Increased expression of an acetylcholinesterase gene may confer organophosphate resistance in the greenbug, Schizaphis graminum (Homoptera: Aphididae)

Pesticide Biochemistry and Physiology 73 (2002) 164–173 www.academicpress.com

Increased expression of an acetylcholinesterase gene may confer organophosphate resistance in the greenbug, Schizaphis graminum (Homoptera: Aphididae) Jian-Rong Gao1 and Kun Yan Zhu* Department of Entomology, 123 Waters Hall, Kansas State University, Manhattan, KS 66506, USA Received 24 April 2002; accepted 4 September 2002

Abstract Acetylcholinesterases (AChE, EC 3.1.1.7) were purified from an organophosphate (OP)-susceptible (OSS) clone and an OP-resistant (OR-0) clone of the greenbug, Schizaphis graminum (Rondani). Enzyme inhibition kinetics showed that AChE from the OR-0 clone was 1.1- to 12.8-fold less sensitive to inhibition by chlorpyrifos oxon, paraoxon, methyl paraoxon, malaoxon, demeton-S-methyl and omethoate than AChE from the OSS clone based on their bimolecular rate constants (ki ). Analyses of DNA sequences of PCR-amplified fragments from the AChE coding regions did not reveal any differences between the OSS and the three OP-resistant clones (OR-0, OR-1, and OR-2). Northern blot analysis, however, showed that the amount of AChE mRNA in the resistant clones was approximately 1.5-fold higher than that in the OSS clone. Southern blots did not provide any evidence of gene amplification for the increased mRNA. The increased AChE mRNA appears to be positively correlated with the amount of AChE in crude enzyme preparations. These results indicated that the increased AChE activity in OP-resistant clones was due to increased expression of the AChE gene. It is possible that an increased transcription rate and/or increased stability of the mRNA results in the increase of AChE mRNA in the OP-resistant clones of the greenbug. Ó 2002 Elsevier Science (USA). All rights reserved. Keywords: Greenbug; Insecticide resistance; Acetylcholinesterase; Northern blot; Southern blot; Polymerase chain reaction; Schizaphis graminum

1. Introduction The greenbug, Schizaphis graminum (Rondani), is an important cosmopolitan pest of small grains and sorghum [1]. Organophosphate insecticides (OP)2 are the major chemicals used for greenbug control [2]. Intensive application of *

Corresponding author. Fax: 1-785-532-6232. E-mail address: [email protected] (K.Y. Zhu). 1 Present address: Department of Entomology, Fernald Hall, University of Massachusetts, Amherst, MA 01003, USA.

2

Abbreviations used: OP, organophosphate; AChE, acetylcholinesterase; ATC, acetylthiocholine iodide; BCA, bicinchoninic acid solution; BSA, bovine serum albumin; cDNA, complementary DNA; DTNB, 5; 50 dithio-bis(2-nitrobenzoic acid); EDTA, ethylenediaminetetraacetic acid; OR-0, OR-1, and OR-2, organophosphate-resistant greenbug clones; OSS, organophosphate-susceptible greenbug clone; PTS buffer, 0.05 M phosphate buffer (pH 7.0) containing 0.1% (v/v) Triton X-100 and 0.05 M NaCl; RT-PCR, reverse transcription followed by polymerase chain reaction; SDS, sodium dodecylsulfate.

0048-3575/02/$ - see front matter Ó 2002 Elsevier Science (USA). All rights reserved. PII: S 0 0 4 8 - 3 5 7 5 ( 0 2 ) 0 0 1 0 5 - 0

J.-R. Gao, K.Y. Zhu / Pesticide Biochemistry and Physiology 73 (2002) 164–173

these chemicals has resulted in development of high levels of resistance to OPs. Resistant populations of the greenbug have been detected since the mid-1970s in the midwestern United States, including populations in Texas, Colorado, Oklahoma, Kansas, Nebraska, and South Dakota [3–7]. Laboratory studies showed significant levels of resistance in three OP-resistant clones of the greenbug to parathion, methyl parathion, chlorpyrifos, dimethoate, omethoate, disulfoton, and demeton-S-methyl, ranging from 3- to 66-fold for the OR-0 clone, 11- to 54-fold for the OR-1 clone, and 30- to 327-fold for the OR-2 clone [8,9]. Biochemical characterization of these resistant clones showed no differences in glutathione S-transferase and cytochrome P450 O-demethylase activities from those of the OP-susceptible clone (OSS) of the greenbug [9–11]. However, general esterase activities in the OR-1 and OR-2 clones were significantly higher than those in the OSS clone for the substrates a-naphthyl acetate, b-naphthyl acetate, a-naphthyl butyrate, and a-naphthyl propionate. In contrast, general esterase activities of the OR-0 clone were very similar to those of the OSS clone [9]. Further studies revealed that the OP-resistant greenbugs also possessed an altered acetylcholinesterase (AChE, EC 3.1.1.7) [12], an essential enzyme involved in neurotransmission in the central nervous system of insects [13,14]. AChE from OP-resistant greenbugs showed 1.1- to 3.8-fold less sensitivity to inhibition by six OP compounds and 1.8- to 2.3-fold higher catalytic activity than that of susceptible greenbugs [8,15]. Apparently, increased amount of AChE contributed to the increased enzyme activity in the resistant greenbugs [15]. Because the OR-0 clone showed increased AChE activity but only normal esterase activity, it enabled us to investigate the role of AChE in OP resistance in the greenbug. In this paper we report: (1) AChE sensitivities to inhibition by six OP compounds among the OSS and OR-0 clones; (2) comparisons of DNA sequences within the AChE coding regions between the OSS and three OPresistant clones; and (3) molecular mechanisms leading to increased AChE activity in the OP-resistant greenbugs. 2. Materials and methods

