Increased interleukin 2 transcription in murine lymphocytes by ciprofloxacin

Immunopharmacology ELSEVIER

Immunopharmacology 27 (1994) 155-164

Increased interleukin 2 transcription in murine lymphocytes by ciprofloxacin Kristian Riesbeck*, Arne Forsgren Department o[ Medt~al Ml~robtology. Lurid Umver~lty. Malmo General Hospital. S-214 O1 Mahno. Sweden

(Recel,md 7 September 1993. accepted 29 November 1993)

Abstract The fluoroquinolone antibiotic, clprofloxacin (clpro), induces hyperproductlon of lnterleukln 2 (IL-2) and Interferon-7 (IFN-7) in stimulated human peripheral blood lymphocytes In this investigation an enhanced and prolonged IL-2 and IL-2 mRNA response was also detected m both stimulated (T cell mitogens or alloantlgens) murlne splenocytes and In the stimulated murine T cell line EL-4 in the presence of clprofloxacln (5-80/~g/ml) as compared to control cells without antibiotics However, in contrast to human lymphocytes, IFN-?, production was inhibited and IFN-], mRNA levels were unaffected at 24 h and only shghtly upregulated at 48 and 72 h of culture in murine splenocytes incubated with cipro (20/lg/ml) EL-4 cells were transfected with a plasmld containing the IL-2 promoter and enhancer region hnked to the chloramphemcol acetyltransferase (CAT) reporter gene Analysis of CAT activity revealed that clpro enhanced IL-2 gene induction In addition, EL-4 cells incubated with clprofloxacin showed an early peak and more activated nuclear factor of activated T cells (NFAT-1) as compared to control cells without antibiotics Clpro did not affect the nuclear transcription factors AP-1 or NFIL-2A Taken together, cipro inhibited IFN-:, synthesis, but enhanced IL-2 production in murlne lymphocytes by means of influencing NFAT-1 and causing an increased IL-2 transcription

Key winds Ciprofloxacin, Murlne bmphocyte, Transcription, Interleukln 2; Interferon-7

1. Introduction * Corresponding author Tel 46-40-331340 Fax 46-40336234 4bhrevtatums AP-1. activator protein-i. CAT. chloramphemcol acetyltransferase. Con A. concanavahn ~k. clpro, clprofloxacm. ELIS 4. enz~ me-hnked lmmunoassay. EMSA. electrophoretlc gel moblhty shift assay. GM-CSF. granulo%te-macrophage colonystimulating factor. IFN-/. interferon- 7, IL-lnterleukm. LPS. llpopolysacchandc. LT. lymphotoxln. MLC. mixed lympho%te cultures. NFAT-1. nuclear factor of acre ated T cells 1. PAGE. polyacrylamlde gel electrophoresls. PHA. phytohemagglutmm. PMA. phorbol mynstate acetate. TB S. Trls-buffered sahne. TLC. thin la)er chromatograph~. TNF-J. tumor necrosis factor-or 0162-3109/94,'$7 00 © 1994 Elsevier Science B V All rights reserved SSD1 0 1 6 2 - 3 1 0 9 ( 9 4 ) 0 0 0 5 5 - 6

The qulnolone carboxyhc acid derivative clprofloxacin (clpro), one of the fluoroqulnolones, has a broad antibacterial spectrum and is effective against both gram-negative and gram-positive bacteria (Wolfson and Hooper, 1989) The bactericidal site of action is at the D N A - g y r a s e - D N A complex (Willmort and Maxwell, 1993, Pal~ et al., 1992). Fluoroquinolones are biological response modifiers as a complement to their antibacterial activity (Shalit, 1991, and references hereto). It has been demon-

156

I~ Rle~he~l,, A Pms~ren ,' lmmumq)harma~ oh~g3 27 I1994) 155-164

strated that especially cmpro among the fluoroquinolones exerts both stlmulatory and inhibitory effects on human and murme immune systems. The stimulation of cytokine production by T lymphocytes is of clinical interest. High experimental concentrations of clpro ( > 40 #g/ml) inhibit D N A replication, cell cycle progresslon, and furthermore induce strand breaks in D N A in phytohemagglutmln (PHA) stimulated human lymphocytes in vitro (Forsgren et al, 1987a, 1987b). In addition, lymphotoxln (LT) and granulocyte-macrophage colony-stimulating factor (GMCSF) production are decreased by high concentrations of clpro (Rlesbeck and Forsgren, 1990) The s)nthesis of tumor necrosis factor-~ (TNF-~) (BaIll2~ et al, 1990), and IL-I (Roche et al., 1987) b) hpopolysaccharide (LPS) stimulated human monocytes are also inhibited in vitro in the presence of cipro at high concentrations At low, clinically achievable ( < 10 /~g/ml), concentrations of repro an increased thymadine uptake has been observed after mltogenic stimulation of human lymphocytes in vitro (Forsgren et al., 1987b; Bredberg et al., 1989). Similar results have also been reported from experiments involving murine lymphocytes (Sttmkel et al., 1991; Guenounou et al., 1987) However, at both low and high concentrations ( 5 80 /,g/ml) cipro and other quinolones are able to enhance human interleukln 2 (IL-2) (Riesbeck et al., 1989; Rlesbeck and Forsgren, 1990; Roche et al, 1988; Stunkel et al., 1991) and interferon-3' (IFN-'/) production (Zehavl-Wlllner and Shallt, 1989; Hahn et al., 1991) Corresponding IL-2 and IFN-?' m R N A levels are upregulated by capro (Riesbeck et al., 1989, 1991). Effects on IL-1 production by cipro are contradictory between human and mufine cell systems. In contrast to a decreased or unaffected IL-1 production in human monocytes, LPS stimulated murine macrophages show a 3.5-fold increased IL-1 production in the presence of clpro (2.5 #g/ml) (Petit et al., 1987). A similar IL-1 increase has also been shown in a human monocyte cell line upon LPS stimulation in the presence of cipro (0.3-30 ~g/ml) (Stunkel et al., 1991) The in vIvo significance of the immunomodulator~ effects by fluoroquinolones detected m wtro is at present not clear. Cipro (45 mg/kg/24 h) enhances repopulation of murine hematopoIetlc organs in sub-

