Increased parathyroid expression of klotho in uremic rats

http://www.kidney-international.org

original article

& 2010 International Society of Nephrology

see commentary on page 1057

Increased parathyroid expression of klotho in uremic rats Jacob Hofman-Bang1, Giedre Martuseviciene1, Martin A. Santini2, Klaus Olgaard1 and Ewa Lewin1,3 1

Nephrological Department P, Rigshospitalet, University of Copenhagen, Copenhagen, Denmark; 2The Neurobiology Research Unit, Rigshospitalet, University of Copenhagen, Copenhagen, Denmark and 3Nephrological Department B, Herlev Hospital, University of Copenhagen, Copenhagen, Denmark

Klotho is a protein of significant importance for mineral homeostasis. It helps to increase parathyroid hormone (PTH) secretion and in the trafficking of Na þ /K þ -ATPase to the cell membrane; however, it is also a cofactor for fibroblast growth factor (FGF)-23 to interact with its receptor, FGFR1 IIIC, resulting in decreased PTH secretion. Studies on the regulation of parathyroid klotho expression in uremia have provided varying results. To help resolve this, we measured klotho expression in the parathyroid and its response to severe uremia, hyperphosphatemia, and calcitriol treatment in the 5/6 nephrectomy rat model of secondary hyperparathyroidism. Parathyroid klotho gene expression and protein were significantly increased in severely uremic hyperphosphatemic rats, but not affected by moderate uremia and normal serum phosphorus. Calcitriol suppressed klotho gene and protein expression in severe secondary hyperparathyroidism, despite a further increase in plasma phosphate. Both FGFR1 IIIC and Na þ /K þ -ATPase gene expression were significantly elevated in severe secondary hyperparathyroidism. Parathyroid gland klotho expression and the plasma calcium ion concentration were inversely correlated. Thus, our study suggests that klotho may act as a positive regulator of PTH expression and secretion in secondary hyperparathyroidism. Kidney International (2010) 78, 1119–1127; doi:10.1038/ki.2010.215; published online 14 July 2010 KEYWORDS: FGF23; hyperparathyroidism; hyperphosphatemia; parathyroid hormone; uremia

Correspondence: Ewa Lewin, Nephrological Department B, Herlev Hospital, Herlev Ringvej, DK-2730 Herlev, Denmark. E-mail: [email protected] Received 18 October 2009; revised 25 April 2010; accepted 5 May 2010; published online 14 July 2010 Kidney International (2010) 78, 1119–1127

Klotho is a protein of significant importance for mineral homeostasis, discovered by Kuro-o in 1997.1 Lack of klotho in mice resembles the clinical picture of human aging. At the same time, calcium and phosphate levels are significantly affected and plasma levels of 1,25-dihydroxyvitamin D increased.2 Klotho is highly expressed in kidney distal convoluted tubule, choroid plexus, and parathyroid glands.3–5 Fibroblast growth factor-23 (FGF23) is a phosphatonin expressed in osteocytes and osteoblasts.6,7 The phenotype of FGF23 knockout mice is similar to that of klotho knockout mice.8,9 FGF23 and klotho act on the sodium phosphate co-transporters NaPi2a and NaPi2c and on 1a-hydroxylase in kidneys, and have as such a central role in phosphate and vitamin D homeostasis.2,8 In 2006, Kurosu et al.10 showed that klotho specifically stimulated signaling of FGF23 through the IIIC splice forms of FGF receptors (FGFRs), most prominently FGFR1 IIIC and FGFR3 IIIC, whereas FGFR2 IIIC and FGFR4 were of minor importance. Klotho functions as an obligatory co-receptor for FGF23, converting the canonical FGFRs to an FGF23-specific receptor, explaining the similarities in knockout phenotypes.11–13 FGF23 reduces the amount of NaPi2a in the brush border of proximal tubules and as such enhances renal phosphaturia.9,12,14 However, the specific klotho-related mechanism in this process has not yet been clarified. FGF23 suppresses renal 1a-hydroxylase in the proximal tubular cells through a klotho-mediated mechanism, whereas FGF23/klotho-mediated induction of renal 24-hydroxylase occurs in the distal tubules and hereby is limiting 1,25dihydroxyvitamin D levels.14,15 This process is klotho dependent. Besides having activities in cooperation with FGF23, klotho has independent effects on mineral homeostasis. Klotho was shown to possess enzyme activity resembling b-glucuronidase, triming sugar moieties, and stabilizing the distal tubular epithelial calcium channel, the transient receptor potential vanilloid 5 channel, on the cell membrane, thus enhancing tubular reabsorption of calcium.16–18 Recently, it was discovered that klotho participates in protein trafficking of Na þ /K þ -ATPase to the cell membrane in the choroid plexus and parathyroid cells. In parathyroids it has been suggested that low extracellular calcium 1119