165

plants in the greenhouse at Kansas State University (KSU) in 1996; the source of these greenbugs is unknown. A resistant strain (OR-0) was provided by John C. Reese of KSU. Two other resistant strains (OR-1 and OR-2), possessing Type I (pattern 1) and Type II (pattern 2) esterases, respectively, were provided by Blair D. Siegfried of the University of Nebraska, Lincoln, NE. The origins of the OR-1 and OR-2 strains were previously described in detail [16]. All greenbug clones were isolated from their corresponding strains and were maintained on stems of 6- to 8week-old sorghum plants. The stems were maintained at 23 °C and supplied with water in 2-L flasks covered with a nylon screen. Stems were replaced about every 5 days [15]. For AChE purification, clones were mass reared on whole sorghum plants at 25  2 °C in growth chambers with a photoperiod of 16:8 (L:D). The sorghum variety used was hybrid NC+ 160 (susceptible to biotype I greenbugs). 2.2. Chemicals Acetylthiocholine iodide (ATC), bicinchoninic acid (BCA) solution, 5; 50 -dithio-bis(2-nitrobenzoic acid) (DTNB), ethylenediaminetetraacetic acid (EDTA), paraoxon (diethyl p-nitrophenyl phosphate, 90% pure), procainamide, sodium dodecylsulfate (SDS), and Triton X-100 were purchased from Sigma Chemical (St. Louis, MO). Chlorpyrifos-oxon (diethyl-3; 5; 6-trichloro-2-pyridinyl phosphate, 97% pure), demeton-S-methyl (S-2-ethylthioethyl O; O-dimethyl phosphorothioate, 95% pure), methyl paraoxon (dimethyl-p-nitrophenyl phosphate, 99.5% pure), and omethoate [O; O-dimethyl-S-(N-methylcarbomoylmethyl) phosphorothioate, 98% pure] were purchased from Chem Service (West Chester, PA). Ammonium sulfate was purchased from Fisher Scientific (Fair Lawn, NJ). Bovine serum albumin (BSA) was purchased from Bio-Rad Laboratories (Hercules, CA). Tetraethylammonium iodide (Net4 I) was purchased from Aldrich Chemical (Milwaukee, WI), and malaoxon (S-(1,2-dicarbethoxyrthyl) O; O-dimethylphosphorothiolate, 86% pure) was provided by Cheminova Agro (Lemvig, Denmark).

2.1. Greenbug clones

2.3. Purification of AChE

An organophosphate-susceptible strain (OSS) of the greenbug was established from sorghum

AChEs from the OSS and OR-0 clones were purified by sequential steps of ammonium sulfate

166

J.-R. Gao, K.Y. Zhu / Pesticide Biochemistry and Physiology 73 (2002) 164–173

precipitation, gel filtration and affinity chromatography, as previously described [17]. Briefly, 4 g of frozen greenbug was homogenized in 50 mL of ice-cold 0.05 M phosphate buffer (pH 7.0) containing 0.5% (v/v) Triton X-100. Supernatant from 45,000g centrifugation of the homogenate was fractionated by ammonium sulfate precipitation at 30% saturation. Precipitated protein containing AChE was dissolved in 12 mL of 0.05 M phosphate buffer (pH 7.0) containing 0.1% (v/v) Triton X-100 and 0.05 M NaCl (PTS buffer). The resolubilized fraction was separated by gel filtration on a Sephadex G-150 column (2:5  40 cm). Eight fractions (3.2 mL/fraction) collected at a flow rate of 0.12 mL/min were pooled and applied to a procainamide–Sepharose 4B affinity column (1  8 cm). After the column was washed with 210 mL PTS buffer, bound AChE was eluted with 0.03 M Net4 I in PTS buffer at flow rate of 0.25 mL/min. Three fractions (0.53 mL/fraction) with the highest AChE activity were pooled and dialyzed for four times, each against 250 mL of 0.05 M phosphate buffer (pH 7.0) containing 0.1% (v/v) Triton X-100 for 1 h. 2.4. AChE activity and protein assays AChE activity was measured according to the method of Ellman et al. [18] with some modifications by Zhu and Gao [15] using ATC as a substrate with a Vmax kinetic microplate reader (Molecular Devices, Menlo Park, CA). Protein concentrations were determined according to the BCA method [19] using BSA as a standard. 2.5. In vitro inhibition of AChE Six OP-oxon analogues were used to determine bimolecular rate constants ðki Þ. All OPs were dissolved in acetone as stock solutions. The acetone concentration was maintained below 1% in final inhibition reactions. The assay procedure was the same as previously described [20,21]. Briefly, 10 lL of each of six different concentrations of an OP was mixed with 10 lL of diluted enzyme using a multichannel pipette and preincubated for 2 min at 25 °C. The residual AChE activity was measured immediately after 180 lL of ATC and DTNB solution was added to the inhibition mixture. The final concentrations of ATC and DTNB in the reaction mixture were 0.50 and 0.04 mM, respectively. The ki values were calculated according to the method of Aldridge and