lethally irradiated mice, possibly through a stimulating effect on IL-3 and G M - C S F production (Kletter et al., 1991). Another report has been published showing that clpro treatment in VlVO increased ex VlVO capacity of LPS stimulated human monocytes to produce IL-1, IL-6 and TNF-:~ (Bailly et al., 1991) Furthermore, splenocytes obtained from mice treated dail) with ciprofloxacm (subcutaneous administration; 0 1-80 mg/kg) for seven days showed an increased th)midlne incorporation when stimulated ex vlvo by alloantigen or P H A (Stunkel et al., 1991) The alms of this investigation were twofold First, to reveal whether an enhanced cytoklne synthesis b? clpro also exists in mouse. Second, to elucidate whether cipro influences IL-2 gene transcription and nuclear transcription factors in the murmne T cell hne EL-4 In the present study, evidence is shown that clpro upregulates murlne IL-2 production at thc protein and m R N A levels by Influencing nuclear factor of activated T cells (NFAT-1) resulting m increased IL-2 transcription. In contrast to a cipro dependent enhancement of human IFN-3, production, the murine IFN-7 synthesis is inhibited in the presence of cipro.

2. Materials and methods 2. i Ammals attd reagents CBA/J (H-2k) and DBA/2J (H-2d) mice were purchased from Bomholtgaard (Ry, Denmark) Preservative-free clpro was kindly provided by Bayer (Wuppertal, Germany). PhytohemagglutInin (PHA) (Wellcome, Dartford, U K ) and concanavahn A (Con A), grade IV (Sigma, St Louis, MO) were dissolved in R P M I 1640 medium (Glbco, Paisley, Scotland) and used at final concentrations of 1 ~g/ml and 5/~g/ ml, respectively Phorbol myristate acetate (PMA) (Sigma) was dissolved In D M S O . 2 2 Cell cultures, IL-2 and IFN-)' analysis H u m a n peripheral blood lymphocytes were ISOlated from buff)' coats with citrate or from heparlnlzed blood from healthy donors by centrifugation on a step gradient of Ficoll-Isopaque (Lym-

K Rtegbeck, A Forsgren / lmmunopharmacology 27 ;1994) 155-164

phoprep, Pharmacia, Uppsala, Sweden) (Rlesbeck et al., 1989). Human lymphocytes (106/ml) were incubated in RPMI 1640 medium supplemented with 1 0 o o heat-inactivated fetal calf serum, glutamine and gentamlcin (12/~g/ml) (Riesbeck et al., 1989) Lymphocytes from mouse spleens were obtained by mechanical &sruption and were incubated in RPMI 1640 (106/ml) supplemented with 5°o fetal calf serum, glutamlne, gentamlcin and 10-5 M mercaptoethanol. The murine T cell lymphoma cell line EL-4 was maintained in the same medium as the splenocytes. In primary mixed lymphocyte cultures (MLC) responder cells (DBA) were incubated together with irradiated stimulator cells (CBA). Primary cultures were harvested after 2 weeks and used in secondary MLC. Secondary MLC contained 0.25 x 106/ml cells from long-term primary MLC and 1.25 x 106/ml irradiated CBA cells (Ryser et al., 1978). In these experiments clpro was only included in secondary MLC. Experiments were also performed with primary MLC (106+ 106 cells/ml) IL-2 biological activity In supernatants was analysed by the IL-2 dependent stimulation of proliferation of the murine cytolytic T-lymphocyte line CTLL-2 as previously described (Rlesbeck et al., 1989). Human and murine IFN-;~ were measured by enzyme-linked immunoassays (ELISA) (Intertest for human or inurlne IFN-',,, Genzyme, Boston, MA, USA). 2 3. RNA preparatlon and Northern blots Total RNA was prepared according to a standard protocol (Chomszynski and Sacchi, 1987)with slight modifications. Briefly, 25 x 106 cells were solubllized in guanidlurn isothiocyanate, sodium acetate, chloroform/isoamylalcohol (chisma), and acid phenol in a final volume of 1 5 ml. Cell debris and D N A were precipitated on Ice and spun down. Thereafter the upper phase was extracted once more with phenol and chisma. Subsequent steps were followed according to the protocol (Chomszynskl and SacchI, 1987). RNA (0.5/~g) was subjected to ethidium bromide stained agarose gels to check the equal concentration and purity of every sample. RNA (1020/~g) was loaded onto formaldehyde-agarose gels (Fourney et al., 1988) and blotted to nylon filter (Hybond-N +; Amersham, Buckinghamshire, UK) as described by the manufacturer. Filters were hy-

