Increased expression of Dkk1 by HR is associated with alteration of hair cycle in hairpoor mice

Journal of Dermatological Science 74 (2014) 81–87

Contents lists available at ScienceDirect

Journal of Dermatological Science journal homepage: www.jdsjournal.com

Increased expression of Dkk1 by HR is associated with alteration of hair cycle in hairpoor mice Bong-Kyu Kim 1, Hwa-Young Lee 1, Injung Kim, Keonwoo Choi, Jongkeun Park, Sungjoo K. Yoon * Department of Medical Lifesciences, The Catholic University of Korea, Seoul, Republic of Korea

A R T I C L E I N F O

A B S T R A C T

Article history: Received 7 October 2013 Received in revised form 27 November 2013 Accepted 19 December 2013

Background: Hairless (Hr), a transcriptional corepressor expressed mainly in the skin, regulates hair follicle (HF) morphogenesis and hair cycling. Recently, we reported a new Hr mutant mouse, ‘‘Hairpoor’’ (HrHp), that resembles the human hair disorder Marie Unna hereditary hypotrichosis (MUHH) in the heterozygous state. The Wnt/b-catenin signaling pathway is critical for homeostasis in various adult tissues including skin and HFs. One of the Wnt inhibitors, Dickkopf (Dkk), inhibits hair growth during the hair cycle as a catagen inducer of apoptosis, resulting in HF reductions. Objective: To investigate regulation of Dkk1 by HR and its effect on hair formation. Methods: The relative expression of Dkk1 in +/HrHP and HrHp/HrHp mice during the hair cycle was investigated using real time PCR and Western blot analysis. Immunohistochemistry was performed in order to confirm abnormal expression of Dkk1 in HFs of +/HrHP and HrHp/HrHp mice. To determine whether Dkk1 expression was also regulated by HR in vitro, an Hr-transient transfection experiment was performed. Alteration of the hair cycle in HrHP heterozygous mice was identified by determination of the hair cycle and measurement of HF length. Results: Dkk1 expression was increased in the skin of +/HrHP and HrHp/HrHp mice, as well as in Hroverexpressing mouse keratinocytes. Additionally, an earlier entrance of HFs into catagen and shortened HF length in +/HrHP mice compared to wild-type mice was observed. Conclusion: Study results suggested that up-regulation of Dkk1 by HR contributed to abnormal development of HFs and failure in regeneration of HFs in HrHp/HrHp mice. These findings also indicated that alteration of the hair cycle in +/HrHP mice was related to the up-regulation of Dkk1 by HR. ß 2014 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

Keywords: HR Dkk1 Hair cycle Hairpoor Wnt pathway

1. Introduction Hair is a unique skin appendage in all mammals. The hair follicle (HF), which produces hair, consists of a hair bulb, containing matrix and dermal papilla, an inner root sheath (IRS), a hair shaft, and an outer root sheath (ORS) [1]. HFs produce hair through a continuous cycle which consists of a hair shaft growth phase (anagen), a regression of HFs and formation of hair clubs phase (categen), and a phase of HF resting during which HFs undergo no significant proliferation, apoptosis or differentiation (telogen) [2,3]. Hairless (HR), a transcriptional corepressor, interacts with nuclear receptors, including the vitamin D receptor (VDR), retinoic acid orphan receptor a (RORa), and thyroid hormone receptor (TR)

* Corresponding author at: Department of Medical Lifesciences, The Catholic University of Korea, Seoul, Seochogu, Banpodong 505, 137-701, Republic of Korea. Tel.: +82 0222587474.. E-mail address: [email protected] (S.K. Yoon). 1 These authors contributed equally to this study.

to regulate expression of their target genes [4–7]. HR is mainly expressed in the skin, specifically in the suprabasal cell layer of the epidermis which is the lower portion of the hair matrix and IRS [8]. HR regulates HF morphogenesis and hair cycling through transcriptional regulation of specific target genes involved these processes [9–12]. Various Hr mutant mice have been studied to elucidate the function of HR [13–15]. Recently, we reported a new Hr mutant mouse, ‘‘Hairpoor’’ (HrHp). This mouse has a mutation in the 50 UTR of Hr and causes HR overexpression through translational de-repression [16]. Importantly, HrHp heterozygotes are an animal model for the human hair disorder Marie Unna hereditary hypotrichosis (MUHH; OMIM-146550, Hypotrichosis 4), which is caused by mutations in the 50 -UTR of the human HR gene [16–18]. MUHH is a rare, autosomal dominant, hair loss disorder characterized by abnormal hair density on the scalp, eyebrows, eyelashes, or body. Scalp hair of those affected with MUHH is sparse or absent at birth, followed by re-growth of coarse and wiry hair in childhood, and subsequent potential hair loss at puberty [19].