Davison [22], and compared between the OSS and OR-0 greenbug clones by using StudentÕs t test [23]. 2.6. RNA and genomic DNA preparations Total RNA was isolated from each of the four greenbug clones (OSS, OR-0, OR-1, and OR-2) with mixed developmental stages using Trizol reagent (Life Technologies, Gaithersburg, MD), and mRNA was selected using MessageMaker Reagent Assembly (Life Technologies). The total RNA was used for RT-PCR and the mRNA was used for Northern blot analysis. Genomic DNA was prepared from each of the four greenbug clones by the method of Sambrook et al. [24] with few modifications. Briefly, 0.5 g of greenbug was pulverized in liquid nitrogen. After the nitrogen had dissipated, the sample was mixed with 10 mL of extraction buffer (100 mM Tris, 1%SDS, 100 mM EDTA, and 0.2 mg/mL of proteinase K) and incubated for 90 min at 65 °C. The DNA was extracted with phenol/chloroform and precipitated with ethanol. The precipitated DNA was collected, dissolved in 10 mL of TE buffer (pH 8.0) containing 200 lg/mL RNase A and incubated at 37 °C for 1 h. The DNA was then extracted again with phenol/chloroform, precipitated with ethanol, and washed once with 70% ethanol. The DNA was redissolved in TE buffer (pH 8.0) and used for Southern blot analysis. 2.7. RT-PCR, DNA sequencing, and sequence analysis First strand cDNA was synthesized from 2.5 lg of total RNA of each resistant greenbug clone in 50 lL of reaction using ProSTAR Ultra HF RT-PCR system (Stratagene, La Jolla, CA) according to manufacturerÕs instructions. PCR was performed after the reverse transcription of RNA. Two fragments, with their ends overlapped, were separately amplified from the open reading frame of the AChE cDNA by using two sets of specific primers designed from the known AChE cDNA sequence of the OSS greenbug clone [25]. For PCR, 4 lL of the reverse transcription reaction was added to a final 50-lL reaction mixture containing 200 lM each of four dNTPs, 4 lM each of forward and reverse primers (Table 1), 2.5 U of Taq DNA polymerase (Promega, Madison, WI), 15 mM ðNH4 Þ2 SO4 , 3.5 mM MgCl2 (for the first set of primers) or 2.5 mM

J.-R. Gao, K.Y. Zhu / Pesticide Biochemistry and Physiology 73 (2002) 164–173

167

Table 1 Locations and sequences of oligonucleotide primers used for RT-PCR Fragment

PCR primer

Locationa

Oligonucleotide sequence (50 –30 )

I

Forward I Reverse I

182–203 1400–1422

GGTGGTCGAACATTTACCACTG AAACATATAGCCACGTGGTCCCA

II

Forward II Reverse II

1285–1306 2390–2411

TAATAGAGGACTCAAGCTGGCA AGCCTAGACTGAATTGTCCTCG

a

The nucleotide locations were based on the known AChE cDNA sequence from the OSS greenbug clone [25].

MgCl2 (for the second set of primers), and 60 mM Tris–HCl (pH 9.5 for the first set of primers, and 9.0 for the second set of primers). The PCR products were separated on 1% agarose gel. The gel blocks containing the DNA fragments were individually cut from the gel and DNA was extracted in 40 lL of TE (pH 8.0). Reamplification of fragment I was performed under the same conditions as described above, except that the DNA extractions were used as PCR templates (6 lL for both the OR-0 and OR-1 clones, and 2 lL for the OR-2 clone). All PCRs, after initial denaturation of the templates at 94 °C for 3 min, were run for three cycles (94 °C for 1 min, 45 °C for 1 min, and 72 °C for 2 min) followed by 35 cycles (94 °C for 1 min, 55 °C for 1 min, and 72 °C for 2 min) and a final extension for 10 min at 72 °C on a Omn-E thermal cycler (Hybaid, Middlesex, UK). The PCR products were purified using Wizard PCR preps DNA purification system (Promega, Madison, WI) after separation on 1% agarose gel. Sequencing was performed on both strands using an ABI PRISM 3700 DNA analyzer (Foster City, CA) at the Sequencing and Genotyping Facility at Kansas State University, Manhattan. cDNA sequences of the three OP-resistant greenbug clones were compared with sequence of the OSS clone using the SIM4 program [26]. 2.8. Northern and Southern blot analyses Northern blot was performed using NorthernMax Kit (Ambion, Austin, TX) according to manufacturerÕs instructions. Briefly, mRNA (9.5 lg/lane) was separated on a 1% agarose gel and transferred to a nylon membrane. A 278-bp PCR-amplified cDNA fragment was generated as a homologous probe using semi-nested PCR and degenerate primers, as described by Zhu et al. [9]. The probe was labeled with [a-32 P]dATP by a random primers DNA labeling system (Life Technologies). The blot was hybridized overnight

