Increased atherosclerosis following treatment with a dual PPAR agonist in the ApoE knockout mouse

Atherosclerosis 195 (2007) 17–22

Increased atherosclerosis following treatment with a dual PPAR agonist in the ApoE knockout mouse Anna C. Calkin ∗ , Terri J. Allen, Markus Lassila, Christos Tikellis, Karin A. Jandeleit-Dahm, Merlin C. Thomas Danielle Alberti Memorial Centre for Diabetic Complications, Baker Medical Research Institute, Melbourne, Australia Received 17 October 2006; received in revised form 9 November 2006; accepted 10 November 2006 Available online 9 January 2007

Abstract Objective: Recent reports have suggested that dual peroxisome proliferator-activated receptor (PPAR) ␣/␥ agonists are associated with adverse cardiovascular events. This study aimed to investigate the actions of the non-thiazolidinedione PPAR␣/␥ agonist, compound 3q, on plaque development in the apolipoprotein E knockout (apoE KO) mouse, a recognised model of accelerated plaque development. Methods: Six-week-old male apoE KO mice were randomised to receive the dual PPAR␣/␥ agonist, compound 3q (3 mg/kg/day), the PPAR␥ agonist, rosiglitazone (20 mg/kg/day), the PPAR␣ agonist, gemfibrozil (100 mg/kg/day) by gavage or no treatment for 20 weeks (n = 12/group). Results: Gemfibrozil and rosiglitazone significantly reduced lesion area. However, compound 3q was associated with a three-fold increase in total plaque area (versus control p < 0.001). This was associated with an upregulation of markers of plaque instability including vascular cell adhesion molecule-1 (3.5-fold, p < 0.001), P-selectin (3.4-fold, p < 0.001) monocyte chemoattractant protein-1 (3.4-fold; p < 0.001) as well as the scavenger receptor, CD36 (2-fold, p < 0.01). These disparate effects were observed with the dual PPAR agonist despite lowering LDL cholesterol and improving insulin sensitivity to a similar extent to PPAR␣ and ␥ agonists used individually. Conclusion: The finding of increased atherogenesis following a dual PPAR␣/␥ agonist is consistent with recent clinical findings. These data provide an important framework for further exploring the potential utility and safety of combinatorial approaches. © 2006 Elsevier Ireland Ltd. All rights reserved. Keywords: Atherosclerosis; PPAR; Glitazone; Apolipoprotein E; Diabetes

1. Introduction Peroxisome proliferator-activated receptors (PPARs) are ligand-activated nuclear transcription factors that play important roles in glucose and lipid homeostasis [1]. PPAR␣ agonists are utilised in the management of dyslipidemia [2], while PPAR␥ agonists are antidiabetic agents. The apparent efficacy of these individual approaches led to the development of dual PPAR␣/␥ agonists, offering the potential of optimising the combined beneficial effects of activating both nuclear receptors. Despite their clear actions as ∗ Corresponding author at: Danielle Alberti Memorial Centre for Diabetic Complications, Baker Medical Research Institute, PO Box 6492, Melbourne, Vic. 8008, Australia. Tel.: +61 3 8532 1465; fax: +61 3 8532 1288. E-mail address: [email protected] (A.C. Calkin).

0021-9150/$ – see front matter © 2006 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.atherosclerosis.2006.11.021

PPAR␥ and PPAR␣ agonists, and efficacy in terms of lipid and glycemic control [3], recent reports have suggested that dual ␣/␥ agonists may be associated with an increased risk of adverse events when used by individuals with diabetes [4]. In particular, the risk of death, myocardial infarction, or stroke was increased by over two-fold in patients receiving the dual PPAR␣/␥ agonist, muraglitazar, compared to those receiving a PPAR␥ agonist (pioglitazone) alone, despite comparable effects on glycemic control [4]. This observation stands in contrast to our experimental findings, in which PPAR␥ and PPAR␣ agonists individually exhibit anti-atherosclerotic activity, over-and-above their beneficial actions on lipid and glycemic control [5,6]. To examine whether dual ␣/␥ agonists also have direct actions on atherogenesis, in the current study, apolipoprotein E knockout (apoE KO) mice are used to explore the

18

A.C. Calkin et al. / Atherosclerosis 195 (2007) 17–22

potential mechanisms by which the non-thiazolidinedione PPAR␣/␥ co-agonist, (S)-3-(4-(2-carbazol(phenoxazin)-9yl-ethoxy)phenyl)-2-ethoxy-propionic acid (compound 3q) [3], may be associated with adverse atherosclerotic outcomes.

