- Email: [email protected]
Incensole acetate prevents beta-amyloid-induced neurotoxicity in human olfactory bulb neural stem cells
Biomedicine & Pharmacotherapy 105 (2018) 813–823
Contents lists available at ScienceDirect
Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha
Incensole acetate prevents beta-amyloid-induced neurotoxicity in human olfactory bulb neural stem cells
T
⁎
Mohammed A. El-Magda, , Sara F. Khalifab, Faisal Abdulrahman A. Alzahranic, Abdelnaser A. Badawyd, Eman S. El-Shetrye, Lamess M. Dawoodf, Mohammed M. Alruwailig, Hedib A. Alrawailih, Engi F. Rishai, Fathy M. El-Taweelb, Hany E. Mareij a
Department of Anatomy, Faculty of Veterinary Medicine, Kafrelsheikh University, Egypt Department of Chemistry, Faculty of Science, Damietta University, Egypt c Department of Biological Sciences, Rabigh College of Science and Arts, King Abdulaziz University (Jeddah), Rabigh Branch, Rabigh 21911, Saudi Arabia d Department of Medical Biochemistry, Faculty of Medicine, Mansoura University, Egypt e Department of Human Anatomy, Faculty of Medicine, Zagazig University, Egypt f Department of Biochemistry, Faculty of Medicine, Tanta University, Egypt g Medical Laboratory Technology Department, Faculty of Applied Medical Biosciences, Northern Border University, Arar City, Saudi Arabia h Medical Laboratory Sciences Department, School of Health Sciences, Quinnipiac University, Hamden, CT, USA i Department of Clinical Pathology, Faculty of Veterinary Medicine, Mansoura University, Egypt j Department of Cytology and Histology, Faculty of Veterinary Medicine, Mansoura University, Egypt b
A R T I C LE I N FO
A B S T R A C T
Keywords: Incensole acetate Beta amyloid Neurotoxicity Olfactory bulb Neural stem cells
β-Amyloid peptide (Aβ) is a potent neurotoxic protein associated with Alzheimer’s disease (AD) which causes oxidative damage to neurons. Incensole acetate (IA) is a major constituent of Boswellia carterii resin, which has anti-inflammatory and protective properties against damage of a large verity of neural subtypes. However, this neuroprotective effect was not studied on human olfactory bulb neural stem cells (hOBNSCs). Herein, we evaluated this effect and studied the underlying mechanisms. Exposure to Aβ25–35 (5 and 10 μM for 24 h) inhibited proliferation (revealed by downregulation of Nestin and Sox2 gene expression), and induced differentiation (marked by increased expression of the immature neuronal marker Map2 and the astrocyte marker Gfap) of hOBNSCs. However, pre-treatment with IA (100 μM for 4 h) stimulated proliferation and differentiation of neuronal, rather than astrocyte, markers. Moreover, IA pretreatment significantly decreased the Aβ25–35induced viability loss, apoptotic rate (revealed by decreased caspase 3 activity and protein expression, downregulated expression of Bax, caspase 8, cyto c, caspase3, and upregulated expression of Bcl2 mRNAs and proteins, in addition to elevated mitochondrial membrane potential and lowered intracellular Ca+2). IA reduced Aβmediated ROS production (revealed by decreased intracellular ROS and MDA level, and increased SOD, CAT, and GPX contents), and inhibited Aβ-induced inflammation (marked by down-regulated expression of IL1b, TNFa, NfKb, and Cox2 genes). IA also significantly upregulated mRNA and protein expression of Erk1/2 and Nrf2. Notably, IA increased the antioxidant enzyme heme oxygenase-1 (HO-1) expression and this effect was reversed by HO-1 inhibitor zinc protoporphyrin (ZnPP) leading to reduction of the neuroprotective effect of IA against Aβinduced neurotoxicity. These findings clearly show the ability of IA to initiate proliferation and differentiation of neuronal progenitors in hOBNSCs and induce HO-1 expression, thereby protecting the hOBNSCs cells from Aβ25–35-induced oxidative cell death. Thus, IA may be applicable as a potential preventive agent for AD by its effect on hOBNSCs and could also be used as an adjuvant to hOBNSCs in cellular therapy of neurodegenerative diseases.
Abbreviations: Aβ, β-Amyloid peptide; AD, Alzheimer’s disease; HO-1, heme oxygenase-1; hOBNSCs, human olfactory bulb neural stem cells; IA, incensole acetate; iPSCs, induced pluripotent stem cells; MMP, mitochondrial membrane potential; MSCs, mesenchymal stem cells; Nes, nestin; ZnPP, zinc protoporphyrin ⁎ Corresponding authors. E-mail address: [email protected] (M.A. El-Magd). https://doi.org/10.1016/j.biopha.2018.06.014 Received 6 April 2018; Received in revised form 2 June 2018; Accepted 3 June 2018 0753-3322/ © 2018 Elsevier Masson SAS. All rights reserved.
Biomedicine & Pharmacotherapy 105 (2018) 813–823
M.A. El-Magd et al.
1. Introduction
glutamine, 0.6% glucose, 5.2 ng/mL sodium selenite, 0.025 mg/mL insulin, 0.1 mg/mL apo-transferrin sodium salt, 9.6 μg/mL putrescine, 3 mM sodium bicarbonate, 5 mM Hepes, 4 mg/mL BSA, heparin 4 μg/ mL (all from Sigma), 20 ng/mL epidermal growth factor (EGF; PeproTech, Rocky Hill, NJ, USA), 10 ng/mL basic fibroblast growth factor (bFGF; PeproTech, Rocky Hill, NJ, USA), and 20 ng/mL leukemia inhibitory factor (LIF; Immunological Sciences, Rome, Italy). The cells grew in form of free-floating neurospheres and were passaged twice by chemical dissociation (by incubation with accutase for 4 min at 37 °C) every 3–4 d. At passage 3 (P3), the cells were plated (single cell/miniwell) onto 96-well plates for 7 days and the formed secondary neurosphere were dissociated and then cultured (1000 cells/cm2) in serumfree medium containing EGF and bFGF, and passaged up to P14. At P15, cells were plated (18,000 cells/cm2) on 15 μg/ml poly-L-lysine into coated glass coverslips and cultured in DF12 medium containing EGF and bFGF for 3 d. Finally, cells grew in DF12 without growth factors (differentiation medium) for longer culture periods to induce neural differentiation. To detect the effects of Aβ25–35 on proliferation and differentiation of hOBNSCs, cells cultured in either proliferation or differentiation media were incubated with 5 μM [28], or 10 μM [2] of Aβ25–35 peptide (Bachem Bioscience,Torrance, CA) for 24 h. The Aβ25–35 peptide was prepared by incubating freshly solubilized peptides at 400 μM in sterile distilled water at 37 °C for 3 d to induce aggregation and stored frozen at −20 °C until use. To study the effects of IA, cells were pretreated with 100 μM IA for 4 h, and then Aβ25–35 was added to the medium for 24 h. IA was extracted from Boswellia carterii resin and then purified and identified as previously described [29,30]. The IA dose was chosen based on a preliminary dose/response experiment using five doses, 12.5, 25, 50, 100, 200 μM, and the best neuroprotective dose, 100 μM, was selected. Parallel wells were cultured in DF12 without Aβ25–35 or IA (untreated control group).
β-Amyloid peptide (Aβ) is a potent neurotoxic protein which together with intracellular neurofibrillary tangles constitute the main hallmark for Alzheimer’s disease (AD) [1,2]. Aggregation of this peptide induces oxidative stress [1,3] which subsequently leads to neural apoptosis in AD [4,5]. The Aβ25–35 peptide, which recently detected in elderly people, was reported to have more potent neurotoxic effects than the well characteristic full length amyloid peptide, Aβ1–42 [6–8]. Drug treatments and cells based therapies are the most promising strategy for treatment of neurodegenerative diseases. Several types of stem cells, including embryonic stem cells, neural stem cells (NSCs), human olfactory bulb neural stem cells (hOBNSCs), induced pluripotent stem cells (iPSCs), and mesenchymal stem cells (MSCs) have been investigated as a cellular therapy for neural injuries and associated neurodegenerative diseases. Among these cells, hOBNSCs therapy is more acceptable for ethical, moral, and safety concerns. Our previous experiments showed the potential of hOBNSCs to restore cognitive deficit in AD and to regenerate neural damage in spinal cord of rats [9–11]. On the other side, controversial results were obtained regarding the therapeutic effect of other stem cells. Some studies showed negative effect for these cells on AD progression and this was attributed to presence of unfavorable constituents, such as Aβ, which inhibit NSCs proliferation and survival [12–16]. In contrast, other reports showed either a stimulatory effect of Aβ on NSCs proliferation, suggesting enhanced neurogenesis [2,17,18], or no significant effect [19]. None of these studies was applied on hOBNSCs. AD is associated with oxidative stress and inflammation. Many studies highlighted natural herbs as potential neuroprotective candidates to attenuate oxidative stress induced by Aβ deposition in neural cells [7,20]. Boswellic acid derived from Boswellia species was widely used for treatment of various types of inflammation and injuries [21] and as memory enhancer [22]. Incensole acetate (IA), a main constituent of Boswellia carterii resin, has neuroprotective effects against neuronal damage in traumatic and ischemic head injury [23,24]. IA exerts its anti-inflammatory effect through inhibition of pro-inflammatory cytokines, including TNFa, IL1b, TGFb, Cox2, and NFkb [23–25]. However, the mechanisms by which IA mediates its effects are unclear and to the best of our knowledge, no publications are available in the literature that address Aβ-induced cytotoxicity in hOBNSCs. Additionally, ample previous experimental data indicate positive role played by the antioxidant enzyme heme oxygenase-1 (HO-1) in protecting neurons against oxidative stress damage induced by Aβ [6,7]. HO-1 protein levels are normally low in neurons, however it can be remarkably increased during the formation of Aβ in AD brain [26]. Several studies have reported that Erk1/2 can activate cytosolic Nrf2 and help its translocation to nucleus (to protect it from cytosolic degradation) where it promotes synthesis of HO-1 [reviewerd in 7]. Thus, in the present study, we aimed to elucidate the effect of IA on hOBNSCs proliferation and differentiation and to investigate the underlying mechanisms regulating IA effects on Aβ-induced neurotoxicity with special concern to the role of HO-1 and its upstream modulators, Erk1/2 and Nrf2.
2.2. Detection of cell viability by MTT assay MTT assay was performed on hOBNSCs neurospheres cultured in proliferation medium (DF12) in 96-well plates. A volume of 20 μL MTT stock solution (5 mg/ml) was added to either untreated cells, cells treated with Aβ25–35 (at concentrations of 5 or 10 μM) alone or pretreated with IA. Absorbance of extracted resultant MTT formazan, with 150 μL dimethyl sulfoxide (DMSO), was recorded at 570 nm. 2.3. Detection of oxidative stress, mitochondrial membrane potential, and intracellular Ca2+ Intracellular reactive oxygen species (ROS) was measured using the fluorescent probe 2,7-dichlorofluorescein diacetate and mitochondrial membrane potential (MMP) was detected using the rhodamine 123 (Rh123) fluorescence as previously described [7]. The levels of malondialdehyde (MDA), superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPX) were measured using commercial kits and as previously described [20,31]. Intracytoplasmic level of Ca2+ was measured using imaging of the fluorescent probe Fura-2/AM as published procedure [28].
2. Materials and methods 2.4. Caspase3 activity assay 2.1. Human OBNSCs culture and treatment Cells were homogenized in phosphate buffer saline (PBS), the lysates were centrifuged at 15,000 rpm for 10 min at 4 °C and supernatants were collected. Protein concentration was determined by Bradford assay. Equal amounts of protein were incubated for 1 h at 37 °C with the specific fluorogenic substrate of caspase3 (7-amino-4methylcoumarin N-acetyl-L-aspartyl-L-glutamyl-L-valyl-L-aspartic acid amide). Cleavage of the caspase substrates was detected using a fluorescence microtitre plate reader at excitation/emission wavelengths of 360/460 nm.
The olfactory bulbs (OBs) were obtained from two adult patients undergoing craniotomy at the Institute of Neurosurgery, Catholic University, Rome, Italy [27]. Prior signed agreements were obtained according to protocols approved by the Ethical Committee of the Catholic University. Obtained OBs were directly broken down at 37 °C in 0.1% Papain (Sigma-Aldrich, St. Louis, MO, USA) for 30 min. Cell suspensions were grown in a proliferation medium (DF12) composed of DMEM/F12 (1:1) (Invitrogen), 0.025 mg/mL progesterone, 2 mM L814
Biomedicine & Pharmacotherapy 105 (2018) 813–823
M.A. El-Magd et al.
Table 1 Primers used in qPCR.