original article

J Hofman-Bang et al.: Parathyroid expression of klotho in uremic rats

level enhances trafficking of Na þ /K þ -ATPase to the cell surface and thereby increases parathyroid hormone (PTH) secretion.19 Another effect of klotho in the parathyroid cell might be related to its function as co-receptor for FGF23. FGF23 suppresses the expression and secretion of PTH in in vivo and in vitro models.4,20 When a stable form of FGF23, FGF23 R176Q, was injected into rats, PTH gene expression was suppressed putatively in the presence of klotho.4,20 As such in parathyroids klotho might have pleiotropic effects some dependent upon FGF23 and others not. These effects might even be opposite as FGFR-associated klotho might contribute to suppression of PTH secretion whereas Na þ /K þ -ATPaseassociated klotho might contribute to an increase of PTH secretion.19,21 Therefore, in parathyroids, klotho seems to be able to convey both negative and positive signals to PTH regulation. Studies on regulation of parathyroid klotho expression in uremia have provided varying results. Thus, expression of klotho in parathyroid glands of rats with mild uremia and normal to slightly elevated PTH was not significantly changed.22 In rats with more severe uremia parathyroid, klotho expression was significantly increased after 2 weeks of uremia and then the expression was suppressed at 6 weeks of uremia, using an adenine uremic rat model in a study by Galitzer et al.23 In human uremic parathyroid glands, it has been found that expression of klotho was significantly decreased24,25 or increased, varying in the different parathyroid nodules.26 Severe uremia and secondary hyperparathyroidism (sec. HPT) are characterized by hyperphosphatemia and hypocalcemia. The aim of this investigation therefore was further to examine parathyroid expression of klotho, and at the same time the expression of receptors for

FGF23 and Na þ /K þ -ATPase (ATP1a1) in response to severe chronic uremia, high levels of phosphate, and administration of high doses of calcitriol. RESULTS Biochemical characteristics of sham-operated, 5/6 nephrectomized, and calcitriol-treated rats

Biochemical findings of sham-operated rats, uremic rats on a standard diet, and uremic rats kept on a high-phosphate (HP) diet are shown in Table 1, whereas the results of sham-operated and uremic HP (UHP) rats receiving either 200 ng of calcitriol or vehicle are presented in Table 2. 5/6 Nephrectomy induced a significant increase in plasma urea, creatinine, and PTH levels. In UHP rats, severe hypocalcemia, hyperphosphatemia, and very severe hyperparathyroidism were induced (PTH increased from 43±6 to 1848±150 pg/ml, Po0.005). Plasma FGF23 levels were, as expected, severely increased in uremic rats. Calcitriol treatment of uremic rats resulted in amelioration of hypocalcemia, a significant suppression of PTH levels and further increase in FGF23 and phosphate levels. As a result of calcitriol treatment sham-operated rats also had significantly suppressed PTH levels, together with increased p-Ca2 þ and FGF23 levels. Effect of uremia and HP diet on parathyroid expressions of klotho, ATP1a1, PTH, CaR, VDR genes and proteins

Figure 1 shows results of assessment of gene activity in parathyroid glands by real-time PCR in sham, moderately uremic rats on standard diet (U) and in the UHP groups. Mean gene expression of the sham group was set to 1. The relative gene expressions of uremic group were not affected, whereas the UHP group was characterized by a significantly

Table 1 | Plasma values of sham and uremic rats

Sham Uremic Uremic HP

N

p-PTH (pg/ml)

p-Phosphate (mM)

p-Ca2+ (mM)

p-Creatinine (lM)

p-Urea (mM)

19 8 32

43±6 198±246w 1848±150**

1.65±0.08 1.40±0.46 4.54±0.40**

1.28±0.01 1.28±0.06 0.85±0.04**

39±1 123±30** 165±13**

6±0.3 21±5** 35±4**

Abbreviations: HP, high phosphate; PTH, parathyroid hormone. Significance of sham versus uremic groups. w Po0.01, **Po0.005.