2. Materials and methods

glucose, cholesterol and triglycerides were measured using an automated system (Abbott Architect ci8200; Abbott Laboratories, Abbott Park, IL) and LDL cholesterol calculated by the Friedewald formula. Fasting plasma insulin was measured by radioimmunoassay (Linco Research, St. Charles, MN). Systolic blood pressure was measured using a computerised non-invasive tail cuff system (Harvard Bioscience, Holliston, MA).

2.1. Experimental design 2.3. Quantitation of atherosclerosis Apolipoprotein E (apoE) gene deletion in mice is widely used as an experimental model of accelerated atherosclerosis. It is associated with marked chronic hypercholesterolemia [7], which is not responsive to treatment with PPAR␣ agonists or HMG-CoA reductase inhibitors [8]. Although not recognised as a model of type 2 diabetes, this model is also associated with insulin resistance and chronic hyperglycemia, more comparable to the clinical setting than our previously employed model of streptozotocin diabetes [5,6], which lacks insulin and therefore the ability to test the impact of insulin sensitization. In this study, 6-week-old male apoE KO mice were randomised to receive the dual PPAR␣/␥ agonist, compound 3q (3 mg/kg/day), the PPAR␥ agonist, rosiglitazone (20 mg/kg/day), the PPAR␣ agonist, gemfibrozil (100 mg/kg/day) by gavage or no treatment for a period of 20 weeks (n = 12/group). Compound 3q is a nonthiazolidinedione PPAR agonist of the same drug class as muraglitazar. The dose of compound 3q was selected to achieve a similar control of glucose and total cholesterol levels as achieved by rosiglitazone and gemfibrozil, respectively. At the completion of the study (20 weeks), mice were culled by intraperitoneal injection of Euthal (10 mg/kg) (Delvet Limited, Seven Hills, Australia) followed by exsanguination by cardiac puncture. Aortas were rapidly dissected out, cleaned of adventitial fat and placed in 10% neutral buffered formalin or snap frozen in liquid nitrogen (LN2 ) and stored at −80 ◦ C. The study protocol was approved by the AMREP Animal Ethics Committee, in accordance with Australian NHMRC guidelines. The investigation conforms with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. 85-23, revised 1996). 2.2. Metabolic parameters and blood pressure In samples from the study endpoint, glycated haemoglobin (GHb) was measured in red blood cells by HPLC [9]. Plasma

Aortas were cleaned of excess fat and stained with Sudan IV-Herheimer’s solution (0.5%, w/v) (Gurr, BDH, Poole, UK) as described previously [10]. The aortae were divided into arch, thoracic and abdominal aorta then cut longitudinally. After pinning en face onto wax, aortas were photographed using an Axiocam camera (Zeiss, Heidelberg, Germany) and analysed. Total and segmental plaque area was quantitated as percentage area visualised red as stained by Sudan IV (Adobe Photoshop version 7.0). Aortas were subsequently embedded in paraffin and sections cut for crosssectional analysis. 2.4. Immunostaining Four micron sections were stained with haemotoxylin and eosin to assess plaque complexity using a standard protocol. 2.5. Gene expression studies RNA was extracted from whole aorta by homogenisation using the Trizol method (Life Technologies, Rockville, MD). Samples were DNAse treated (DNA removal kit, Ambion, Austin, TX) and cDNA synthesised (Pierce, Rockford, IL). Quantitative real time RT-PCR was carried out using the Taqman system as previously described by our group [5] on an ABI Prism 7700 Sequence Detector (Applied Biosystems, Foster City, CA). Probes and primers were designed user Primer Express system (Table 1) [5,6]. Gene expression of vascular cell adhesion molecule (VCAM)-1, monocyte chemoattractant protein (MCP)-1, P-selectin and CD36 were normalised to 18S mRNA and reported as ratios compared to the level of expression in untreated control mice. For statistical purposes, non-parametric data were handled as their log derivative. Differences in expression were compared using Student’s t-tests (two groups) or one-way ANOVA (three or more groups).