at 42 °C with the 32 P-labeled probe. After being washed, the blot was exposed to Kodak X-Omat AR film for 6 days at )80 °C with an intensifying screen. The intensity of images was quantified with an AMBIS Radioanalytic Imaging System (AMBIS, San Diego, CA). For Southern blot analysis, genomic DNA was digested with each of three restriction enzymes (EcoRI, EcoRV, and HindIII) at 37 °C overnight, and separated on a 0.7% agarose gel (10 lg/lane). The DNA was depurinated with 0.2 N HCl for 10 min, rinsed briefly in distilled water, denatured with 0.4 N NaOH containing 5 SSC for 30 min, transferred to a nylon membrane in the denaturation solution for 12 h and neutralized in 0.5 M Tris–HCl (pH 7.2), 5 SSC for 15 min. The blot was prehybridized at 65 °C for 1 h in 6 SSC buffer containing 5 DenhardtÕs solution, 0.5% SDS, 5% dextran sulfate, and 0.2 mg/mL sheared herring sperm DNA. A 1.7-kb probe was prepared from an AChE cDNA isolated from the cDNA library [25] by EcoRI digestion and labeled with [a-32 P]dATP by a random primers DNA labeling system (Life Technologies). Hybridization with the 32 P-labeled cDNA probe was performed overnight in the above buffer at 65 °C. The blot was washed in 2 SSC containing 0.5% SDS twice at room temperature, and in 0.1 SSC containing 0.5% SDS four times at 65 °C. The blot was exposed to Kodak X-Omat AR film for 3 h at )80 °C with an intensifying screen.

3. Results AChEs from the OSS clone and a representative resistant clone, OR-0, were successfully purified. The purification of AChE from the OSS clone (data not presented) was very similar to that previously reported [17]. However, the purification factor (619-fold) and yield (3.9%) for the OR0 clone were 3.6- and 3-fold, respectively, lower than those (2253-fold and 12%) for the OSS clone

168

J.-R. Gao, K.Y. Zhu / Pesticide Biochemistry and Physiology 73 (2002) 164–173

(Table 2). The AChE from both clones exhibited similar rank order in sensitivity to inhibition by six OPs, as determined by comparison of their bimolecular rate constants ðki Þ (Fig. 1). For the AChE from the OSS clone the rank order from

the most sensitive to the least was chlorpyrifos oxon > paraoxon > methyl paraoxon > malaoxon > demeton-S-methyl > omethoate. Rank order for AChE from the OR-0 clone was chlorpyrifos oxon > methyl paraoxon > malaoxon > para-

Table 2 Purification of AChE from the OR-0 greenbug clone by ammonium sulfate precipitation, Sephadex G-150 gel filtration, and procainamide-based affinity chromatography Purification step

Volume (mL)

Protein (mg/mL)

Total protein (mg)

Triton X-100 extract Ammonium sulfate Gel filtration Affinity column

50.0

7.36

368.00

12.1

8.07

23.2 1.53

1.10 0.015

Specific activity (lmol/min/mg)

Total activity (lmol/min)

Yield (%)

Purification factor (-fold)

0.089

32.95

100

1.0

97.65

0.176

17.24

52

2.0

25.52 0.023

0.597 55.082

15.26 1.27

46 3.9

6.7 618.9

Fig. 1. Inhibition of AChE purified from the OSS and OR-0 clones of the greenbug by organophosphate oxon analogues. After the enzyme was preincubated with an organophosphate inhibitor for 2 min at 25 °C, the percentage of residual AChE activity was determined against a control in the absence of the inhibitor. Each point represents the mean of five determinations (n ¼ 5). The correlation coefficients (r) of all linear regression lines are >0:97 except for OR-0 with omethoate which is 0.89 (P < 0:01).