Nes Sox2 Map2 Gfap Bax Caspase 8 Cyto c Bcl2 TNFa IL1β Cox2 NFkb HO-1 Nrf2 Erk2 B actin
Forward (5'–3')
Reverse (5'–3')
GGGCCTACAGAGCCAGATCG GGATAAGTACACGCTGCCCG GGGTGCATCCAGTTTCTGCG GCTCAATGTCAAGCTGGCCC TGCTTCAGGGTTTCATCCAG AGAGTCTGTGCCCAAATCAAC TTTGGATCCAATGGGTGATGTTGAG AGGAAGTGAACATTTCGGTGAC CCCAGGGACCTCTCTCTAATC ACAGATGAAGTGCTCCTTCCA CCCTTGGGTGTCAAAGGTAA ATGGCTTCTATGAGGCTGAG CGGGCCAGCAACAAAGTG CAGCGACGGAAAGAGTATG GCGCGGGCCCGGAGAT GGTC CTGGAACGGTGAAGGTGACA
CAGGAGGGTCCTGTACGTGG CTGTCCATGCGCTGGTTCAC CCCAATCAATGCTTCCTCGGT CTTTTGCCCCCTCGAATCTGC GGCGGCAATCATCCTCTG GCTGCTTCTCTCTTTGCTGAA TTTGAATTCCTCATTAGTAGCTTTTTTGAG GCTCAGTTCCAGGACCAGGC ATGGGCTACAGGCTTGTCACT GTCGGAGATTCGTAGCTGGAT GCCCTCGCTTATGATCTGTC GTTGTTGTTGGTCTGGATGC AGTGTAAGGACCCATCGGAGAA TGGGCAACCTGGGAGTAG TGAAGCGCAGTAAGATTTTT AAGGGACTTCCTGTAACAATGCA
Herein, we checked this effect on hOBNSCs using Aβ25–35 at two different concentrations; 5 μM [28], and 10 μM [2]. This effect was monitored by detection of relative expression of two proliferation-related genes, nestin (Nes) and Sox2, and two differentiation-related genes, the immature neuron marker Map2 and the astrocyte marker Gfap in hOBNSCs cultured in proliferation and differentiation media, respectively (Fig.1A–D). Treatment the hOBNSCs by each dose of Aβ25–35 led to a significant down-regulation in expression of proliferation-related genes and a significant up-regulation in expression of differentiationrelated genes as compared to untreated (control) cells. However, pretreatment by IA resulted in a robust increase in expression of Nes, Sox2, and Map2, but with notable down-regulation for Gfap in hOBNSCs as compared to cells treated by Aβ25–35 alone. IA induced downregulation of Gfap expression to level similar to that in control cells.
2.5. Detection of relative gene expression by real time PCR Total RNA was isolated from hOBNSCs under proliferation and differentiation conditions using Gene JET RNA Purification Kit (Thermo Scientific) according to the manufacturer’s instructions. RNA was quantified with a Nanodrop, and then 5 μg RNA was reversely transcribed using RevertAid H Minus Reverse Transcriptase (Thermo Scientific) to produce cDNA as previously described [32]. The qPCR was performed using 2 μl cDNA, 1 μL from each primer and 12.5 μL Maxima SYBR Green Master Mix (Thermo Scientific) as follows: 95 °C for 5 min and 45 cycles of 95 °C for 15 s and 60 °C for 1 min. Primer sequences were shown in Table 1 and the melting curves were constructed as previously described [33]. The differences in relative gene expression were normalized with β-actin expression and evaluated using 2−ΔΔCt method.
3.2. IA pre-treatment decreased the Aβ25–35-induced viability loss 2.6. Western blotting analysis The total number of all different size neurospheres was counted under the light microscope. The number and size of hOBNSC neurospheres significantly decreased following addition of 5 or 10 μM Aβ25–35 as compared to untreated control neurospheres (Fig. 2A–C, F). Notably, pretreatment with 100 μM IA significantly increased the number and size of the neurospheres, but remained below that of the control group (Fig. 2D–F). For further confirmation to its observed proliferative effect, we detected the effect of IA on Aβ25–35-induced hOBNSCs cell viability loss by MTT assay. Cells were pre-incubated with 100 μM IA for 4 h and then stressed with 5 or 10 μM Aβ25–35 for 24 h. The two doses of the Aβ25–35 caused approximately 50% decrease in cell viability when compared to untreated cells (Fig. 2G). IA pretreatment significantly ameliorated Aβ25–35-induced cell death at the two different concentrations. A 48–52% decrease in cell viability at Aβ25–35 was restored to 85–89% upon pre-treatment with IA.
Following rinsing in PBS, cells were incubated for 20 min with RIPA lysis buffer, then cell lysates were centrifuged at 15,000 for 15 min and supernatants were collected. Protein concentration was detected using the Bradford method. Proteins were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to nitrocellulose membranes. The membranes were incubated with primary antibodies against the following proteins: Bax, caspase 3, cyto c, caspase 8, Bcl2, HO-1, phosphor-ERK1/2, Nrf2, and B actin (1:1000). Secondary horseradish peroxidase -conjugated anti-rabbit IgG antibody detection was done with enhanced chemiluminescence reagents (Santa Cruz). The density of bands was measured using Image J analysis software. 2.7. Statistical analysis One way ANOVA using GraphPad Prism 5 (GraphPad Software, Inc., LaJolla, CA, USA) was used to determine the difference between the groups. Comparison of means was carried out with Tukey's Honestly Significant Difference (Tukey’s HSD) test. Data were expressed as mean ± standard error of mean (SEM) and significance was declared at P < 0.05.
3.3. IA pre-treatment reduced Aβ25–35-triggered apoptosis The ameliorative effect of IA on apoptosis triggered by Aβ25–35 was first assessed by measuring caspase 3 enzymatic activity and protein expression level as a final marker of apoptosis. Cells treated with Aβ25–35 alone had higher caspase 3 activity and protein expression level than untreated cells (Fig. 3A–C). Pre-treatment with IA reversed this adverse change but the level of caspase 3 enzyme and protein remained higher than that in control cells. Next, the underlying molecular mechanism of apoptosis induced by Aβ25–35 was investigated by detecting changes in the relative mRNA and protein level of the apoptotic markers [Bax, caspase 8, cytochrome c (cyto c)] and the anti-apoptotic marker, Bcl2 using qPCR and western blot analysis (Fig. 3D–K). Exposure of hOBNSCs to Aβ25–35 resulted in a significant increase in the
3. Results 3.1. Effect of Aβ25–35 and IA on proliferation and differentiation of hOBNSCs Previous studies have showed controversial results regarding the effect of Aβ25–35 on the proliferation and differentiation of NSCs. 815
Biomedicine & Pharmacotherapy 105 (2018) 813–823
M.A. El-Magd et al.
Fig. 1. IA pre-treatment increased proliferation of hOBNSCs. Changes in relative expression for proliferation- related genes Nes (A) and Sox2 (B) and differentiationrelated genes, the immature neuron marker Map2 (C) and the astrocyte marker Gfap (D) in hOBNSCs cultured in proliferation and differentiation media, respectively. Data represent three independent experiments and were presented as fold change mean ± SEM from the untreated control (Cnt) cells. !!P < 0.01, !!!P < 0.0001, !!!! P < 0.0001 vs control group; ***P < 0.001, ****P < 0.0001 vs Aβ25–35-treated group.
ROS and found that pretreatment with IA scavenged the elevated intracellular ROS induced by Aβ25–35 (Fig.5A). Second, we investigated IA effect on the lipid peroxidation by measuring the MDA level. Similarly, pre-treatment with IA significantly reduced the elevated MDA level induced by Aβ25–35 (Fig.5B). Third, we studied IA effect on the activities of SOD, CAT, and GPX antioxidant enzymes and found that IA increased the levels of these enzymes, which were reduced by Aβ, to levels comparable to that of untreated cells (Fig. 5C–E).
mRNA and protein level of Bax, caspase 8, cyto c and decrease in the mRNA and protein level of Bcl2 as compared with the untreated cells. Notably, IA pretreatment reversed these changes. 3.4. IA restored the impaired MMP and the elevated Ca2+ level induced by Aβ25–35 Given that mitochondrial membrane potential (MMP) is an important event in early stages of apoptosis, we first examined whether Aβ25–35 could impair MMP and whether IA could improve this effect. Treatment with Aβ25–35 for 24 h significantly reduced MMP (as revealed by lowered Rh123 staining), indicating a mitochondrial dysfunction (Fig.4A). However, IA pretreatment significantly elevated this reduced MMP. For its role in induction of apoptosis of neural cells [34], the levels of intracellular Ca2+ were measured by imaging of the fluorescent calcium indicator dye fura-2 following treatment by Aβ25–35 alone or pre-conditioned with IA. Concentration of intracellular Ca2+ was significantly increased in hOBNSCs that were treated by Aβ25–35 compared to untreated cells (Fig. 4B).Again, IA treatment restored the disrupted calcium homeostasis-induced by Aβ25–35.
3.6. IA ameliorated Aβ25–35-induced inflammation Given that IA exerts its effects through inhibition of inflammatory markers mediated by NFkB, we investigated the effect of Aβ25–35 and IA on expression of inflammation-related genes (IL1b, TNFa, NFkB, and Cox2). Administration of Aβ25–35 caused a robust increase in expression levels of these genes as compared to control (untreated) cells, while pretreatment with IA reversed this effect (Fig.6). 3.7. IA repressed Aβ25–35-induced neurotoxicity through activation of HO-1 First, we assessed the effect of AI on molecules upstream to the antioxidant-related gene, HO1, including Erk1/2 and Nrf2. Our results revealed that Aβ25–35 did not change mRNA and protein levels of Erk1/ 2 and Nrf2 as compared to untreated cells (Fig. 7). In contrast, AI pretreatment significantly upregulated their expression. Second, we investigated the effects of IA on HO-1 induction, as a downstream target
3.5. IA attenuated Aβ-induced oxidative stress Given that Aβ is able to cause neurotoxicity through induction of oxidative stress, we investigated whether IA can attenuate Aβ25–35-induced oxidative stress. First, we assessed IA effect on the intracellular 816
Biomedicine & Pharmacotherapy 105 (2018) 813–823
M.A. El-Magd et al.
Fig. 2. IA pre-treatment inhibited the Aβ25–35-induced viability loss. A representative phase contrast micrograph of hOBNSC neurospheres under five conditions: untreated control (A), Aβ25–35 5 μM (B), Aβ25–35 10 μM (C), Aβ25–35 5 μM + IA 100 μM (D), and Aβ25–35 10 μM + IA 100 μM (E). F) Counts of total neurospheres of all sizes. G) Cell viability was detected with the MTT assay. Data represent three independent experiments and were presented as fold change mean ± SEM from the untreated control cells. !P < 0.05, !!P < 0.01, !!! P < 0.0001 vs control group; *P < 0.05, **P < 0.05, ****P < 0.0001 vs Aβ25–35-treated group. Scale bar = 100 μm.
Aβ25–35-induced neurotoxicity through activation of HO-1, cells were first pre-incubated for 1 h with the HO-1 inhibitor ZnPP, and then for 4 h with IA and finally for 24 h with Aβ, after which cell viability was determined by MTT assays. Our results showed a significant increase in death rate of cells pretreated with the ZnPP as compared to those pretreated with IA, but ZnPP alone didn't result in cytotoxicity (Fig. 7). This suggests that IA attenuated Aβ25–35-induced neurotoxicity through, at least in part, induction of HO-1. 4. Discussion Previous studies have shown that IA, an active component of Boswellia carterii, a herb that used for centuries in traditional medicine, has neuroprotective effect against hippocampal neurodegeneration and can improve cognitive ability in traumatic and ischemic head injuries [23,24]. Hippocampal neurodegeneration is caused by apoptosis-dependant oxidative stress induced by Aβ deposition, leading to AD. Taken together, we hypothesized that IA may mediate its neuroprotective effect through inhibition of Aβ25–35-induced oxidative stress and cell death. To the best of our knowledge, this is the first study to show that IA increased antioxidant enzyme HO-1 expression, probably through activation of Erk1/2 and its downstream target Nrf2, and that the increased HO-1 activity induced by IA is responsible for the neuroprotective effects against the Aβ25–35-induced oxidative cell death. In the present study, we used Aβ25–35 instead of the common used Aβ1–42 because the former, which is a short (only 11 amino acid, GSNKGAIIGLM) derivative of Aβ1–42, is proved to be more neurotoxic than the latter due to its special fibrillary aggregation properties (selfaggregation) that induce ion-channel formation in phospholipid membranes, resulting in robust ROS production and decreased mitochondrial membrane potential [reviewed by 8]. Unlike the full-length Aβ1–42, Aβ25–35 does not need aging to aggregate and become toxic [35]. Aβ25–35 is also the best Aβ fragment to be used in experiments investigating the initial stage of AD, such as the present study. For its potent aggregation capacity and neurotoxicity, presence in elderly people, Aβ25–35 could play an integral role in the pathogenesis of AD [8]. Another novelty for our study is the using of hOBNSCs which were successfully used in our previous studies to restore cognitive deficit in AD and regenerate neural damage in spinal cord of rats [9–11]. These cells in addition to other neural cells of OB have peculiar smell function which usually lost in early stages of AD before its classic clinical signs, memory loss and dementia [36]. Our data may help understanding the underlying mechanisms controlling this dysfunction that may be useful for early clinical diagnosis of AD. Some reports showed that Aβ deposition inhibits NSCs proliferation, leading to impaired neurogenesis [12–16]. Others showed a stimulatory effect of Aβ on NSCs proliferation, suggesting enhanced neurogenesis [2,17,18]. Surprisingly, another study showed neither stimulatory nor inhibitory effects in adult hippocampal neurogenesis following Aβ overexpression [19]. In the present study, treatment of hOBNSCs with Aβ25–35 (5 and 10 μM) led to a significant down-regulation in expression of proliferation-related genes (Nes, and Sox2) and a significant upregulation in expression of differentiation-related genes (Map2 and Gfap) as compared to untreated cells. In support to our findings, LopezToledano and Shelanski also showed that Aβ1-42 might induce differentiation, rather than proliferation, of neuronal progenitors [2].
for Erk1/2 and Nrf2 pathway. Again, AI pre-treatment significantly increased mRNA and protein levels of HO-1 as compared to Aβ25–35treated group (Fig. 7). Third, to functionally prove that IA ameliorated 817
Biomedicine & Pharmacotherapy 105 (2018) 813–823
M.A. El-Magd et al.
