate temporarily has actively migrated away from this place, or the cells died and the colony disintegrated prior to further differentiation into stalk cells and spores. This procedure turned out to be useful for characterizing and distinguishing Dictyostelium ECM mineral composites as a function of in vivo modifications with biomineralization-related proteins. The experimental parameters for electron microscopic detection of key features of the matrix components are reported in detail. The destination vector pDM353, which is a Gateway expression vector for fusion proteins with a C-terminal GFP-sequence, was modified as shown in Fig. 1. The constitutive act15 promoter of pDM353 was replaced by an inducible [ecmB] promoter. This promoter is active when amoebae differentiate into prespore and prestalk cells. A sequence encoding the ecmB signal peptide (SPecmB), flanked by restriction sites, was introduced upstream the gateway cloning site, thus enabling the exchange of the signal peptide if necessary. The modification of the destination vector required several steps including PCR cloning of fragments as outlined in Supplementary Material 1 and Table 1. All modifications were verified by restriction digests and DNA sequencing.

Fig. 1. Tailored expression vector pECM353 and localization of the inserted sequence after Gateway cloning. Here, a PerlGFP insert is shown. The [ecmB] promotor ensures that gene expression is induced by Dictyostelium in the multicellular stage. The ecmB signal sequence is intended for extracellular localization of the expressed protein.

The GatewayTM conversion site of this destination vector was suitable for the convenient cloning of biomineralization-related genes by rapid and simple enzymatic recombination. The respective GatewayTM entry vectors were obtained by ligation of suitable PCR products (Table 1) which encoded the biomineralizationrelated genes. In this pilot study, the final vectors encoding the biomineralization-related proteins n16N, OC-17 and perlucin were named pECM353_n16NGFP, pECM353_OC17GFP, and pECM353_ PerlGFP. All destination vectors were verified by DNA sequencing of the insert and flanking att-linker regions (Supplementary Material 1). Dictyostelium Ax3-Orf+ strains were stably transformed with plasmids pECM353_n16NGFP, pECM353_OC17GFP, or pECM353_PerlGFP as examined by colony PCR for several weeks. The respective transformed cell lines selected in the presence of G418 are in the following referred to as AX3_n16NGFP, AX3_OC17GFP and AX3_PerlGFP.

3.2. Protein expression in Dictyostelium cell lines The new expression vector generated during this study was especially designed for extracellular localization of the target proteins. The promoter was selected according to previous studies of Jermyn and Williams, who demonstrated that the [ecmB] promoter is active only in multicellular stages of the Dictyostelium life cycle (Jermyn and Williams, 1991). Due to the conserved and wellcharacterized ecmB signal peptide, which is translated at the Nterminus of any target sequence which is in the correct reading frame, the fusion proteins will enter the exocytotic pathway, the signal peptide will be cleaved off, and the target protein will finally appear mainly in the extracellular matrix of prestalk and stalk cells. This was verified by Western blots using a monoclonal anti-GFP antibody for testing crude extracts of differentiated Dictyostelium cell lines Ax3-Orf+, AX3_n16NGFP, AX3_OC17GFP, and AX3_PerlGFP (Fig. 2, left). Only for the transformed cell lines, a single protein band per lane was detected, which corresponded to the calculated molecular weights of 34.0 kDa for n16NGFP, 45.5 kDa for OC17GFP and 48.4 kDa for PerlGFP without signal peptide (sequences listed in Supplementary Material 1). The n16NGFP band runs slightly higher than
35 kDa, suggesting that posttranslational modifications occur. In fact, the probability of phosphorylation of up to 8 Ser, 1 Thr and 8 Tyr residues per n16NGFP

Please cite this article in press as: Eder, M., et al. In vivo modified organic matrix for testing biomineralization-related protein functions in differentiated Dictyostelium on calcite. J. Struct. Biol. (2016), http://dx.doi.org/10.1016/j.jsb.2016.03.015

6

M. Eder et al. / Journal of Structural Biology xxx (2016) xxx–xxx

Fig. 2. Protein expression and viability of cell lines. Left image, Western blot of protein extracts from Dictyostelium Ax3-Orf+(lane 1) transformed with expression vectors pECM353_n16NGFP (lane 2), pECM353_OC17GFP (lane 3), pECM353_PerlGFP (lane 4). Molecular weight marker bands in kDa are indicated on the left. An anti-GFP antibody was used to generate the Western blot signals. The major signals represent the correctly processed proteins n16NGFP, OC17GFP and PerlGFP. Right image, Light microscopy images of the new Dictyostelium cell lines indicate that protein expression has no severe effects on the overall morphology of the differentiated multicellular stages and the general properties of their cellulose stalks. Arrows indicate some rare morphologies observed in transformed strains. Bars: 200 lm (top) and 100 lm (bottom).

molecule is very high (preliminary data). Any background bands as seen for example in OC17GFP extracts (Fig. 2), which could indicate either transcription problems or degradation, are minor. According to frequent Western blot analyses, the full-length proteins were stable at room temperature for at least 5 days and degraded within 14 days in the native stalks under environmental conditions. Only after long-term storage at RT or 20 °C, or harsh vortexing, an additional band at 26.8 kDa was observed. Routine analyses for gene expression were performed by PCR (Supplementary Material 2). Light microscopic investigations performed in the bright field mode showed that the stalks and basal discs of differentiated AX3_n16NGFP, AX3_OC17GFP and AX3_PerlGFP cell lines, and the reference strain Ax3-Orf+ were morphologically similar (Fig. 2, right). Only in few cases, the basal stalk of AX3_n16NGFP cell lines had a coarser surface, whereas stalks of AX3_OC17GFP cell lines were thinner and AX3_PerlGFP sometimes bulged near the basal region (Fig. 2, right, arrows). In the following, region 1 corresponds to the basal disc, region 2 to the lower stalk region, region 3 to the central stalk region and region 4 to the spore head as indicated in Fig. 3A and Supplementary Material 3. Fluorescence signals corresponding to GFP emission were detected in the stalks of AX3_n16NGFP, AX3_OC17GFP and AX3_PerlGFP cell lines (Fig. 3), suggesting that the proteins of interest with C-terminal GFP domains are translated in fulllength and thus confirming the Western blot results. The quantitative image analysis of fluorescence microscopy data (Supplementary Material 4) revealed that fluorescence signals in region 1 were higher than in region 3 for the three transformed cell lines. The Ax3-Orf+ strains revealed some autofluorescence which was significantly lower in both regions (Supplementary Material 4). Ax3-Orf+ samples were therefore used as a reference for adjusting the fluorescence microscopic imaging parameters accordingly (Fig. 3P and R). The fluorescence signals in region 3 of AX3_n16NGFP, AX3_OC17GFP and AX3_PerlGFP cell lines was about twice as much compared to the autofluorescence of Ax3Orf+ in the same region (Fig. 3P; Supplementary Material 4, right).