Table 1 Sequences of probes and primers for real time RT-PCR

VCAM-1 MCP-1 CD36 P-selectin

Forward primer 5 –3

Reverse primer 5 –3

Probe 5 –3

CTGCTCAAGTGATGGGATACCA GTCTGTGCTGACCCCAAGAAG TGCAGGTCAACATACTGGTCAAG GGCCATTGTTTGACTGTAGAGTTTAA

ATCGTCCCTTTTTGTAGACATGAAG TGGTTCCGATCCAGGTTTTTA AGTCTCATTTAGCCACAGTATAGGTACAA AGACCTCACTGAACAAACGTGAAG

FAM-CCAAAATCCTGTGGAGCAG FAM-AATGGGTCCAGACATAC FAM-AGAATCTGAAGAGACCTTAC N/A

A.C. Calkin et al. / Atherosclerosis 195 (2007) 17–22

19

Table 2 Physical and biochemical characteristics of the study groups at the conclusion of the 20-week study Parameter

Control

Body weight (g) Systolic BP (mmHg) Glucose (mmol/L) Glycated haemoglobin (%) Insulin (ng/mL) Total cholesterol (mmol/L) LDL cholesterol (mmol/L) HDL cholesterol (mmol/L) Triglycerides (mmol/L)

31.0 107 11.9 4.8 0.55 12.3 8.2 3.1 1.1

± ± ± ± ± ± ± ± ±

Compound 3q 1.0 2 1.7 0.1 0.09 0.7 0.7 0.2 0.2

29.6 106 12.2 3.8 0.24 8.1 3.6 1.1 3.2

± ± ± ± ± ± ± ± ±

0.5 2 1.4 0.1* 0.08* 1.8* 1.4* 0.2* 0.7*

Rosiglitazone 29.0 106 12.5 3.4 0.31 16.3 8.6 2.6 1.8

± ± ± ± ± ± ± ± ±

0.5 2 0.9 0.1* 0.05* 2.1 0.5 0.2 0.5

Gemfibrozil 28.8 103 11.2 3.5 0.32 8.8 4.6 2.6 1.0

± ± ± ± ± ± ± ± ±

0.6 2 0.6 0.1* 0.03* 1.4 0.5* 0.2 0.5

BP indicates blood pressure; LDL, low density lipoprotein; HDL, high density lipoprotein. Data are expressed as mean ± S.E.M. * p < 0.05 vs. control group (n = 8–12/group).

3. Results 3.1. Mouse lipid and glycemic parameters and blood pressure The apoE KO model is associated with marked changes in plasma lipids, particularly elevations in total and LDL cholesterol concentrations [7]. In our study, LDL cholesterol levels were reduced by both PPAR␣ agonists, gemfibrozil and compound 3q, consistent with the role of PPAR␣ in dyslipidemia associated with this model [11]. However, compound 3q also increased triglyceride concentrations and reduced HDL cholesterol levels compared to untreated animals (Table 2). The selective PPAR␥ agonist, rosiglitazone, had no significant effects on lipid levels in this model. The apoE KO model was also associated with mild fasting hyperglycemia, an elevated GHb concentration, and hyperinsulinemia, consistent with insulin resistance previously described in this model. Treatment with either PPAR agonist individually or with the dual PPAR␣/␥ agonist improved insulin sensitivity, associated with reduced plasma insulin levels and reduced GHb. However, mean fasting glucose levels were unchanged by any of the interventions (Table 2). There was no difference in body weight or systolic blood pressure between any of the groups.

terol clefts (Fig. 2, top right panel), similar to that previously described in diabetic mice [5,6]. 3.3. Vascular adhesion Changes in the expression of pro-inflammatory mediators found in the aorta of apoE KO mice correlate with changes in plaque composition in lesion-prone sites. Moreover, vascular adhesion arising from the expression of adhesion molecules in endothelial cells is thought to be a key contributor to endovascular inflammation. We have previously shown that diabetes is associated with increased expression of VCAM1 within atherosclerotic plaque [6]. In this study, treatment with compound 3q was also associated with a significant increase in the expression of VCAM-1 compared to untreated animals (p < 0.001) (Fig. 3A). Similarly, expression of the macrophage marker, MCP-1 was significantly increased in apoE KO mice receiving compound 3q (p < 0.001) (Fig. 3B).