157

bridized according to standard protocols (Fourney et al., 1988) and exposed for 24 to 72 h to preflashed X-ray film (XAR-5; Kodak, Rochester, NY) at -70 °C using intensifying screens. Autoradlographs were quantified by scanning laser densltometry. 2 4 DNA and probes The IL-2 specific probe was a 500 bp EcoRIHmdIII fragment from pUCmIL2-2 (Kashima et al., 1985). The IFN-), probe were two PSTI fragments (653 and 453 bp) (Gray and Goeddek 1983). The/~-actin probe was derived from a 1250 bp Pst I fragment from p91 (Mlnty et al., 1981) The specific fragments were purafied from agarose gels and labeled with [~-32p]dCTP (spec. act 3000 C1/mmol; PB 10205, Amersham) by random priming (Amersham) Free nucleotldes were separated on spincolumns (Costar, Cambridge, MA) containing Sephadex G-50 DNA grade fine (Pharmacla). For transfection experiments a plasmld containing the IL-2 promoter region (635-base pairs: + 51 to -584) linked to the bacterial reporter gene chloramphenacol acetyltransferase (CAT) was used (IL-2-CAT) (Mfirtensson and Leanderson, 1989) As a control for transfection efficiency a plasmid containing the mouse metalloth~oneln promoter and enhancer linked to the SV 40 enhancer and the CAT gene was utilized (MT-CAT-SV) (Mgtrtensson and Leanderson, 1989). For electrophoretic mobility shift assays oligonucleotides were labeled with [),-32P]ATP (specific activity 3000 Ci/mmol; PB 10168, Amersham) by bacteriophage T4 polynucleotide kinase (Boehrlnger Mannhelm, Mannhelm, Germany). 2 5. Transfections and chloramphemcol aceo'ltransferase (CA T) assay

Before transfections 10 x 106 EL-4 cells in logphase were washed in Trls-buffered sahne (TBS). Cells were transfected in suspension using DEAEdextran (Sigma) (Mgmensson and Leanderson, 1989 and references herein) at a final concentration of 0,6 mg/ml in a total volume of 640/~1 TBS including the appropriate DNA (10 ~tg). Incubations were for 5 mln, whereafter the cells were instantly washed and then incubated for 45 h before harvesting. Cells were induced with 20 ng PMA/ml during the last

158

K RtesheLlt, A Fotsgren ,' Immunopha~macology 27 <1994J 155-164

15 h of incubation, whereafter they were washed twice m phosphate buffered saline (PBS) and resuspended in 50 #1 sonicatlon buffer (10 mM Tris-HC1, 0 5 mM MgC12, ph 7 4). Extracts were prepared by freezing and thawing thrice followed by sonlcation for 12 mln. The CAT reaction was performed in a reaction mixture of 120 #1 containing 50 ~1 cell extract, 0.2 #CI [14C]chloramphenlcol (50-60 mC1/ mmol; CFA 754, Amersham), 50 #1 0.25 Trls-HCI, pH 7.8, 20 #1 4 mM acetyl coenzyme A (Boehrlnger Mannhelm) at 37 : C for 85 mm After incubation the products were separated from the substrate by thinlayer chromatography (TLC). TLC plates were exposed to X-ray films for 1-3 days at room temperature. For quantification, areas containing the acetylated and nonacetylated forms of [14C]chloramphenlcol were cut out from the TLC plates and measured in a scintillation counter, 2.6 Preparation of whole cell protem extracts and electrophorenc gel moblh O' shift assay (EMSA) At the indicated times protein extracts were prepared from stimulated EL-4 cells (SchNer et al, 1989). Protein concentrations were determined by a protein assay (Pierce BCA*Reagent; Tecator, Sollentuna, Sweden). Protein extract (2 5-10 l~g) was mixed with 1,0 /~g poly[d(I-C)] (Boehrlnger Mannheim) and 5 x binding buffer (100 mM phosphate buffer pH 6.0, 50 mM MgC12, 0 5 mM EDTA, 10 mM DTT, 0.05')0 NP 40, 0.5 M NaC1, 500/~g/ ml BSA, 20°0 Ficoll) in afinal volume of 15 ~(1 After lncubaUon for 10 min at room temperature 10000 cpm [32p] klnased probe was added and the reactions were further incubated at 37 °C for 20 min Samples were separated on 5°o TBEpolyacrylamade gels (PAGE), which were fixed, dried, and autoradlographed The probes used were the NFAT-1 binding site (distal purme box) from -285 to -254, 5ggaggaaaaactgtttcatacagaaggcgt3 (Shaw et al., 1988) and the AP-1 consensus binding site, 5ctagtgatgagtcagccggatc3 (Stratagene, La Jolla, CA), and NFIL-2A binding site from -88 to -63, 5atgtgtaatatgtaaaacattttgac3 (Shaw et al., 1988) Competmon experiments using 10 to 1000 x molar excess of unlabeled oligonucleotidcs were carried out to identi~ the specific complexes

2 7 Statisttcs Wilcoxon's rank sum test and logrank statistics were used. p < 0 . 0 5 or less was considered as significant 3. Results