The three cell lines differed in the local distribution of fluorescence signals, indicating that each recombinant protein interferes with the Dictyostelium ECM in a characteristic manner. Some features of the selected proteins including amino acid composition and isoelectric point pI are listed in Table 2. As shown in Fig. 4, AX3_n16NGFP and AX3_PerlGFP cell lines showed fluorescence in distinct spots, whereas the fluorescence in AX3_OC17GFP cell lines was rather diffuse, especially in region 1. The fluorescence patterns observed in region 3 were also distinct in the case of AX3_n16NGFP and AX3_PerlGFP cell lines, and more diffuse in the case of AX3_OC17GFP cell lines (Fig. 4). Inhomogeneous distribution of GFP signals could as well explain the larger error bars observed for n16NGFP, OC17GFP and PerlGFP in the quantitative analysis (Supplementary Material 4). When spore-heads of all strains including the reference Ax3-Orf+ (region 4, Supplementary Material 3) were analyzed, fluorescence signals above the autofluorescence of Ax3-Orf+ were observed in AX3_n16NGFP, AX3_OC17GFP and AX3_PerlGFP cell lines at the upper and lower region of the spore head (Supplementary Material 3), which is specific for gene expression under the control of an [ecmB] promoter (Ceccarelli et al., 1991). Some fractions of the GFP-tagged proteins eventually remain trapped in intracellular compartments. However, Dictyostelium stalk cells undergo programmed cell death shortly after differentiation (Ameisen, 1996; Cornillon et al., 1994; Whittingham and Raper, 1960), which means that any intracellular GFP signal will be degraded very soon. As a matter of fact, the observed fluorescence signals remained stable in the stalks for up to 2 weeks. Another observation was that the GFP-tagged proteins were detected in the medium. GFP signals were also closely associated with inorganic crystals which formed externally during subsequent assays (Supplementary Material 5). These lines of evidence led us to the conclusion that at least part of the GFP-fusion proteins were deposited in the extracellular matrix (ECM) of differentiated AX3_n16NGFP, AX3_OC17GFP and AX3_PerlGFP Dictyostelium cell lines. In summary, all genes inserted into the new GatewayTM expression vector were successfully expressed in different stalk regions of

Please cite this article in press as: Eder, M., et al. In vivo modified organic matrix for testing biomineralization-related protein functions in differentiated Dictyostelium on calcite. J. Struct. Biol. (2016), http://dx.doi.org/10.1016/j.jsb.2016.03.015

M. Eder et al. / Journal of Structural Biology xxx (2016) xxx–xxx

7

Fig. 3. Detection of GFP-tagged proteins in Dictyostelium. Bright field (A) and fluorescence (B) light microscopy images of different stalk regions of the transformed Dictyostelium after differentiation. As indicated by arrows in (A), region 3 (top row, C–P) and region 1 (bottom row, E–R) of Ax3-Orf+ strains expressing n16NGFP (A and B, C– F), OC17GFP (G–J), PerlGFP (K–N) and the non-transformed Ax3-Orf+ reference strain (O–R) are shown. Control fluorescence images (3P and 3R) were acquired with the same exposure settings (excitation, gain etc.) as the other fluorescence images. Scale bars: (A and B) 100 lm, (C–R) 20 lm.

3.3. Dictyostelium matrix-mineral composites: a case study for testing protein function

Table 2 Amino acid composition of partial gene products (in%). Refs.a,b

n16N

OC-17

perlucin

GFP

Ala, A Arg, R Asn, N Asp, D Cys, C Gln, Q Glu, E Gly, G His, H Ile, I Leu, L Lys, K Met, M Phe, F Pro, P Ser, S Thr, T Trp, W Tyr, Y Val, V

3.3 10.0 3.3 13.3 10.0 0.0 3.3 6.7 3.3 6.7 0.0 13.3 0.0 0.0 3.3 3.3 0.0 3.3 16.7 0.0

15.5 13.4 1.4 4.2 4.2 0.0 5.6 13.4 2.1 0.7 7.0 1.4 0.0 4.2 5.6 9.2 3.5 5.6 0.0 2.8

6.5 8.4 7.1 4.5 3.9 5.8 6.5 7.7 4.5 5.2 9.7 2.6 0.6 3.9 3.2 7.7 2.6 3.9 5.8 0.0

3.4 3.0 5.5 7.6 0.8 3.0 6.8 9.7 4.2 5.1 8.0 8.4 2.1 5.5 4.2 3.8 6.8 0.4 4.6 7.2

Length (aa) pI (calc.)

30 8.6

142 9.8

155 7.2

237 5.8

a Gasteiger E., Hoogland C., Gattiker A., Duvaud S., Wilkins M.R., Appel R.D., Bairoch A., 2005. In: John, M., Walker (Ed.). The Proteomics Protocols Handbook, Humana Press, pp. 571–607. b http://web.expasy.org/tools/protparam/protparam-doc.html.

multicellular Dictyostelium under control of the [ecmB] promoter. All our results were in good agreement with former publications (Ceccarelli et al., 1991; Jermyn and Williams, 1991). The spatial distribution and accumulation of the expressed proteins occurs in a protein-specific manner and presumably within the Dictyostelium ECM, suggesting that such differences should have consequences for the diffusion from the ECM to the medium as well as for the guidance of crystal growth at the interface between the in vivo modified organic matrix and the medium. Externally induced calcium carbonate precipitation turned out not to be a straight-forward method to screen the protein-specific mineralization potential of genetically modified cellulose matrices harvested from the three different Dictyostelium cell lines (Eder et al., submitted for publication). Therefore, we tested the capability of Dictyostelium to grow directly on calcite surfaces, which would provide a more defined interface and could potentially act as an external reservoir for calcium ions. Electron microscopic methods were developed to record mineral sequestration within the extracellular matrix of Dictyostelium slugs under these conditions as reported in the following sections.