3.2. Lesion development and complexity After 20 weeks of study, the apoE KO model was associated with a significant accumulation of atherosclerotic plaque in the aorta (Figs. 1 and 2). As previously reported [5,6], both gemfibrozil and rosiglitazone significantly reduced lesion area. By contrast, the dual PPAR␣/␥ agonist, compound 3q, was associated with a three-fold increase in total plaque area (versus control p < 0.001). The magnitude of this effect was similar in all areas of the aorta (Fig. 1), but quantitatively greatest in the aortic arch where most plaque accumulates in this model. Indeed, the increase in plaque area seen with compound 3q in control animals was of a similar level to that seen following the induction of streptozotocin diabetes in these mice [5,6]. Moreover, the lesions seen in mice treated with compound 3q were complex with a necrotic core and choles-

Fig. 1. Total aortic plaque area expressed as the percentage of aortic area staining positive for Sudan IV red (upper panel) and representative en face aortic arch sections (lower panel). * p < 0.05 vs. control (n = 6/group).

20

A.C. Calkin et al. / Atherosclerosis 195 (2007) 17–22

Fig. 2. Representative aortic sections stained with haemotoxylin and eosin. C, indicates control; 3q, compound 3q; R, rosiglitazone; G, gemfibrozil.

Fig. 3. Aortic expression of genes associated with atherosclerotic plaque development at the conclusion of the study. (A) Vascular cell adhesion molecule-1; (B) monocyte chemoattractant protein-1; (C) CD36; (D) P-selectin. Data mean ± S.E.M. * p < 0.05 vs. control (n = 6/group). C, indicates control; 3q, compound 3q; R, rosiglitazone; G, gemfibrozil.

A.C. Calkin et al. / Atherosclerosis 195 (2007) 17–22

CD36 is a macrophage scavenger receptor that has been shown to potentiate foam cell formation via the uptake of oxidized LDL. The expression of CD36 was also increased in animals receiving compound 3q compared to untreated mice (Fig. 3C). There was a strong correlation between the expression of CD36 and VCAM-1 in animals treated with compound 3q. Finally, the expression of P-selectin, a pro-thrombotic marker of endothelial activation associated with more aggressive atherosclerotic disease, was also increased in animals treated with compound 3q (Fig. 3D). Neither gemfibrozil nor rosiglitazone significantly modified the aortic expression of VCAM-1, P-selectin, or CD36 in apoE KO mice (Fig. 3).

4. Discussion PPAR␥ and PPAR␣ agonists are widely used in clinical practice. As demonstrated in this study and previously by our group [5,6], both have anti-atherosclerotic actions over-andabove their beneficial actions on lipid and glycemic control. Their combination offered the potential of optimising the combined beneficial effects of activating both nuclear receptors. However, our study in an experimental model of insulin resistance and dyslipidemia found increased plaque formation in apoE KO animals receiving the non-thiazolidinedione PPAR␣/␥ co-agonist, (S)-3-(4-(2-carbazol(phenoxazin)-9yl-ethoxy)phenyl)-2-ethoxy-propionic acid (compound 3q). This was associated with an increase in the vascular expression of P-selectin, MCP-1, VCAM-1 and CD36, markers of endothelial activation and inflammation that are associated with plaque complexity. These experimental findings potentially provide an important framework for investigating recent reports that dual ␣/␥ agonists may be associated with an increased risk of cardiovascular events when used by individuals with insulin resistance [4]. This study used as its dual PPAR␣/␥ agonist, compound 3q, a non-thiazolidinedione agent in the same class as muraglitazaar. Compound 3q has subsequently been discontinued because of adverse toxicity profiles observed in preclinical studies. These side effects were largely confined to tumorogenicity in rodent models, with some additional reports of mild hepatotoxicity. It is unclear whether this apparent toxicity may have also contributed to our finding of increased atherogenesis in the apoE KO mouse, although it cannot be excluded. Certainly, compound 3q has a high affinity for the PPAR␣ and PPAR␥ receptors [3]. In our study, compound 3q was able to increase insulin sensitivity and improve glycemic control, equivalent to the selective PPAR␥ agonist rosiglitazone. Similarly, compound 3q reduced LDL cholesterol levels, equivalent to the selective PPAR␣ agonist, gemfibrozil (Table 2). In addition, compound 3q was able to increase the urinary excretion of N-methylnicotinamide (NMN) 10-fold in this model, consistent with PPAR␣ agonist activity (data not shown). Both these findings would suggest that compound 3q is functioning as both a PPAR␣ and ␥ agonist in our model.