Fig. 3. IA pre-treatment reduced Aβ25–35-triggered apoptosis. (A) IA reduced the elevated caspase 3 enzymatic activities induced by Aβ25–35. (B) IA reversed the changes in caspase 3, Bax, caspase 8, cyto c, and Bcl2 proteins expression induced by on Aβ25–35 as measured by Western blots. (C) Densitometric analysis of changes in levels of caspase-3 protein. Changes in relative expression of Bax (D), caspase 8 (F), cyto c (H), and Bcl2 (J) in hOBNSCs cultured in proliferation media as measured by qPCR. Densitometric analysis of changes in levels of Bax (E), caspase 8 (G), cyto c (I), and Bcl2 (K). Data represent three independent experiments and were presented as fold change mean ± SEM from the untreated control (Cnt) cells. **P < 0.01, ***P < 0.001, ****P < 0.0001 vs. control group; !P < 0.05, !! P < 0.01, !!!! P < 0.0001 vs Aβ25–35-treated group. 818
Biomedicine & Pharmacotherapy 105 (2018) 813–823
M.A. El-Magd et al.
Fig. 4. IA improved the impaired MMP and suppressed the elevated intracellular Ca2+ induced by Aβ25–35. (A) Reduced rhodamine 123 fluorescence indicated MMP impairment. (B) Changes in intracellular Ca2+ levels as measured by loading hOBNSCs with Fura-2. Data represent three independent experiments. Values are expressed as % ± SEM (n = 9). ** P < 0.01, ***P < 0.001 vs. untreated control (Cnt) group; !!!P < 0.001, !!!!P < 0.0001 vs Aβ25–35-treated group.
Fig. 5. IA inhibited Aβ25–35-triggered oxidative stress. Oxidative stress was determined by measuring intracellular ROS (A), lipid peroxidation marker MDA (B), and antioxidant enzymes including, SOD (C), CAT (D), and GPX (E). Data represent three independent experiments. Values are expressed as % ± SEM (n = 9). ** P < 0.01, ***P < 0.001, ****P < 0.0001 vs. untreated control (Cnt) group; !!!!P < 0.0001 vs Aβ25–35-treated group.
However, in contrast to our results, this previous study did not find any significant effect for Aβ25–35 when used at a concentration of 10 μM. Our experiments differ from theirs in the type of NSC (human OBNSCs vs rat embryonic NSCs derived from hippocampus) and this could explain the differences in results. On the other hand, our results agree with those reported by Haughey et al. [37] who found an inhibitory effect for 5 μM Aβ25–35 on NSCs derived from cortical tissues of human fetuses. Unlike Aβ25–35, we found that pre-treatment by IA resulted in a robust increase in expression of proliferation-related genes and Map2 gene which is a specific marker for immature neurons. Strikingly, the astrocyte marker Gfap was downregulated in hOBNSCs cultured in differentiation medium. In consistent with our findings, Moussaieff et al. [23] also found an attenuated Gfap expression within the
hippocampus of mice injected by IA, suggesting inactivation of astrocytes formation. Given the significant role for astrocytes in inflammation and the attenuated Gfap expression, IA may exert a neuroprotective effect, at least in part, via its anti-inflammatory activity. These findings are consistent with results of neurosphere assay (count and size) and MTT assay which showed that IA pre-treatment increased the number and size of the neurospheres and decreased the Aβ25–35-induced viability loss and thus, IA protected hOBNSCs against neurotoxic effect of Aβ. Aβ accumulation induces activation of apoptosis-related pathways that cause neuronal dysfunction and loss in AD [4,20]. Consistent with previous studies, we also found high rate of apoptosis in hOBNSCs exposed to Aβ25–35. It is well known that mitochondrial membrane 819
Biomedicine & Pharmacotherapy 105 (2018) 813–823
M.A. El-Magd et al.
Fig. 6. IA ameliorated Aβ25–35-induced inflammation. Changes in relative expression of IL1b (A), TNFa (B),NFkB (C), and Cox2 (D) in hOBNSCs cultured in proliferation media as measured by qPCR. Data represent three independent experiments and were presented as fold change mean ± SEM from the untreated control (Cnt) cells. **P < 0.01, ***P < 0.001 vs. control group; !P < 0.05, !!!!P < 0.0001 vs Aβ25–35-treated group.
antioxidant enzymes activities [3]. In parallel, we also found that IA improved the antioxidant enzymes levels depleted by Aβ25–35. Moreover, our results revealed presence of high levels of the lipid peroxidation marker MDA in hOBNSCs treated by Aβ25–35. Consequently, Aβ25–35 may damage or kill hOBNSCs by stimulating membrane lipid peroxidation, that impairs membrane ion channel and exchange and which, in turn, leads to cellular calcium overproduction and can trigger apoptosis [34]. Indeed, we found that treatment with Aβ25–35 led to a robust increase in intracellular calcium concentrations in hOBNSCs and these levels were restored by IA to levels comparable to control (untreated cells). Calcium can also regulate neuronal differentiation and survival during neurogenesis and its disruption is associated with early onset of some AD forms [44]. Intracellular calcium overproduction can also induce mitochondrial release of cyto c, activation of caspase 3, and ultimately apoptosis [45]. IA prevented Ab25–35-induced calcium overproduction, possibly by inhibiting ROS production and thereby preventing loss of proteins regulating calcium exchange. AD neuro-inflammation may be induced by Aβ and/or astrocyte proliferation, which further triggered pro-inflammatory cytokine accumulation and activation of Cox2 that is expressed in neurons and mediates the synthesis of inflammatory prostaglandins [46]. Previous studies reported induction of pro-inflammatory cytokines (TNFa, IL6, IL1b, and NFkB) activation in AD patients after in vitro stimulation with Aβ [43]. In consistent, we also found a remarkable upregulation for mRNA levels of TNFa, IL1b, NFkB, and Cox2 in hOBNSCs treated by Aβ25–35. On the other hand, IA is a powerful anti-inflammatory with neuroprotective effect, at least in part, via inhibition of TNFa, IL1b, Cox2, and NFkB [23,25]. In agreement, we also found a remarkable downregulation for all examined pro-inflammatory cytokines in hOBNSCs pre-treated by IA. By downregulation of these cytokines, IA likely inhibits downstream stress response induced by Ab25–35. Inflammation and oxidative stress are the main cellular changes related to AD. Consequently, the best preventive therapeutics could contains an anti-inflammatory drug and anti-oxidant. Low AD incidence and risk were noticed in patients who received non-steroidal anti-inflammatory drugs (NASIDs) for 2 years [47]. NASIDs inhibit neuro-inflammation through inactivation of Cox2. Unlike NASIDs which did not significantly improve the cognitive ability of patients, IA enhanced the memory and cognitive ability and has neuroprotective effect. Therefore, IA may be used as a safer and cheaper anti-inflammatory in preventive therapeutic for AD alternative to NASIDs.
potential (MMP) is an important event in early stages of apoptosis. OB proteomic screening suggested a disrupted mitochondrial function as revealed by dysregulation of important 29 mitochondrial proteins during different AD stages [38,39]. Mitochondrial dysfunction due to loss of MMP has been observed in neural cells exposed to Aβ [20], and in AD brain [40], and is necessary for induction of oxidative stress. IA significantly reserved MMP impaired by Aβ25–35, suggesting attenuation of Aβ-induced mitochondrial dysfunction. Loss of MMP can induce apoptosis through activation of caspase-3 activator cyto c release from the mitochondrial matrix to the cytosol via the disrupted mitochondrial membranes. Consequently, cells treated by Aβ25–35 had a marked increase in caspase 3 activity and protein and this change was inhibited by IA. In support, previous studies have reported a crucial role for caspase 3 in Aβ-induced apoptosis in AD brains [4,41] and this effect was ameliorated by natural products [7,20]. As caspase 3 is the end result of the apoptotic pathway, we examined the upstream molecules in this pathway to elucidate the prospective signaling molecules regulating Aβ25–35-induced apoptosis and how this can be ameliorated by IA. In the intrinsic pathway, the anti-apoptotic Bcl2, that resides in the outer mitochondrial wall, inhibits cyto c release from mitochondria, while the pro-apoptotic Bax, which is located in the cytosol, induces cyto c release and translocate to the mitochondria to form a proapoptotic complex with Bcl2 [42]. On the other hand, the extrinsic apoptotic pathway is mediated by caspase 8. In the present study, cells treated with Aβ25–35 alone had a robust increase in Bax, caspase 8, cyto c and a remarkable decrease in Bcl2 mRNAs and proteins, while when pretreated with IA the expression of these molecules was reversed. This suggests involvement of both extrinsic and intrinsic pathways of apoptosis in Aβ25–35-induced neurotoxicity. Similar results regarding the activation of both apoptotic pathways by Aβ were reported by other studies [4,5,41]. Taken together, our findings suggest that IA significantly attenuated Aβ-induced apoptosis and mitochondrial dysfunction, at least in part, through improving MMP, stimulating the antiapoptotic marker Bcl2, and inhibiting pro-apoptotic markers Bax, caspase8, cyto c, caspase 3 in hOBNSCs. Aβ has been proposed as a stressor that can induce cells loss in neurons originated from regions severely affected in AD through stimulation of ROS formation [1,43]. IA protected hOBNSCs against Aβinduced apoptosis by inhibiting overproduction of intracellular ROS. It is also well documented that Aβ exerts its neurotoxic effect via not only induction of oxygen free radicals release but also by repression of 820
Biomedicine & Pharmacotherapy 105 (2018) 813–823
M.A. El-Magd et al.
Fig. 7. IA protected hOBNSCs against Aβ-induced toxicity through HO-1. Changes in relative expression of Erk2 (A), Nrf2 (D), and HO-1 (F) genes in hOBNSCs cultured in proliferation media was measured by qPCR. (B) IA induced upregulation in Erk1/2, Nrf2, and HO-1 proteins expression as measured by Western blots. Densitometric analysis of changes in levels of Erk1/2 (C), Nrf2 (E), and HO-1 (G) proteins. HO-1 enzyme inhibitor ZnPP blocked the protective effect of IA against Aβ25–35-induced cytotoxicity as measured by MTT assay (H). Data represent three independent experiments and were presented as fold change mean ± SEM from the untreated control (Cnt) cells. **P < 0.01, ***P < 0.001, ****P < 0.0001 vs. control group; !P < 0.05, !! P < 0.01, !!!!P < 0.0001 vs Aβ-treated group; ### P < 0.001 vs IA-pretreated group.
Additionally, the protective effects induced by IA were greatly declined by the HO-1 blocker ZnPP. This confirms previous reports that attenuation of Aβ-induced oxidative cell death can involve induction of the HO-1. Given that IA may induce Nrf2, it is likely that IA may activate HO-1 by regulating Nrf2 through Erk1/2 pathway. HO-1 not only
Recent studies have reported inhibition of Aβ-induced oxidative cell death through induction of HO-1 and its upstream inducers, Erk1/2 and Nrf2 [6,7]. To assess this possibility in the context of IA, we investigated its effects on Erk1/2, Nrf2 and HO-1 and found that it can activate Erk1/2, Nrf2 and HO-1 mRNAs and proteins in hOBNSCs. 821
Biomedicine & Pharmacotherapy 105 (2018) 813–823
M.A. El-Magd et al.
acts as endogenous antioxidant but it can also inhibit the production of tau, thereby activation of HO-1 should represent a potential treatment for AD [48]. Whether IA induces HO-1 expression through Erk1/2-dependant Nrf2/ARE activation remains an interesting speculation that waits further investigation. Another important question remains to be answered by the next studies, is that the oxidative stress induced by Aβ25–35 may be independent on Erk1/2, Nrf2, and HO-1 pathways as these molecules were not inhibited when the cells exposed to Aβ25–35. A previous study has even reported a significant increase in HO-1 protein expression following exposure of neural cells to Aβ25–35 alone when compared to untreated cells [7]. The authors attribute this increase to adaptive endogenous anti-oxidative response to tackle oxidative stress induced by Aβ25–35. Moreover, a recent OB proteomic analysis study has revealed that Aβ resulted in different olfactory signaling depending on species and stage of AD, where it induced inactivation of ERK1/2 in 6-months mice, but in human OBs it induced activation of ERK1/2 across AD staging [36]. This ERK1/2 dysregulation precedes Aβ accumulation in the OB of APP/PS1 mouse model of AD. A more recent study by the same group also reported that ERK1/2 activation may be associated with the disrupted cytoskeletal coupling that occurs in olfactory neurons at initial stages of AD, probably leading to the synaptic defect [39].