J.-R. Gao, K.Y. Zhu / Pesticide Biochemistry and Physiology 73 (2002) 164–173

oxon > demeton-S-methyl > omethoate. The sensitivity of AChE from the OR-0 clone to inhibition by all tested OPs was 1.1- to 12.8-fold lower than that of OSS, depending on the OP compound (Table 3). To examine whether point mutations in the AChE gene are responsible for or contribute to OP resistance, the AChE cDNA within the coding region was amplified from the three resistant clones with RT-PCR. Two fragments were amplified; fragment I consisted of 1.2 kb and fragment II 1.1 kb (Fig. 2). The DNA sequences of these fragments from three OR clones did not differ from that from the OSS clone [25]. Northern blot analysis was used to examine whether elevated AChE expression is responsible for the increased AChE activity in the OR clones. Strong hybridization was seen to the 3.7-kb transcripts of all the clones. The amount of the AChE mRNA in all three OR clones was 1.5-fold higher than that in the OSS clone as determined by an AMBIS Radioanalytic Imaging System (Fig. 3).

169

In Southern blot analysis, genomic DNA was digested with each of the three enzymes EcoRI, HindIII or EcoRV, which has 2 (position in cDNA 222–223 and 1775–1776), 1 (3181–3182), or no internal cleavage sites within the AChE cDNA, respectively. By using the 1.7-kb cDNA probe, identical bands were found among the four greenbug clones: 8.4- and 6.9-kb fragments in the EcoRI digested DNA, and 6.9-kb fragments in both the HindIII and EcoRV digested DNA (Fig. 4). There was no obvious difference among the OSS and the three OR clones in either the banding pattern or the intensity of the bands in the blot when an equal amount of genomic DNA was used for all clones.

4. Discussion 4.1. Insensitive AChE in OP-resistant greenbugs Based on the purification profiles, the total activities recovered from the Triton X-100 ex-

Table 3 Bimolecular rate constants ðki Þ of six organophosphate compounds in the inhibition of AChE from organophosphatesusceptible (OSS) and -resistant (OR-0) clones of the greenbug Organophosphate

ki ðM1 min1 Þa

Ratio of ki (OSS/OR-0)

OSS Chlorpyrifos oxon Methyl paraoxon Paraoxon Malaoxon Demeton-S-methyl Omethoate

OR-0 7

ð2:27  0:10Þ  10 ð2:10  0:07Þ  105 ð2:30  0:07Þ  105 ð1:41  0:13Þ  105 ð4:79  0:21Þ  104 ð3:57  0:20Þ  103

ð1:93  0:13Þ  107 ð1:64  0:03Þ  105 ð1:00  0:01Þ  105 ð1:11  0:04Þ  105 ð4:30  0:09Þ  104 ð0:28  0:02Þ  103 ; b

1.2 1.3 2.3 1.3 1.1 12.8

a

Values are the means  SD of five determinations (n ¼ 5). Three highest concentrations were used for calculating ki . * A mean followed by an asterisk is significantly different from that of OSS for a given compound (StudentÕs t test, P < 0:05). b

Fig. 2. RT-PCR amplification of AChE cDNA fragments from the three OR clones of the greenbug. Two cDNA fragments (1.2- and 1.1-kb) with their ends overlapped were amplified and 15 lL of PCR product from each 50 lL reaction was analyzed on a 1.5% agarose gel.

170

J.-R. Gao, K.Y. Zhu / Pesticide Biochemistry and Physiology 73 (2002) 164–173

Fig. 3. Northern blot analysis of mRNA from the OSS and three OR clones of the greenbug. A sample of 9.5 lg mRNA was separated on each lane of 1% agarose gel. The blot was hybridized with a 32 P-labeled, 278-bp PCR-generated probe.

Fig. 4. Southern blot analysis of genomic DNA from the OSS and three OR clones of the greenbug. Ten lg of genomic DNA was digested with each of three restriction enzymes EcoRI, EcoRV or HindIII and separated on 0.7% agarose gel. The blot was hybridized with a 32 P-labeled 1.7-kb cDNA probe.

traction, ammonium sulfate precipitation and gel filtration for the OR-0 clone were approximately 2-fold higher than those for the OSS clone [17]. However, total AChE activity for the OR-0 from affinity chromatography was 1.7-fold lower than that for the OSS clone. The higher AChE activity for the OR-0 clone in Triton X-100 extraction, ammonium sulfate precipitation, and gel filtration was apparently due to the higher amount of AChE in the OR-0 greenbugs. However, the decreased purification efficiency for the OR-0 clone was due to decreased affinity of the enzyme to the affinity ligand procainamide because a significant amount of AChE bypassed through the affinity column before it was eluted (Table 2). In addition, AChE purified from the OR-0 clone was 1.1- to 12.8-fold less sensitive to inhibition by six OP compounds than AChE from the OSS clone (Table 3). These insensitivity levels of purified AChE for the OR-0 clone were similar to those for the crude AChE preparations reported previously [8,9,12,15]. Thus, our purification and inhibition studies have clearly shown that AChE in the OR-0 clone is biochemically different from AChE in the OSS clone. Nevertheless, AChE from the OR-0 clone was only marginally insensitive (1.1- to 2.3-fold) to the OP compounds examined except for omethoate (12.8-fold) as determined based on the second phase of the inhibition curve (Fig. 1, Table 3). In