21

Why a dual agonist, theoretically representing a combination of definitively anti-atherosclerotic agents should be pro-atherosclerotic remains to be established. Inflammation is known to be crucial to the development of atherosclerosis in the apoE KO model [12]. Activation of PPAR␣ or PPAR␥ inhibits the expression of pro-inflammatory cytokines in vascular cells, potentially contributing to their antiatherosclerotic actions [5,6]. However, in our study, the vascular expression of VCAM-1, P-selectin, MCP-1 and CD36 were selectively increased by compound 3q. This probably reflects the increase in macrophage-rich plaques in animals treated with compound 3q and changes in plaque complexity in lesion-prone sites. However, a direct effect on plaque composition cannot be excluded. Compound 3q also increased triglycerides and reduced HDL cholesterol in the apoE KO mouse (Table 2). The potential role of these changes in its proatherosclerotic actions remains to be determined. Unlike in humans, the role of endogenous HDL cholesterol and triglycerides in murine atherosclerosis is controversial. Lipoprotein metabolism differs between humans and mice, where the main cholesterol carrier is HDL, CETP is absent and fatty streaks occur in the proximal aorta rather than coronary vessels. Nevertheless, some studies have suggested that murine HDL cholesterol exerts direct anti-atherogenic effects in the apoE KO model, including inhibition of adhesion molecules such as VCAM-1 and P-selectin [12]. However, agents that reduce plasma triglycerides and raise HDL cholesterol do not protect against atherosclerosis in the apoE KO mouse [13–15]. Both rosiglitazone and gemfibrozil also have actions outside activation of their respective PPARs. For example, some of the actions of fibrates persist in PPAR␣-deficient mice [16]. Similarly, some of the inhibitory effects on gene regulation by thiazolidinediones may not require the presence of the PPAR␥ receptor [17,18]. Rosiglitazone stimulates IL-1 receptor antagonist via a PPAR␤/␦ mechanism, potentially contributing to its anti-inflammatory properties [19]. Thiazolidinediones are able to inhibit elevated endothelial cell plasminogen activated inhibitor (PAI-1), via pathways not involving activation of the PPAR receptor [18]. In addition, PPAR␥ agonists are also able to directly antagonize the activities of other transcription factors including AP-1, signal transducers and activators of transcription1 (STAT-1) and NF-␬B, possibly through trans-repression mechanisms [17,20]. The degree to which these PPARindependent actions contribute to the anti-atherosclerotic actions of PPAR␣ or PPAR␥ agonists, and the extent to which these actions are or are not replicated by dual agonists remains to be established. It is conceivable that the highly potent but PPAR-specific nature of compound 3q’s actions may have contributed to its apparent lack of efficacy in this model over more promiscuous agents. PPAR␥ and PPAR␣ agonists individually are widely used in patients with diabetes and in the metabolic syndrome, and frequently in combination to maintain metabolic control. While the apparently negative trial outcomes [4], combined

22

A.C. Calkin et al. / Atherosclerosis 195 (2007) 17–22

with the pro-atherogenic findings of our study do not support the use of dual PPAR agonists in this setting, the safety of combining individual PPAR␥ and PPAR␣ agonists has not been tested and cannot be imputed from these studies. Given the prevalent use of these agents in clinical practice, such combinatorial studies needs to be urgently performed to answer this important question. In summary, our data supports the potential adverse cardiovascular effects of dual PPAR␣/␥ agonist therapy, demonstrating increased plaque formation and elevated markers of plaque instability in apoE KO animals receiving the non-thiazolidinedione PPAR␣/␥ agonist, compound 3q. These findings are consistent with recent clinical studies showing an increased risk of cardiovascular events associated with the use of the dual ␣/␥ agonist, muraglitazar. Furthermore, these data in an experimental model associated with accelerated atherosclerosis, provide an important framework for further exploring the possible utility and safety of these combinatorial approaches in the preclinical setting.

[6]

[7]

[8] [9]

[10]

[11]

[12]

[13]

Acknowledgements The dual PPAR␣/␥ agonist, compound 3q, was a gift from Per Sauerberg, Novo Nordisk A/S. ACC is supported by a Peter Doherty NHMRC Fellowship.