Table 2 | Plasma values of sham and uremic HP rats given vehicle (V) or 200 ng of calcitriol (C) N

p-PTH (pg/ml)

p-Phosphate (mM)

p-Ca2+ (mM)

p-Creatinine (lM)

p-Urea (mM)

Sham+V

9

44±8

1.96±0.01

1.28±0.03

35±1

7±0.2

Sham+C

10

7±5**

2.72±0.07w

1.39±0.01y

44±2w

7±0.2

Uremic HP+V

10

1475±162

3.20±0.27

0.99±0.05

115±12

22±2

Uremic HP+C

11

4.56±0.73

1.15±0.05y

152±32

34±8w

701±201w

p-FGF23 (pg/ml) 300±17 2079±103** 2073±404 14242±2615**

Abbreviations: FGF, fibroblast growth factor; HP, high phosphate; PTH, parathyroid hormone. Significant differences of the effects of calcitriol versus vehicle are indicated in the sham as well as the uremic HP groups. y Po0.05, wPo0.01, **Po0.005.

1120

Kidney International (2010) 78, 1119–1127

original article

3

Uremic HP

Sham CaR

VDR

*

***

PTH

***

Klotho

**

ATP1a1

***

2

1

Klotho

- 130 kDa

NaK

- 100 kDa

VDR

- 54 kDa

B2M

- 12 kDa Uremic HP

0

Uremic HP + C

Parathyroid expressions of FGFR1–FGFR4 genes

Klotho has been shown to be a cofactor to various FGFRs forming a specific receptor for FGF23 signaling.10 Figure 3 shows the relative expressions of different FGFRs in rat parathyroids (note the logarithmic scale on the ordinate). Thus, FGFR1 and splice variant FGFR1 IIIC were highly expressed, whereas expression of FGFR3 and FGFR4 was minimal. FGFR2 was highly expressed as well, but its relevance for FGF23 signaling is uncertain. Effect of uremia and HP diet on parathyroid expressions of FGFR1–FGFR4 genes

Figure 4 shows the effect of uremia HP on parathyroids expression of four different FGFRs, as well as the special IIIC splice variants of FGFR1 and FGFR3. Compared to the shamoperated group, significantly higher expression in the UHP group was found for FGFR1 IIIC to 1.41±0.07 (Po0.005) and FGFR2 gene to 1.76±0.12 (Po0.005). Total FGFR1 was not affected in uremia and expression of FGFR3 was significantly suppressed in the UHP group to 0.49±0.04 (Po0.005), whereas FGFR3 IIIC expression was the same between the groups, 0.98±0.08. FGFR4 is not spliced in the IIIC version, and therefore only total FGFR4 gene activity was measured and found to be significantly suppressed to 0.65±0.06 (Po0.005) in the UHP group. Kidney International (2010) 78, 1119–1127

- 54 kDa

B2M

- 12 kDa

**

*

5 4 3 2 1

H P

+

H P

C

0

U re m ic

increased expression of PTH to 2.11±0.11 (Po0.005), a significant decrease of VDR to 0.24±0.06 (Po0.005), and a significant decrease of CaR to 0.83±0.03 (Po0.05). Expression of klotho was significantly increased, 1.34±0.07 (Po0.01) and expression of ATP1a1, a functional subunit of the Na þ /K þ -ATPase, was also significantly increased to 1.61±0.09 (Po0.005). In parathyroids of UHP rats, the protein expressions of klotho and the Na þ /K þ -ATPase were significantly elevated, (Po0.01), as shown in Figure 2a, whereas, as expected, protein expression of VDR was significantly suppressed (Po0.005).

VDR

U re m ic

Figure 1 | Effect of uremia (U) and uremia and high-phosphate diet (UHP) on parathyroid gene expressions, compared to a sham group (S). Klotho and Na þ /K þ -ATPase were significantly elevated in the UHP group. CaR, calcium sensing receptor gene; VDR, vitamin D receptor gene; PTH, parathyroid hormone gene; ATP1a1, Na þ /K þ -ATPase a 1 subunit gene. *Po0.05, **Po0.01, ***Po0.005.

- 130 kDa

Sh am

U S H P

S U U H P

S U U H P

S U U H P

S U U H P

Klotho

Klotho protein

Parathyroid gene expression

J Hofman-Bang et al.: Parathyroid expression of klotho in uremic rats

Figure 2 | Expression of klotho protein in parathyroids of normal and uremic rats. Effects of calcitriol. (a) Western blots on the expression of klotho, Na þ /K þ -ATPase (NaK), and vitamin D receptor (VDR) proteins in the parathyroids from three representative uremic high-phosphate (HP) and normal rats, using B2M as control protein. Both klotho and NaK were significantly upregulated at the protein level in the parathyroids from uremic HP rats, whereas the expression of VDR was significantly suppressed. (b) Effect of a single dose of 200 ng of calcitriol. Western blots on the expression of klotho and VDR proteins in the parathyroids from three representative uremic HP and normal rats, showing a significant downregulation of klotho and upregulation of VDR after calcitriol. (c) Quantification of the klotho protein expression in the uremic parathyroids and after calcitriol. *Po0.05, **Po0.01.