0923-1811/$36.00 ß 2014 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved. http://dx.doi.org/10.1016/j.jdermsci.2013.12.007

B.-K. Kim et al. / Journal of Dermatological Science 74 (2014) 81–87

82

Wnt/b-catenin signaling is critical for embryonic development and maintenance of homeostasis in various adult tissues, including skin and HFs, through control of cell proliferation, migration, differentiation, and motility [20–25]. To initiate the Wnt/b-catenin pathway, Wnt proteins are secreted and then bind to Frizzleds (Fz) or low-density lipoprotein receptor-related protein 5/6 (LRP 5/6). This interaction can be regulated by several secreted inhibitors, including the secreted frizzled-related protein (Sfrp) family, Wnt inhibitory factor 1 (Wif1), and Cerberus, which bind directly to Wnt and sequester it from its receptors. The Dickkopf (Dkk) class also inhibits the Wnt/b-catenin pathway by competing with Wnt proteins for binding to LRP5/6 [26]. Recently, Kwack and her colleagues reported that Dkk1 has a role in hair growth inhibition as a catagen inducer in hair cycling, which leads to a decrease in final HFs as well as an induction of apoptosis in follicular keratinocytes [27]. We previously reported that expression of several Wnt inhibitors was changed in the HrHp/HrHp skin and HR overexpressing keratinocytes. However, regulation of Dkks by HR has not been documented. In this study, we investigated the relationship between DKKs and HR and assessed its effect on HF formation. We found that Dkk1 expression was increased consistently in the HrHp/HrHp skin and in HR over-expressing cells. Furthermore, we detected an earlier entrance of HFs into catagen and a shortened HF length in HrHP heterozygous mice as compared to wild-type mice. These results suggested that Dkk1 was up-regulated by HR and that this regulation may contribute to the alteration of the hair cycle in +/HrHP and HrHp/HrHp mice.

2. Materials and methods 2.1. Mice Maintenance of mice was previously reported [28]. All animal experiments were approved by the Institutional Animal Care and Use Committee (IACUC) of the Catholic University and performed in accordance with the Guidelines for Animal Experimentation. 2.2. Reverse transcription polymerase chain reaction (RT-PCR) and real time PCR Dorsal skins were obtained from wild-type, HrHp heterozygote, and HrHp/HrHp mice. Total RNA was extracted from dorsal skins and mouse keratinocyte cells (PAM212) using Trizol reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s instructions. The single-stranded cDNAs were synthesized using the PrimeScript 1st strand cDNA Synthesis kit (Takara, Tokyo, Japan) and used to conduct real time PCR in a CFX96 TouchTM Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA, USA) using gene-specific primers. Primer sequences and cycling conditions are listed in Table 1.