fact, there was no significant difference in the sensitivity of purified AChE to inhibition by demeton-S between the OSS and OR-0 clones (data not shown). Further, there were no or very little correlations between the insensitivity levels of AChE and the resistance levels of the insect to the OP compounds for the OR-0 clone. For example, AChE purified from the OR-0 clone was 1.2-, 1.3-, 2.3-, 1.1-, and 12.8-fold less sensitive to inhibition by chlorpyrifos oxon, methyl paraoxon, paraoxon, demeton-S-methyl, and omethoate, respectively (Table 3). However, the OR-0 greenbugs were about 3.1-, 4.8-, 18.2-, 44.5-, and 19.9-fold more resistant to chlorpyrifos, methyl parathion, parathion, demeton-S-methyl, and omethoate than the OSS greenbugs in our bioassay [9]. These results suggest that reduced sensitivity of AChE plays only a secondary role, whereas increased AChE activity plays a major role in conferring or contributing to OP resistance in the greenbug. This notion is particularly true for the OR-0 clone since no other resistance mechanisms were identified in our previous studies [9]. 4.2. Increased AChE activity as an important resistance mechanism Studies on Drosophila melanogaster indicate that 25% of AChE activity is sufficient for survival and development of the insect [27]. Increased

J.-R. Gao, K.Y. Zhu / Pesticide Biochemistry and Physiology 73 (2002) 164–173

AChE activity, therefore, may confer OP and/or carbamate resistance in insects even through the enzyme is sufficiently sensitive to these insecticides. In fact, increased AChE activity associated with OP-resistance has been documented in California red scale, Aonidiella aurantii [28], and the contribution to resistance from increased AChE has been demonstrated in D. melanogaster [29,30]. Furthermore, excellent correlations between the amount of AChE and the level of parathion resistance have been found in field-collected D. melanogaster populations [31]. All these studies have firmly established that increased activity or amount of AChE can lead to OP and/or carbamate resistance in insects. Our previous study revealed that increased AChE activity was mainly due to the increased amount of AChE as indicated by increased Vmax for AChE from the resistant greenbugs [15]. Northern blot analysis, however, showed that the amount of the AChE mRNA in the resistant clones was approximately 1.5-fold higher than that in the OSS clone. However, unlike the gene amplification of a carboxylesterase (E4) in insecticide-resistant green peach aphids (Myzus persicae) [32], Southern blot analysis did not show any evidence of gene amplification for the increased mRNA in the OP-resistant greenbugs. The increased AChE mRNA appeared to be positively correlated with the AChE activity in crude enzyme preparations [15]. These results indicate that the increased AChE activity in the OP-resistant clones is due to the increased expression of an AChE gene. It is possible that increased transcription rate and/or increased stability of the mRNA result in the increase of AChE mRNA in the OP-resistant clones. The increased amount of AChE may compensate for the function of insecticide-inhibited AChE by maintaining an adequate functional titer of AChE in the synaptic regions of insect nervous system. To our knowledge, this is the first molecular study on increased AChE activity conferring or contributing to OP resistance in an agriculturally important insect. 4.3. Two-AChE-gene hypothesis The existence of two AChE genes has been suggested in the northern house mosquito (Culex pipiens) [33]. Several studies have not been able to find any structural changes in AChE even though decreased sensitivity of AChE to insecticide inhibition was biochemically established in resistant insects [34,35]. For example, a 10,000-fold de-

171

crease in propoxur sensitivity was associated with only one of two possible AChE genes in a resistant strain of the northern house mosquito [34]. It has been hypothesized that insensitive AChE may result from structural changes due to point mutations in an unidentified AChE gene. Our study also did not find any sequence differences in the AChE coding regions between the OSS and three OR clones of the greenbug while decreased sensitivity of purified AChE to inhibition by six OP compounds was observed in the OR clones. Such results lead us to hypothesize that the greenbug may also have two different AChE genes. Although we have not yet obtained a complete cDNA sequence of the first AChE gene from the greenbug, our Northern blot analysis of mRNA for the first gene revealed a 7.6-kb transcript with no sign of overexpression in the OR-0 clone [9]. We have sequenced, however, the cDNAs of the second AChE gene from the OSS clone [25] and all three OR clones (this study). Although the cDNA sequence of this gene remained unaltered, our Northern blot analysis revealed a 3.7-kb transcript with significantly increased expressions of the gene in all three OR clones. Because both altered and unaltered AChEs could be co-purified from the resistant greenbugs, it is expected that purified AChEs may show heterogeneous responses to certain OP compounds such as omethoate (Fig. 1). According to the omethoate inhibition plot, approximately 35% of AChE might be expressed by the structurally altered gene. The remaining proportion of the enzyme might be expressed by the unaltered, but overexpressed AChE gene as determined in this study. Our two-AChE-gene hypothesis is further supported by direct molecular evidences. First, our semi-nested PCR amplification of the greenbug AChE cDNA simultaneously generated two different fragments (data not shown). These fragments shared only 47% identity in their nucleotide sequences (Zhu, unpublished). Secondly, our Northern blot analyses using the two PCR-generated fragments as probes revealed two different transcripts with sizes of 7.6 and 3.7 kb [9,25]. Thirdly, the expression levels of the AChE with the 7.6-kb transcript were similar among the OSS and OR clones [9], whereas the AChE gene with the 3.7-kb transcript was overexpressed in the OR clones. These results have clearly demonstrated the existence of two distinctively different AChE genes encoding different AChEs in the greenbug.

