Increased ethyl caproate production by inositol limitation in Saccharomyces cerevisiae

JOURNALOFBIOSCENCE AND BIOENGINEWNG Vol. 95,No.5,448-454.2003

Increased Ethyl Caproate Production by Inositol Limitation in Saccharomyces cerevisiae KEIJI FURUKAWA,‘”

TASUKU YAMADA,’ HARUHIKO AND SHOD0 HARA’

MIZOGUCHI,’

General Research Laboratory oj’Kiku-Masamune Sake Brewing Co. Ltd., l-8-6 Uozaki-nishimachi, Higashinada-ku, Kobe 6584026, Japan’ Received 8 August 2002iAccepted 8 January 2003

Sake mash was prepared using rice with polishing ratios of 70%, go%, 90% and 98%. At a polishing ratio of 70%, the highest amounts of ethyl caproate were produced in sake mash, and supplementation of inositol caused a decrease in ethyl caproate production. However, at a polishing ratio of over 90%, supplementation of inositol had no effect on ethyl caproate production. These results suggest that the use of rice with a polishing ratio of 70% results in increased ethyl caproate content in sake when limiting the inositol available to yeast. The reduction in ethyl caproate production following inositol addition was due to the decrease in its enzymatic substrate caproic acid, because the concentrations of middle chain fatty acids (MCFA), caproic acid, caprylic acid and capric acid in sake were lowered by inositol. A disruptant of the OPIl gene, an inositol/choline-mediated negative regulatory gene, produced higher amounts of MCFA than the control strain both in the static culture and in sake mash when a sufficient amount of inositol was supplemented. Therefore, the enhancement of MCFA biosynthesis by inositol limitation was thought to be caused not by a posttranscriptional event, but predominantly by transcriptional enhancement of fatty acid biosynthetic genes. The overexpression of FAN considerably stimulated MCFA formation while that of ASC2, ACCl and FAS2 genes was not effective. Co-overexpression of FASl and FAS2 resulted in a maximal stimulation of MCFA formation and substantially abolished the inhibitory effect of inositol on MCFA formation. These results suggest that the repression of FASl gene expression by inositol results in the decrease in MCFA formation. Therefore, it is presumed that the removal of inositol by polishing the rice used in sake brewing, increases the production of ethyl esters of MCFA, since high-level production of MCFA is achieved by the derepression of FASl transcription. [Key words: ethyl caproate, Saccharomyces cerevisiae, inositol, fatty acid, OPII, FASI] In general, highly polished rice is used for sake brewing because proteins and lipids, which are present predominantly in the outer layer of brown rice, lower the quality of sake. For example, it is expected that the removal of lipids by polishing the rice used in sake brewing, increases the production of acetate esters such as isoamyl acetate, because unsaturated fatty acids in lipids lower the alcohol acetyltransferase activity responsible for acetate ester production in Succharomyces cerevisiae (l-3). Additionally, the phytate (inositol hexaphosphate) content in brown rice is markedly decreased by polishing (4). During the sake mash process, phytate in steamed rice is partially hydrolyzed to inositol by acid phosphatase and phytase of rice koji (5%) and by yeast acid phosphatase mainly encoded by PHOll or PHO12 (7), and then the liberated inositol is utilized for yeast growth. Brewery yeasts, including sake-yeast, require inositol for their growth at low temperature (S-10). Therefore, inositol is not supplied in sufficient amounts to yeast in sake mash which is brewed at low temperature using highly polished

rice (4). It is presumed that the amount of liberated inositol affects the physiological properties of yeasts such as their growth. However, there are few reports on the effect of inositol on the quality of sake produced. In this study, we show that the limitation of inositol in sake mash increases the production of ethyl caproate, one of the most important sake flavor components produced by yeast. MATERIALS

Strains, plasmids and media The S. cerevisiae strains used in this study are listed in Table 1. Strain UT-l (11) was kindly donated by Dr. Kitamoto. A hyper-ethyl caproate-producing mutant of K901, strain C38, was obtained from cerulenin-resistant mutants by the method of Tchikawa et al. (12). Yeast cells were cuitured in Wickerham’s synthetic medium with 10% glucose used as the carbon source and supplementation of 0, 0.5 or 200 mg/l inositol. When necessary, appropriate amounts of adenine, uracil and tryptophan were added to the medium for culturing auxotrophic strains. The AUR-YPD medium containing 500 pg/l aureobasidin A (Takara Bio, Kyoto), 1% yeast extract, 2% Polypepton (Nihon Seiyaku, Tokyo), 2% glucose, 100 @l adenine and 2% agar was used for the isolation of an OPZI disruptant from strain W303-I A.