2.3. Western blot analysis of the protein extracts from the skin of wildtype, HrHp/+ and HrHp/HrHp mice Total proteins were extracted from the skins of the wild-type and HrHp/HrHp mice using RIPA (150 mM sodium chloride, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris– HCl, pH 8.0) according to the standard method [11]. To quantify the amount of protein, Bradford method was used. Three hundred micrograms of protein were used for Western blot analysis with rabbit polyclonal HR antibody (1:5000, Abfrontier, Seoul, Korea), monoclonal Dkk1 antibody (1:100, Santa Cruz Biotechnology, Santa Cruz, CA, USA) or mouse polyclonal b-actin antibody (1:5000, Applied Biological Materials, Vancouver, Canada). Sensitivity of the antigen–antibody reaction was improved using Can Get Signal (Toyobo, Osaka, Japan) following the manufacturer’s instruction. The protein signals were visualized using the ECL system (Amersham Biosciences). 2.4. Histological study of skin from wild-type and HrHp/HrHp mice Skin samples were taken from wild-type and HrHp heterozygote mice from postnatal day 3 (P3) to postnatal day 21 (P21) for histological study as previously described [16]. Paraffin sections (6 mm) were prepared and hematoxylin and eosin (H&E) staining was performed using a standard method. Cells were observed with an optical microscope (Olympus, Tokyo, Japan). 2.5. Immunohistochemistry Samples of the upper back skin of wild-type mice at P14, P17, and P21 were sectioned (3 mm) prior to antigen retrieval, which was conducted by treating slides with 5% BSA and 0.5% Tween-20. Slides were incubated with Dkk1 antibody (1:100) for 4 h at room temperature. Polymer detection was achieved using HRP-conjugated antibody (Dako, Glostrup, Denmark) incubated for 1 h at room temperature. DAB Chromogen was used for color reaction (Dako Glostrup, Denmark). The b-catenin expression was detected by incubating the slides with b-catenin antibody (1:100, Sigma– Aldrich) overnight at 4 8C. Then Alexa Fluor 488 goat anti-mouse secondary antibody (Invitrogen, 1:500) was incubated for 3 h at room temperature after washing three times. Fluorescence signal was observed with a Fluorescent microscope (Olympus, Tokyo, Japan). 2.6. Cell culture and transient transfection experiments PAM212 cells were grown in DMEM (Invirogen) containing 10% FBS with 5% CO2 in a 37 8C incubator. Cells were plated at 8  105/ dish and incubated for 24 h. Three micrograms of a full-length Hr cDNA clone (BC049182) and pcDNA 3.1(+) with 0.4 mg of pCMV3.1/ b-gal were transfected into cells using Lipofectamine2000 (Invitrogen) reagent. After two days, cells were collected and

Table 1 List of gene specific primers. Genes

Accession number

Sequences

Size (bp)

Tm (8C)

Dkk1

NM_010051

150

62

Dkk2

NM_020265

155

62

Hr

NM_021877

316

62

Itgb1

NM_010578

228

62

Gapdh

NM_008084

F: caaaggacaagaaggctccgtc R: ggtgcacacctgaccttctt F: catcctcaccccacatatcc R: gtaggcatgggtctccttca F: gagaagagtggggtgtgagc R: ctcggttacctacccaccac F: tccttcaattgctcaccttg R: ccgtctggcaatttgctatt F: aactttggcattgtggaagg R: acacattgggggtaggaaca

223

62

B.-K. Kim et al. / Journal of Dermatological Science 74 (2014) 81–87

83

total RNAs were isolated for real time PCR analyses. The relative expression level was normalized against transfection efficiency determined by b-galactosidase activity. 2.7. Determination of hair cycle score and measurement of HF length The hair cycle stage of HFs was determined using a method described previously [29]. Briefly, the score of each hair cycle was defined as follows: Telogen = 1, Anagen I = 2, Anagen II = 3, Anagen III = 4, Anagen IV = 5, Anagen V = 6, Anagen VI = 8, Catagen I = 8, Catagen II = 7, Catagen III = 7, Catagen IV = 6, Catagen V = 5, Catagen VI = 4, Catagen VII = 3, Catagen VIII = 2. A total of 30 HFs were used to calculate the hair cycle score (HCS). The hair cycle stage of each HF was determined based on histological characteristics and a score was assigned. Scores were added and divided by 10 to calculate the HCS for each section. Three independent sections from three mice were analyzed to obtain the average HCS. Using H&E stained sections, the length of each HF was determined by measuring the distance between the bottom of the hair bulb to the surface of the epidermis for each HF and an average of 30 HFs was obtained for each group. 2.8. Statistical analysis p Values were calculated using Student’s t-tests or one-way analysis of variance. A value of p < 0.05 was regarded as statistically significant. 3. Results 3.1. Expression of Dkk1 was increased in the skin of HrHp/HrHp mice and Hr-overexpressing keratinocytes Recently, we and other investigators reported that Wnt inhibitors, Sfrp1, Sfrp2 and Wise were down-regulated by HR over-expression whereas expression of Wif1 was increased [9,17,30]. Because the Dkk family are Wnt inhibitors and their expression has not been documented in the skin of HrHp/HrHp mice, we examined the expression of members of the Dkk family in HrHp/ HrHp mice. Among members of the Dkk family, Dkk1 and Dkk2 transgenic mice have been reported to have a hairless phenotype or decreased HF density [31,32]. Therefore, we investigated the expression of Dkk1 and Dkk2 to assess whether these Wnt inhibitors were also affected by HR overexpression. We performed real time PCR to determine the relative expression of Dkk1 and Dkk2 in the skin of HrHp/HrHp mice as compared to wild-type mice. We found Dkk1 expression was significantly increased at all-time points tested to 7.76  3.58, 3.99  0.88, 6.32  0.64, 9.19  3.99 and 6.62  2.74-fold in HrHp/HrHp mice at P7, P10, P14, P17 and P28, respectively (Fig. 1a). In contrast, Dkk2 expression was not significantly changed in HrHp/HrHp mice at P10 (1.91  1.40), P14 (1.05  0.30), and P17 (1.33  0.97), although its expression was increased at P7 (4.26  0.83) and P28 (5.18  1.09) (Fig. 1b). We also investigated the expression of Dkk1 protein in the skins of HrHp/HrHp and wild-type mice at P10 and P17 using Western blot analysis. Dkk1 expression showed correlation with HR expression level. As well as the wild-type skin showed higher expression level of Dkk1 at P17 than at P10, the HrHp/HrHp mouse skin expressed much more Dkk1 than the wild-type skin at both time points, which is comparable to the mRNA expression pattern (Fig. 1c). To further investigate the expression pattern of Dkk1, we performed immunohistochemistry in the skin of HrHp/HrHp mice at P14, P17, and P21. In previous studies, Dkk1 has been shown to be expressed in early and middle anagen [27]. Additionally, its expression was shown to be increased strongly in the follicular keratinocytes of late anagen HFs and then decreased during