A fast and relatively robust test system was designed based on supplying a solid substrate that serves as a well-defined starting point but with sufficient flexibility for mineral precursors to interact with the protein of interest. Depending on whether or not the protein is trapped in the matrix, it may diffuse toward the mineral interface. If proteins are immobilized within the matrix (e.g. lectins), they could be exposed to mineral components which are locally dissolved from the substrate and sequestered by the extracellular matrix (Fig. 5). A third possibility would be the active uptake and release of ions by the living cells. As shown in Fig. 5, multicellular Dictyostelium slugs actively colonize calcite crystals. It turned out that non-transformed Ax3-Orf+ cells and AX3_OC17GFP cell lines (Fig. 5A–D) frequently colonize calcite crystals and continue with their differentiation process to a certain extent, whereas AX3_PerlGFP slugs either avoid or do not survive extended exposure to calcium carbonate, as demonstrated by matrix remnants on the crystals (Fig. 5E and F). Dissolution of the crystal surface was also observed in regions that were covered by organic matrix of AX3_n16NGFP cell lines (Fig. 5G and H). Spore heads, which were frequently observed to be attached on crystals, were not taken into account because there was no clear indication that the differentiation process, which goes hand in hand with protein expression in the basal plate, has occurred in direct contact with the crystal. In contrast to non-transformed cell lines (X), severe crack formation was observed for the matrix deposits on calcium carbonate crystals of the cell lines AX3_n16NGFP (Fig. 6A–D) and AX3_PerlGFP (Fig. 6E–H). It turned out that the crack patterns of the two different strains were different. Branching effects occurred for both strains, but at different length scales. A common feature of all four tested Dictyostelium strains were small granules of different sizes, which were frequently observed within the organic matrix patches. This observation raised the question whether or not this phenomenon was related to the physiology of multicellular Dictyostelium stages crawling on the solid substrate and, in particular, due to the exposure of their extracellular matrix to calcium carbonate crystals. In order to investigate the interfacial part of the matrix which was in direct contact with the calcite crystal, a replica technique was developed: A crystal was manually placed upside down on a sticky carbon tape using tweezers, and immediately removed. Remnants of the organic matrix, which remained attached to the carbon tape, were then subjected to electron microscopic inspection (Supplementary Materials 6 and 7). However, this procedure turned out not to be particularly ideal for performing a fast screening.

Please cite this article in press as: Eder, M., et al. In vivo modified organic matrix for testing biomineralization-related protein functions in differentiated Dictyostelium on calcite. J. Struct. Biol. (2016), http://dx.doi.org/10.1016/j.jsb.2016.03.015

8

M. Eder et al. / Journal of Structural Biology xxx (2016) xxx–xxx

A

B

500µm

500µm

D

C

100µm

E

100µm

F

100µm

100µm

H

G

2µm

2µm

Fig. 5. Scanning electron microscopy images obtained with different detectors, LFD (left column) and SSD (right column) of a typical fast screening assay. Calcite crystals are inspected after exposure to Dictyostelium extracellular matrices. Matrix deposits occur on the solid calcium carbonate substrates during and after differentiation of multicellular stages. Transformed Ax3-Orf+ cell lines expressing either OC17GFP (A–D), PerlGFP (E and F), or n16NGFP (G and H) under the control of the ecmB promotor. Colonies of AX3_OC17GFP cell lines were frequently observed to enter calcite crystals, suggesting that Ax3-Orf+ cells provide a matrix which is, to some extent, physiologically compatible with Dictyostelium differentiation on calcium minerals. Traces of temporary colonization by AX3_PerlGFP cell lines are shown in (F). The calcite surface appears partly dissolved in areas where AX3_n16NGFP cell lines resided (H).

Fig. 4. GFP-tagged protein patterns in Dictyostelium. Fluorescence microscopy images of cell lines AX3_n16NGFP (A, region 1; B, region 3), AX3_OC17GFP (C, region 1; D, region 3) and AX3_PerlGFP (E, region 1; F, region 3) indicate that the spatial distribution of the GFP-signals is characteristic for each fusion protein, and each region within the differentiated colonies, suggesting specific and matrixdependent protein interactions.

Direct imaging of the organic matrix on calcite surfaces revealed that all Dictyostelium cell lines (AX3_n16NGFP, AX3_OC17GFP, AX3_PerlGFP, and Ax3-Orf+) produce granules which contain the elements P and Ca, although the calcite background poses some problems for the elemental analysis, and the identification of Ca within the granules was not as straightforward as in the replica assay (Supplementary Materials 6 and 7). Fig. 7 shows some representative results of fast screening assays performed with Ax3-Orf+ and AX3_OC17GFP cell lines. Cracks in the matrix as previously described for the matrices of

AX3_n16NGFP and AX3_PerlGFP in the basal disc (region 1) (Fig. 6) were not detected. However, granules similar to the ones from AX3_n16NGFP slugs (Fig. 6, Supplementary Material 6) were detected due to their high BSE signals as compared to the surrounding organic matrix. A replica assay performed with AX3_OC17GFP slugs clearly identified the elements P, Mg and Ca to be associated with the granules (Supplementary Material 7). Taken together, these data show that the new screening system presented here would, in principle, be suitable to quickly identify cell lines according to the size and the distribution of the granules observed in the SSD detector (Fig. 7B, D, F, H) and to relate this phenomenon to the likelihood of crack formation at a higher hierarchical length scale, e.g. the multicellular slug. The observed property variations of the organic matrix and the mineral deposits therein raised the question of how the supply of mineral precursors occurs. Therefore, the calcium distribution in the matrices of non-transformed Ax3-Orf+ Dictyostelium, which were located on calcite surfaces, was analyzed by EDX measurements as indicated in Fig. 8.