* Corresponding author. e-mail: [email protected] phone: +81-(0)78-854-1038

AND METHODS

fax: +81-(0)78-854-1058

44x

INCREASED ETHYL CAPROATE PRODUCTION

Vol.. 95,2003

449

TABLE 1. Yeast strains used in this study Strain

Description

Source

Kyokai no. 701 (K701) Kyokai no. 901 (K901) Kyokai no. 8 (K8) ATCC32694 C38 UT-I UT-IDOP W303-1A WDOP

Non-foaming mutant of sake yeast Kyokai no. 7 MATah Non-foaming mutant of sake yeast Kyokai no. 9 MATaicc Sake yeast MTala Sake yeast MATala Sake yeast, hyper-ehtyl caproate-producing mutant ofK901 Sake yeast obtained from Kyokai no. 7 MATala, trplltrpl, ura3iura3 Sake yeast MATala, Aopil::TRPllAopil::URA3, trplltrpl, ura3lura3 MATa, ade2-1, ura3-I, his3-II, trpl-I, leu2-3, IeuZ-112, canIMATa. , Aoail::AURl-C. ade2-1. ura3-I. his3-/I. trul-I. leu2-3. leu2-112. canl-100

BSJ” BSJ” BSJ” ATCC” This study K. Kitamoto’ This study YGSGd This studv

A

a The Brewing Society of Japan. h American Type Culture Collection. ’Tokyo University. d Yeast Genetic Stock Center.

Plasmid vector pAURll2 (Takara Bio) and pUC19 were used for the construction of the OPZl disruption vector. Multicopy vectors pG-IM, pG-1MB and pGlMU were constructed for the overexpression of several fatty acid synthetic genes as follows. The synthesized oligonucleotides, S’GATCCCCGGIACCATGGGCCCTC GAGCTCGCGGCCGC and S’GATCGCGGCCGCGAGCTCGA GGGCCCATGGTACCGCG were annealed at room temperature. The resultant fragment was cut with BarnHI and cloned into the multicopy vector pG-1 (13) to yield the vector pG-1 M which contained a multi-cloning site with restriction sites BarnHI, SacII, Kpnl, Ncol, Apal, XhoI, SacI, Not1 and SaZl. The synthesized oligonucleotides, S’GATCGGTACCGCGGGCCCTCGAGAGCT and S’CTCGAGGGCCCGCGGTACC were annealed at room temperature. The resultant fragment was cloned into the BamHI-Sac1 site of the multicopy vector pG-1M to yield the vector pGlMB which contained a multi-cloning site with restriction sites KpnI, SuclI, Ncol, Apal, Xhol, SacI, Not1 and San. The fragment containing the URA3 gene amplified from the plasmid pRS426 (14) by PCR using a 5’primer, 5’-CCCgcatgcGCTTTTCAATTCAATTCA TC-3’, and 3’ primer, 5’-CCCgcatgcCATAGGGTAATAACTGAT AT-3’, was cut with SphI and cloned into pGlM to yield pGlMU which harbored the URA3 gene as a selective marker. DNA manipulation Escherichia coli HBl 01 was used for DNA manipulation and was transformed by the method of Hanahan (15). The yeast strains were transformed using the electroporation method (16). Unless otherwise stated, PCR was carried out using Ex taq DNA polymerase (Takara Bio). Disruption of OPII gene The OPZI (inositolicholine-mediated negative regulatory gene) genes of the laboratory yeast strain, W303-IA and the sake yeast strain, UT-l were disrupted as follows. For disruption of the OPZl gene of strain W303-lA, both flanking regions of the OPZl ORF were amplified by PCR: A 2372-bp Y-flanking region of the OPZI ORF was amplified from yeast genomic DNA by PCR using a 5’primer, 5’-GCtctagaCCCA AACATTTGGTCTTATT-3’, and a 3’primer, 5’-GCtctagaCAATG ACTAGTATCTTCGTT-3’. This fragment was cut with XbaI and cloned into plasmid pAURll2 to yield plasmid pAUROPF. A 205%bp 3’-flanking region of the OPZl ORF was amplified from yeast genomic DNA by PCR using a 5’primer, 5’-CGGggtaccCCG AGACAGATTGAGGTCTT-3’, and a 3’primer, 5’-CGGggtaccAA ATCTTAAGGGTGAAGACA-3’. This fragment was cut with KpnI and cloned into plasmid pAUROPF so that both flanking regions of the OPZI ORF were orientated in the same direction. The resulting plasmid pAUROPFR was cut with BstXI and @II, and the linear 6%kbp fragment containing OPZl::AURl-C was integrated into the OPII allele in strain W303-1A. Aureobasidin A-resistant transformants were recovered and disruption of OPZI was confirmed by PCR (data not shown). For disruption of the OPZl gene of strain UT-l, a 5.86-kb DNA