172

J.-R. Gao, K.Y. Zhu / Pesticide Biochemistry and Physiology 73 (2002) 164–173

Further studies are needed to determine possible structural alterations of the first AChE gene in the OR greenbugs and to elucidate structure and function relationships of both AChEs.

Acknowledgments The authors thank Drs. John C. Reese and Blair D. Siegfried for providing greenbug colonies used in this study, and Dr. James E. Baker for reviewing an earlier draft of the manuscript. This research was partially supported by the Kansas Agricultural Experiment Station, Kansas State University and US Department of Agriculture. The manuscript is Contribution No. 02-399-J from the Kansas Agricultural Experiment Station, Kansas State University. Greenbug voucher specimens (No. 083) were deposited in the Museum of Entomological and Prairie Arthropod Research, Kansas State University, Manhattan, KS 66506.

[9]

[10] [11]

[12]

[13]

[14]

References [1] R.L. Metcalf, R.A. Metcalf, Destructive and Useful Insects: Their Habits and Control, fifth ed., McGraw-Hill, New York, 1993. [2] J.H. Hatchett, K.J. Starks, J.A. Webster, Insect and mite pests of wheat, in: E.G. Heyne (Ed.), Wheat and Wheat Improvement, second ed., Agron. Monogr., vol. 13, second ed., American Society of Agronomy, Madison, 1987, pp. 625–675. [3] D.C. Peters, E.A. Wood Jr., K.J. Starks, Insecticide resistance in selection of the greenbug, J. Econ. Entomol. 68 (1975) 339. [4] G.L. Teetes, C.A. Schaefer, J.R. Gibson, R.C. Mclntyre, E.E. Lathman, Greenbug resistance to organophosphorus insecticides on the Texas High Plains, J. Econ. Entomol. 68 (1975) 214. [5] T.L. Archer, E.D. Bynum Jr., Pesticide resistance by arthropod pests on feed grains, Southwest Entomol. 3 (1978) 251. [6] P.E. Sloderbeck, M.A. Chowdhury, L.J. Depew, L.L. Buschman, Greenbug (Homoptera: Aphididae) resistance to parathion and chlorpyrifosmethyl, J. Kans. Entomol. Soc. 64 (1991) 1. [7] R.A. Shufran, G.E. Wilde, P.E. Sloderbeck, W.P. Morrison, Occurrence of insecticide resistant greenbugs (Homoptera: Aphididae) in Kansas, Texas, Oklahoma, and Colorado and suggestions for management, J. Econ. Entomol. 90 (1997) 1106. [8] J.-R. Gao, K.Y. Zhu, Comparative toxicity of selected organophosphate insecticides against resistant and susceptible clones of the greenbug, Schiza-

[15]

[16]

[17]

[18]

[19]

[20]

[21]