of cultured rat cortical neurons, Brain Res. 842 (2) (1999) 311–323. [5] M. Folin, S. Baiguera, L. Fioravanzo, M.T. Conconi, C. Grandi, G.G. Nussdorfer, P.P. Parnigotto, Caspase-8 activation and oxidative stress are involved in the cytotoxic effect of beta-amyloid on rat brain microvascular endothelial cells, Int. J. Mol. Med. 17 (3) (2006) 431–435. [6] Y. Wang, Y. Miao, A.Z. Mir, L. Cheng, L. Wang, L. Zhao, Q. Cui, W. Zhao, H. Wang, Inhibition of beta-amyloid-induced neurotoxicity by pinocembrin through Nrf2/ HO-1 pathway in SH-SY5Y cells, J. Neurol. Sci. 368 (2016) 223–230. [7] H.-Q. Wang, X.-B. Sun, Y.-X. Xu, H. Zhao, Q.-Y. Zhu, C.-Q. Zhu, Astaxanthin upregulates heme oxygenase-1 expression through ERK1/2 pathway and its protective effect against beta-amyloid-induced cytotoxicity in SH-SY5Y cells, Brain Res. 1360 (2010) 159–167. [8] L. Millucci, L. Ghezzi, G. Bernardini, A. Santucci, Conformations and biological activities of amyloid beta peptide 25–35, Curr. Protein Pept. Sci. 11 (1) (2010) 54–67. [9] H.E. Marei, A. Althani, N. Afifi, F. Michetti, M. Pescatori, R. Pallini, P. Casalbore, C. Cenciarelli, P. Schwartz, A.E. Ahmed, Gene expression profiling of embryonic human neural stem cells and dopaminergic neurons from adult human substantia nigra, PLoS One 6 (12) (2011) e28420. [10] H.E. Marei, A. Althani, S. Rezk, A. Farag, S. Lashen, N. Afifi, A. Abd-Elmaksoud, R. Pallini, P. Casalbore, C. Cenciarelli, T. Caceci, Therapeutic potential of human olfactory bulb neural stem cells for spinal cord injury in rats, Spinal Cord 54 (10) (2016) 785–797. [11] H.E. Marei, A. Farag, A. Althani, N. Afifi, A. Abd-Elmaksoud, S. Lashen, S. Rezk, R. Pallini, P. Casalbore, C. Cenciarelli, Human olfactory bulb neural stem cells expressing hNGF restore cognitive deficit in Alzheimer’s disease rat model, J. Cell. Physiol. 230 (1) (2015) 116–130. [12] W. Zhang, P.J. Wang, H.Y. Sha, J. Ni, M.H. Li, G.J. Gu, Neural stem cell transplants improve cognitive function without altering amyloid pathology in an APP/PS1 double transgenic model of Alzheimer’s disease, Mol. Neurobiol. 50 (2) (2014) 423–437. [13] Q. Zhang, H.H. Wu, Y. Wang, G.J. Gu, W. Zhang, R. Xia, Neural stem cell transplantation decreases neuroinflammation in a transgenic mouse model of Alzheimer’s disease, J. Neurochem. 136 (4) (2016) 815–825. [14] J.A. Kim, S. Ha, K.Y. Shin, S. Kim, K.J. Lee, Y.H. Chong, K.A. Chang, Y.H. Suh, Neural stem cell transplantation at critical period improves learning and memory through restoring synaptic impairment in Alzheimer’s disease mouse model, Cell Death Dis. 6 (2015) e1789. [15] S.Q. Chen, Q. Cai, Y.Y. Shen, P.Y. Wang, M.H. Li, G.Y. Teng, Neural stem cell transplantation improves spatial learning and memory via neuronal regeneration in amyloid-beta precursor protein/presenilin 1/tau triple transgenic mice, Am. J. Alzheimer’s Dis. Dement. 29 (2) (2014) 142–149. [16] W. Fischer, K. Wictorin, A. Bjorklund, L.R. Williams, S. Varon, F.H. Gage, Amelioration of cholinergic neuron atrophy and spatial memory impairment in aged rats by nerve growth factor, Nature 329 (6134) (1987) 65–68. [17] K. Jin, A.L. Peel, X.O. Mao, L. Xie, B.A. Cottrell, D.C. Henshall, D.A. Greenberg, Increased hippocampal neurogenesis in Alzheimer’s disease, Proc. Natl. Acad. Sci. U. S. A. 101 (1) (2004) 343–347. [18] M.A. Lopez-Toledano, M.L. Shelanski, Increased neurogenesis in young transgenic mice overexpressing human APP(Sw, Ind), J. Alzheimer’s Dis.: JAD 12 (3) (2007) 229–240. [19] M.J. Yetman, J.L. Jankowsky, Wild-type neural progenitors divide and differentiate normally in an amyloid-rich environment, J. Neurosci. 33 (44) (2013) 17335–17341. [20] D.L. Chen, P. Zhang, L. Lin, O. Shuai, H.M. Zhang, S.H. Liu, J.Y. Wang, Protective effect of Bajijiasu against beta-amyloid-induced neurotoxicity in PC12 cells, Cell. Mol. Neurobiol. 33 (6) (2013) 837–850. [21] D. Poeckel, L. Tausch, N. Kather, J. Jauch, O. Werz, Boswellic acids stimulate arachidonic acid release and 12-lipoxygenase activity in human platelets independent of Ca2+ and differentially interact with platelet-type 12-lipoxygenase, Mol. Pharmacol. 70 (3) (2006) 1071–1078. [22] S. Marshall, Frankincense: festive pharmacognosy, Pharm. J. 271 (2003) 862–864. [23] A. Moussaieff, N.A. Shein, J. Tsenter, S. Grigoriadis, C. Simeonidou, A.G. Alexandrovich, V. Trembovler, Y. Ben-Neriah, M.L. Schmitz, B.L. Fiebich, E. Munoz, R. Mechoulam, E. Shohami, Incensole acetate: a novel neuroprotective agent isolated from Boswellia carterii, J. Cerebr. Blood Flow Metab. 28 (7) (2008) 1341–1352. [24] A. Moussaieff, J. Yu, H. Zhu, S. Gattoni-Celli, E. Shohami, M.S. Kindy, Protective effects of incensole acetate on cerebral ischemic injury, Brain Res. 1443 (2012) 89–97. [25] S.I. Ali, C.R. Zhang, A.A. Mohamed, F.K. El-Baz, A.K. Hegazy, M.A. Kord, M.G. Nair, Major constituents of Boswellia carteri resin exhibit cyclooxygenase enzyme inhibition and antiproliferative activity, Nat. Prod.Commun. 8 (10) (2013) 1365–1366. [26] A. Takeda, Y. Itoyama, T. Kimpara, X. Zhu, J. Avila, B.E. Dwyer, G. Perry, M.A. Smith, Heme catabolism and heme oxygenase in neurodegenerative disease, Antioxid. Redox Signal. 6 (5) (2004) 888–894. [27] E. Saad, H. Marei, M. El-Magd, H. El-Fatiry, Molecular characterization of olfactory bulb neural stem cells during proliferation and differentiation, J. Appl. Pharm. Sci. 8 (1) (2018) 087–092. [28] N.J. Haughey, D. Liu, A. Nath, A.C. Borchard, M.P. Mattson, Disruption of neurogenesis in the subventricular zone of adult mice, and in human cortical neuronal precursor cells in culture, by amyloid β-peptide, Neuromol. Med. 1 (2) (2002) 125–135. [29] A. Moussaieff, R. Mechoulam, Boswellia resin: from religious ceremonies to medical uses; a review of in-vitro, in-vivo and clinical trials, J. Pharm. Pharmacol. 61 (10)
5. Conclusions We report for the first time that incensole acetate has the ability to induce proliferation and differentiation of neuronal progenitors of hOBNSCs and ameliorate Aβ25–35 induced oxidative stress, inflammation, and apoptosis in these cells. This neuroprotective effect was not only associated with restoration of the dysregulated MMP, intracellular Ca2+, ROS level, and apoptosis- and inflammation-related mRNA/ protein expression, but also to regulation of antioxidant enzymes HO-1 expression, probably through activation of Erk1/2 and Nrf2 signal pathways. This study advances our understanding of how the anti-inflammatory IA can prevent Aβ-induced neurotoxicity and contribute to the development of hOBNSCs therapies for AD. Authors’ contributions ME and SK contributed to concept and design, collection and assembly of data, data analysis and interpretation, manuscript writing, and final approval of the manuscript. FA, AB, EE, LD, MA, HA and ER contributed to data analysis and interpretation, and manuscript writing. FE and HM contributed to experimental design, manuscript writing and revision. Competing interests The authors declare that there is no competing interests regarding the publication of this paper. Funding This study was funded by authors and no other fund was received. References [1] D.A. Butterfield, J. Drake, C. Pocernich, A. Castegna, Evidence of oxidative damage in Alzheimer’s disease brain: central role for amyloid beta-peptide, Trends Mol. Med. 7 (12) (2001) 548–554. [2] M.A. Lopez-Toledano, M.L. Shelanski, Neurogenic effect of beta-amyloid peptide in the development of neural stem cells, J. Neurosci. 24 (23) (2004) 5439–5444. [3] E. Tamagno, M. Guglielmotto, M. Aragno, R. Borghi, R. Autelli, L. Giliberto, G. Muraca, O. Danni, X. Zhu, M.A. Smith, G. Perry, D.G. Jo, M.P. Mattson, M. Tabaton, Oxidative stress activates a positive feedback between the gamma- and beta-secretase cleavages of the beta-amyloid precursor protein, J. Neurochem. 104 (3) (2008) 683–695. [4] J. Harada, M. Sugimoto, Activation of caspase-3 in beta-amyloid-induced apoptosis
822
Biomedicine & Pharmacotherapy 105 (2018) 813–823
M.A. El-Magd et al.
[39] M. Lachen-Montes, A. Gonzalez-Morales, M.V. Zelaya, E. Perez-Valderrama, K. Ausin, I. Ferrer, J. Fernandez-Irigoyen, E. Santamaria, Olfactory bulb neuroproteomics reveals a chronological perturbation of survival routes and a disruption of prohibitin complex during Alzheimer’s disease progression, Sci. Rep. 7 (1) (2017) 9115. [40] J.X. Chen, S.D. Yan, Pathogenic role of mitochondrial [correction of mitochondral] amyloid-beta peptide, Expert Rev. Neurother. 7 (11) (2007) 1517–1525. [41] J.W. Allen, B.A. Eldadah, X. Huang, S.M. Knoblach, A.I. Faden, Multiple caspases are involved in beta-amyloid-induced neuronal apoptosis, J. Neurosci. Res. 65 (1) (2001) 45–53. [42] D.G. Nicholls, S.L. Budd, Mitochondria and neuronal survival, Physiol. Rev. 80 (1) (2000) 315–360. [43] D. Di Bona, G. Scapagnini, G. Candore, L. Castiglia, G. Colonna-Romano, G. Duro, D. Nuzzo, F. Iemolo, D. Lio, M. Pellicano, V. Scafidi, C. Caruso, S. Vasto, Immuneinflammatory responses and oxidative stress in Alzheimer’s disease: therapeutic implications, Curr. Pharm. Des. 16 (6) (2010) 684–691. [44] M.P. Mattson, F.M. LaFerla, S.L. Chan, M.A. Leissring, P.N. Shepel, J.D. Geiger, Calcium signaling in the ER: its role in neuronal plasticity and neurodegenerative disorders, Trends Neurosci. 23 (5) (2000) 222–229. [45] K. Paszty, A.K. Verma, R. Padanyi, A.G. Filoteo, J.T. Penniston, A. Enyedi, Plasma membrane Ca2+ATPase isoform 4b is cleaved and activated by caspase-3 during the early phase of apoptosis, J. Biol. Chem. 277 (9) (2002) 6822–6829. [46] P. Eikelenboom, E. van Exel, J.J. Hoozemans, R. Veerhuis, A.J. Rozemuller, W.A. van Gool, Neuroinflammation—an early event in both the history and pathogenesis of Alzheimer’s disease, Neuro-Degener. Dis. 7 (1–3) (2010) 38–41. [47] B.A. int’Veld, A. Ruitenberg, A. Hofman, L.J. Launer, C.M. van Duijn, T. Stijnen, M.M. Breteler, B.H. Stricker, Nonsteroidal antiinflammatory drugs and the risk of Alzheimer’s disease, N. Engl. J. Med. 345 (21) (2001) 1515–1521. [48] I. Mateo, P. Sanchez-Juan, E. Rodriguez-Rodriguez, J. Infante, J.L. VazquezHiguera, I. Garcia-Gorostiaga, J. Berciano, O. Combarros, Synergistic effect of heme oxygenase-1 and tau genetic variants on Alzheimer’s disease risk, Dement. Geriatr. Cognit. Disord. 26 (4) (2008) 339–342.
(2009) 1281–1293. [30] S. Corsano, R. Nicoletti, The structure of incensole, Tetrahedron 23 (1967) 1977–1984. [31] M.A. El-Magd, K.A. Kahilo, N.E. Nasr, T. Kamal, M. Shukry, A.A. Saleh, A potential mechanism associated with lead-induced testicular toxicity in rats, Andrologia 49 (9) (2017), http://dx.doi.org/10.1111/and.12750 e12750. [32] M.A. El-Magd, W.S. Abdo, M. El-Maddaway, N.M. Nasr, R.A. Gaber, E.S. El-Shetry, A.A. Saleh, F.A.A. Alzahrani, D.H. Abdelhady, High doses of S-methylcysteine cause hypoxia-induced cardiomyocyte apoptosis accompanied by engulfment of mitochondaria by nucleus, Biomed. Pharmacother. 94 (2017) 589–597. [33] M.A. El-Magd, A. Khamis, S.K. Nasr Eldeen, W.M. Ibrahim, A.F. Salama, Trehalose enhances the antitumor potential of methotrexate against mice bearing Ehrlich ascites carcinoma, Biomed. Pharmacother. 92 (2017) 870–878. [34] R. Sattler, M. Tymianski, Molecular mechanisms of calcium-dependent excitotoxicity, J. Mol. Med. (Berlin, Germany) 78 (1) (2000) 3–13. [35] S. Varadarajan, J. Kanski, M. Aksenova, C. Lauderback, D.A. Butterfield, Different mechanisms of oxidative stress and neurotoxicity for Alzheimer’s A beta(1–42) and A beta(25–35), J. Am. Chem. Soc. 123 (24) (2001) 5625–5631. [36] M. Lachen-Montes, A. Gonzalez-Morales, X.M. de Morentin, E. Perez-Valderrama, K. Ausin, M.V. Zelaya, A. Serna, E. Aso, I. Ferrer, J. Fernandez-Irigoyen, E. Santamaria, An early dysregulation of FAK and MEK/ERK signaling pathways precedes the beta-amyloid deposition in the olfactory bulb of APP/PS1 mouse model of Alzheimer’s disease, J. Proteom. 148 (2016) 149–158. [37] N.J. Haughey, D. Liu, A. Nath, A.C. Borchard, M.P. Mattson, Disruption of neurogenesis in the subventricular zone of adult mice, and in human cortical neuronal precursor cells in culture, by amyloid beta-peptide: implications for the pathogenesis of Alzheimer’s disease, Neuromol. Med. 1 (2) (2002) 125–135. [38] M.V. Zelaya, E. Perez-Valderrama, X.M. de Morentin, T. Tunon, I. Ferrer, M.R. Luquin, J. Fernandez-Irigoyen, E. Santamaria, Olfactory bulb proteome dynamics during the progression of sporadic Alzheimer’s disease: identification of common and distinct olfactory targets across Alzheimer-related co-pathologies, Oncotarget 6 (37) (2015) 39437–39456.