fragment containing the OPIl coding region and the 5’ and 3’ flanking regions was amplified from yeast genomic DNA by PCR using a 5’ primer, 5’-CCCggtaccAATCTATTCTCTTGGCCATC-3’ and 3’ primer, 5’-CGGggtaccAAATCTTAAGGGTGAAGACA-3’. This fragment was cut with KpnI and cloned into plasmid pUC19 to yield plasmid pUC19OP. The TRPI gene was amplified from plasmid pGlM by PCR using a 5’primer, 5’-CCCactagtAATTCG GTCGAAAAAAGAAA-3’ and a 3’ primer, 5’-CCCggtgaccAGAT CTTTTATGCTTGCTTT-3’. The fragment containing the TRpl gene was cut with SpeI and BstPI and cloned into pUCl9OP to yield plasmid pUCl9OpT in which the 1.84-kb OPZl coding region was replaced with the TRPl gene. The URA3 gene was amplified from plasmid pAURl12 by PCR using a 5’ primer, 5’CCCactagtGTAAGCTTTTCAATTCATCA-3’ and a 3’ primer, 5’CCCggtgaccCCCGGGTAATAACTGATATA-3’. The fragment containing the URA3 gene was cut with Spel and BstPI and cloned into pLJC 19OP to yield plasmid pUCOPU in which the 1.84-kb OPZI coding region was replaced with the URA3 gene. Strain UT-1 was transformed with pUCOPT linearized by digestion with BamHl and AflI for integration at the OPZl locus. The resulting integrants which had a disrupted OPIl gene on one chromosome and a normal OPZI gene on the other, were isolated on Trp- plates. Transformants were retransformed with pUCl9OPU digested with BstxI and AflI to disrupt the remaining copy of the OPZI gene. As a result of the two transformations, transformants in which two copies of the OPZI gene were disrupted, were isolated on Trp-, Uraplates. The disruption of the OPZl gene was confirmed by PCR (data not shown). Construction of vectors for gene expression ACS2, ACCI, FASI and FAS2 genes were amplified by PCR from the genomic DNA of yeast strain K901 using KOD DNA polymerase (Toyobo, Osaka) as follows. The ACS2 gene was amplified by PCR using a 5’ primer, 5’-TCCccgcggATGACAATCAAGGAACATAA-3’ and a 3’ primer, 5’-CCCgagctcCTCATTACGAAATTTTTCTC-3’. The PCR product was cut with SacII-Sac1 and cloned into pG- 1MU to yield plasmid pGlMU-ACS2 The FAS2 gene was amplified by PCR using a 5’primer, 5’-TCCccgcggATGAAGCCGGAAGTTG AGCA-3’ and a 3’primer, 5’-CCCgagctcCTATTTCTTAGTACiAA ACGG-3’. The PCR product was cut with Sacll-Sac1 and cloned into pG-1MU to yield plasmid pGlMU-FAS2. The ACCl gene was amplified by PCR using a 5’ primer, 5’-TCCccgcggATGAGC GAAGAAAGCTTATT-3’ and a 3’primer, 5’-CCCgaggctcGCiTTT ATTTCAAAGTCTTCA-3’. The PCR product was cut with SucllSac1 and cloned into pG- 1MB to yield plasmid pG 1MB-ACC 1. A part of the FASI gene (bp l-3543 of the ORF) was amplified by PCR using a 5’primer, 5’-TCCccgcggATGGACGCTTACTCCAC AAG-3’ and a 3’primer, 5’-CCCgagataAACCATTCCTTGGCTT GGCT-3’. The PCR product was cut with SacII-Sac1 and cloned into pG- I MB to yield plasmid pG1 MB-DFAS 1. Another part of

450

FURlJKAWA ET AL.

the FASI gene (bp 325 l-6156 of the ORF) was amplified by PCR using a 5’ primer, 5’-AGTTACTACATCAATATTAC-3’ and a 3’ primer, 5’-CCCgagctcTTAGGATTGTTCATACTTTT-3’. The PCR product was cut with BarnHI-Sucl and cloned into BarnHI-Sacldigested pG-IMBD-FASI to yield plasmid pGIMB-FASI for overexpression of the FASJ gene. Sake brewing Laboratory-scale sake brewing was carried out according to the method of Namba et al. (I 7) using 200 g of rice, supplemented with 0 or 125 mg of inositoi. Unless otherwise stated, rice with a polishing ratio of 70% was used. In sake brewing with strain UT-I and the OPZI disruptant, UT-1 DOP, 27 mg of tryptophan and 68 mg of uracil were supplemented. Fermentation was conducted at 15°C and the fermentation profile was monitored by a loss of weight in conjunction with CO2 evolution. When CO1 evolution reached 60 g, the sake mash was centrifuged to obtain fresh sake. The yeast cell density in the sake mash was determined microscopically. Enzyme assay Yeast cells in the sake mash were fractionated by centrifugation (18). Yeast cell-free extract was prepared as previously described (4) and was subjected to assays for alcohol acyltransferase (AACTase), the esterase in ethyl caproate synthesis, and the esterase in ethyl caproate hydrolysis. The activities of alcohol acyltransferase and the esterase in ethyl caproate synthesis were measured by the method of Kuriyama et al. (I 9) except that methyl caproate was used as the internal standard for the determination of ethyl caproate. Esterase activity in ethyl caproate hydrolysis was assayed by the method of Kuriyama et al. (I 9) except that the liberated caproic acid was measured using heptanoic acid as the internal standard. One unit of each enzyme was defined as the amount of enzyme which produced 1 pmole of ethyl caproate or caproic acid per hour. Each activity was represented as units per ml of sake mash, calculated from activity per cell-free extract on the basis of cell density. For Middle chain fatty acids and ethyl caproate analysis middle chain fatty acid (MCFA) analysis, I ml of 0.72 N sulfuric acid and 20 pg of n-heptanoic acid as an internal standard were added to 10 ml of culture supernatant or sake. Following extraction three times with 3 ml of ethyl ether, the extract was concentrated to 100 pl with nitrogen gas, followed by gas chromatography-mass spectrometry (GC-MS) analysis. CC-MS was carried out using a Shimadzu CC-17A gas chromatograph equipped with a DB-WAX column (0.32 mm i.d. x 30 m, 0.5 pm film thickness; J & W Scientific, Folsom, CA, USA) that was directly connected to a QP 5000 quadrupole mass spectrometer (Shimadzu, Kyoto). Helium was used as the carrier gas to maintain the flow rate through the column at 2.0 ml/min. The oven temperature was initially held at 120°C for 2 min, then raised to 200°C at 1O”C/min and finally held at 200°C for 5 min. Other settings were as follows: I pl injection volume, I : 50 split ratio, 250°C interface temperature and electron impact ionization (El) at 70 eV. n-Butanoic acid (C4 : 0), n-caproic acid (C6:0), n-caprylic acid (CS :0) and n-capric acid (C lO:O) were quantified by selected ion monitoring (SIM) of the fragment ion at m/z 60. The ethyl caproate content of sake was quantified by head space gas chromatography (20). RESULTS