Fig. 1. The relative expression of Dkk1 and Dkk2 in the HrHp/HrHp mice. (a) Real time PCR revealed that Dkk1 was consistently increased in the HrHp/HrHp mice at P7–P28. (b) In contrast, Dkk2 expression was not significantly changed in HrHp/HrHp mice at P10, P14 and P17. (a and b) The value is the average of three independent experiments conducted in duplicate. The data was normalized against Gapdh mRNA expression. Asterisks indicates p < 0.05. NS = no significant. (c) Western blot analysis revealed that both HR and Dkk1 protein expression was increased in HrHp/ HrHp mice at P10 and P17. b-Actin was used as protein loading control.

catagen and telogen [27]. In wild-type mice, we also detected Dkk1 expression in the ORS, IRS, and dermal papillae (DP) at P14 but its expression was nearly undetectable at P17 and P21. In contrast, Dkk1 was highly expressed in the remnant of the HFs at P14, P17, and P21 in HrHp/HrHp mice (Fig. 2a–c). These results corresponded with our real time PCR data (Fig. 1a). To further investigate whether the expression of Dkk1 was also increased by HR in vitro, we induced HR over-expression through transfection of an HrcDNA construct into mouse keratinocyte cells (PAM212). When Hr was over-expressed, Dkk1 expression was increased to 1.64  0.16fold compared to that of the mock transfection control, while Itgb1, which is expressed in ORS and the surrounding connective tissue sheath and inhibits hair growth [33], showed no significant changes between mock transfected and Hr transfected PAM212 cells (Fig. 2d and e). We also investigated the expression of Dkk2 and its expression was not significantly changed (Supplementary Fig. 1). The similar result between HR and Dkk2 was shown in other cell line (HEK293T) [12,17] .In addition, we also examined b-Catenin expression in order to investigate whether the canonical Wnt signaling is also downregulated in the HFs of the HrHp/HrHp mice due to the Dkk1upregulation. We found the inverse relationship between the expressions of Dkk1 and b-Catenin in the HFs. In HrHp/HrHp mice,

84

B.-K. Kim et al. / Journal of Dermatological Science 74 (2014) 81–87

Fig. 2. HR up-regulates expression of Dkk1 in vivo and in vitro. (a–c) Increased expression of Dkk1 in HrHp/HrHp HFs. Immunohistochemistry of 6 mm thick sections of the wildtype and the HrHp/HrHp mice skins at P14 (a), P17 (b) and P21 (c) using a Dkk1 antibody. Dkk1 (dark brown) was strongly expressed in the remnant of the HFs in HrHp/HrHp mouse. In wild-type, Dkk1 was weakly (a) or nearly not expressed (b and c). Arrowheads indicate Dkk1 expression. (d and e) HR up-regulates Dkk1 in Hr-over-expressed keratinocyte. (d) Real time PCR showed the expression of Hr in PAM212 cells transfected with the Hr-expression construct. (e) Relative expression of Dkk1 in PAM212 cells. Dkk1 mRNA level was increased in Hr-transfected cells compared with the mock-transfected cells, while Itgb1 mRNA expression did not show any difference. The value is the average of three independent experiments conducted in duplicate. The data was normalized against Gapdh mRNA expression. Asterisks indicate p < 0.05. (f and g) Immunohistochemistry revealed that b-catenin was almost not expressed in the remnant of the HFs where Dkk1 was highly expressed (arrowhead). Scale bar = 50 mm (f) and 100 mm (g).