823
Contents lists available at ScienceDirect
Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha
Incensole acetate prevents beta-amyloid-induced neurotoxicity in human olfactory bulb neural stem cells
T
⁎
Mohammed A. El-Magda, , Sara F. Khalifab, Faisal Abdulrahman A. Alzahranic, Abdelnaser A. Badawyd, Eman S. El-Shetrye, Lamess M. Dawoodf, Mohammed M. Alruwailig, Hedib A. Alrawailih, Engi F. Rishai, Fathy M. El-Taweelb, Hany E. Mareij a
Department of Anatomy, Faculty of Veterinary Medicine, Kafrelsheikh University, Egypt Department of Chemistry, Faculty of Science, Damietta University, Egypt c Department of Biological Sciences, Rabigh College of Science and Arts, King Abdulaziz University (Jeddah), Rabigh Branch, Rabigh 21911, Saudi Arabia d Department of Medical Biochemistry, Faculty of Medicine, Mansoura University, Egypt e Department of Human Anatomy, Faculty of Medicine, Zagazig University, Egypt f Department of Biochemistry, Faculty of Medicine, Tanta University, Egypt g Medical Laboratory Technology Department, Faculty of Applied Medical Biosciences, Northern Border University, Arar City, Saudi Arabia h Medical Laboratory Sciences Department, School of Health Sciences, Quinnipiac University, Hamden, CT, USA i Department of Clinical Pathology, Faculty of Veterinary Medicine, Mansoura University, Egypt j Department of Cytology and Histology, Faculty of Veterinary Medicine, Mansoura University, Egypt b
A R T I C LE I N FO
A B S T R A C T
Keywords: Incensole acetate Beta amyloid Neurotoxicity Olfactory bulb Neural stem cells
β-Amyloid peptide (Aβ) is a potent neurotoxic protein associated with Alzheimer’s disease (AD) which causes oxidative damage to neurons. Incensole acetate (IA) is a major constituent of Boswellia carterii resin, which has anti-inflammatory and protective properties against damage of a large verity of neural subtypes. However, this neuroprotective effect was not studied on human olfactory bulb neural stem cells (hOBNSCs). Herein, we evaluated this effect and studied the underlying mechanisms. Exposure to Aβ25–35 (5 and 10 μM for 24 h) inhibited proliferation (revealed by downregulation of Nestin and Sox2 gene expression), and induced differentiation (marked by increased expression of the immature neuronal marker Map2 and the astrocyte marker Gfap) of hOBNSCs. However, pre-treatment with IA (100 μM for 4 h) stimulated proliferation and differentiation of neuronal, rather than astrocyte, markers. Moreover, IA pretreatment significantly decreased the Aβ25–35induced viability loss, apoptotic rate (revealed by decreased caspase 3 activity and protein expression, downregulated expression of Bax, caspase 8, cyto c, caspase3, and upregulated expression of Bcl2 mRNAs and proteins, in addition to elevated mitochondrial membrane potential and lowered intracellular Ca+2). IA reduced Aβmediated ROS production (revealed by decreased intracellular ROS and MDA level, and increased SOD, CAT, and GPX contents), and inhibited Aβ-induced inflammation (marked by down-regulated expression of IL1b, TNFa, NfKb, and Cox2 genes). IA also significantly upregulated mRNA and protein expression of Erk1/2 and Nrf2. Notably, IA increased the antioxidant enzyme heme oxygenase-1 (HO-1) expression and this effect was reversed by HO-1 inhibitor zinc protoporphyrin (ZnPP) leading to reduction of the neuroprotective effect of IA against Aβinduced neurotoxicity. These findings clearly show the ability of IA to initiate proliferation and differentiation of neuronal progenitors in hOBNSCs and induce HO-1 expression, thereby protecting the hOBNSCs cells from Aβ25–35-induced oxidative cell death. Thus, IA may be applicable as a potential preventive agent for AD by its effect on hOBNSCs and could also be used as an adjuvant to hOBNSCs in cellular therapy of neurodegenerative diseases.
Abbreviations: Aβ, β-Amyloid peptide; AD, Alzheimer’s disease; HO-1, heme oxygenase-1; hOBNSCs, human olfactory bulb neural stem cells; IA, incensole acetate; iPSCs, induced pluripotent stem cells; MMP, mitochondrial membrane potential; MSCs, mesenchymal stem cells; Nes, nestin; ZnPP, zinc protoporphyrin ⁎ Corresponding authors. E-mail address: [email protected] (M.A. El-Magd). https://doi.org/10.1016/j.biopha.2018.06.014 Received 6 April 2018; Received in revised form 2 June 2018; Accepted 3 June 2018 0753-3322/ © 2018 Elsevier Masson SAS. All rights reserved.
Biomedicine & Pharmacotherapy 105 (2018) 813–823
M.A. El-Magd et al.
1. Introduction
glutamine, 0.6% glucose, 5.2 ng/mL sodium selenite, 0.025 mg/mL insulin, 0.1 mg/mL apo-transferrin sodium salt, 9.6 μg/mL putrescine, 3 mM sodium bicarbonate, 5 mM Hepes, 4 mg/mL BSA, heparin 4 μg/ mL (all from Sigma), 20 ng/mL epidermal growth factor (EGF; PeproTech, Rocky Hill, NJ, USA), 10 ng/mL basic fibroblast growth factor (bFGF; PeproTech, Rocky Hill, NJ, USA), and 20 ng/mL leukemia inhibitory factor (LIF; Immunological Sciences, Rome, Italy). The cells grew in form of free-floating neurospheres and were passaged twice by chemical dissociation (by incubation with accutase for 4 min at 37 °C) every 3–4 d. At passage 3 (P3), the cells were plated (single cell/miniwell) onto 96-well plates for 7 days and the formed secondary neurosphere were dissociated and then cultured (1000 cells/cm2) in serumfree medium containing EGF and bFGF, and passaged up to P14. At P15, cells were plated (18,000 cells/cm2) on 15 μg/ml poly-L-lysine into coated glass coverslips and cultured in DF12 medium containing EGF and bFGF for 3 d. Finally, cells grew in DF12 without growth factors (differentiation medium) for longer culture periods to induce neural differentiation. To detect the effects of Aβ25–35 on proliferation and differentiation of hOBNSCs, cells cultured in either proliferation or differentiation media were incubated with 5 μM [28], or 10 μM [2] of Aβ25–35 peptide (Bachem Bioscience,Torrance, CA) for 24 h. The Aβ25–35 peptide was prepared by incubating freshly solubilized peptides at 400 μM in sterile distilled water at 37 °C for 3 d to induce aggregation and stored frozen at −20 °C until use. To study the effects of IA, cells were pretreated with 100 μM IA for 4 h, and then Aβ25–35 was added to the medium for 24 h. IA was extracted from Boswellia carterii resin and then purified and identified as previously described [29,30]. The IA dose was chosen based on a preliminary dose/response experiment using five doses, 12.5, 25, 50, 100, 200 μM, and the best neuroprotective dose, 100 μM, was selected. Parallel wells were cultured in DF12 without Aβ25–35 or IA (untreated control group).
β-Amyloid peptide (Aβ) is a potent neurotoxic protein which together with intracellular neurofibrillary tangles constitute the main hallmark for Alzheimer’s disease (AD) [1,2]. Aggregation of this peptide induces oxidative stress [1,3] which subsequently leads to neural apoptosis in AD [4,5]. The Aβ25–35 peptide, which recently detected in elderly people, was reported to have more potent neurotoxic effects than the well characteristic full length amyloid peptide, Aβ1–42 [6–8]. Drug treatments and cells based therapies are the most promising strategy for treatment of neurodegenerative diseases. Several types of stem cells, including embryonic stem cells, neural stem cells (NSCs), human olfactory bulb neural stem cells (hOBNSCs), induced pluripotent stem cells (iPSCs), and mesenchymal stem cells (MSCs) have been investigated as a cellular therapy for neural injuries and associated neurodegenerative diseases. Among these cells, hOBNSCs therapy is more acceptable for ethical, moral, and safety concerns. Our previous experiments showed the potential of hOBNSCs to restore cognitive deficit in AD and to regenerate neural damage in spinal cord of rats [9–11]. On the other side, controversial results were obtained regarding the therapeutic effect of other stem cells. Some studies showed negative effect for these cells on AD progression and this was attributed to presence of unfavorable constituents, such as Aβ, which inhibit NSCs proliferation and survival [12–16]. In contrast, other reports showed either a stimulatory effect of Aβ on NSCs proliferation, suggesting enhanced neurogenesis [2,17,18], or no significant effect [19]. None of these studies was applied on hOBNSCs. AD is associated with oxidative stress and inflammation. Many studies highlighted natural herbs as potential neuroprotective candidates to attenuate oxidative stress induced by Aβ deposition in neural cells [7,20]. Boswellic acid derived from Boswellia species was widely used for treatment of various types of inflammation and injuries [21] and as memory enhancer [22]. Incensole acetate (IA), a main constituent of Boswellia carterii resin, has neuroprotective effects against neuronal damage in traumatic and ischemic head injury [23,24]. IA exerts its anti-inflammatory effect through inhibition of pro-inflammatory cytokines, including TNFa, IL1b, TGFb, Cox2, and NFkb [23–25]. However, the mechanisms by which IA mediates its effects are unclear and to the best of our knowledge, no publications are available in the literature that address Aβ-induced cytotoxicity in hOBNSCs. Additionally, ample previous experimental data indicate positive role played by the antioxidant enzyme heme oxygenase-1 (HO-1) in protecting neurons against oxidative stress damage induced by Aβ [6,7]. HO-1 protein levels are normally low in neurons, however it can be remarkably increased during the formation of Aβ in AD brain [26]. Several studies have reported that Erk1/2 can activate cytosolic Nrf2 and help its translocation to nucleus (to protect it from cytosolic degradation) where it promotes synthesis of HO-1 [reviewerd in 7]. Thus, in the present study, we aimed to elucidate the effect of IA on hOBNSCs proliferation and differentiation and to investigate the underlying mechanisms regulating IA effects on Aβ-induced neurotoxicity with special concern to the role of HO-1 and its upstream modulators, Erk1/2 and Nrf2.
2.2. Detection of cell viability by MTT assay MTT assay was performed on hOBNSCs neurospheres cultured in proliferation medium (DF12) in 96-well plates. A volume of 20 μL MTT stock solution (5 mg/ml) was added to either untreated cells, cells treated with Aβ25–35 (at concentrations of 5 or 10 μM) alone or pretreated with IA. Absorbance of extracted resultant MTT formazan, with 150 μL dimethyl sulfoxide (DMSO), was recorded at 570 nm. 2.3. Detection of oxidative stress, mitochondrial membrane potential, and intracellular Ca2+ Intracellular reactive oxygen species (ROS) was measured using the fluorescent probe 2,7-dichlorofluorescein diacetate and mitochondrial membrane potential (MMP) was detected using the rhodamine 123 (Rh123) fluorescence as previously described [7]. The levels of malondialdehyde (MDA), superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPX) were measured using commercial kits and as previously described [20,31]. Intracytoplasmic level of Ca2+ was measured using imaging of the fluorescent probe Fura-2/AM as published procedure [28].
2. Materials and methods 2.4. Caspase3 activity assay 2.1. Human OBNSCs culture and treatment Cells were homogenized in phosphate buffer saline (PBS), the lysates were centrifuged at 15,000 rpm for 10 min at 4 °C and supernatants were collected. Protein concentration was determined by Bradford assay. Equal amounts of protein were incubated for 1 h at 37 °C with the specific fluorogenic substrate of caspase3 (7-amino-4methylcoumarin N-acetyl-L-aspartyl-L-glutamyl-L-valyl-L-aspartic acid amide). Cleavage of the caspase substrates was detected using a fluorescence microtitre plate reader at excitation/emission wavelengths of 360/460 nm.
The olfactory bulbs (OBs) were obtained from two adult patients undergoing craniotomy at the Institute of Neurosurgery, Catholic University, Rome, Italy [27]. Prior signed agreements were obtained according to protocols approved by the Ethical Committee of the Catholic University. Obtained OBs were directly broken down at 37 °C in 0.1% Papain (Sigma-Aldrich, St. Louis, MO, USA) for 30 min. Cell suspensions were grown in a proliferation medium (DF12) composed of DMEM/F12 (1:1) (Invitrogen), 0.025 mg/mL progesterone, 2 mM L814
Biomedicine & Pharmacotherapy 105 (2018) 813–823
M.A. El-Magd et al.
Table 1 Primers used in qPCR.