AND DISCUSSION

Effects of inositol on ethyl caproate formation To determine the effect of the polishing mash

in sake

ratio of rice on ethyl caproate production, sake mash was prepared using strain K90 1 and rice of various polishing ratios (70%, 80%, 90% and 98%) (total rice 200 g) to which 0 or 125 mg of inositol was supplemented (Fig. I ). Rice with a polishing ratio of 70% was then routinely used for koji making. At a

j

02

B

II 70

80

90

Polishing ratio(%)

FIG I tXect of polishing ratio on yeast cell density and ethyl caproate production in sake mash. Sake mash was prepared with strain K901 using 200g of polished rice (polishing ratio: 70%, 80%. 90% and 98%) with the supplementation of 0 mg (open bars) or 125 mg (solid bars) of inositol. The final yeast cell density (A) in sake mash was determined microscopically. The ethyl caproate concentration (B) in the supernatant (fresh sake) was measured by head space gas chromatography. Each data point is the mean for two independent experiments and the bar indicates SD.

polishing ratio of 70%, the final yeast cell density was lowest in the sake mash not supplemented with inositol. When 125 mg of inositol was supplemented, the cell density attained the maximal level. This result shows that at a polishing ratio of 70%, inositol was limiting for yeast growth as shown in a previous study (4). On the contrary, at a polishing ratio of over 90%, supplementation of inositol had no effect on cell density. Furthermore, at a polishing ratio of 70%, the largest amount of ethyl caproate was produced in sake mash without supplementation of inositol, and the supplementation of inositol caused an approximate 50% decrease in ethyl caproate production. However, at a polishing ratio of over 90%, supplementation of inositol had no effect on ethyl caproate production similarly to the case of cell density. These results suggest that sufficient amounts of inositol were supplied to yeast in sake mash in which rice with a polishing ratio of over 90% was used. Therefore, the use of a rice of polishing ratio of 70% results in an increased ethyl caproate content in sake through inositol limitation. To determine the relationship between the amount of inositol supplemented and ethyl caproate produced, sake mash to which various amounts of inositol were added, was prepared using 200 g of polished rice (polishing ratio of 70%) (Fig. 2). For supplementation of inositol up to 10 mg per 200 g of rice, the yeast cell density increased and ethyl caproate production decreased with increasing amounts of inositol added. However, the addition of more than 10 mg of inositol had little effect either on cell density or ethyl caproate production. From results shown in Figs. I and 2, it

Var.. 95.2003

INCREASED

ETHYL

CAPROATE

PRODUCTION

1.0

0.018 -

0.9 2

0.7

.g

0012 -

0.6

:

0010 -

0.5 0.4

g B

0.008 -

0.3

5 Gj

0.004 -

0.2

0.014 -

0.006 0.002 0

0.1

t 0

0.016 -

0.9

’

0

I

I

10

20

I

III

30

lnositol added (q/200-g

0 125

total rice)

FIG. 2. The relationship between the amount of inositol supplemented and ethyl caproate production in sake mash. Sake mash to which O-125 mg of inositol was added was prepared using 200 g of polished rice (polishing ratio: 70%). The final yeast cell density (open circles) and ethyl caproate concentration (closed circles) in sake were measured as outlined in Fig. I.

TARI,E

lnositol

2.