phis graminum (Homoptera: Aphididae), J. Agric. Food Chem. 48 (2000) 4717. K.Y. Zhu, J.-R. Gao, S.R. Starkey, Organophosphate resistance mediated by alterations of acetylcholinesterase in a resistant clone of the greenbug, Schizaphis graminum (Homoptera: Aphididae), Pestic. Biochem. Physiol. 68 (2000) 138. M. Ono, B.D. Siegfried, Role of greenbug esterases in resistance to parathion, Pestic. Sci. 43 (1995) 166. J.-R. Gao, Biochemical and molecular analyses of acetylcholinesterase from organophosphate-susceptible and resistant clones of the greenbug, Schizaphis graminum (Homoptera: Aphididae), Ph.D. Dissertation, Kansas State University, Manhattan, KS, 2001. B.D. Siegfried, M. Ono, Mechanisms of parathion resistance in the greenbug, Schizaphis graminum (Rondani), Pestic. Biochem. Physiol. 45 (1993) 24. A.T. Eldefrawi, Acetylcholinesterase and anticholinesterases, in: G.A. Kerkut, L.I. Gilbert (Eds.), Comprehensive Insect Physiology, Biochemistry and Pharmacology, vol. 12, Pergamon Press, New York, 1985, pp. 115–130. F. Matsumura, Toxicology of Insecticides, second ed., Plenum Press, New York, 1985. K.Y. Zhu, J.-R. Gao, Increased activity associated with reduced sensitivity of acetylcholinesterase in organophosphate-resistant greenbug, Schizaphis graminum (Homoptera: Aphididae), Pestic. Sci. 55 (1999) 11. M. Ono, J.S. Richman, B.D. Siegfried, Characterization of esterases from susceptible and parathionresistant strains of the greenbug (Homoptera: Aphididae), J. Econ. Entomol. 87 (1994) 1430. J.-R. Gao, K.Y. Zhu, An acetylcholinesterase purified from the greenbug (Schizaphis graminum) with some unique enzymological and pharmacological characteristics, Insect Biochem. Molec. Biol. 31 (2001) 1095. G.L. Ellman, K.D. Courtney, V. Andres, R.M. Featherstone, A new and rapid colorimetric determination of acetylcholinesterase activity, Biochem. Pharmacol. 7 (1961) 88. P.K. Smith, R.I. Krohn, G.T. Hermanson, A.K. Mallia, F.H. Gartner, M.D. Provenzano, E.K. Fujimoto, N.M. Goeke, B.J. Olson, D.C. Klenk, Measurement of protein using bicinchoninic acid, Analyt. Biochem. 150 (1985) 76. K.Y. Zhu, J.M. Clark, Comparisons of kinetic properties of acetylcholinesterase purified from azinphosmethyl-susceptible and -resistant strains of Colorado potato beetle, Pestic. Biochem. Physiol. 51 (1995) 57. J.-R. Gao, J.V. Rao, G.E. Wilde, K.Y. Zhu, Purification and kinetic analysis of acetylcholinesterase from western corn rootworm, Diabrotica virgifera virgifera (Coleoptera: Chrysomelidae), Arch. Insect Biochem. Physiol. 39 (1998) 118.

J.-R. Gao, K.Y. Zhu / Pesticide Biochemistry and Physiology 73 (2002) 164–173 [22] W.N. Aldridge, A.N. Davison, The inhibition of erythrocyte cholinesterase by tri-esters of phosphoric acid, Biochem. J. 51 (1952) 62. [23] SAS Institute, SAS/STAT Guide for Personal Computers, version 6.12., SAS Institute, Cary, NC, 1996. [24] J. Sambrook, D.W. Russell, Molecular Cloning: A Laboratory Manual, third ed., Cold Spring Harbor Laboratory Press, New York, 2001. [25] J.-R. Gao, S. Kambhampati, K.Y. Zhu, Molecular cloning and characterization of a greenbug (Schizaphis graminum) cDNA encoding acetylcholinesterase possibly evolved from a duplicate gene lineage, Insect Biochem. Molec. Biol. 32 (2002) 765. [26] L. Florea, G. Hartzell, Z. Zhang, G.M. Rubin, W.A. Miller, A computer program for aligning a cDNA sequence with a genomic DNA sequence, Genome Res. 8 (1998) 967. [27] F. Hoffmann, D. Fournier, P. Spierer, Minigene rescues acetylcholinesterase lethal mutations in Drosophila melanogaster, J. Mol. Biol. 223 (1992) 17. [28] E. Levitin, E. Cohen, The involvement of acetylcholinesterase in resistance of the California red scale Aonidiella aurantii to organophosphorus pesticides, Entomol. Exp. Appl. 88 (1998) 115. [29] D. Fournier, J.-M. Bride, F. Hoffman, F. Karch, Acetylcholinesterase: two types of modifications

[30]

[31]

[32]

[33]

[34]

[35]

173

confer resistance to insecticide, J. Biol. Chem. 267 (1992) 14270. S. Berrada, D. Fournier, Transposition-mediated transcriptional overexpression as a mechanism of insecticide resistance, Mol. Gen. Genet. 256 (1997) 348. A. Charpentier, D. Fournier, Levels of total acetylcholinesterase in Drosophila melanogaster in relation to insecticide resistance, Pestic. Biochem. Physiol. 70 (2001) 100. A.L. Devonshire, L.M. Field, Gene amplification and insecticide resistance, Annu. Rev. Entomol. 36 (1991) 1. D. Bourguet, M. Raymond, D. Fournier, C.A. Malcolm, J.-P. Toutant, M. Arpagaus, Existence of two acetylcholinesterases in the mosquito Culex pipiens (Diptera: Culicidae), J. Neurochem. 67 (1996) 2115. C.A. Malcolm, D. Bourguet, A. Ascolillo, S.J. Rooker, C.F. Garvey, L.M.C. Hall, N. Pasteur, M. Raymond, A sex-linked Ace gene, not linked to insensitive acetylcholinesterase-mediated insecticide resistance in Culex pipiens, Insect Mol. Biol. 7 (1998) 107. T. Tomita, O. Hidoh, Y. Kono, Absence of protein polymorphism attributable to insecticide-insensitivity of acetylcholinesterase in the green rice leafhopper, Nephotettix cincticeps, Insect Biochem. Molec. Biol. 30 (2000) 325.