b-Catenin was almost not detected in the remnant of the HFs where Dkk1 was highly expressed (arrowheads in Fig. 2f and g). Collectively, these results strongly supported the hypothesis that overexpression of HR up-regulated Dkk1 expression in vivo and in vitro. Supplementary material related to this article can be found, in the online version, at http://dx.doi.org/10.1016/j.jdermsci. 2013.12.007. 3.2. Alteration of the hair cycle occurred in HrHp heterozygous mice Previous studies have suggested that Dkk1 promotes catagen progression and regression of HFs by blocking the Wnt/b-catenin signaling pathway [27]. Based on this report, we hypothesized that up-regulation of Dkk1 by HR could also promote catagen and HF regression in HrHp mice. Because HrHp/HrHp mice are born with total alopecia and a completely absent hair cycle, we used HrHp heterozygous mice for this study. First, we investigated whether expression of Dkk1 also increased in HrHp heterozygote mice as compared to wild-type mice. Real time PCR revealed that Dkk1 was also increased to 5.19  1.99-, 9.81  3.83-, 3.17  1.03-, and 1.8  0.30-fold compared to age-matched wild-type skin at P7, P10, P14, and P17, respectively (Fig. 3a). Overall, this up-regulation was less than that observed in HrHp/HrHp mice. We then performed

immunohistochemical staining to observe Dkk1 expression in HrHp heterozygote HFs. As shown in Fig. 3b and c, Dkk1 showed stronger expression in the ORS, IRS, and DP in HrHp heterozygote HFs than in wild-type mice at P14 and P17. At P21, Dkk1 expression was not detected in HFs from wild-type skin whereas its expression was still observed in the HrHp heterozygote (Fig. 3d). These results suggested that Dkk1 was also up-regulated in the skin of HrHp heterozygote mice. Lastly, we characterized the histological changes of HFs in wildtype and HrHp heterozygote mice using dorsal skin sections. At P3, no significant differences were observed between wild-type and HrHp heterozygote mice. HFs from wild-type mice continued to grow until P10 and entered catagen at P14, which proceeded until P17. In contrast, HFs from HrHp heterozygote mice were in full anagen at P7 and in mid-catagen by P10. Moreover, HrHp heterozygote mice already regenerated HFs at P21 (Fig. 4a). To quantify this alteration of the hair cycle in HrHp heterozygote mice, we counted various hair cycle stages (P0  P21) of HFs in wild-type and HrHp heterozygote mice for calculation of HCSs. Once calculated, HCSs revealed different hair-cycling patterns between wild-type and HrHp heterozygote mice. In wild-type mice, the HCS was significantly higher at P10 and P14 than during other stages. Compared with the wild-type, HrHp heterozygote mice showed the

B.-K. Kim et al. / Journal of Dermatological Science 74 (2014) 81–87

85

Fig. 3. Dkk1 was also up-regulated in the skin of HrHp heterozygote mice. (a) The relative expression level of Dkk1 of the HrHp heterozygote skin compared to that of the agematched wild-type skin from P7 to P17. Real time PCR revealed the consistent up-regulation of Dkk1 in HrHp heterozygote mice. The value is the average of three independent experiments conducted in duplicate. The data was normalized against Gapdh mRNA expression. Asterisks indicate p < 0.05. NS = no significant. (b–d) Dkk1 expression (dark brown) was increased in HFs of HrHp heterozygote mice. Higher expression of Dkk1 was detected in the ORS, IRS and DP on the HFs in HrHp heterozygote HFs compared to the wild type HFs. Arrowheads indicate Dkk1 expression.