3 1 Ctproflo.~acm enhanced IL-2 production, but inhibited IFN-7 s3vlthests m murme lymphocvtes Fig 1 shows that clpro (20-80 F~g/ml) caused an increased and prolonged IL-2 response to PHA. The IL-2 increase by clpro was generally lower when Con A instead of P H A was used as mitogenlc stimulus. At 48 h of incubation with Con A and cipro at 40 and 80 Ftg/ml, only 2 respectively 3 times more IL-2 was detected as compared to the control (not shown) To further prove the clpro dependent IL-2 Increase the murlne T cell lymphoma cell line EL-4 was sub-stimulated with P M A (2 ng/ml) and incubated for 24 h in the presence of clpro (5-80 Fig," ml) (Fig 1B). Here, clpro (5-40 l~g/ml) enhanced the IL-2 production to a lower degree compared to P H A stimulated splenocytes However, capro at 80 t(g/ml increased the IL-2 synthesis more than 4 times, which was similar to the effects on splenocytes (Fig. 1A). Clpro did not affect unstlmulated lylnphocytes Primary and secondar? mixed l~mphocyte cultures (MLC) were performed with clprofloxacln added during the last 24 to 72 h of culture In these experiments only a slightly, but slgnificantl? increased IL-2 production in the presence of o p r o was observed (not shown) In contrast to the enhanced murme IL-2 production, clpro inhibited murine IFN-?, synthesis at 1248 h of incubation (Fig 2A). For example, IFN-;, production at 24 h was inhibited by 60°o (20 #g,' ml of clpro) and 94",, (8(1 t~g/inl of clpro) The influence of clpro on murme IFN-;' production smklngly differed from effects on human IFN-;, synthesis As can be interpreted from Fig 2B, clpro at 24 h of culture enhanced human IFN-;, s~nthesls 2.1 and 3.8-fold at 20 and 80 ttg/ml, respectively To exclude an earlier kinetics in munne than in human lymphoc~tes, supernatants from cultures treated with clpro for 6 h were also analyzed However, no IFN-~' was detected at 6 h (not shown)

K RtesbecL, A For~gten ,; Immunopharmacologt 27 (19941 155-164

A

B 500

3 E

~-ev .-I

159

2

20

40

60

70~

'°°11 300 11

Clpro20

0

71

80

0

Time (hours)

5 20 40 80

Ciprofloxacin (i.tg/ml)

Fig 1 Effects of c]pro on murlnc IL-2 production m stimulated spleen lymphocytes (A) and the T cell hne EL-4 (B) At m]tmt]on of cultures murlne splenoc)tes (10"/ml) ~ ere incubated with PHA ( 1/xg,'ml) and clpro at 80 #g,'ml, 40 #g/ml. 20/ag/ml or 5 #g,'ml as compared to control Cells were harvested at the indicated times Shown are the means of two exper]ments with l)mphoc)tes from four different m]ce Values above error bars (standard devmtlons) ]n (B) indicate mean IL-2 concentratmns (U/ml) EL-4 cells were st]mulated with PMA (2 ng/ml) and harvested after 24 h Supernatants were anal)zed for IL-2 blolog]cal acu~lty All IL-2 concentrat]ons obtained from cells incubated ~lth clpro were s]gnlficantl) separable from control values (p < 0 05 or less)

3 2 Effects ofclproflo:~acm on IL-2 andIFN-7 m R N A levels To confirm the IL-2 increase and I F N - T inhibition by clpro, total RNA was isolated and Northern

A

Murine

i

600 1

Z

200-

--

B

[] C,pro5

• Cipro20

~'~ 4001 ,...,°

(RNA) blots were performed. IL-2, IFN-?, and /~-actm m R N A levels were analysed with radioactive c D N A probes. In PHA-stlmulated murlne lymphocytes increased IL-2 m R N A levels were detected in the presence of clpro (20 and 80 #g/ml) (Fig. 3).

[] Clpro80

--~

¢- 600 0 ,~,P_ ~'~° 400 Z

o

Human

200

o

12

18

24

Time (hours)

48

12

18

24

48

Time (hours)

Fig 2 Different effects of clpro on murlne (A) and human (B) IFN- 7 production Supernatants from murlne spleen lymphocytes incubated for 12-48 h were analyzed for IFN- 5, by EEISA Culture conditions were as described m Fig [ In addition, PHA (1 ~g,,ml) stimulated human l~mphocytes were incubated in the presence of clpro and analyzed for IFN- 7 by ELIS& IFN-7 concentrations are expressed as percentage of the control ( = 100"o) without antibiotics at every time point Clpro at 5-80 /xg/ml are indicated Shown are the means of experiments ~tth Ismphocytes from four different mice and four different human blood donors Error bars indicate standard devlauons Values aboxe error bars show mean IFN- 7 concentrations (pg/ml) IFN-T concentrations m murlne splenocytes incubated with c]pro (20 and 80 #g/ml) and in human lyinphocytes cultured with clpro (5-80 /~g/ml at 12 h and 20-80/~g/ml at 18-48 h) ~ere slgmficantly separable ( p < 0 05 or less)from control lymphocytes

K Rtesbeek, A Fol*gren ,' Immunophatma~ology 27 (1994) 155-164

160

T)me (hrs) C=pro (pg/ml)

24 48 72 10 20 801 10 2O 801 10 20 801

IL-2

=" l

IFN-y

-,,,4-

O

Actin

Fig 3 Increased IL-2 mRNA concentrations, but unaffected IFN-y mRNA levels m murlne l~mphocytes incubated in the presence ofclpro PHA stimulated splenoc)tes m the absence (O) or presence of clpro (2(1 or 80 #g/ml) were incubated for the indicated times (24-72 h) Total RNA was extracted, 20 /~g was fractlonated on denaturing agarose gels prior to hybridization with an IL-2 cDNA probe The filters were stripped and rehybndlzed with IFN- 7 and/~-actln cDNA probes The molecular weights were 0 8 kb for IL-2, 1 6 kb for IFN-/ and 2 0 kb for fi-actln Three different experiments were performed Velthsimilar results

Scanning d a t a revealed that a p p r o x i m a t e l y 16 times m o r e IL-2 m R N A was present in lymphocytes inc u b a t e d with cipro at 80 #g/ml c o m p a r e d to control cells after 24 h of incubation In parallel to the lowered I F N - ? synthesis in cipro treated lymphocytes, I F N - ? m R N A levels were mainly unaffected at 24 h o f incubation. A t 48 and 72 h, however, slightly m o r e I F N - 7 m R N A was detected in cultures incub a t e d with clpro (20/~g/ml) as c o m p a r e d to control cells. In addition, lower I F N - y m R N A levels were found In the presence o f 80/~g/ml cipro at 48 h. The control, actin m R N A , was u n c h a n g e d m lymphocytes incubated with cipro.