Effect of inositol on ethyl caproate content of sake Strain K70l

K90l

K8

ATCC32694

C38

+

1.08 0.38

0.99 0.44

1.16 0.16

0.54 0.15

14.76 8.28

Ratio

0.3s

0.44

0.14

0.28

0.56

Sake mash was prepared with several types of sake yeasts using 200 g of polished rice with the supplementation of 0 mg (-) or 125 mg (+) inositol. The ethyl caproate concentration (ppm) of the supernatant (fresh sake) was measured by head space gas chromatography.

was considered that in sake mash with rice at a polishing ratio of 90%, at least 10 mg more inositol was supplied to yeast than when rice at a polishing ratio of 70% was used. To ascertain the effect of inositol on ethyl caproate formation, sake mash supplemented with 0 or 125 mg of inositol was prepared using 200 g of polished rice (polishing ratio: 70%) and several types of sake yeast. As shown in Table 2, for all strains tested, more than a 50% decrease in the ethyl caproate content in the resultant sake was observed when inositol was added to the sake mash. Activities of intracellular yeast enzymes involved in ethyl caproate formation To investigate why inositol caused a reduction in ethyl caproate formation, sake mash was prepared with strain K901, a conventional sake yeast, using 200 g of polished rice with or without the addition of 125 mg of inositol. The activities of alcohol acyltransferase, the esterase in ethyl caproate synthesis, and the esterase in ethyl caproate hydrolysis, all of which affected the ethyl caproate content (19) were assayed (Fig. 3). In contrast to the result shown in Table 2, supplementation of sake mash with inositol little affected these enzyme activities. Therefore, it was thought that the reduction in ethyl caproate formation in sake mash following inositol addition was caused by a factor other than an effect on these enzyme activities. Effect of inositol on MCFA formation in sake mash Since inositol did not influence the enzyme activity involved in ethyl caproate formation (Fig. 3) the possibility

0.30 0.25 0.20 0.15 0.10 0.05 0

5

10

15

20

Time(d)

FIG. 3. Time course of AACTase and esterase activities of yeast in sake mash. Sake mash was prepared with strain K90l using 200 g of polished rice with (closed circles) or without (open circles) the addition of 125 mg of inositol. The activities of AACTase (a) and the esterase in ethyl caproate synthesis (b) and the esterase in ethyl caproate hydrolysis (c) of yeast cell-free extract were measured and are represented as units per ml of sake mash.

that inositol reduces the level of caproic acid, the substrate for ethyl caproate formation, was considered because the concentration of caproic acid in the culture is known to affect that of ethyl caproate (21). To determine the effect of inositol on MCFA formation, sake mash supplemented with 0 or 125 mg of inositol was prepared using strain K901 and strain C38, followed by analysis of the MCFA in sake. Supplementation with inositol caused a reduction in the MCFA content in sake (Table 3). The addition of inositol caused a decrease in the concentration of caproic acid as well as that of ethyl caproate. This result indicates that inhibition of MCFA synthesis by inositol results in the low amount of ethyl caproate. Two reasons were considered for the increase in MCFA following inositol limitation: One was that the release of medium chain fatty acyl-CoA was promoted due to the decreased elongation of fatty acids as observed in anaerobiosis (22-24). The other was that fatty acid biosynthesis in S. cerevisiae was increased. In a static culture,

452

FURUKAWA TABLE

Strain

3.

.1. t~lOSt I. BlOl.N(,..