highest HCS at P7 (Fig. 4b), indicating that HrHp heterozygote mice HFs reached at full anagen by P7. To further characterize the changes of HF in HrHp heterozygote mice, the density and length of wild-type and HrHp heterozygote mice HFs were measured. HF density was not significantly different between wild-type and HrHp heterozygote mice (data not shown). However, HF length in HrHp heterozygote mice was drastically shorter than in wild-type HFs throughout the all stages except P21 (Fig. 4c). These observations indicated that the HFs of the HrHp heterozygote mice never reached a length similar to that of wild-type HFs and entered catagen earlier than normal HFs. 4. Discussion Many signaling molecules, including Wnts, Bmps, Fgfs, and Shh, and transcription factors are involved in the control of HF development and the hair cycle [34]. Among these, the Wnt/bcatenin pathway is one of major signaling pathways known to control these processes. The Wnt/b-catenin pathway is necessary not only for the initiation of HF development and control of hair cycle, but also for determination of HF spacing [24,31,32,35]. Through studies of HR mutant mice, several Wnt inhibitors with expression regulated by HR were revealed [9,10,17,30]. In this study, we found that Dkk1, a Wnt inhibitor, was increased in HrHp/HrHp mice and that its expression was regulated by HR in vivo and in vitro. Dkk1 transgenic mice do not form any HFs and are completely blocked from the development of skin appendages including all types of hair follicles, vibrissae, teeth, and mammary glands. Moreover, ectopic expression of Dkk1 inhibits expression of placode markers and molecules necessary for early HF development [31,32], indicating that Dkk1 is a critical molecule in the formation of HFs. In HrHp/HrHp mice, Dkk1 was highly up-regulated compared to wild-type mice. Considering the role of Dkk1 in HF development, this up-regulation was likely to have contributed the abnormal development of HFs and failed

regeneration of HFs in HrHp/HrHp mice. As shown in Fig. 2a–c, Dkk1 was highly expressed in the remnants of HFs consistently blocked from normal formation of HFs. We also found that expression of Dkk1 was increased in HrHp heterozygote mice and that they had an early onset of catagen compared to wild-type mice. Results of a recent study suggested that Dkk1 promoted regression of HFs through induction of anagen-to-catagen transition in the hair cycle [27]. Similar to this effect, HrHp heterozygote mice also underwent earlier catagen onset through a shortened anagen phase and early maturation of HFs as compared to wild type mice. This similarity strongly suggests that early catagen onset in HrHp heterozygote mice was caused by increased expression of Dkk1, which may provide critical information for understanding the mechanisms underlying MUHH, as HrHp heterozygotes are an animal model for MUHH. Interestingly, HR is known as a transcriptional corepressor, suppressing expression of target genes through interactions with nuclear receptors [5–7]. Because Dkk1 expression was upregulated by over-expressing HR in vivo and in vitro, we speculate that HR may regulate Dkk1 expression indirectly. It is possible that HR regulates Dkk1 expression through regulation of other transcription factors which subsequently regulate Dkk1 transcription. There is also a distinct possibility that a specific miRNA mediates regulation of Dkk1 expression by HR. For example, miR92 inhibits secretion of Dkk3 in neuroblastoma cells [36] and miR29a regulates the abundance of Wnt-3a, b-catenin, and Dkk1 in bone tissue [37]. Stage-specific expression of miRNAs has been reported [38] and thus, any one of the many miRNAs with expressions that change during the anagen-to-catagen transition stage may be a candidate for mediating the regulation of Dkk1 expression by HR. Therefore, further investigation is needed to elucidate the accurate molecular mechanisms by which HR regulates Dkk1 expression. In summary, our results demonstrated that alteration of the hair cycle in HrHp heterozygote mice was related to the

86

B.-K. Kim et al. / Journal of Dermatological Science 74 (2014) 81–87

Fig. 4. Alteration of hair cycle in HrHp heterozygote mice. (a) Hematoxylin and eosin (H&E) staining of the skins of the wild-type and HrHp heterozygote mice at P3–P21. Early onset catagen and next anagen were observed in HrHp heterozygote mice. (b) Calculation of hair cycle scores for wild-type and HrHp heterozygote HFs. HrHp heterozygote mice displayed abnormal hair-cycling patterns compared with wild-type. At least 10 hair follicles in the mice were evaluated in each mouse group. (c) Measurement of HF length for wild-type and HrHp heterozygote mice. Total of 10 HFs for each mouse and three mice for each group were used for measurement.

up-regulation of Dkk1 by HR. These results suggest a new paradigm for understanding the pathophysiology of MUHH and hair cycle regulation by HR. In addition, our findings are also helpful in explaining abnormal formation of HFs in HrHp/HrHp mice. In order to elucidate the mechanisms of hair loss in HrHp/HrHp mice, the relationship between HR and its multiple target genes including Dkk1 is essential. Further studies will be required to understand the mechanisms underlying such regulation, which will facilitate the search for a rational treatment for MUHH and other HRassociated hair disorders. Acknowledgement This research was supported by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education, Science and Technology (NRF2013R1A1A2011821).