3.3. hTcreased IL-2 transcnpnon and NFA T-1 levels' m E L - 4 cells' incubated with ctprofloaacm The increased levels of IL-2 m R N A suggested an e n h a n c e d transcription rate m murlne splenoc~ctes incubated with clpro. Therefore we investigated the role of transcriptional regulation in the reduction of IL-2 expression in EL-4 cells incubated with cipro EL-4 cells were transiently transfected with a plasmid containing the IL-2 e n h a n c e r and p r o m o t e r region (635-base pairs; + 51 to - 5 8 4 ) hnked to the bacterial reporter gene c h l o r a m p h e n l c o l acetyltransferase ( I L - 2 - C A T ) . The p l a s i m d utilized in these experiments is outlined in Fig. 4A. C A T activity as m e a s u r e d according to Materials and M e t h o d s mdirectly reflects the capability o f a stimulated cell to induce IL-2 gene transcription through activation of specific transcriptional regulation factors EL-4 cells transfected with I L - 2 - C A T were cultured for 30 h following reduction by mltogen (20 ng/ml P M A ) and simultaneous addition o f c l p r o Cells were further incubated and C A T - a c t l v W was analyzed 10 to 15 h later. Cipro (40 and 80/~g/ml) elevated C A T expression 2- to 3-fold in a dosed e p e n d e n t m a n n e r (Fig. 4A). The thin layer chrom a t o g r a p h y from a typical experiment is shown in Fig. 4B. These results were consistent with the increased e n d o g e n o u s I k - 2 p r o d u c t i o n in EL-4 cells e x p o s e d to clpro as described above (Fig. 1B). Thus, cipro e n h a n c e d IL-2 transcription as revealed by the upregulated I L - 2 - C A T expression. Clpro (80 /~g/ ml) a d d e d without mltogen to transfected EL-4 cells upregulated I L - 2 - C A T expression 14°o c o m p a r e d to control cells (not shown). Electrophoretlc gel moblllt~y shift assays ( E M S A ) were p e r f o r m e d to determine specific binding of nuclear transcription regulation factors to the IL-2 p r o m o t e r region. Higher levels o f N F A T - 1 were detected as earl~ as 15 min after m~togen stimulation in EL-4 cells incubated with clpro in c o m p a r i s o n with control cells without clpro (Fig. 5). Control ceils reached similar N F A T - 1 levels 15 min later (at 30 mln). In addition, N F A T - 1 in cipro treated cells seemed to be ' c o n s u m e d ' as was d e m o n s t r a t e d at 60 mln o f stimulation c o m p a r e d to the control without antibiotic AP-1 and N F - I L 2 A (upstream promoter site) binding c a p a m t y were not mfluenced by clpro (Fig. 5).

K Riesbecl~, A Fmsgren / Immunophatmacology 27 (1994) 155-164

4. Discussion

Control t

In this report we have shown an upregulated IL-2 and inhibited IFN-7 synthesis by the antabacterlal

Ttme (m)n):

NFAT-1

®

300

I--

161

0

15

30

60 120

tttl-

Cipro t ~Ol

I

~- 15

30

60 120

01) •

2oo

o

g~ 0

40

AP-1

80

Cnpro (pg/ml)

IL2enhancer/ ~A~DCR pr°m°ter AT

Clpro (pg/ml):

0

0

Mttogen.

+

I

40

80

+

+

II ~ 1

[ - - I

• 'tP 9VVV

,~

NFIL-2A

P"I --. oN1m

ogmD

q

i._

=~

f

Fig 4 Increased mduclblhty of IL-2-CAT expression in stimulated EL-4 cells incubated with clpro The increase m CAT activity was dose dependent m the presence of clpro (40 and 80 #g:' ml) Three independent experiments ulth duphcates were performed at every' concentration Error bars indicate standard deviations The IL-2-CAT construct is also sho~n (&) A typical thin layer chromatography plate from one of the experiments The X-ray film is demonstrated MT-C~T-SV Is a transfectlon control and indicates the mouse metalloth]oneln promoter and enhancer hnked to the SV 40 enhancer and the CAT gene (By EL-4 cells were transfected with 10 #g plasmld in suspension using DEAE-dextran After 30 h clpro was added and cells were stimulated with nmogen (PMA, 20 ng,'ml) 10-15 h later CAT actw~ty was measured with [14C] labeled clhloramphemcol and analyzed on TLC follow,ng exposure to X-ray films