[14]

[15]

References [1] Spiegelman BM. PPAR-gamma: adipogenic regulator and thiazolidinedione receptor. Diabetes 1998;47:507–14. [2] Guan Y. Peroxisome proliferator-activated receptor family and its relationship to renal complications of the metabolic syndrome. J Am Soc Nephrol 2004;15:2801–15. [3] Lohray BB, Lohray VB, Bajji AC, et al. (−)3-[4-[2-(Phenoxazin10-yl)ethoxy]phenyl]-2-ethoxypropanoic acid [(−)DRF 2725]: a dual PPAR agonist with potent antihyperglycemic and lipid modulating activity. J Med Chem 2001;44:2675–8. [4] Nissen SE, Wolski K, Topol EJ. Effect of muraglitazar on death and major adverse cardiovascular events in patients with type 2 diabetes mellitus. JAMA 2005;294:2581–6. [5] Calkin AC, Forbes JM, Smith CM, et al. Rosiglitazone attenuates atherosclerosis in a model of insulin insufficiency independent

[16] [17]

[18]

[19]

[20]

of its metabolic effects. Arterioscler Thromb Vasc Biol 2005;25: 1903–9. Calkin AC, Cooper ME, Jandeleit-Dahm KA, Allen TJ. Gemfibrozil decreases atherosclerosis in experimental diabetes in association with a reduction in oxidative stress and inflammation. Diabetologia 2006;49:766–74. Moghadasian MH, McManus BM, Nguyen LB, et al. Pathophysiology of apolipoprotein E deficiency in mice: relevance to apo E-related disorders in humans. FASEB J 2001;15:2623–30. Wen M, Segerer S, Dantas M, et al. Renal injury in apolipoprotein E-deficient mice. Lab Invest 2002;82:999–1006. Cefalu WT, Wang ZQ, Bell-Farrow A, Kiger FD, Izlar C. Glycohemoglobin measured by automated affinity HPLC correlates with both short-term and long-term antecedent glycemia. Clin Chem 1994;40:1317–21. Candido R, Jandeleit-Dahm KA, Cao Z, et al. Prevention of accelerated atherosclerosis by angiotensin-converting enzyme inhibition in diabetic apolipoprotein E-deficient mice. Circulation 2002;106:246–53. Tordjman K, Bernal-Mizrachi C, Zemany L, et al. PPARalpha deficiency reduces insulin resistance and atherosclerosis in apoE-null mice. J Clin Invest 2001;107:1025–34. Tian J, Pei H, James JC, et al. Circulating adhesion molecules in apoEdeficient mouse strains with different atherosclerosis susceptibility. Biochem Biophys Res Commun 2005;329:1102–7. Nestel P, Fujii A, Allen T. The cis-9,trans-11 isomer of conjugated linoleic acid (CLA) lowers plasma triglyceride and raises HDL cholesterol concentrations but does not suppress aortic atherosclerosis in diabetic apoE-deficient mice. Atherosclerosis; 2006. Ko KW, Paul A, Ma K, Li L, Chan L. Endothelial lipase modulates HDL but has no effect on atherosclerosis development in apoE−/− and LDLR−/− mice. J Lipid Res 2005;46:2586–94. Bentzon JF, Skovenborg E, Hansen C, et al. Red wine does not reduce mature atherosclerosis in apolipoprotein E-deficient mice. Circulation 2001;103:1681–7. Gonzalez FJ. Recent update on the PPAR alpha-null mouse. Biochimie 1997;79:139–44. Chawla A, Barak Y, Nagy L, et al. PPAR-gamma dependent and independent effects on macrophage-gene expression in lipid metabolism and inflammation. Nat Med 2001;7:48–52. Liu HB, Hu YS, Medcalf RL, Simpson RW, Dear AE. Thiazolidinediones inhibit TNFalpha induction of PAI-1 independent of PPARgamma activation. Biochem Biophys Res Commun 2005;334:30–7. Moulin D, Bianchi A, Boyault S, et al. Rosiglitazone induces interleukin-1 receptor antagonist in interleukin-1beta-stimulated rat synovial fibroblasts via a peroxisome proliferator-activated receptor beta/delta-dependent mechanism. Arthritis Rheum 2005;52: 759–69. Hattori Y, Hattori S, Kasai K. Troglitazone upregulates nitric oxide synthesis in vascular smooth muscle cells. Hypertension 1999;33:943–8.