ET AL. Effect of inositol

lnositol

K90 I +

on MCFA content of sake Fatty acid C8:O 2.1 1.3

~~~ C6:O 4.2 1.8

TABLE

ClO:O

Strain

0.42 0.32

W303-IA

0.48 0.43 0.76 Ratio _ 6.5 28.X 0.93 3.6 + 13.8 0.63 0.48 0.55 0.68 Ratio Sake mash was prepared as described in Table 2. MCFA content (ppm) of the supematant (fresh sake) was measured by GC-MS. C38

inositol limitation increased the concentration of cellular fatty acids by as much as it increased the MCFA concentration (data not shown). This result is consistent with reports that Succharomyces carlsbergensis accumulated cellular fatty acids because of inositol deficiency (25, 26). Therefore, it is considered that the increase in MCFA formation due to inositol limitation is caused by the enhancement of fatty acid biosynthesis, and not by decreased elongation of fatty acids. Effect of OPZl disruption on MCFA formation in It has been reported that an increase in static culture fatty acid synthesis in inositol-deficient cells of S. carlsbergensis was at least partly due to the allosteric activation of acetyl-CoA carboxylase. Both a marked increase in fiuctose- 1,6-P, and a considerable decrease in citrate in inositoldeficient cells resulted in stimulation of acetyl-CoA carboxylase activity. However, it has recently been reported that the fatty acid biosynthetic genes, including ACS2 (27), ACCl (28), FASl and FAS2 (29, 30), possess an inositol/cholineresponsive element in their respective promoter regions and are regulated in response to inositol/choline. However, they are not repressed by inositol/choline to the same extent as the phospholipid biosynthetic genes such as INOl, CHOl and OPZ3 (3 1). To clarify whether the increase in fatty acid synthesis by inositol limitation is caused by the allosteric activation of fatty acid synthetic enzymes, or by the transcriptional derepression of fatty acid synthetic genes, we determined the effects of OPII (an inositol/choline-mediated negative regulatory gene) disruption on fatty acid synthesis. Strain WDOPl, an OPIl disruptant of W303-l A, was statically cultured in the synthetic medium supplemented with 0 or 200 mgll inositol at 15°C for 5 d followed by the analysis of MCFA in the culture supernatant (Table 4). In the control strain W303- 1A, inositol limitation caused an enhancement of MCFA formation as shown in sake prepared using sake TABLE

5.

MCFA and ethyl caproate

4.

MCFA formation in the culture supernalam of the OPIl disruptant Fatty acid (pmoleigcells)

lnositol

i:6 :
C4:O 7.2kO.45 5.5kO.43

+ Ratio

0.16

t

7.4kO.71 8.lil.13

WDOPI Ratio

13.810.75 6.9i0.47 0.50 20.3+1.27 21.5+0.09

I .09

1.06

lnositol

UT-I

_

IJT-IDOP

+ _ +

C4:O 2.32kO.03 1.18+0.06 2.32kO.03 2.00f0.12

0.5 1 31.2+1.45 29.5+1.17 0.95

-~ C IO:0 10.7il.32 2.6iO.10 0.24 IO.hiO.6X 5.310.17 0150

W303-IA and WDOPI (Aopil.:AL’R/-C) were cultured in the sqnthetic medium supplemented with 0 (-) or 200 mgil (+) inositol for 5 d at 15°C. MCFA in the culture supernatant was measured and is represented as amount per I g dry cells. Each value is expressed as the mean&S.D. ofthree independent experiments.

yeast (Table 3). On the contrary, the MCFA content in the OPIl disruptant WDOPl was higher than that in the control strain when sufficient amounts of inositol were supplemented. This result suggests that the reduction in MCFA formation by inositol results from the Opi 1p-mediated transcriptional repression of fatty acid biosynthetic genes. Therefore, we concluded that the enhancement of fatty acid formation by inositol limitation in S. cerevisiue is mainly caused by the transcriptional enhancement of genes involved in fatty acid synthesis, and not by the posttranscriptional activation of fatty acid biosynthetic enzymes such as acetylCoA carboxylase. Sake brewing with OPIl disruptant To confirm the effect of Opilp on MCFA formation, sake mash supplemented with 0 or 125 mg of inositol (total rice 200 g) was prepared with strain UT-l and the OPZl disruptant UT1DOP. For strain UT- 1, supplementation of inositol caused a reduction in the ethyl caproate as well as the MCFA content (Table 5). The MCFA and ethyl caproate contents in the OPIl disruptant UT-1DOP were higher than those in the control strain when a sufficient amount of inositol was supplemented. This result indicates that the reduction in MCFA formation by inositol in sake mash also results from the Opi 1p-mediated transcriptional repression of fatty acid biosynthetic genes, followed by the reduction in ethyl caproate production. Effect of overexpression of genes involved in fatty acid To determine which biosynthesis on MCFA formation fatty acid synthetic gene predominantly contributes to the enhancement of MCFA biosynthesis, each of plasmids pGlMU-ACS2, pGlMB-ACCl, pGlMB-FASl and pGl MU-FAS2 was transformed into strain W303- 1A to ob-

content of sake brewed with the OPII disruptant MCFA (ppm)

Strain