Please cite this article in press as: Eder, M., et al. In vivo modified organic matrix for testing biomineralization-related protein functions in differentiated Dictyostelium on calcite. J. Struct. Biol. (2016), http://dx.doi.org/10.1016/j.jsb.2016.03.015

M. Eder et al. / Journal of Structural Biology xxx (2016) xxx–xxx

A

9

B

10µm

10µm

D

C

2µm

E

2µm

F

10µm

10µm

H

G

2µm

2µm

Fig. 6. Properties of Dictyostelium composites produced on calcite. Scanning electron microscopy images (left column, LFD; right column, SSD) of Dictyostelium matrices from AX3_n16NGFP (A–D) and AX3_PerlGFP (E–H) after drying. Cracks were observed at different length scales. Granules in the sub-micron range are only visible in the SSD images. Elemental analysis showed that granules consist of P (typical for all Ax3-Orf+ cell lines), Mg and, Ca, the latter excreted from cells and/or absorbed from the calcite crystal substrates (Supplementary Materials 6F, 7F). A homogeneous distribution of granules and the formation of cracks are observed predominantly in the case of AX3_PerlGFP cell lines (E–H), and the branching pattern of cracks is different from those observed for AX3_n16NGFP (A–D). Comparison of data sets was made with respect to experiments with identical environmental and processing conditions. The detection of Ca suffers from the fact that X-ray fluorescence from the calcite substrate cannot be excluded, unless matrix deposits are separated from the crystal (see also Supplementary Materials 6 and 7). The SSD image at this magnification shows that the smallest visible granules are in the range of 50 nm.

It turned out that traces of calcium can be detected in the organic part of a Dictyostelium slug next to the calcite. However, no calcium signals were detected in matrix regions distant from the calcite. It was expected that the quality of the analysis would largely depend on the possibility to exclude calcium signals from the background. Analyses were performed with specimens in different orientations (Supplementary Materials 8 and 9). Whenever calcium signals were observed, they occurred only in the regions close to the calcite surface. This phenomenon could well be related to the technically poor differentiation between Ca in the matrix and Ca from the substrate. However, the possibility that the aqueous matrix of Dictyostelium, even in the non-transformed state, sequesters Ca2+ ions from the calcite surface would also be compatible with the observed results. If the extracellular matrix

Fig. 7. Texture of Dictyostelium composites produced on calcite. Scanning electron microscopy images taken with LFD (left column) and SSD (right column) detectors reveal an inhomogeneous distribution of mineral granules in matrix deposits of AX3_OC17GFP (A–D) and Ax3-Orf+ cell lines (E–H). Some areas do not contain any visible granules. The size distribution of the AX3_OC17GFP granules is not homogeneous.

of Dictyostelium acts by default as a reservoir for Ca2+ ions and/or nanoparticles, this would provide a substantial degree of intrinsic control over the Ca2+ dissolution from a solid surface and subsequent re-precipitation of a mineral phase within the matrix. Under these conditions, one could assume a constant interference of recombinantly expressed proteins (compare also Fig. 5G and Supplementary Materials 6 and 7). This could eventually explain some of the differences observed for some cell lines with respect to the homogeneity of size, density, localization and distribution of mineral granules within the matrix. An additional experiment was performed to clarify whether or not the formation of calcium containing granules depends on calcite as a substrate for growth, and that it is not the cells which supply the calcium. Fig. 9 shows an experiment performed with the AX3_OC17GFP cell line grown on silicon substrates. The ECM of this and other cell lines (Supplementary Material 10) also contained granules which were easy to visualize under the respective electron microscopy conditions in ETD and SSD detection modes. As shown in Fig. 9, the slugs colonize the solid substrate and differentiate to some extent (Fig. 9A and B). A close-up view of the matrix (Fig. 9C and F) reveals the presence of electron-dense granules. Small-scale cracks are also formed (Fig. 9E and F). Elemental analysis demonstrated that the granules

Please cite this article in press as: Eder, M., et al. In vivo modified organic matrix for testing biomineralization-related protein functions in differentiated Dictyostelium on calcite. J. Struct. Biol. (2016), http://dx.doi.org/10.1016/j.jsb.2016.03.015

10

M. Eder et al. / Journal of Structural Biology xxx (2016) xxx–xxx

A

B

A

B

1 2 3 4

5

50µm

100µm

D

C

10µm

500µm

F

500µm

D

C

500µm

E

500µm

E

10µm

F

7 1

2

G 3

4

5

6 H

100µm

100µm

2µm

2µm

H

G

Fig. 8. Scanning electron microscopic of Ax3-Orf+ colonies on calcite crystals. Phosphorous and sulfur signals, which were identified by X-ray spectroscopic analyses (Supplementary Materials 8 and 9) identify them as matrix deposits from Dictyostelium. P, S, and Mg signals remain constant in the different locations as indicated by numbers [1–4] (A), whereas Ca signals increase from the tip [1] to the calcite surface [5] (Supplementary Material 8). (B), Close-up view of (A) at the interface between the calcite and the organic matrix. The organic matrix of nontransformed Dictyostelium appears homogeneous in the ETD images (A and B). Both, LFD (C and E) and SSD (D and F) images reveal large-scale cracks in an otherwise homogeneous matrix. Spectroscopic elemental analysis in top view (F and Supplementary Material 9) reveals that Ca signals are detected in matrix regions with direct contact to the calcite substrate (F, [1–3]; Supplementary Material 9, F1– F3), but not in the elevated stalk regions (F, [4–6]; Supplementary Material 9, F4– F6). Contributions to the observed signals from the underlying calcite substrate (Supplementary Material 9, F7) cannot be excluded. Note that elemental analyses were made in average matrix regions, without paying attention to the presence or absence of mineral granules.