Effect of calcitriol on parathyroid klotho and ATP1a1 genes as compared to the corresponding effect on PTH, CaR, and VDR gene expressions in normal and uremic rats on an HP diet

In kidneys, klotho is highly expressed in the distal convoluted tubule, where it has a negative feedback effect on synthesis of calcitriol. Expression of klotho is activated by calcitriol in a time-dependent manner and suppresses CYP27b encoding the 25-(OH)vitamin D 1a-hydroxylase. To examine whether calcitriol also activates expression of klotho gene in parathyroid glands, we injected increasing doses of calcitriol or vehicle intraperitoneally into normal rats, as shown in Figure 5. As expected, a significant decrease of PTH and a significant dose-related increase of both CaR and VDR gene expressions were found in parathyroids of the group receiving calcitriol. Parathyroid gene expressions of klotho 1121

J Hofman-Bang et al.: Parathyroid expression of klotho in uremic rats

Parathyroid gene expression

3

0.1 0.01 0.001

Figure 3 | The expressions of the different fibroblast growth factor (FGF) receptors in the rat parathyroids are presented in relation to the expression of FGFR1, which is set to 1. Please note that the ordinate is a logarithmic scale. Thus, FGFR1 and the splice variant FGFR1 IIIC are highly expressed, whereas the expressions of FGFR3 and FGFR4 are minimal. FGFR2 is highly expressed as well, but its relevance for FGF23 signaling is uncertain.

Parathyroid gene expression

3 R1

R1 IIIC

R2

***

R3

***

R3 IIIC

***

***

1

S U H P

S U H P

S U H P

S U H P

S U H P

S U H P

0

Figure 4 | Effect of uremia and high-phosphate diet (UHP) on the parathyroid gene expressions of fibroblast growth factor receptors (FGFRs) compared to a sham group (S). IIIC depicts the ‘C’ splice variants of FGFR1 and FGFR3. ***Po0.005.

Parathyroid gene expression

3

2

** ***

VDR

*** ***

PTH

Klotho

ATP1a1

** ***

1

0 20 40 0 00 0 20 40 0 00

0 20 40 0 00

0 0 20 40 0 00 0 20 40 0 00

**

Klotho

PTH

**

**

ATP1a1

*

2

1

0

Figure 6 | Effect of a single dose of 200 ng of calcitriol or vehicle on parathyroid gene expressions in uremic rats on a high-phosphate diet (UHP) compared to a vehicle-treated sham group (S). Calcitriol significantly reduced the elevated expression of klotho in the UHP group and had the expected effects on CaR, VDR, and PTH, whereas Na þ /K þ -ATPase was not affected. CaR, calcium sensing receptor gene; VDR, vitamin D receptor gene; PTH, parathyroid hormone gene; klotho, klotho gene; ATP1a1, Na þ /K þ -ATPase a 1 subunit gene. *Po0.05, **Po0.01 (between UHP and UHP þ C).

R4

2

CaR

VDR

U UHS H P P + C S U UH H P P + C

1

CaR

S U UH H P P + C U U HS H P P + C U UHS H P P + C

10

FG FR 1 FG FR 1 III C FG FR 2 FG FR 3 FG FR 3 III C FG FR 4

Parathyroid gene expression

original article

and ATP1a1 were however not significantly affected by calcitriol in these normal rats. Figure 6 shows effect of a single injection of 200 ng of calcitriol on parathyroid gene expressions in uremic hyperphosphatemic rats. Calcitriol administration resulted in a significant suppression by 22% (Po0.05) of the klotho gene in uremic parathyroid glands and by 38% at the klotho protein level (Po0.05; Figure 2b and c). Expression of ATP1a1 was not significantly affected by calcitriol, whereas the well-known effects of calcitriol on parathyroid PTH, CaR, and VDR gene expressions were seen (Figure 6). Parathyroid klotho correlations in uremia

In UHP rats, a significant inverse correlation was shown between parathyroid klotho gene expression and p-Ca2 þ (r ¼ 0.62, Po0.005), and between p-Ca2 þ and parathyroid FGFR1 IIIC mRNA gene expression (r ¼ 0.85, Po0.0001, Figure 7). Figure 8 shows highly significant direct correlations between klotho and PTH gene expressions (r ¼ 0.78, Po0.0001); FGFR1 IIIC and PTH gene (r ¼ 0.90, Po0.0001); and klotho and FGFR1 IIIC gene expressions (r ¼ 0.71, Po0.0001) in parathyroids of UHP rats with severe sec. HPT. Linear correlations were shown between ATP1a1 and PTH gene (r ¼ 0.72, Po0.0001) and ATP1a1 and klotho gene expressions (r ¼ 0.78, Po0.0001) in uremic parathyroids (Figure 9).