Nes Sox2 Map2 Gfap Bax Caspase 8 Cyto c Bcl2 TNFa IL1β Cox2 NFkb HO-1 Nrf2 Erk2 B actin
Forward (5'–3')
Reverse (5'–3')
GGGCCTACAGAGCCAGATCG GGATAAGTACACGCTGCCCG GGGTGCATCCAGTTTCTGCG GCTCAATGTCAAGCTGGCCC TGCTTCAGGGTTTCATCCAG AGAGTCTGTGCCCAAATCAAC TTTGGATCCAATGGGTGATGTTGAG AGGAAGTGAACATTTCGGTGAC CCCAGGGACCTCTCTCTAATC ACAGATGAAGTGCTCCTTCCA CCCTTGGGTGTCAAAGGTAA ATGGCTTCTATGAGGCTGAG CGGGCCAGCAACAAAGTG CAGCGACGGAAAGAGTATG GCGCGGGCCCGGAGAT GGTC CTGGAACGGTGAAGGTGACA
CAGGAGGGTCCTGTACGTGG CTGTCCATGCGCTGGTTCAC CCCAATCAATGCTTCCTCGGT CTTTTGCCCCCTCGAATCTGC GGCGGCAATCATCCTCTG GCTGCTTCTCTCTTTGCTGAA TTTGAATTCCTCATTAGTAGCTTTTTTGAG GCTCAGTTCCAGGACCAGGC ATGGGCTACAGGCTTGTCACT GTCGGAGATTCGTAGCTGGAT GCCCTCGCTTATGATCTGTC GTTGTTGTTGGTCTGGATGC AGTGTAAGGACCCATCGGAGAA TGGGCAACCTGGGAGTAG TGAAGCGCAGTAAGATTTTT AAGGGACTTCCTGTAACAATGCA
Herein, we checked this effect on hOBNSCs using Aβ25–35 at two different concentrations; 5 μM [28], and 10 μM [2]. This effect was monitored by detection of relative expression of two proliferation-related genes, nestin (Nes) and Sox2, and two differentiation-related genes, the immature neuron marker Map2 and the astrocyte marker Gfap in hOBNSCs cultured in proliferation and differentiation media, respectively (Fig.1A–D). Treatment the hOBNSCs by each dose of Aβ25–35 led to a significant down-regulation in expression of proliferation-related genes and a significant up-regulation in expression of differentiationrelated genes as compared to untreated (control) cells. However, pretreatment by IA resulted in a robust increase in expression of Nes, Sox2, and Map2, but with notable down-regulation for Gfap in hOBNSCs as compared to cells treated by Aβ25–35 alone. IA induced downregulation of Gfap expression to level similar to that in control cells.
2.5. Detection of relative gene expression by real time PCR Total RNA was isolated from hOBNSCs under proliferation and differentiation conditions using Gene JET RNA Purification Kit (Thermo Scientific) according to the manufacturer’s instructions. RNA was quantified with a Nanodrop, and then 5 μg RNA was reversely transcribed using RevertAid H Minus Reverse Transcriptase (Thermo Scientific) to produce cDNA as previously described [32]. The qPCR was performed using 2 μl cDNA, 1 μL from each primer and 12.5 μL Maxima SYBR Green Master Mix (Thermo Scientific) as follows: 95 °C for 5 min and 45 cycles of 95 °C for 15 s and 60 °C for 1 min. Primer sequences were shown in Table 1 and the melting curves were constructed as previously described [33]. The differences in relative gene expression were normalized with β-actin expression and evaluated using 2−ΔΔCt method.
3.2. IA pre-treatment decreased the Aβ25–35-induced viability loss 2.6. Western blotting analysis The total number of all different size neurospheres was counted under the light microscope. The number and size of hOBNSC neurospheres significantly decreased following addition of 5 or 10 μM Aβ25–35 as compared to untreated control neurospheres (Fig. 2A–C, F). Notably, pretreatment with 100 μM IA significantly increased the number and size of the neurospheres, but remained below that of the control group (Fig. 2D–F). For further confirmation to its observed proliferative effect, we detected the effect of IA on Aβ25–35-induced hOBNSCs cell viability loss by MTT assay. Cells were pre-incubated with 100 μM IA for 4 h and then stressed with 5 or 10 μM Aβ25–35 for 24 h. The two doses of the Aβ25–35 caused approximately 50% decrease in cell viability when compared to untreated cells (Fig. 2G). IA pretreatment significantly ameliorated Aβ25–35-induced cell death at the two different concentrations. A 48–52% decrease in cell viability at Aβ25–35 was restored to 85–89% upon pre-treatment with IA.
Following rinsing in PBS, cells were incubated for 20 min with RIPA lysis buffer, then cell lysates were centrifuged at 15,000 for 15 min and supernatants were collected. Protein concentration was detected using the Bradford method. Proteins were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to nitrocellulose membranes. The membranes were incubated with primary antibodies against the following proteins: Bax, caspase 3, cyto c, caspase 8, Bcl2, HO-1, phosphor-ERK1/2, Nrf2, and B actin (1:1000). Secondary horseradish peroxidase -conjugated anti-rabbit IgG antibody detection was done with enhanced chemiluminescence reagents (Santa Cruz). The density of bands was measured using Image J analysis software. 2.7. Statistical analysis One way ANOVA using GraphPad Prism 5 (GraphPad Software, Inc., LaJolla, CA, USA) was used to determine the difference between the groups. Comparison of means was carried out with Tukey's Honestly Significant Difference (Tukey’s HSD) test. Data were expressed as mean ± standard error of mean (SEM) and significance was declared at P < 0.05.
3.3. IA pre-treatment reduced Aβ25–35-triggered apoptosis The ameliorative effect of IA on apoptosis triggered by Aβ25–35 was first assessed by measuring caspase 3 enzymatic activity and protein expression level as a final marker of apoptosis. Cells treated with Aβ25–35 alone had higher caspase 3 activity and protein expression level than untreated cells (Fig. 3A–C). Pre-treatment with IA reversed this adverse change but the level of caspase 3 enzyme and protein remained higher than that in control cells. Next, the underlying molecular mechanism of apoptosis induced by Aβ25–35 was investigated by detecting changes in the relative mRNA and protein level of the apoptotic markers [Bax, caspase 8, cytochrome c (cyto c)] and the anti-apoptotic marker, Bcl2 using qPCR and western blot analysis (Fig. 3D–K). Exposure of hOBNSCs to Aβ25–35 resulted in a significant increase in the
3. Results 3.1. Effect of Aβ25–35 and IA on proliferation and differentiation of hOBNSCs Previous studies have showed controversial results regarding the effect of Aβ25–35 on the proliferation and differentiation of NSCs. 815
Biomedicine & Pharmacotherapy 105 (2018) 813–823
M.A. El-Magd et al.
Fig. 1. IA pre-treatment increased proliferation of hOBNSCs. Changes in relative expression for proliferation- related genes Nes (A) and Sox2 (B) and differentiationrelated genes, the immature neuron marker Map2 (C) and the astrocyte marker Gfap (D) in hOBNSCs cultured in proliferation and differentiation media, respectively. Data represent three independent experiments and were presented as fold change mean ± SEM from the untreated control (Cnt) cells. !!P < 0.01, !!!P < 0.0001, !!!! P < 0.0001 vs control group; ***P < 0.001, ****P < 0.0001 vs Aβ25–35-treated group.
ROS and found that pretreatment with IA scavenged the elevated intracellular ROS induced by Aβ25–35 (Fig.5A). Second, we investigated IA effect on the lipid peroxidation by measuring the MDA level. Similarly, pre-treatment with IA significantly reduced the elevated MDA level induced by Aβ25–35 (Fig.5B). Third, we studied IA effect on the activities of SOD, CAT, and GPX antioxidant enzymes and found that IA increased the levels of these enzymes, which were reduced by Aβ, to levels comparable to that of untreated cells (Fig. 5C–E).
mRNA and protein level of Bax, caspase 8, cyto c and decrease in the mRNA and protein level of Bcl2 as compared with the untreated cells. Notably, IA pretreatment reversed these changes. 3.4. IA restored the impaired MMP and the elevated Ca2+ level induced by Aβ25–35 Given that mitochondrial membrane potential (MMP) is an important event in early stages of apoptosis, we first examined whether Aβ25–35 could impair MMP and whether IA could improve this effect. Treatment with Aβ25–35 for 24 h significantly reduced MMP (as revealed by lowered Rh123 staining), indicating a mitochondrial dysfunction (Fig.4A). However, IA pretreatment significantly elevated this reduced MMP. For its role in induction of apoptosis of neural cells [34], the levels of intracellular Ca2+ were measured by imaging of the fluorescent calcium indicator dye fura-2 following treatment by Aβ25–35 alone or pre-conditioned with IA. Concentration of intracellular Ca2+ was significantly increased in hOBNSCs that were treated by Aβ25–35 compared to untreated cells (Fig. 4B).Again, IA treatment restored the disrupted calcium homeostasis-induced by Aβ25–35.
3.6. IA ameliorated Aβ25–35-induced inflammation Given that IA exerts its effects through inhibition of inflammatory markers mediated by NFkB, we investigated the effect of Aβ25–35 and IA on expression of inflammation-related genes (IL1b, TNFa, NFkB, and Cox2). Administration of Aβ25–35 caused a robust increase in expression levels of these genes as compared to control (untreated) cells, while pretreatment with IA reversed this effect (Fig.6). 3.7. IA repressed Aβ25–35-induced neurotoxicity through activation of HO-1 First, we assessed the effect of AI on molecules upstream to the antioxidant-related gene, HO1, including Erk1/2 and Nrf2. Our results revealed that Aβ25–35 did not change mRNA and protein levels of Erk1/ 2 and Nrf2 as compared to untreated cells (Fig. 7). In contrast, AI pretreatment significantly upregulated their expression. Second, we investigated the effects of IA on HO-1 induction, as a downstream target
3.5. IA attenuated Aβ-induced oxidative stress Given that Aβ is able to cause neurotoxicity through induction of oxidative stress, we investigated whether IA can attenuate Aβ25–35-induced oxidative stress. First, we assessed IA effect on the intracellular 816
Biomedicine & Pharmacotherapy 105 (2018) 813–823
M.A. El-Magd et al.
Fig. 2. IA pre-treatment inhibited the Aβ25–35-induced viability loss. A representative phase contrast micrograph of hOBNSC neurospheres under five conditions: untreated control (A), Aβ25–35 5 μM (B), Aβ25–35 10 μM (C), Aβ25–35 5 μM + IA 100 μM (D), and Aβ25–35 10 μM + IA 100 μM (E). F) Counts of total neurospheres of all sizes. G) Cell viability was detected with the MTT assay. Data represent three independent experiments and were presented as fold change mean ± SEM from the untreated control cells. !P < 0.05, !!P < 0.01, !!! P < 0.0001 vs control group; *P < 0.05, **P < 0.05, ****P < 0.0001 vs Aβ25–35-treated group. Scale bar = 100 μm.
Aβ25–35-induced neurotoxicity through activation of HO-1, cells were first pre-incubated for 1 h with the HO-1 inhibitor ZnPP, and then for 4 h with IA and finally for 24 h with Aβ, after which cell viability was determined by MTT assays. Our results showed a significant increase in death rate of cells pretreated with the ZnPP as compared to those pretreated with IA, but ZnPP alone didn't result in cytotoxicity (Fig. 7). This suggests that IA attenuated Aβ25–35-induced neurotoxicity through, at least in part, induction of HO-1. 4. Discussion Previous studies have shown that IA, an active component of Boswellia carterii, a herb that used for centuries in traditional medicine, has neuroprotective effect against hippocampal neurodegeneration and can improve cognitive ability in traumatic and ischemic head injuries [23,24]. Hippocampal neurodegeneration is caused by apoptosis-dependant oxidative stress induced by Aβ deposition, leading to AD. Taken together, we hypothesized that IA may mediate its neuroprotective effect through inhibition of Aβ25–35-induced oxidative stress and cell death. To the best of our knowledge, this is the first study to show that IA increased antioxidant enzyme HO-1 expression, probably through activation of Erk1/2 and its downstream target Nrf2, and that the increased HO-1 activity induced by IA is responsible for the neuroprotective effects against the Aβ25–35-induced oxidative cell death. In the present study, we used Aβ25–35 instead of the common used Aβ1–42 because the former, which is a short (only 11 amino acid, GSNKGAIIGLM) derivative of Aβ1–42, is proved to be more neurotoxic than the latter due to its special fibrillary aggregation properties (selfaggregation) that induce ion-channel formation in phospholipid membranes, resulting in robust ROS production and decreased mitochondrial membrane potential [reviewed by 8]. Unlike the full-length Aβ1–42, Aβ25–35 does not need aging to aggregate and become toxic [35]. Aβ25–35 is also the best Aβ fragment to be used in experiments investigating the initial stage of AD, such as the present study. For its potent aggregation capacity and neurotoxicity, presence in elderly people, Aβ25–35 could play an integral role in the pathogenesis of AD [8]. Another novelty for our study is the using of hOBNSCs which were successfully used in our previous studies to restore cognitive deficit in AD and regenerate neural damage in spinal cord of rats [9–11]. These cells in addition to other neural cells of OB have peculiar smell function which usually lost in early stages of AD before its classic clinical signs, memory loss and dementia [36]. Our data may help understanding the underlying mechanisms controlling this dysfunction that may be useful for early clinical diagnosis of AD. Some reports showed that Aβ deposition inhibits NSCs proliferation, leading to impaired neurogenesis [12–16]. Others showed a stimulatory effect of Aβ on NSCs proliferation, suggesting enhanced neurogenesis [2,17,18]. Surprisingly, another study showed neither stimulatory nor inhibitory effects in adult hippocampal neurogenesis following Aβ overexpression [19]. In the present study, treatment of hOBNSCs with Aβ25–35 (5 and 10 μM) led to a significant down-regulation in expression of proliferation-related genes (Nes, and Sox2) and a significant upregulation in expression of differentiation-related genes (Map2 and Gfap) as compared to untreated cells. In support to our findings, LopezToledano and Shelanski also showed that Aβ1-42 might induce differentiation, rather than proliferation, of neuronal progenitors [2].
for Erk1/2 and Nrf2 pathway. Again, AI pre-treatment significantly increased mRNA and protein levels of HO-1 as compared to Aβ25–35treated group (Fig. 7). Third, to functionally prove that IA ameliorated 817
Biomedicine & Pharmacotherapy 105 (2018) 813–823
M.A. El-Magd et al.
Fig. 3. IA pre-treatment reduced Aβ25–35-triggered apoptosis. (A) IA reduced the elevated caspase 3 enzymatic activities induced by Aβ25–35. (B) IA reversed the changes in caspase 3, Bax, caspase 8, cyto c, and Bcl2 proteins expression induced by on Aβ25–35 as measured by Western blots. (C) Densitometric analysis of changes in levels of caspase-3 protein. Changes in relative expression of Bax (D), caspase 8 (F), cyto c (H), and Bcl2 (J) in hOBNSCs cultured in proliferation media as measured by qPCR. Densitometric analysis of changes in levels of Bax (E), caspase 8 (G), cyto c (I), and Bcl2 (K). Data represent three independent experiments and were presented as fold change mean ± SEM from the untreated control (Cnt) cells. **P < 0.01, ***P < 0.001, ****P < 0.0001 vs. control group; !P < 0.05, !! P < 0.01, !!!! P < 0.0001 vs Aβ25–35-treated group. 818
Biomedicine & Pharmacotherapy 105 (2018) 813–823
M.A. El-Magd et al.