Fig. 9. Scanning electron microscopic (A–F) and X-ray spectroscopic (G and H) analyses of Dictyostelium slugs on Si substrates. On silicon substrates, AX3_OC17GFP forms many colonies with a characteristic shape, different from the morphology on calcium carbonate. EDX analyses demonstrate that AX3_OC17GFP matrix deposited on Si consists of granules which contain P and Mg (F–H). No Ca was detected (G and H).

contain P and Mg, but no Ca (Fig. 9G). Mg was observed only in the granules, but not in the matrix (Fig. 9H). There is no Ca, neither in the granules nor in the matrix. The main focus here was not put on identifying the function of the proteins, but on developing a fast and robust screening assay in which the selected examples were intended to serve only as a preliminary case study for future developments. According to the results presented here, it is assumed that calcium can be supplied in a relatively robust manner to a ‘‘default ECM” by providing the Dictyostelium culture during the aggregation phase of its life cycle the opportunity to colonize a calcite substrate. Further interactions between the ECM and the calcite may or may not occur, depending on the ability to supplement the ECM with additional compounds such as heterologous ‘‘biomineralization proteins”. It would be particularly interesting to test the ability of a protein of interest to interfere with early stages of mineral deposition. As shown in Fig. 10, the detection limit for the smallest particle size that would routinely be identified by the screening system presented here is in the range between 30 and 50 nm. One must not forget that the detection limit of particles or granules in this system depends on many complex imaging parameters (Goldstein et al., 1992; Stokes, 2008). The distribution of granules,

either embedded deeply within or next to the surface of the matrix, plays an important role. The influence of the background is stronger in the case of calcite as compared to silicon. This implies that functionalities of biomineralization proteins on the molecular level cannot be identified directly during the very early stages of Ca2+ sequestration into the matrix. However, subsequent ripening steps of the mineral containing granules may still be observed, and eventually investigated in relation to a specific protein. In fact, the full range of advantages of the expression and screening system will only be exploited when different proteins are supplied in combination by co-cultures of Dictyostelium and providing them with the opportunity to colonize calcite. Modification of the mineralizing ECM is performed on the molecular level; the screening of effects is performed on the level of granules and their ripening processes starting at length scales of
30 nm. Additional features such as crack formation can be screened at length scales of sub-micron to mm levels. Once a given combination of features in one of the Dictyostelium composite is identified, molecular biology tools are in place to perform a fast and easy screening on the molecular level using a set of universal primers for the expression vector as described above (Fig. 1 and Supplementary Material 1).

H

Si C

Si

C O

Mg 1

O

P

P

keV 2

3

4

5

6

7

8

9

1

2

keV 3

4

5

6

7

8

9

Please cite this article in press as: Eder, M., et al. In vivo modified organic matrix for testing biomineralization-related protein functions in differentiated Dictyostelium on calcite. J. Struct. Biol. (2016), http://dx.doi.org/10.1016/j.jsb.2016.03.015

11

M. Eder et al. / Journal of Structural Biology xxx (2016) xxx–xxx

A

B

500nm

500nm

Fig. 10. High magnification scanning electron microscopic investigation of small granules in Dictyostelium matrices deposited by two different (A and B) AX3_n16NGFP slugs on calcite. Images of an uncoated specimen were taken at 100.000 magnification. Granules of 30–50 nm were contrasted in the back-scattered electron image (SSD detector) under the conditions used for the fast screening assays reported in this work.

3.4. Advantages and disadvantages of the screening system This work takes advantage of the fact that Dictyostelium can temporarily grow under starvation conditions on solid mineral substrates. This fact was exploited to study protein function in an extracellular matrix. The cloning system was designed such that protein expression is induced only under starvation conditions, when the organism enters the multicellular stage. Biomineralization proteins which eventually induce physiological problems during the vegetative growth phase in the single cell stadium can thus still be analyzed to some extent. During the growth phase, there should be no interference between the biomineralization proteins and the physiological constraints of the cells, as long as cell densities are kept in an appropriate range. For practical reasons, calcite crystals were chosen as a substrate because this type of material can easily be split into small pieces. In the present study, crystals were manipulated individually by hand under a binocular microscope. Size and orientation of the crystals could, in principle, be manipulated more accurately before inserting them in the starvation agar plate. Any subsequent steps bear about the same level of control as any other cell biological experiment. Since all experiments were started with the same amount of cells seeded on the starvation agar plate, the chances for slug migration toward the solid crystals are equally high, regardless of the cell line. However, as soon as slugs are formed and protein expression starts, each protein may influence the extracellular matrix of the slug in a characteristic way. Further studies will reveal the various ways how biomineralization proteins alter the physical properties of the extracellular matrix. It remains to be seen how sensitive Dictyostelium responds to such alterations. 4. Conclusion In summary, Dictyostelium as a model system offers several perspectives for studying biomineralization proteins when heterologously expressed and secreted in an extracellular matrix. This study shows that  Dictyostelium tolerates inorganic crystals as the substrate for survival, especially prior to sporulation in the ‘‘multicellular” stages.  Mineral granules are formed within or next to the matrix and are used as an indicator for monitoring protein functions. Some proteins may enhance the formation of such mineral granules, whereas others may suppress it.

 The size of mineral granules, which varies in the nontransformed Ax3-Orf+, is easy to monitor in order to detect size-dependent protein–mineral interactions.  The combination of various SEM detection methods provides a fast screening of the distribution, the size and the size distribution of the granules. New proteins may be detected that interfere with all these parameters.  Mineral precipitates of less than 50 nm diameter can be identified in the native matrix environment in the presence of a CaCO3 substrate background. This compares roughly to the size of mineral constituents which are frequently observed in natural biominerals.  EDX analysis provides insight into the elemental composition of the granules, which may be an additional parameter for classifying protein functions. Comparative experiments with silicon substrates can help to elucidate whether or not the detected calcium results from the environment but not from cellular reservoirs, in contrast to Mg (magnesium) and P (phosphorous) according to the present findings.  Independently of phosphorous containing granules, sulfur signals can identify the presence of extracellular Dictyostelium matrix on the solid substrates. This would be important to identify protein functions also in those cases where mineral granule formation is inhibited.  The screening system presented here is suitable to investigate crack formation as a function of proteins in the matrix under defined drying conditions. As shown here, even drying conditions that are not well controlled induce cracks that can differentiate between the Ax3-Orf+ and various biomineralization GFP-fusion proteins such as the eggshell protein OC17 with reduced potential for crack formation, the pearl oyster bivalve protein fragment n16N with high potential for cracks at higher length scale, and the gastropod nacre protein perlucin with high potential for cracks at small length scales. In principle, quantification would be possible, for example if the size of cracks which form after gentle dessication treatment depends on protein expression. However, one cannot distinguish between cracks that form due to protein induced mineral granules and those which form as a consequence of calcium uptake into the matrix. Formation, size distribution and elemental composition of granules may be influenced by a set of interacting proteins. The calcite-ECM interface adds an additional level of mechanistic complexity. As a first step, the Dictyostelium on calcite system as presented here offers a new perspective to characterize the function of biomineralization proteins under conditions that mimick the in vivo state.