Fig 5 Enhanced levels of NFAT-1 at 15 mln m mltogen activated EL-4 ceils incubated w~th c~pro At the indicated times protein extracts were prepared from stnnulated (20 ng..'ml PMA) EL-4 cells and EMSA was performed Clpro (80 #g.'ml) was added at initiation of cultures Protein extracts were prepared and protein concentrations determined 2 5-10/~g protein extract was incubated w~th the NF~T-1. AP-1. or N F I L - 2 ~ probes and analyzed on non-denaturing polyacrylamlde gel according to Materlal and Methods These results are representative for three different experiments In the NFIL-2A PAGE the frec probe ns visible at the bottom of the gel

agent clpro in stimulated murme lymphocytes. However, the enhanced Ik-2 producUon (2.5 umts/ml) was considerably lower as compared to that reported for human cells (Riesbeck et al., 1989). The same difference between human and murme lymphocytes

A Rle~he~k, A Fm~gren ,; lmmunopharmatology 27 (1994) 155-164

162

~as not demonstrated regarding IL-2 gene expression Transcriptional activity and IL-2 m R N A steady state levels observed in murine splenocytes incubated with cipro were more comparable with the same capabilities in human lymphocytes (Riesbeck et al., 1989, unpublished data). This may be expected because of the total homology' between important regulatory sites in the human and murine IL-2 promoters (Hentsch et al., 1992). In addition to clpro dependent enhancement of IL-2 synthesis, an increased IL-1 production in the presence of cipro has also been described in both a human monocytlc cell line and murlne splenocytes (Stankel et al., 1991: Baally et al., 1991, Petit et al., 1987). Most likely the influence of clpro on IL-2 production is not mediated through an earb interaction with the IL-1 production as has been proposed by others (Stunkel et al, 1991). Two examples excluding IL-1 as a first messenger are results obtained with the murlne and human T cell lines EL-4 and Jurkat, respectively (Fig. IB) (Riesbeck ct al., 1989, unpublished data) Furthermore, when purified human T-lymphocytes were incubated with substimulatory levels of antI-CD28 in conjunction with PMA, addition of cipro (80 Fg/ml) increased the IL-2 synthesis 100-fold when measured after 72 h of incubation (unpublished observations) The influence ofcipro on IFN-T synthesis differed between murlne and human lymphocytes (Fig. 2). IFN- 7 production was inhibited in murlne cells, but upregulated in human lymphocytes. An increased human IFN-;' s~nthesis has previously also been demonstrated by' others (Zehavl-Wlllner and Shallt, 1989; Hahn et al, 1991). Thus it was unexpected that clpro did not increase murine IFN-), m R N A similar to IL-2 m R N A (Fig. 3) as was observed in

D1 Site (human)

-124

TAGTTATrAAT -114

Similar motif (mouse)

-943

TAGTTATTAAT -934

D2 Site (human)

S~mflarmotfl(mouse)

-36

-579

human lymphocytes (Rlesbeck et al., 1989, 1991). The slightly more IFN-7 m R N A detected in splenocyte cultures with clpro (20/~g/ml) at 48 and 72 h of incubation may be explained by secondary stlmulatory' effects due to an increased IL-2 production m the presence of clpro as has been demonstrated in Fig. 1. Since more IFN- 7 m R N A is detected in lymphocytes cultured with clpro at 20 /~g/'ml as compared to control cells, more IFN-7 would have been expected at the protein level. However, perhaps murlne splenocytes are considerably more sensitive to toxic effects of cipro than human peripheral blood lymphocytes. This may be supported by the observation that less IFN-), m R N A is found at 48 h in murlne cells incubated in the presence of 80/~g/'ml clpro compared to the control without any antibiotic. Furthermore, in contrast to IFN-;', only, the cipro dependent IL-2 enhancement readily' corresponds to the upregulated IL-2 m R N A levels detected in human lymphocytes (Rlesbeck et al., 1989, 1991). The discrepancy' between human and mouse regarding the effects of clpro on IFN-7 production may. be explained by a partial homology only between the human IFN-), promoter and the murine counterpart (Clccarone et al., 1990). Evidence has recently been reported showing also functional differences between the human and murine IFN-7 promoters (Brown et al., 1992). Nuclear protein binding to the human IFN-), promoter has been well characterized. The human IFN-~, promoter consists of at least three different regions with specific protein binding sites designated D1, D2, and U s~tes (Brown et al., 1992). In Fig. 6 these defined sites are outlined and compared to similar motifs present m the murlne IFN-), promoter The D2 site has no

CAATTAG

-30

IAl-L£]c

I LT..JG C AA G ~A L~.C~ T G T~ L A~O J ~T]I ~ G C T~IAA~~TG TTA~GGI JG I [T AJT T_T T .A C~T ACA I

T

......

534

Fig 6 Comparisonof known regulatorysites in the human IFN-/promoter region with sln311armotifs present in the murlne IFN-;, DN 5'-flanking region Analysis was performed using the Macintosh program Gene Works Published sequences uere obtained from the EMBL Genebank (Clccarone et al, 1990, Brown et al, 1992, Fox et al, 1991)