?X :o 25.4fl.78 12.9+0.34

C6:O

C8:O

CIO:O

4.49f0.08 I .85rtO.O8 5.78?0.11 4.97+0.06

2.24&O. 10 0.97kO.07 3.0310.14 3.05io.03

0.13+0.02 0.071tO.02 0.18f0.0l 0.18+0.0I

Sake mash was prepared with UT-l and UT-l DOP (Aopil::TRPl/Aopil::URA3) using 200 g of polished of tryptophan and 68 mg of uracil and 0 or I25 mg of inositol. MCFA and ethyl caproate concentrations expressed as the meanfS.D. of two independent experiments.

I‘otal 9.18f0.02 4.07rto.11 11.32kO.23 10.20+0.01

t:thq I caproatc @pm) 0.71 f0.05 0.30fO.OI 0.69+0 0.64+0.(12

rice with the supplementation of 27 mg (ppm) in sake were measured and are

INCREASED ETHYL CAPROATE PRODUCTION

Vol.. 95, 2003

453

60.0

III

Vector Inositol

pCl-MU (control)

H

pGlMUAt32

H

pGlMUFAS2

H

pC-1MB (control)

H

pGlMB

ACCl H

pGlMB-

FASl H

pGl-MU+pGl-MB (control) L

H

pGMU-FAS2 pGM+B-FASl L

H

FIG. 4. Effect of overexpression of ACSZ, ACCI, FASI and FAS2 on MCFA content in the culture supematant. pGMU-ACS2 and pGMUFAS2, and pGMB-ACCI and pGMB-FASl, and their respective control vectors, pGMU and pGMB, were transformed into strain W303-1A. Transformants were cultured in the synthetic medium supplemented with 0 mgll (L) and 200 mg/l (H) inositol for 5 d at 15°C. The culture supematants were subiected to MCFA analvsis. Data are mean values of three independent experiments and the bar indicates S.D. Open bars, C6; striped bars, C8; solidbars, C IO. ’

tain transformants which overexpressed ACSZ, ACCI, FASI and FASZ, respectively. The corresponding control vectors were pG-1MU and pGl-MB. Transformants were statically cultured in the synthetic medium supplemented with 0 or 200 mg/l inositol at 15°C for 5 d followed by analysis of MCFA in the culture supematant (Fig. 4). It is known that acetyl-CoA carboxylase is a rate-limiting enzyme in fatty acid synthesis (26, 28, 3 l), and the expression of the acetylCoA carboxylase gene ACCl was repressed 3-fold by inosito1 and choline (28). Furthermore, in in vitro experiments, acetyl-CoA carboxylase was involved in the temperaturedependant control of fatty acid chain length (32). However, in our study on the reduction in MCFA synthesis by inositol, overexpression of ACCI had no effect on the enhancement of MCFA formation (Fig. 4). Similarly, neither overexpression of ASCZ (acetyl-CoA synthetase gene) nor that of FAS2 (a-subunit of fatty acid synthetase gene) had any effect. On the contrary, when FASl (P-subunit of fatty acid synthetase gene) was overexpressed, MCFA synthesis was clearly increased. Co-overexpression of FASl and FAS2 caused a maximal stimulation of MCFA formation. This might be due to the stability of the polypeptide encoded by FASl because fatty acid synthetase is composed of a complex of a- and P-subunits and the individual subunits are liable to be decomposed by proteolytic enzymes (33). Furthermore, when both FASl and FASZ, which are known to be repressed 1.3-3-fold by inositol (29,30), were co-overexpressed, inositol addition did not cause a decrease in MCFA formation. These results suggest that repression of the FASl gene ex-

pression by inositol results in the decrease in MCFA formation. In this study, we found that the removal of inositol by polishing rice elevated the production of esters of MCFA through the enhancement of MCFA biosynthesis by derepression of FASI expression. It is assumed that sake brewing in particular is carried out under inositol limiting conditions in commercial alcoholic beverage production, because the inositol content of commercial sake (about 5 ppm) is much lower than that of other beverages (beer, 56ppm; white wine, 399ppm; red wine, 393 ppm; huan jiu, 220 ppm). Therefore, polishing rice for use in sake brewing may be of significance in the removal of inositol from rice to increase the production of esters of MCFA, especially ethyl caproate.

REFERENCES Yoshioka, K. and Hashimoto, H.: Ester formation by alcohol acetyltransferase from brewers’ yeast. Agric. Biol. Chem., 45,2183-2190 (1981). Yoshioka, K. and Hashimoto, H.: Cellular fatty acid and esters formation by brewers’ yeast. Agric. Biol. Chem., 47, 2287-2294 (1983). Fujii, T., Kobayashi, H., Furukawa, S., and Tamai, Y.: Effect of aeration and unsaturated fatty acids on expression of the Saccharomyces cerevisiae alcohol acetyltransferase gene. Appl. Environ. Microbial., 63,9 I O-9 15 ( 1997). Furukawa, K., Nakatsuru, Y., Mizoguchi, H., and Hara, S.: Factors affecting the increase of inositol content of yeast

454

FURUKAWA ET AL