Please cite this article in press as: Eder, M., et al. In vivo modified organic matrix for testing biomineralization-related protein functions in differentiated Dictyostelium on calcite. J. Struct. Biol. (2016), http://dx.doi.org/10.1016/j.jsb.2016.03.015

12

M. Eder et al. / Journal of Structural Biology xxx (2016) xxx–xxx

Acknowledgements This study benefits from support by Dictybase (www.dictybase. org) and generous supply of plasmids by Dietmar Manstein. We thank Eva Weber for expert advice and support. This work would have been impossible without the continuous support of Eduard Arzt. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.jsb.2016.03.015. References Addadi, L., Joester, D., Nudelman, F., Weiner, S., 2006. Mollusk shell formation: a source of new concepts for understanding biomineralization processes. Chem. Eur. J. 12, 980–987. Ameisen, J.C., 1996. The origin of programmed cell death. Science 272, 1278–1279. Annesley, S., Fisher, P., 2009. Dictyostelium discoideum—a model for many reasons. Mol. Cell. Biochem. 329, 73–91. Ashby, M.F., 2008. The CES EduPack Database of Natural and Man-Made Materials Granta Material Inspiration – Bioengineering. Granta Design, Cambridge, U.K.. Baldauf, S.L., Roger, A.J., Wenk-Siefert, I., Doolittle, W.F., 2000. A kingdom-level phylogeny of eukaryotes based on combined protein data. Science 290, 972– 977. Blank, S., Arnoldi, M., Khoshnavaz, S., Treccani, L., Kuntz, M., Mann, K., Grathwohl, G., Fritz, M., 2003. The nacre protein perlucin nucleates growth of calcium carbonate crystals. J. Microsc. 212, 280–291. Blanton, R.L., 1993. Prestalk cells in monolayer cultures exhibit two distinct modes of cellulose synthesis during stalk cell differentiation in Dictyostelium. Development 119, 703–710. Blanton, R.L., Fuller, D., Iranfar, N., Grimson, M.J., Loomis, W.F., 2000. The cellulose synthase gene of Dictyostelium. Proc. Natl. Acad. Sci. U.S.A. 97, 2391–2396. Bonner, J.T., 2001. First Signals: The Evolution of Multicellular Development. Princeton Univ Press, Princeton, New Jersey, U.S.A.. Bonner, J.T., Savage, L.J., 1947. Evidence for the formation of cell aggregates by chemotaxis in the development of the slime mold Dictyostelium discoideum. J. Exp. Zool. 106, 1–26. Bozzaro, S., Fisher, P.R., Loomis, W., Satir, P., Segall, J.E., 2004. Guenther Gerisch and Dictyostelium, the microbial model for ameboid motility and multicellular morphogenesis. Trends Cell Biol. 14, 585–588. Ceccarelli, A., Mahbubani, H., Williams, J.G., 1991. Positively and negatively acting signals regulating stalk cell and anterior-like cell differentiation in Dictyostelium. Cell 65, 983–989. Cornillon, S., Foa, C., Davoust, J., Buonavista, N., Gross, J.D., Golstein, P., 1994. Programmed cell death in Dictyostelium. J. Cell Sci. 107, 2691–2704. Dauphin, Y., 2001. Comparative studies of skeletal soluble matrices from some Scleractinian corals and Molluscs. Int. J. Biol. Macromol. 28, 293–304. Douzery, E.J.P., Snell, E.A., Bapteste, E., Delsuc, F., Philippe, H., 2004. The timing of eukaryotic evolution: does a relaxed molecular clock reconcile proteins and fossils? Proc. Natl. Acad. Sci. U.S.A. 101, 15386–15391. Dove, P.M., DeYoreo, J.J., Weiner, S., 2003. Biomineralization. In: Rosso, J.J. (Ed.), Reviews in Mineralogy and Geochemistry, vol. 54. The Mineralogical Society of America – Geochemical Society, Washington, U.S.A. Eder, M., Muth, C., Weiss, I.M., submitted for publication. Slow carbonate vapor diffusion and mineral precipitation protocol for Dictyostelium stalks. Data in Brief. Eichinger, L., Rivero-Crespo, F., 2006. Dictyostelium discoideum Protocols (Methods in Molecular Biology). Humana Press, Totowa, New Jersey, U.S.A.. Eichinger, L., Pachebat, J.A., Glockner, G., Rajandream, M.A., et al., 2005. The genome of the social amoeba Dictyostelium discoideum. Nature 435, 43–57. Fey, P., Kowal, A.S., Gaudet, P., Pilcher, K.E., Chisholm, R.L., 2007. Protocols for growth and development of Dictyostelium discoideum. Nat. Protoc. 2, 1307– 1316. Freeze, H., Loomis, W.F., 1978. Chemical analysis of stalk components of Dictyostelium discoideum. Biochim. Biophys. Acta 539, 529–537. Gerisch, G., 1959. Ein Submerskulturverfahren für entwicklungsphysiologische Untersuchungen an Dictyostelium discoideum. Naturwissenschaften 46, 654– 656. Goldstein, J., Newbury, D.E., Echlin, P., Joy, D.C., Romig Jr., A.D., Lyman, C.E., Fiori, C., Lifshin, E., 1992. Scanning Electron Microscopy and X-Ray Microanalysis – A Text for Biologists, Materials Scientists, and Geologists Plenum Press. Springer, New York. Gotliv, B.-A., Addadi, L., Weiner, S., 2003. Mollusk shell acidic proteins: in search of individual functions. ChemBioChem 4, 522–529. Grimson, M.J., Blanton, R.L., 2006. Cryofixation methods for ultrastructural studies of Dictyostelium discoideum. Methods Mol. Biol. (Clifton N.J.) 346, 339–365. Grimson, M.J., Haigler, C.H., Blanton, R.L., 1996. Cellulose microfibrils, cell motility, and plasma membrane protein organization change in parallel during culmination in Dictyostelium discoideum. J. Cell Sci. 109, 3079–3087.