Fig. 4. IA improved the impaired MMP and suppressed the elevated intracellular Ca2+ induced by Aβ25–35. (A) Reduced rhodamine 123 fluorescence indicated MMP impairment. (B) Changes in intracellular Ca2+ levels as measured by loading hOBNSCs with Fura-2. Data represent three independent experiments. Values are expressed as % ± SEM (n = 9). ** P < 0.01, ***P < 0.001 vs. untreated control (Cnt) group; !!!P < 0.001, !!!!P < 0.0001 vs Aβ25–35-treated group.
Fig. 5. IA inhibited Aβ25–35-triggered oxidative stress. Oxidative stress was determined by measuring intracellular ROS (A), lipid peroxidation marker MDA (B), and antioxidant enzymes including, SOD (C), CAT (D), and GPX (E). Data represent three independent experiments. Values are expressed as % ± SEM (n = 9). ** P < 0.01, ***P < 0.001, ****P < 0.0001 vs. untreated control (Cnt) group; !!!!P < 0.0001 vs Aβ25–35-treated group.
However, in contrast to our results, this previous study did not find any significant effect for Aβ25–35 when used at a concentration of 10 μM. Our experiments differ from theirs in the type of NSC (human OBNSCs vs rat embryonic NSCs derived from hippocampus) and this could explain the differences in results. On the other hand, our results agree with those reported by Haughey et al. [37] who found an inhibitory effect for 5 μM Aβ25–35 on NSCs derived from cortical tissues of human fetuses. Unlike Aβ25–35, we found that pre-treatment by IA resulted in a robust increase in expression of proliferation-related genes and Map2 gene which is a specific marker for immature neurons. Strikingly, the astrocyte marker Gfap was downregulated in hOBNSCs cultured in differentiation medium. In consistent with our findings, Moussaieff et al. [23] also found an attenuated Gfap expression within the
hippocampus of mice injected by IA, suggesting inactivation of astrocytes formation. Given the significant role for astrocytes in inflammation and the attenuated Gfap expression, IA may exert a neuroprotective effect, at least in part, via its anti-inflammatory activity. These findings are consistent with results of neurosphere assay (count and size) and MTT assay which showed that IA pre-treatment increased the number and size of the neurospheres and decreased the Aβ25–35-induced viability loss and thus, IA protected hOBNSCs against neurotoxic effect of Aβ. Aβ accumulation induces activation of apoptosis-related pathways that cause neuronal dysfunction and loss in AD [4,20]. Consistent with previous studies, we also found high rate of apoptosis in hOBNSCs exposed to Aβ25–35. It is well known that mitochondrial membrane 819
Biomedicine & Pharmacotherapy 105 (2018) 813–823
M.A. El-Magd et al.
Fig. 6. IA ameliorated Aβ25–35-induced inflammation. Changes in relative expression of IL1b (A), TNFa (B),NFkB (C), and Cox2 (D) in hOBNSCs cultured in proliferation media as measured by qPCR. Data represent three independent experiments and were presented as fold change mean ± SEM from the untreated control (Cnt) cells. **P < 0.01, ***P < 0.001 vs. control group; !P < 0.05, !!!!P < 0.0001 vs Aβ25–35-treated group.
antioxidant enzymes activities [3]. In parallel, we also found that IA improved the antioxidant enzymes levels depleted by Aβ25–35. Moreover, our results revealed presence of high levels of the lipid peroxidation marker MDA in hOBNSCs treated by Aβ25–35. Consequently, Aβ25–35 may damage or kill hOBNSCs by stimulating membrane lipid peroxidation, that impairs membrane ion channel and exchange and which, in turn, leads to cellular calcium overproduction and can trigger apoptosis [34]. Indeed, we found that treatment with Aβ25–35 led to a robust increase in intracellular calcium concentrations in hOBNSCs and these levels were restored by IA to levels comparable to control (untreated cells). Calcium can also regulate neuronal differentiation and survival during neurogenesis and its disruption is associated with early onset of some AD forms [44]. Intracellular calcium overproduction can also induce mitochondrial release of cyto c, activation of caspase 3, and ultimately apoptosis [45]. IA prevented Ab25–35-induced calcium overproduction, possibly by inhibiting ROS production and thereby preventing loss of proteins regulating calcium exchange. AD neuro-inflammation may be induced by Aβ and/or astrocyte proliferation, which further triggered pro-inflammatory cytokine accumulation and activation of Cox2 that is expressed in neurons and mediates the synthesis of inflammatory prostaglandins [46]. Previous studies reported induction of pro-inflammatory cytokines (TNFa, IL6, IL1b, and NFkB) activation in AD patients after in vitro stimulation with Aβ [43]. In consistent, we also found a remarkable upregulation for mRNA levels of TNFa, IL1b, NFkB, and Cox2 in hOBNSCs treated by Aβ25–35. On the other hand, IA is a powerful anti-inflammatory with neuroprotective effect, at least in part, via inhibition of TNFa, IL1b, Cox2, and NFkB [23,25]. In agreement, we also found a remarkable downregulation for all examined pro-inflammatory cytokines in hOBNSCs pre-treated by IA. By downregulation of these cytokines, IA likely inhibits downstream stress response induced by Ab25–35. Inflammation and oxidative stress are the main cellular changes related to AD. Consequently, the best preventive therapeutics could contains an anti-inflammatory drug and anti-oxidant. Low AD incidence and risk were noticed in patients who received non-steroidal anti-inflammatory drugs (NASIDs) for 2 years [47]. NASIDs inhibit neuro-inflammation through inactivation of Cox2. Unlike NASIDs which did not significantly improve the cognitive ability of patients, IA enhanced the memory and cognitive ability and has neuroprotective effect. Therefore, IA may be used as a safer and cheaper anti-inflammatory in preventive therapeutic for AD alternative to NASIDs.
potential (MMP) is an important event in early stages of apoptosis. OB proteomic screening suggested a disrupted mitochondrial function as revealed by dysregulation of important 29 mitochondrial proteins during different AD stages [38,39]. Mitochondrial dysfunction due to loss of MMP has been observed in neural cells exposed to Aβ [20], and in AD brain [40], and is necessary for induction of oxidative stress. IA significantly reserved MMP impaired by Aβ25–35, suggesting attenuation of Aβ-induced mitochondrial dysfunction. Loss of MMP can induce apoptosis through activation of caspase-3 activator cyto c release from the mitochondrial matrix to the cytosol via the disrupted mitochondrial membranes. Consequently, cells treated by Aβ25–35 had a marked increase in caspase 3 activity and protein and this change was inhibited by IA. In support, previous studies have reported a crucial role for caspase 3 in Aβ-induced apoptosis in AD brains [4,41] and this effect was ameliorated by natural products [7,20]. As caspase 3 is the end result of the apoptotic pathway, we examined the upstream molecules in this pathway to elucidate the prospective signaling molecules regulating Aβ25–35-induced apoptosis and how this can be ameliorated by IA. In the intrinsic pathway, the anti-apoptotic Bcl2, that resides in the outer mitochondrial wall, inhibits cyto c release from mitochondria, while the pro-apoptotic Bax, which is located in the cytosol, induces cyto c release and translocate to the mitochondria to form a proapoptotic complex with Bcl2 [42]. On the other hand, the extrinsic apoptotic pathway is mediated by caspase 8. In the present study, cells treated with Aβ25–35 alone had a robust increase in Bax, caspase 8, cyto c and a remarkable decrease in Bcl2 mRNAs and proteins, while when pretreated with IA the expression of these molecules was reversed. This suggests involvement of both extrinsic and intrinsic pathways of apoptosis in Aβ25–35-induced neurotoxicity. Similar results regarding the activation of both apoptotic pathways by Aβ were reported by other studies [4,5,41]. Taken together, our findings suggest that IA significantly attenuated Aβ-induced apoptosis and mitochondrial dysfunction, at least in part, through improving MMP, stimulating the antiapoptotic marker Bcl2, and inhibiting pro-apoptotic markers Bax, caspase8, cyto c, caspase 3 in hOBNSCs. Aβ has been proposed as a stressor that can induce cells loss in neurons originated from regions severely affected in AD through stimulation of ROS formation [1,43]. IA protected hOBNSCs against Aβinduced apoptosis by inhibiting overproduction of intracellular ROS. It is also well documented that Aβ exerts its neurotoxic effect via not only induction of oxygen free radicals release but also by repression of 820
Biomedicine & Pharmacotherapy 105 (2018) 813–823
M.A. El-Magd et al.
Fig. 7. IA protected hOBNSCs against Aβ-induced toxicity through HO-1. Changes in relative expression of Erk2 (A), Nrf2 (D), and HO-1 (F) genes in hOBNSCs cultured in proliferation media was measured by qPCR. (B) IA induced upregulation in Erk1/2, Nrf2, and HO-1 proteins expression as measured by Western blots. Densitometric analysis of changes in levels of Erk1/2 (C), Nrf2 (E), and HO-1 (G) proteins. HO-1 enzyme inhibitor ZnPP blocked the protective effect of IA against Aβ25–35-induced cytotoxicity as measured by MTT assay (H). Data represent three independent experiments and were presented as fold change mean ± SEM from the untreated control (Cnt) cells. **P < 0.01, ***P < 0.001, ****P < 0.0001 vs. control group; !P < 0.05, !! P < 0.01, !!!!P < 0.0001 vs Aβ-treated group; ### P < 0.001 vs IA-pretreated group.
Additionally, the protective effects induced by IA were greatly declined by the HO-1 blocker ZnPP. This confirms previous reports that attenuation of Aβ-induced oxidative cell death can involve induction of the HO-1. Given that IA may induce Nrf2, it is likely that IA may activate HO-1 by regulating Nrf2 through Erk1/2 pathway. HO-1 not only
Recent studies have reported inhibition of Aβ-induced oxidative cell death through induction of HO-1 and its upstream inducers, Erk1/2 and Nrf2 [6,7]. To assess this possibility in the context of IA, we investigated its effects on Erk1/2, Nrf2 and HO-1 and found that it can activate Erk1/2, Nrf2 and HO-1 mRNAs and proteins in hOBNSCs. 821
Biomedicine & Pharmacotherapy 105 (2018) 813–823
M.A. El-Magd et al.
acts as endogenous antioxidant but it can also inhibit the production of tau, thereby activation of HO-1 should represent a potential treatment for AD [48]. Whether IA induces HO-1 expression through Erk1/2-dependant Nrf2/ARE activation remains an interesting speculation that waits further investigation. Another important question remains to be answered by the next studies, is that the oxidative stress induced by Aβ25–35 may be independent on Erk1/2, Nrf2, and HO-1 pathways as these molecules were not inhibited when the cells exposed to Aβ25–35. A previous study has even reported a significant increase in HO-1 protein expression following exposure of neural cells to Aβ25–35 alone when compared to untreated cells [7]. The authors attribute this increase to adaptive endogenous anti-oxidative response to tackle oxidative stress induced by Aβ25–35. Moreover, a recent OB proteomic analysis study has revealed that Aβ resulted in different olfactory signaling depending on species and stage of AD, where it induced inactivation of ERK1/2 in 6-months mice, but in human OBs it induced activation of ERK1/2 across AD staging [36]. This ERK1/2 dysregulation precedes Aβ accumulation in the OB of APP/PS1 mouse model of AD. A more recent study by the same group also reported that ERK1/2 activation may be associated with the disrupted cytoskeletal coupling that occurs in olfactory neurons at initial stages of AD, probably leading to the synaptic defect [39].