cells in sake mash. Seibutsu-kogaku, 74, 367-374 (1996). 5. Shimizu, H., Nakatani, T., Okabe, M., Mikami, S., and Iwano, K.: Influence of acid phosphatase and phytase on parallel fermentation in sake brewing. J. Brew. Sot. Jpn.. 91, 362-366 (1996). 6. Nakatani, T., Okabe, M., Shimizu, H., Mikami, S., and Iwano, K.: Influence of phytic acid and related compounds on the parallel fermentation in sake brewing. J. Brew. Sot. Jpn., 91, 527-532 (1996). 7. Furukawa, K., Mizoguchi, H., and Hara, S.: Effect of yeast acid phosphatase on inositol liberation in sake mash. Seibutsu-kogaku, 79, 133-141 (2001). 8. Amaha, M. and Takeuchi, M.: Temperature dependence of vitamin requirements of some brewery yeasts. J. Inst. Brew.. 67,339-344 (1961). 9. Takeda, M. and Tsukahara, T.: Influence of vitamins on yeast cell morphology. J. Brew. Sot. Jpn., 57, 1036-1041 (1962). IO. Takeda, M. and Tsukahara, T.: Vitamin requirement of yeast in the culture at low temperature. J. Brew. Sot. Jpn., 57, 1109-1111 (1962). Il. Kitamoto, K., Oda, K., Gomi, K., and Takahashi, K.: Construction of uracil and tryptophan auxotroph mutants from sake yeasts by disruption of URA3 and TRPI. Agric. Biol. Chem., 54,2979-2987 (1990). 12. Ichikawa, E., Hosokawa, N., Hata, Y., and Imayasu, S.: Breeding of sake yeast with improved ethyl caproate productivity. Agric. Biol. Chem., 55, 2153-2154 (1991). 13. Schena, M., Picard, D., and Yamamoto, K. R.: Vectors for constitutive and inducible gene expression in yeast. Methods Enzymol., 194, 389-398 (1991). 14. Christianson, T., Sikorski, R. S., Dante, M., Shero, J. H., and Hieter, P.: Multifunctional yeast high-copy-number shuttle vectors. Gene, 110, 119-l 22 (I 992). 15. Hanahan, D.: Studies on transformation of Escherichia co/i with plasmids. J. Mol. Biol., 166, 557.-580 (1983). 16. Becker, D. M. and Guarente, L.: High-efficiency transformation of yeast by electroporation. Methods Enzymol., 194, 1822187 (1991). 17. Namba, Y., Obata, T., Kayashima, S., Yamasaki, Y., Murakami, M., and Shimoda, T.: Method of small scalebrewing test. J. Brew. Sot. Jpn., 73, 295-300 (I 978). 18. Mizoguchi, H., Ikeda, T., and Hara, S.: Differences in the intracellular lipids of sake yeast in main mash seeded respectively with two kinds of seed mash: kimoto and sokujo-moto. J. Ferment. Bioeng., 80, 586-59 I (1995). 19. Kuriyama, K., Ashida, S., Saito, Y., Hata, Y., Suginami, K., and Imayasu, S.: Ethyl caproate synthesis and hydrolysis activity of sake yeast. Hakkokogaku, 64, 1755180 (1886). 20. Yoshizawa, K.: Rapid method for determining flavor components in sake by head space gas chromatography. J. Sot. Brew. Jpn., 68, 59-61 (1973).

21.

22.

23.

24.

25.

Kuriyama, K., Ashida, S., Saito, Y., Hata, Y., Suginami, K.. and Imavasu. S.: The role of veast and koii in the formation of ethyl “cap&ate in moromi. hakkokogaku, 64. 253-259 ( 1986). Wakil, S. J., Stoops, J. K., and Joshi, V.: Fatty acid synthesis and its regulation. Ann. Rev. Biochem.. 52, 537 -579 (1983). Schweizer, E.: Genetics of fatty acid biosynthesis in yeast, p. 59-83. In Numa, S. (ed.), Fatty acid metabolism and its regulation. Elsevier, Amsterdam ( 1984). Hammond, J. R. M.: Brewer’s yeast, p. 620. In Rose, .A. Ii. and Harrison, J. S. (ed.), The yeast. vol. V. Yeast technology. Academic Press, London ( 1993). Paltauf, F. and Johnston, J. M.: Lipid metabolism in inos~tol-deficient yeast. S’accharomyces carlsher~~ensis. Biochim. Bioohvs. Acta. 218.4244430 f 1970). Hayashi, E., Hasegawa, R., and Tomita, T.: Accumulation of neutral lipids in Saccharom_yces car1,dergensi.s by myoinositol deficiency and its mechanism. J. Biol. C’hem., 18, 5759-5799 (1976). Hiesinger, M., Wagner, C., and Schiiller, H.-J.: The acetylCoA synthetase gene ilCS2 of the yeast Saccharom.vcc,.s cerevisiae IS coregulated with structural genes of fatty acid biosynthesis by the transcriptional activators InoZp and lno4p. FEBS Lett., 415, 16-20 (1997). Haglacher, M., Ivessa, A. S., Paltauf, El, and Kohlwein, S. D.: Acetyl-CoA carboxylase from yeast is an essential enzyme and is regulated by factors that control phospholipid metabolism. J. Biol. Chem., 268, 10946- 10952 (1993). Schiiller, H. J., Hahn, A., Triister, F., Schiitz, A., and Schweizer, E.: Coordinate genetic control of yeast fatty acid synthase genes FAST and FAS2 by upstream activation site common to genes involved in membrane lipid biosynthesis. EMBO J., 11, I0771 14 (1992). Chirala, S. S.: Coordinated regulation and inositol-mediated and fatty acid-mediated repression of fatty acid synthetase genes in Sacchurom_yces cerevisiae. Proc. Natl. Acad. Sci. USA, 89, 10232-l 0236 (I 992). Greenberg, M. L. and Lopes, J. M.: Genetic regulation ot phospholipid biosynthesis in Succharomyces cerevisiac. Microbiol. Rev., 60, l-20 (1996). Hori, T., Nakamura, N., and Okuyama, H.: Possible involvement of acetyl coenzyme A carboxylase as well as fatty acid synthetase in the temperature-controlled synthesis ot fatty acids in SaccharomyccT,r cerevisiae. J. Biochem. (Tokyo). 101,949-9.56 (1987). Schiiller, H.-J., Fiirtsch, B., Rautenstrauss, B., Wolf, D. H., and Schweizer, E.: Differential proteolytic sensitivity of yeast fatty acid synthetase subunits CI and p contributing to a balanced ratio of both fatty acid synthetase components. Eur. J. Biochem., 203,607-614 (1992). I

26.

27.

28.

29.

30.

31.

32.

33.

,

I

_

,