References [1] Langbein L, Schweizer J. Keratins of the human hair follicle. International Review of Cytology 2005;243:1–78. [2] Hardy MH. The secret life of the hair follicle. Trends in Genetics: TIG 1992;8:55–61. [3] Stenn KS, Paus R. Controls of hair follicle cycling. Physiological Reviews 2001;81:449–94.

[4] Cachon-Gonzalez MB, Fenner S, Coffin JM, Moran C, Best S, Stoye JP. Structure and expression of the hairless gene of mice. Proceedings of the National Academy of Sciences of the United States of America 1994;91:7717–21. [5] Hsieh JC, Sisk JM, Jurutka PW, Haussler CA, Slater SA, Haussler MR, et al. Physical and functional interaction between the vitamin D receptor and hairless corepressor, two proteins required for hair cycling. Journal of Biological Chemistry 2003;278:38665–74. [6] Moraitis AN, Giguere V, Thompson CC. Novel mechanism of nuclear receptor corepressor interaction dictated by activation function 2 helix determinants. Molecular and Cellular Biology 2002;22:6831–41. [7] Thompson CC, Bottcher MC. The product of a thyroid hormone–responsive gene interacts with thyroid hormone receptors. Proceedings of the National Academy of Sciences of the United States of America 1997;94:8527–32. [8] Panteleyev AA, Paus R, Christiano AM. Patterns of hairless (hr) gene expression in mouse hair follicle morphogenesis and cycling. American Journal of Pathology 2000;157:1071–9. [9] Beaudoin III GM, Sisk JM, Coulombe PA, Thompson CC. Hairless triggers reactivation of hair growth by promoting Wnt signaling. Proceedings of the National Academy of Sciences of the United States of America 2005;102:14653–58. [10] Thompson CC, Sisk JM, Beaudoin III GM. Hairless and Wnt signaling: allies in epithelial stem cell differentiation. Cell Cycle 2006;5:1913–7. [11] Kim BK, Lee HY, Choi JH, Kim JK, Yoon JB, Yoon SK. Hairless plays a role in formation of inner root sheath via regulation of Dlx3 gene. Journal of Biological Chemistry 2012;287:16681–88. [12] Kim BK, Yoon SK. Hairless down-regulates expression of Msx2 and its related target genes in hair follicles. Journal of Dermatological Science 2013;71:203–9. [13] Zarach JM, Beaudoin III GM, Coulombe PA, Thompson CC. The co-repressor hairless has a role in epithelial cell differentiation in the skin. Development 2004;131:4189–200. [14] Ahmad W, Panteleyev AA, Sundberg JP, Christiano AM. Molecular basis for the rhino (hrrh-8J) phenotype: a nonsense mutation in the mouse hairless gene. Genomics 1998;53:383–6.