K Rte~heck, A Forsgren / lmmunopharmacology 27 (1994) 155-164

equivalent in the murine promoter while the D 1 and U sites share great homology between the species. Human nuclear protein binding to the downstream portion of the IFN-7 promoter was dependent upon the integrity of both the D1 and D2 sites. Furthermore, Brown and colleagues investigated binding capacity of nuclear proteins prepared from routine EL-4 cells to probes from the human IFN-7 promoter. Interestlngl~y, mitogen stimulated EL-4 cells showed no response of bands detected in nuclear extracts from reduced human Jurkat cells. In bacteria fluoroqulnolones inhibit the supercolllng enzyme DNA gyrase (a type II topoisomerase) (Wlllmott and Maxwell, 1993, Pahi et al., 1992) and induce the SOS response considered to reflect DNA damage (Power and Phillips, 1992). In parallel, eukaryotlc topolsomerase II is also affected by fluoroquinolones at high concentrations (Hussy et al., 1986, Bredberg et al., 1991). Evidence of an intracellular effect by cipro on topolsomerase II activity in human lyinphoblastoid cells has been described (Bredberg et al., 1991). It is important to take into account that eukaryotic cells accumulate fluoroqulnolones intracellularly (Garraffo et al., 1991). Thus, in lymphocytes a topolsomerase inhibition resulting in increased IL-2 transcription may be envisaged by high concentrations of cipro. Topolsomerase II does also play a role in gene transcription (Wang, 1991) This is the fact regarding topoisomerase II inhtbators such as m-AMSA, vepesid, and novoblocln These drugs have been shown to induce vtmentln gene expression in human promonocytic leukemia U-937 cells (Rlus et al., 1991) One explanation for the effects of cipro on IL-2 production may be that cipro induces genotoxlc stress followed by activation of transcription factors as has been described for DNA damaging agents (Herrlich et al., 1992; Holbrook and Fornace, 1991). From a chnlcal point of view it ~s necessary to further characterize the regulatory pathways influenced by clpro and investigate whether an lmmunomodulatory effect of clpro occurs in humans

Tomas Leanderson (Immunology Unit, Lund University, Sweden) for providing us with the murine cDNAs. This investigation was supported In parts by grants from the Anna and Edwin Berger Foundation, the Cancer Foundation at MalmO General Hospital, the Medical Faculty at Lund University, the Cancer Foundation at Malm0 General Hospital, and the Osterlund Foundation.

°

References

1 Balll~¢ S. Fay M, Roche Y, Gougerot-Pocldalo MA Effects of

2

3

4

5

6

7

8

9

10

11 12

5. Acknowledgements For excellent technical help we would like to thank Mrs. Agnethe Hennksson. We also thank professor

163

13

qulnolones on tumor necrosis factor production by human monocytes Int J Immunopharmacol 1990. 12 31-36 Badl) S, Fay M, Ferrua B, Gougerot-Pocldalo MA Clprofloxacm treatment in VlVO increases the ex VlVO capacity of hpopolysacchande-stlmulatcd human monocktes to produce IL-l. IL-6 and tumour necrosis factor-alpha Chn exp Immunol 1991, 85 331-334 Bredberg A, Brant M, Rlesbeck K, Azou Y, Forsgren A 4-Qumolone antlbmtlcs posltlve genotonlc screening tests despite an apparent lack of mutation induction Mut Res 1989. 211 171-181 Bredberg M, Brant M, Jaszyk M Clprofloxacm-mduced lnhlbmon of topolsomerase II m human lymphoblastold cells Antlmlcrob Agents Chemother 1991, 35 448-450 Brown DA. Kondo KL, Wong SW, Diamond DJ Characterization of nuclear protein binding to the interferon-?, promoter m qmesccnt and actl,~ated human T cells Eur J h n nmnol 1992, 22 2419-2428 Clccarone VC, Chrlvla J, Hardy KJ, Young HA Idenuficatlon ofenhancer-hke elements m human IFN- 7 genomlc D N A J h n m u n o l 1990, 144 725-730 Chomczynskl P, Sacchl N Single-step method of R N A Isolation by acid g u a m d m m m thlocyanate-phcnol-chloroform cxtraction Anal Blochem 1987, 162 156-159 Forsgren A, Schlossman SF, Tedder TF 4-Qmnolone drugs affect cell cycle progression and function of human lymphocytes in vitro Antlmlcrob Agents Chemother 1987a, 31 768773 Forsgren A, Bredberg A, Pardee AB, Schlossman SF, Tedder TF Effects of clprofloxacm on eucar)otic pynmldlne nucleotlde Nosynthesls and cell growth Antlmlcrob Agents Chemother 1987b, 31 774-779 Fourne) RM, Mlyakoshl J, Day IIl RS, Paterson MC Northern Blotting efficient R N A staining and transfer Focus 1988, 10(5) 4 - 7 Fox HS, Bond BL, Parslow TG Estrogen regulates the IFN- 7 promoter J Immunol 1991, 146 4362-4367 Garraffo R, Jambou D, Chlchmanlan RM. Ravolre S, Lapalus P In vitro and m vwo clprofloxacm pharmacoklnetlcs m human neutrophds Anhmlcrob Agents Chemother 1991.35 2215-2218 Gray PW, Goeddel D Structure of the human 1FN-?, gene Nature 1982,298 859-863