of cultured rat cortical neurons, Brain Res. 842 (2) (1999) 311–323. [5] M. Folin, S. Baiguera, L. Fioravanzo, M.T. Conconi, C. Grandi, G.G. Nussdorfer, P.P. Parnigotto, Caspase-8 activation and oxidative stress are involved in the cytotoxic effect of beta-amyloid on rat brain microvascular endothelial cells, Int. J. Mol. Med. 17 (3) (2006) 431–435. [6] Y. Wang, Y. Miao, A.Z. Mir, L. Cheng, L. Wang, L. Zhao, Q. Cui, W. Zhao, H. Wang, Inhibition of beta-amyloid-induced neurotoxicity by pinocembrin through Nrf2/ HO-1 pathway in SH-SY5Y cells, J. Neurol. Sci. 368 (2016) 223–230. [7] H.-Q. Wang, X.-B. Sun, Y.-X. Xu, H. Zhao, Q.-Y. Zhu, C.-Q. Zhu, Astaxanthin upregulates heme oxygenase-1 expression through ERK1/2 pathway and its protective effect against beta-amyloid-induced cytotoxicity in SH-SY5Y cells, Brain Res. 1360 (2010) 159–167. [8] L. Millucci, L. Ghezzi, G. Bernardini, A. Santucci, Conformations and biological activities of amyloid beta peptide 25–35, Curr. Protein Pept. Sci. 11 (1) (2010) 54–67. [9] H.E. Marei, A. Althani, N. Afifi, F. Michetti, M. Pescatori, R. Pallini, P. Casalbore, C. Cenciarelli, P. Schwartz, A.E. Ahmed, Gene expression profiling of embryonic human neural stem cells and dopaminergic neurons from adult human substantia nigra, PLoS One 6 (12) (2011) e28420. [10] H.E. Marei, A. Althani, S. Rezk, A. Farag, S. Lashen, N. Afifi, A. Abd-Elmaksoud, R. Pallini, P. Casalbore, C. Cenciarelli, T. Caceci, Therapeutic potential of human olfactory bulb neural stem cells for spinal cord injury in rats, Spinal Cord 54 (10) (2016) 785–797. [11] H.E. Marei, A. Farag, A. Althani, N. Afifi, A. Abd-Elmaksoud, S. Lashen, S. Rezk, R. Pallini, P. Casalbore, C. Cenciarelli, Human olfactory bulb neural stem cells expressing hNGF restore cognitive deficit in Alzheimer’s disease rat model, J. Cell. Physiol. 230 (1) (2015) 116–130. [12] W. Zhang, P.J. Wang, H.Y. Sha, J. Ni, M.H. Li, G.J. Gu, Neural stem cell transplants improve cognitive function without altering amyloid pathology in an APP/PS1 double transgenic model of Alzheimer’s disease, Mol. Neurobiol. 50 (2) (2014) 423–437. [13] Q. Zhang, H.H. Wu, Y. Wang, G.J. Gu, W. Zhang, R. Xia, Neural stem cell transplantation decreases neuroinflammation in a transgenic mouse model of Alzheimer’s disease, J. Neurochem. 136 (4) (2016) 815–825. [14] J.A. Kim, S. Ha, K.Y. Shin, S. Kim, K.J. Lee, Y.H. Chong, K.A. Chang, Y.H. Suh, Neural stem cell transplantation at critical period improves learning and memory through restoring synaptic impairment in Alzheimer’s disease mouse model, Cell Death Dis. 6 (2015) e1789. [15] S.Q. Chen, Q. Cai, Y.Y. Shen, P.Y. Wang, M.H. Li, G.Y. Teng, Neural stem cell transplantation improves spatial learning and memory via neuronal regeneration in amyloid-beta precursor protein/presenilin 1/tau triple transgenic mice, Am. J. Alzheimer’s Dis. Dement. 29 (2) (2014) 142–149. [16] W. Fischer, K. Wictorin, A. Bjorklund, L.R. Williams, S. Varon, F.H. Gage, Amelioration of cholinergic neuron atrophy and spatial memory impairment in aged rats by nerve growth factor, Nature 329 (6134) (1987) 65–68. [17] K. Jin, A.L. Peel, X.O. Mao, L. Xie, B.A. Cottrell, D.C. Henshall, D.A. Greenberg, Increased hippocampal neurogenesis in Alzheimer’s disease, Proc. Natl. Acad. Sci. U. S. A. 101 (1) (2004) 343–347. [18] M.A. Lopez-Toledano, M.L. Shelanski, Increased neurogenesis in young transgenic mice overexpressing human APP(Sw, Ind), J. Alzheimer’s Dis.: JAD 12 (3) (2007) 229–240. [19] M.J. Yetman, J.L. Jankowsky, Wild-type neural progenitors divide and differentiate normally in an amyloid-rich environment, J. Neurosci. 33 (44) (2013) 17335–17341. [20] D.L. Chen, P. Zhang, L. Lin, O. Shuai, H.M. Zhang, S.H. Liu, J.Y. Wang, Protective effect of Bajijiasu against beta-amyloid-induced neurotoxicity in PC12 cells, Cell. Mol. Neurobiol. 33 (6) (2013) 837–850. [21] D. Poeckel, L. Tausch, N. Kather, J. Jauch, O. Werz, Boswellic acids stimulate arachidonic acid release and 12-lipoxygenase activity in human platelets independent of Ca2+ and differentially interact with platelet-type 12-lipoxygenase, Mol. Pharmacol. 70 (3) (2006) 1071–1078. [22] S. Marshall, Frankincense: festive pharmacognosy, Pharm. J. 271 (2003) 862–864. [23] A. Moussaieff, N.A. Shein, J. Tsenter, S. Grigoriadis, C. Simeonidou, A.G. Alexandrovich, V. Trembovler, Y. Ben-Neriah, M.L. Schmitz, B.L. Fiebich, E. Munoz, R. Mechoulam, E. Shohami, Incensole acetate: a novel neuroprotective agent isolated from Boswellia carterii, J. Cerebr. Blood Flow Metab. 28 (7) (2008) 1341–1352. [24] A. Moussaieff, J. Yu, H. Zhu, S. Gattoni-Celli, E. Shohami, M.S. Kindy, Protective effects of incensole acetate on cerebral ischemic injury, Brain Res. 1443 (2012) 89–97. [25] S.I. Ali, C.R. Zhang, A.A. Mohamed, F.K. El-Baz, A.K. Hegazy, M.A. Kord, M.G. Nair, Major constituents of Boswellia carteri resin exhibit cyclooxygenase enzyme inhibition and antiproliferative activity, Nat. Prod.Commun. 8 (10) (2013) 1365–1366. [26] A. Takeda, Y. Itoyama, T. Kimpara, X. Zhu, J. Avila, B.E. Dwyer, G. Perry, M.A. Smith, Heme catabolism and heme oxygenase in neurodegenerative disease, Antioxid. Redox Signal. 6 (5) (2004) 888–894. [27] E. Saad, H. Marei, M. El-Magd, H. El-Fatiry, Molecular characterization of olfactory bulb neural stem cells during proliferation and differentiation, J. Appl. Pharm. Sci. 8 (1) (2018) 087–092. [28] N.J. Haughey, D. Liu, A. Nath, A.C. Borchard, M.P. Mattson, Disruption of neurogenesis in the subventricular zone of adult mice, and in human cortical neuronal precursor cells in culture, by amyloid β-peptide, Neuromol. Med. 1 (2) (2002) 125–135. [29] A. Moussaieff, R. Mechoulam, Boswellia resin: from religious ceremonies to medical uses; a review of in-vitro, in-vivo and clinical trials, J. Pharm. Pharmacol. 61 (10)
5. Conclusions We report for the first time that incensole acetate has the ability to induce proliferation and differentiation of neuronal progenitors of hOBNSCs and ameliorate Aβ25–35 induced oxidative stress, inflammation, and apoptosis in these cells. This neuroprotective effect was not only associated with restoration of the dysregulated MMP, intracellular Ca2+, ROS level, and apoptosis- and inflammation-related mRNA/ protein expression, but also to regulation of antioxidant enzymes HO-1 expression, probably through activation of Erk1/2 and Nrf2 signal pathways. This study advances our understanding of how the anti-inflammatory IA can prevent Aβ-induced neurotoxicity and contribute to the development of hOBNSCs therapies for AD. Authors’ contributions ME and SK contributed to concept and design, collection and assembly of data, data analysis and interpretation, manuscript writing, and final approval of the manuscript. FA, AB, EE, LD, MA, HA and ER contributed to data analysis and interpretation, and manuscript writing. FE and HM contributed to experimental design, manuscript writing and revision. Competing interests The authors declare that there is no competing interests regarding the publication of this paper. Funding This study was funded by authors and no other fund was received. References [1] D.A. Butterfield, J. Drake, C. Pocernich, A. Castegna, Evidence of oxidative damage in Alzheimer’s disease brain: central role for amyloid beta-peptide, Trends Mol. Med. 7 (12) (2001) 548–554. [2] M.A. Lopez-Toledano, M.L. Shelanski, Neurogenic effect of beta-amyloid peptide in the development of neural stem cells, J. Neurosci. 24 (23) (2004) 5439–5444. [3] E. Tamagno, M. Guglielmotto, M. Aragno, R. Borghi, R. Autelli, L. Giliberto, G. Muraca, O. Danni, X. Zhu, M.A. Smith, G. Perry, D.G. Jo, M.P. Mattson, M. Tabaton, Oxidative stress activates a positive feedback between the gamma- and beta-secretase cleavages of the beta-amyloid precursor protein, J. Neurochem. 104 (3) (2008) 683–695. [4] J. Harada, M. Sugimoto, Activation of caspase-3 in beta-amyloid-induced apoptosis
822
Biomedicine & Pharmacotherapy 105 (2018) 813–823
M.A. El-Magd et al.
[39] M. Lachen-Montes, A. Gonzalez-Morales, M.V. Zelaya, E. Perez-Valderrama, K. Ausin, I. Ferrer, J. Fernandez-Irigoyen, E. Santamaria, Olfactory bulb neuroproteomics reveals a chronological perturbation of survival routes and a disruption of prohibitin complex during Alzheimer’s disease progression, Sci. Rep. 7 (1) (2017) 9115. [40] J.X. Chen, S.D. Yan, Pathogenic role of mitochondrial [correction of mitochondral] amyloid-beta peptide, Expert Rev. Neurother. 7 (11) (2007) 1517–1525. [41] J.W. Allen, B.A. Eldadah, X. Huang, S.M. Knoblach, A.I. Faden, Multiple caspases are involved in beta-amyloid-induced neuronal apoptosis, J. Neurosci. Res. 65 (1) (2001) 45–53. [42] D.G. Nicholls, S.L. Budd, Mitochondria and neuronal survival, Physiol. Rev. 80 (1) (2000) 315–360. [43] D. Di Bona, G. Scapagnini, G. Candore, L. Castiglia, G. Colonna-Romano, G. Duro, D. Nuzzo, F. Iemolo, D. Lio, M. Pellicano, V. Scafidi, C. Caruso, S. Vasto, Immuneinflammatory responses and oxidative stress in Alzheimer’s disease: therapeutic implications, Curr. Pharm. Des. 16 (6) (2010) 684–691. [44] M.P. Mattson, F.M. LaFerla, S.L. Chan, M.A. Leissring, P.N. Shepel, J.D. Geiger, Calcium signaling in the ER: its role in neuronal plasticity and neurodegenerative disorders, Trends Neurosci. 23 (5) (2000) 222–229. [45] K. Paszty, A.K. Verma, R. Padanyi, A.G. Filoteo, J.T. Penniston, A. Enyedi, Plasma membrane Ca2+ATPase isoform 4b is cleaved and activated by caspase-3 during the early phase of apoptosis, J. Biol. Chem. 277 (9) (2002) 6822–6829. [46] P. Eikelenboom, E. van Exel, J.J. Hoozemans, R. Veerhuis, A.J. Rozemuller, W.A. van Gool, Neuroinflammation—an early event in both the history and pathogenesis of Alzheimer’s disease, Neuro-Degener. Dis. 7 (1–3) (2010) 38–41. [47] B.A. int’Veld, A. Ruitenberg, A. Hofman, L.J. Launer, C.M. van Duijn, T. Stijnen, M.M. Breteler, B.H. Stricker, Nonsteroidal antiinflammatory drugs and the risk of Alzheimer’s disease, N. Engl. J. Med. 345 (21) (2001) 1515–1521. [48] I. Mateo, P. Sanchez-Juan, E. Rodriguez-Rodriguez, J. Infante, J.L. VazquezHiguera, I. Garcia-Gorostiaga, J. Berciano, O. Combarros, Synergistic effect of heme oxygenase-1 and tau genetic variants on Alzheimer’s disease risk, Dement. Geriatr. Cognit. Disord. 26 (4) (2008) 339–342.
(2009) 1281–1293. [30] S. Corsano, R. Nicoletti, The structure of incensole, Tetrahedron 23 (1967) 1977–1984. [31] M.A. El-Magd, K.A. Kahilo, N.E. Nasr, T. Kamal, M. Shukry, A.A. Saleh, A potential mechanism associated with lead-induced testicular toxicity in rats, Andrologia 49 (9) (2017), http://dx.doi.org/10.1111/and.12750 e12750. [32] M.A. El-Magd, W.S. Abdo, M. El-Maddaway, N.M. Nasr, R.A. Gaber, E.S. El-Shetry, A.A. Saleh, F.A.A. Alzahrani, D.H. Abdelhady, High doses of S-methylcysteine cause hypoxia-induced cardiomyocyte apoptosis accompanied by engulfment of mitochondaria by nucleus, Biomed. Pharmacother. 94 (2017) 589–597. [33] M.A. El-Magd, A. Khamis, S.K. Nasr Eldeen, W.M. Ibrahim, A.F. Salama, Trehalose enhances the antitumor potential of methotrexate against mice bearing Ehrlich ascites carcinoma, Biomed. Pharmacother. 92 (2017) 870–878. [34] R. Sattler, M. Tymianski, Molecular mechanisms of calcium-dependent excitotoxicity, J. Mol. Med. (Berlin, Germany) 78 (1) (2000) 3–13. [35] S. Varadarajan, J. Kanski, M. Aksenova, C. Lauderback, D.A. Butterfield, Different mechanisms of oxidative stress and neurotoxicity for Alzheimer’s A beta(1–42) and A beta(25–35), J. Am. Chem. Soc. 123 (24) (2001) 5625–5631. [36] M. Lachen-Montes, A. Gonzalez-Morales, X.M. de Morentin, E. Perez-Valderrama, K. Ausin, M.V. Zelaya, A. Serna, E. Aso, I. Ferrer, J. Fernandez-Irigoyen, E. Santamaria, An early dysregulation of FAK and MEK/ERK signaling pathways precedes the beta-amyloid deposition in the olfactory bulb of APP/PS1 mouse model of Alzheimer’s disease, J. Proteom. 148 (2016) 149–158. [37] N.J. Haughey, D. Liu, A. Nath, A.C. Borchard, M.P. Mattson, Disruption of neurogenesis in the subventricular zone of adult mice, and in human cortical neuronal precursor cells in culture, by amyloid beta-peptide: implications for the pathogenesis of Alzheimer’s disease, Neuromol. Med. 1 (2) (2002) 125–135. [38] M.V. Zelaya, E. Perez-Valderrama, X.M. de Morentin, T. Tunon, I. Ferrer, M.R. Luquin, J. Fernandez-Irigoyen, E. Santamaria, Olfactory bulb proteome dynamics during the progression of sporadic Alzheimer’s disease: identification of common and distinct olfactory targets across Alzheimer-related co-pathologies, Oncotarget 6 (37) (2015) 39437–39456.
823