B.-K. Kim et al. / Journal of Dermatological Science 74 (2014) 81–87 [15] Panteleyev AA, Ahmad W, Malashenko AM, Ignatieva EL, Paus R, Sundberg JP, et al. Molecular basis for the rhino Yurlovo (hr(rhY)) phenotype: severe skin abnormalities and female reproductive defects associated with an insertion in the hairless gene. Experimental Dermatology 1998;7:281–8. [16] Baek IC, Kim JK, Cho KH, Cha DS, Cho JW, Park JK, et al. A novel mutation in Hr causes abnormal hair follicle morphogenesis in hairpoor mouse, an animal model for Marie Unna Hereditary Hypotrichosis. Mammalian Genome 2009;20:350–8. [17] Kim JK, Kim E, Baek IC, Kim BK, Cho AR, Kim TY, et al. Overexpression of Hr links excessive induction of Wnt signaling to Marie Unna hereditary hypotrichosis. Human Molecular Genetics 2010;19:445–53. [18] Wen Y, Liu Y, Xu Y, Zhao Y, Hua R, Wang K, et al. Loss-of-function mutations of an inhibitory upstream ORF in the human hairless transcript cause Marie Unna hereditary hypotrichosis. Nature Genetics 2009;41:228–33. [19] Argenziano G, Sammarco E, Rossi A, Delfino M, Calvieri S. Marie Unna hereditary hypotrichosis. European Journal of Dermatology: EJD 1999;9:278–80. [20] Cadigan KM, Nusse R. Wnt signaling: a common theme in animal development. Genes & Development 1997;11:3286–305. [21] Wodarz A, Nusse R. Mechanisms of Wnt signaling in development. Annual Review of Cell and Developmental Biology 1998;14:59–88. [22] Miller JR, Hocking AM, Brown JD, Moon RT. Mechanism and function of signal transduction by the Wnt/beta-catenin and Wnt/Ca2+ pathways. Oncogene 1999;18:7860–72. [23] Logan CY, Nusse R. The Wnt signaling pathway in development and disease. Annual Review of Cell and Developmental Biology 2004;20:781–810. [24] Reddy S, Andl T, Bagasra A, Lu MM, Epstein DJ, Morrisey EE, et al. Characterization of Wnt gene expression in developing and postnatal hair follicles and identification of Wnt5a as a target of Sonic hedgehog in hair follicle morphogenesis. Mechanisms of Development 2001;107:69–82. [25] Ouji Y, Yoshikawa M, Moriya K, Ishizaka S. Effects of Wnt-10b on hair shaft growth in hair follicle cultures. Biochemical and Biophysical Research Communications 2007;359:516–22. [26] Kawano Y, Kypta R. Secreted antagonists of the Wnt signalling pathway. Journal of Cell Science 2003;116:2627–34.

87

[27] Kwack MH, Kim MK, Kim JC, Sung YK. Dickkopf 1 promotes regression of hair follicles. Journal of Investigative Dermatology 2012;132:1554–60. [28] Nam Y, Kim JK, Cha DS, Cho JW, Cho KH, Yoon S, et al. A novel missense mutation in the mouse hairless gene causes irreversible hair loss: genetic and molecular analyses of Hr m1Enu. Genomics 2006;87:520–6. [29] Muller-Rover S, Handjiski B, van der Veen C, Eichmuller S, Foitzik K, McKay IA, et al. A comprehensive guide for the accurate classification of murine hair follicles in distinct hair cycle stages. Journal of Investigative Dermatology 2001;117:3–15. [30] Kim BK, Baek IC, Lee HY, Kim JK, Song HH, Yoon SK. Gene expression profile of the skin in the ‘hairpoor’ (HrHp) mice by microarray analysis. BMC Genomics 2010;11:640. [31] Andl T, Reddy ST, Gaddapara T, Millar SE. WNT signals are required for the initiation of hair follicle development. Developmental Cell 2002;2:643–53. [32] Sick S, Reinker S, Timmer J, Schlake T. WNT and DKK determine hair follicle spacing through a reaction–diffusion mechanism. Science 2006;314:1447–50. [33] Kloepper JE, Hendrix S, Bodo E, Tiede S, Humphries MJ, Philpott MP, et al. Functional role of beta 1 integrin-mediated signalling in the human hair follicle. Experimental Cell Research 2008;314:498–508. [34] Krause K, Foitzik K. Biology of the hair follicle: the basics. Seminars in Cutaneous Medicine and Surgery 2006;25:2–10. [35] Li YH, Zhang K, Ye JX, Lian XH, Yang T. Wnt10b promotes growth of hair follicles via a canonical Wnt signalling pathway. Clinical and Experimental Dermatology 2011;36:534–40. [36] Haug BH, Henriksen JR, Buechner J, Geerts D, Tomte E, Kogner P, et al. MYCNregulated miRNA-92 inhibits secretion of the tumor suppressor DICKKOPF-3 (DKK3) in neuroblastoma. Carcinogenesis 2011;32:1005–12. [37] Wang FS, Chuang PC, Lin CL, Chen MW, Ke HJ, Chang YH, et al. MicroRNA-29a protects against glucocorticoid-induced bone loss and fragility in rats by orchestrating bone acquisition and resorption. Arthritis and Rheumatism 2013;65:1530–40. [38] Mardaryev AN, Ahmed MI, Vlahov NV, Fessing MY, Gill JH, Sharov AA, et al. Micro-RNA-31 controls hair cycle-associated changes in gene expression programs of the skin and hair follicle. FASEB Journal 2010;24:3869–81.