Harper, R.A., 1926. Morphogenesis in Dictyostelium. Bull. Torrey Bot. Club 53, 229– 268. Heinemann, F., Gummich, M., Radmacher, M., Fritz, M., 2011. Modification of CaCO3 precipitation rates by water-soluble nacre proteins. Mater. Sci. Eng., C 31, 99– 105. Hincke, M.T., Tsang, C.P.W., Courtney, M., Hill, V., Narbaitz, R., 1995. Purification and immunochemistry of a soluble matrix protein of the chicken eggshell (ovocleidin 17). Calcif. Tissue Int. 56, 578–583. Insall, R., 2005. The Dictyostelium genome: the private life of a social model revealed? BMC Genomics 6, 222. Jermyn, K.A., Williams, J.G., 1991. An analysis of culmination in Dictyostelium using prestalk and stalk-specific cell autonomous markers. Development 111, 779– 787. Kanaya, K., Okayama, S., 1972. Penetration and energy-loss theory of electrons in solid targets. J. Phys. D Appl. Phys. 5, 43–58. Keene, E.C., Evans, J.S., Estroff, L.A., 2010. Matrix interactions in biomineralization: aragonite nucleation by an intrinsically disordered nacre polypeptide, n16N, associated with a b-chitin substrate. Cryst. Growth Des. 10, 1383–1389. Kim, I.W., DiMasi, E., Evans, J.S., 2004. Identification of mineral modulation sequences within the nacre-associated oyster shell protein, n16. Cryst. Growth Des. 4, 1113–1118. Lakshminarayanan, R., Joseph, J.S., Kini, R.M., Valiyaveettil, S., 2005. Structurefunction relationship of avian eggshell matrix proteins: a comparative study of two major eggshell matrix proteins, ansocalcin and OC-17. Biomacromolecules 6, 741–751. Langenick, J., Araki, T., Yamada, Y., Williams, J.G., 2008. A Dictyostelium homologue of the metazoan Cbl proteins regulates STAT signalling. J. Cell Sci. 121, 3524– 3530. Levi-Kalisman, Y., Falini, G., Addadi, L., Weiner, S., 2001. Structure of the nacreous organic matrix of a bivalve mollusk shell examined in the hydrated state using cryo-TEM. J. Struct. Biol. 135, 8–17. Liu, B.A., Jablonowski, K., Raina, M., Arcé, M., Pawson, T., Nash, P.D., 2006. The human and mouse complement of SH2 domain proteins: establishing the boundaries of phosphotyrosine signaling. Mol. Cell 22, 851–868. Lowenstam, H.A., 1981. Minerals formed by organisms. Science 211, 1126–1131. Lowenstam, H.A., Weiner, S., 1989. On Biomineralization. Oxford Univ. Press, New York. Mann, K., Weiss, I.M., André, S., Gabius, H.J., Fritz, M., 2000. The amino-acid sequence of the abalone (Haliotis laevigata) nacre protein perlucin. Detection of a functional C-type lectin domain with galactose/mannose specificity. Eur. J. Biochem. 267, 5257–5264. Mann, K., Edsinger-Gonzales, E., Mann, M., 2012. In-depth proteomic analysis of a mollusc shell: acid-soluble and acid-insoluble matrix of the limpet Lottia gigantea. Proteome Sci. 10. Manstein, D.J., Schuster, H.P., Morandini, P., Hunt, D.M., 1995. Cloning vectors for the production of proteins in Dictyostelium discoideum. Gene 162, 129–134. Marin, F., Luquet, G., Marie, B., Medakovic, D., Gerald, P.S., 2007. Molluscan shell proteins: primary structure, origin, and evolution. Current Topics in Developmental Biology. Academic Press, pp. 209–276. McGuire, V., Alexander, S., 1996. PsB multiprotein complex of Dictyostelium discoideum: demonstration of cellulose binding activity and order of protein subunit assembly. J. Biol. Chem. 271, 14596–14603. McRobbie, S.J., Tilly, R., Blight, K., Ceccarelli, A., Williams, J.G., 1988. Identification and localization of proteins encoded by two DIF-inducible genes of Dictyostelium. Dev. Biol. 125, 59–63. Metzler, R.A., Evans, J.S., Killian, C.E., Zhou, D., Churchill, T.H., Appathurai, N.P., Coppersmith, S.N., Gilbert, P.U.P.A., 2010. Nacre protein fragment templates lamellar aragonite growth. J. Am. Chem. Soc. 132, 6329–6334. Mikšík, I., Sedláková, P., Lacinová, K., Pataridis, S., Eckhardt, A., 2010. Determination of insoluble avian eggshell matrix proteins. Anal. Bioanal. Chem. 397, 205–214. Morrissey, J.H., Devine, K.M., Loomis, W.F., 1984. The timing of cell-type-specific differentiation in Dictyostelium discoideum. Dev. Biol. 103, 414–424. Neuhaus, E.M., Soldati, T., 1999. Molecular mechanisms of membrane trafficking. What do we learn from Dictyostelium discoideum? Protist 150, 235–243. Pincus, D., Letunic, I., Bork, P., Lim, W.A., 2008. Evolution of the phospho-tyrosine signaling machinery in premetazoan lineages. Proc. Natl. Acad. Sci. U.S.A. 105, 9680–9684. Raper, K.B., 1984. The Dictyostelids. Princeton University Press, Princeton. Raper, K.B., Fennell, D.I., 1952. Stalk formation in Dictyostelium. Bull. Torrey Bot. Club 79, 25–51. Reimer, L., 1998. Scanning Electron Microscopy – Physics of Image Formation and Microanalysis, 2 ed. Springer-Verlag, Berlin Heidelberg. Reyes-Grajeda, J.P., Moreno, A., Romero, A., 2004. Crystal structure of ovocleidin-17, a major protein of the calcified Gallus gallus eggshell: implications in the calcite mineral growth pattern. J. Biol. Chem. 279, 40876–40881. Samata, T., Hayashi, N., Kono, M., Hasegawa, K., Horita, C., Akera, S., 1999. A new matrix protein family related to the nacreous layer formation of Pinctada fucata. FEBS Lett. 462, 225–229. Sambrook, J., Fritsch, E.F., Maniatis, T., 2001. Molecular Cloning,, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, U.S.A.. Schaap, P., Nebl, T., Fisher, P.R., 1996. A slow sustained increase in cytosolic Ca2+ levels mediates stalk gene induction by differentiation inducing factor in Dictyostelium. EMBO J. 15, 5177–5183. Schönitzer, V., Eichner, N., Clausen-Schaumann, H., Weiss, I.M., 2011. Transmembrane myosin chitin synthase involved in mollusc shell formation produced in Dictyostelium is active. Biochem. Biophys. Res. Commun. 415, 586–590.