164

K Rte~heck. A For~gren / lmmunopharmacology 27 H994) 155-164

14 Guenounou M. Ronco E. K o d a n E. Vacheron F. Moinrikof V Modulation of mouse spleen cell prohferatlon and mterleukm 1 production by qmnolones Path Blol 1987.35 785789 15 Hahn T. Barak Y. LlebOvlch E. Malach L. Dagan O. Rubmstem E Ciprofloxacm inhibits human hematopoletlc cell growth Synergism with tumor necrosis factor and interferon Exp HematoI 1991. 19 157-160 16 Hentsch B. Mouzakl A. Pfeuffer l. Rungger D. Serfllng E The weak. fine-tuned binding of ubNultous transcnption factors to the Ik-2 enhancer contributes to Its T cell-resmcted actl~lt) Nucl Acids Res 1992.20 2657-2665 17 Herrhch P. Ponta H. Rahmsdorf HJ D N A damage-induced gene expression Signal transducuon and relation to growth factor signaling Re~ Physlol Blochem Pharmacol 1992. 119 187-223 18 Holbrook NJ. Fornace Jr AJ Response to adversR) molecular control ofgene actl,~at~on following genotoxlc stress Ne~ Blol 1991.3 825-833 19 Hussy P. Mass G. Tummler B. Grosse F. Schomburg U Effect of 4-qulnolones and novoblocln on calf thymus D N ~ polymerase prlmase complex, topolsomerases I and II. and growth of mammalian lymphoblasts Antlmlcrob Agents Chemother 1986.29 1073-1078 20 Kashlma N. Nlshl-Takaoka C. t~ujlta T. Taki S. Yamada G. Hamuro J. Tanlguchl T Unique structure of murmc lnterleukln-2 as deduced from cloned c D N A s Nature 1985. 313 402-404 21 Kletter Y. Rlkhs I. Shaht l. Fabian I Enhanced repopulatlon ofmurlne hematopoletlc organs in sublethally lrradmted mice after treatment wRh clprofloxacln Blood 1991. 78 16851691 22 Mint) A J, Caravattl M. Benolt R, Cohen A, Daubas P, We)dert A, Gros F, Buckmghani M Mouse actm messenger R N A s J Blol Chem 1981, 256 1008-1014 23 Martensson IL, Leanderson T Regulation of lnterleukln 2 gene e,~presslon d~screpancy bet,~een enhancer actl,,lt) and endogenous gent expression Eur J Immunol 1989, 19 145149 24 Palu G, Vahsena S, Clarrocchl G, Gatto B, Palumbo M Qumolone binding to D N A is mediated b) magnesium ions Proc Nail Acad Scl U S A 1992. 89 9671-9675 25 Petit JC, Daguet GL, Richard G, Burghoffer B Infuence of clprofloxacln and plperacflhn on lnterleukin-I production b) murlne macropbages J Antlmlcrob Chemother 1987. 20 615-617 26 Po~er EGM, Phllhps I Induction of the SOS gene (umuC) b) 4-qulnolone antibacterial drugs J Med Mlcroblol 1992, 36 78-82

27 Rlesbeck K, Andersson J, Gullberg M, Forsgren A Fluorinated 4-qulnolones Induce h)perproductlon of lnterleukln 2 Proc Natl Acad Scl U S A 1989, 86 2809-2813 28 Rlesbeck K, Forsgren A Selective enhancement of s)nthesls of lnterleukln-2 in lymphocytes in the presence of clprofloxacln Eur J Chn Mlcroblol Infect Dis 1990, 9 409-413 29 Rlesbeck K, Bredberg A, Forsgren A Clprofloxacln enhances the synthesis of lnterleukln-2 in human lymphoc)tes, while other cytoklnes are inhibited Eur J Chn Mlcroblol Infect Dis 199l, Special Issue 387-388 30 Rlus C, Zorrilla AR, Cabanas C, Fehclslma M, Bernabeu C, Aller J Differentiation of human promonocytlc leukemia U-937 cells with D N A topolsomerase II lnhlbltors induction of vJmentln gene expression Mol Pharmacol 1991, 39 442448 31 Roche Y, Fa) M, Gougerot-Pocldalo MA Effects of qulnoIones on lnterleukln 1 production in vitro b) human monoc)tes lmmunopharmacology 1987, 13 99-100 32 Roche Y, Fa? M, Gougerot-Pocldalo MA Enhancement of lnterleukln 2 production b) qulnolone-treated human mononuclear lcukoc)tes lnt J Immunopharmacol 1988, 10 161167 33 R)ser J-E, Cerottlnl J-C, Brunner KT Generation ofcytol)uc lymphocytes in vitro IX Induction of secondar) CTL responses In primary long-term M L C by supernatants from secondar) MLC J Immunol 1978. 120 370-377 34 Scholer HR, Hatzopoulos AK, Balhng R, Suzuki N, Gruss P A family of octamer-specific proteins present during mouse embryogenesls exldence for germhne-speclfiC expression of an Oct factor E M B O J 1989, 8 2543-2550 35 Shaht I Immunological aspects of new qulnolones Eur J Chn Mlcroblol Infect Dis 1991, 10 262-266 36 Shau JP, Utz PJ, Durand DD, Toole JJ, Emmel EA, Crabtree G R Identification of a putative regulator of earl)' T cell actlxatlon genes Sclencc 1988, 241 202-205 37 Stunkel KGE. Hewlctt G, Zeder HJ Clprofloxacm enhances T cell function b~ lnodulatmg lnterleukm activities Chn Exp hnmunol 1991, 86 525-531 38 Wang JC D N A topolsomerases W h ) s o man)~ J Blol Chcm 1991, 266 6659-6662 39 Wlllmott CJR, Max,~ell A A single point nmtatlon in the DN ~ g)rase A protein greatl) reduces binding of fluoroqulnoloncs to the g)rase-DN~, complex Antlm~crob Agents Chemother 1993, 37 126-127 4(/ Wolfson IS. Hooper DC Fluoroqumolonc antnnl~.iobml agents Chn Mmroblol Rex 1989, 2 378-424 41 Zehax l-Wfllner T. Shaht I Enhancement oflnterleukln-2 production in human 1)lnphocytcs b) two nexx qulnolone d e m atires L)mphoklne Res 1989, 3 35-46