Please cite this article in press as: Eder, M., et al. In vivo modified organic matrix for testing biomineralization-related protein functions in differentiated Dictyostelium on calcite. J. Struct. Biol. (2016), http://dx.doi.org/10.1016/j.jsb.2016.03.015

M. Eder et al. / Journal of Structural Biology xxx (2016) xxx–xxx Stokes, D.J., 2008. Principles and Practice of Variable Pressure/Environmental Scanning Electron Microscopy (VP-ESEM). John Wiley & Sons Ltd., West Sussex, UK. Suzuki, M., Saruwatari, K., Kogure, T., Yamamoto, Y., Nishimura, T., Kato, T., Nagasawa, H., 2009. An acidic matrix protein, Pif, is a key macromolecule for nacre formation. Science 325, 1388–1390. Ti, Z.C., Wilkins, M.R., Vardy, P.H., Gooley, A.A., Williams, K.L., 1995. Glycoprotein complexes interacting with cellulose in the ‘‘cell print” zones of the Dictyostelium discoideum extracellular matrix. Dev. Biol. 168, 332–341. Tsien, R.Y., 1998. The green fluorescent protein. Annu. Rev. Biochem. 67, 509–544. Veltman, D.M., Akar, G., Bosgraaf, L., Van Haastert, P.J.M., 2009. A new set of small, extrachromosomal expression vectors for Dictyostelium discoideum. Plasmid 61, 110–118. Walhout, A.J.M., Temple, G.F., Brasch, M.A., Hartley, J.L., Lorson, M.A., van den Heuvel, S., Vidal, M., 2000. [34] GATEWAY recombinational cloning: Application to the cloning of large numbers of open reading frames or ORFeomes. In: Thorner, J. et al. (Eds.), Methods in Enzymology. Academic Press, New York, pp. 575–592. Weber, E., Guth, C., Weiss, I.M., 2012a. GFP facilitates native purification of recombinant perlucin derivatives and delays the precipitation of calcium carbonate. PLoS One 7 e46653. Weber, E., Guth, C., Eder, M., Bauer, P., Arzt, E., Weiss, I.M., 2012b. Biotechnological mineral composites via vaterite precursors. In: MRS Proceedings 1465, mrss121465-ss1403-1410. http://dx.doi.org/10.1557/opl.2012.1046. Weber, E., Bloch, L., Guth, C., Fitch, A.N., Weiss, I.M., Pokroy, B., 2014. Incorporation of a recombinant biomineralization fusion protein into the crystalline lattice of calcite. Chem. Mater. 26, 4925–4932.

13

Weiner, S., 1979. Aspartic acid-rich proteins: major components of the soluble organic matrix of mollusk shells. Calcif. Tissue Int. 29, 163–167. Weiner, S., Addadi, L., 2011. Crystallization pathways in biomineralization. Annu. Rev. Mater. Res. 41, 21–40. Weiner, S., Traub, W., 1984. Macromolecules in mollusc shells and their functions in biomineralization. Philos. Trans. R. Soc. Lond. B 304, 425–434. Weiner, S., Talmon, Y., Traub, W., 1983. Electron diffraction of mollusc shell organic matrices and their relationship to the mineral phase. Int. J. Biol. Macromol. 5, 325–328. Weiss, I.M., 2010. Jewels in the pearl. ChemBioChem 11, 297–300. Weiss, I.M., 2012. Species-specific shells: chitin synthases and cell mechanics in molluscs. Z. Kristallogr. 227, 723–738. Weiss, I.M., Marin, F., 2008. The role of enzymes in biomineralization processes. In: Sigel, A.S., Sigel, H., Sigel, R.K.O. (Eds.), Met. Ions Life Sci. – Biomineralization: From Nature to Application. John Wiley & Sons, West Sussex, UK, pp. 71–126. Weiss, I.M., Kaufmann, S., Mann, K., Fritz, M., 2000. Purification and characterization of perlucin and perlustrin, two new proteins from the shell of the mollusc Haliotis laevigata. Biochem. Biophys. Res. Commun. 267, 17–21. Whittingham, W.F., Raper, K.B., 1960. Non-viability of stalk cells in Dictyostelium. Proc. Natl. Acad. Sci. U.S.A. 46, 642–649. Williams, J.G., 2006. Transcriptional regulation of Dictyostelium pattern formation. EMBO Rep. 7, 694–698.

Please cite this article in press as: Eder, M., et al. In vivo modified organic matrix for testing biomineralization-related protein functions in differentiated Dictyostelium on calcite. J. Struct. Biol. (2016), http://dx.doi.org/10.1016/j.jsb.2016.03.015