Calcitriol dose (ng per rat)

Figure 5 | Effect of increasing doses of calcitriol on parathyroid gene expressions in normal rats. No effect was found on klotho and Na þ /K þ -ATPase, whereas dose-dependent effects were found on CaR, VDR, and PTH, as expected. CaR, calcium sensing receptor gene; VDR, vitamin D receptor gene; PTH, parathyroid hormone gene; klotho, klotho gene; ATP1a1, Na þ /K þ -ATPase a 1 subunit gene. **Po0.01, ***Po0.005. 1122

DISCUSSION

Sec. HPT in uremic rats, kept on a high-phosphorus diet, was in this study associated with a significantly increased expression of parathyroid klotho gene and protein. Other studies on parathyroid klotho expression in uremia have provided varying results. Thus, expression of klotho in Kidney International (2010) 78, 1119–1127

original article

J Hofman-Bang et al.: Parathyroid expression of klotho in uremic rats

2.5 FGFR1 IIIC mRNA

Klotho mRNA

2.5 2.0 1.5 1.0 0.5 0.0 0.25

0.50

0.75

1.00

1.25

2.0 1.5 1.0 0.5 0.0 0.25

1.50

0.50

0.75

1.00

1.25

1.50

Plasma Ca2+, mM

Plasma Ca2+, mM

3.5

3.5

3.0

3.0

2.5

2.5

PTH mRNA

PTH mRNA

Figure 7 | Linear correlations between gene expression of klotho and plasma Ca2 þ (r ¼ 0.80, Po0.0001) and fibroblast growth factor receptor 1 (FGFR1) IIIC and plasma Ca2 þ (r ¼ 0.86, Po0.0001) in the parathyroids of uremic high-phosphate (HP) rats with severe hyperparathyroidism.

2.0 1.5 1.0 0.5

2.0 1.5 1.0 0.5

0.0

0.0 0.0

0.5

1.0 1.5 2.0 Klotho mRNA

2.5

3.0

0.0

0.5

1.0 1.5 2.0 2.5 FGFR1 IIIC mRNA

3.0

FGFR1 IIIC mRNA

3.0 2.5 2.0 1.5 1.0 0.5 0.0 0.0

0.5

1.0 1.5 2.0 Klotho mRNA

2.5

3.0

3.5

3.0

3.0

2.5 Klotho mRNA

PTH mRNA

Figure 8 | Linear correlations between gene expression of klotho and parathyroid hormone (PTH) (r ¼ 0.78, Po0.0001); fibroblast growth factor receptor 1 (FGFR1) IIIC and PTH (r ¼ 0.90, Po0.0001); and klotho and FGFR1 IIIC (r ¼ 0.71, Po0.0001) in the parathyroids of uremic high-phosphate (HP) rats with severe hyperparathyroidism.

2.5 2.0 1.5 1.0

1.5 1.0 0.5

0.5 0.0 0.0

2.0

0.0 0.5

1.0

1.5

2.0

2.5

3.0

ATP1a1 mRNA

0.0

0.5

1.0

1.5

2.0

2.5

3.0

ATP1a1 mRNA

Figure 9 | Linear correlations between gene expressions of Na þ /K þ -ATPase a 1 (ATP1a1) and parathyroid hormone (PTH) (r ¼ 0.72, Po0.0001) and ATP1a1 and klotho (r ¼ 0.78, Po0.0001) in the parathyroids of uremic high-phosphate (HP) rats with severe hyperparathyroidism.

parathyroid glands of rats with mild uremia and normal to slightly elevated PTH levels was not significantly different from that of normal rats.22 In rats with more severe uremia Kidney International (2010) 78, 1119–1127

parathyroid klotho expression was significantly increased after 2 weeks of uremia and then the expression was found to be suppressed at 6 weeks of uremia, as shown by Galitzer 1123

original article

et al.,23 using an adenine uremic rat model. In a study on human uremic parathyroid glands, Komaba et al.25 found that the expression of klotho was significantly depressed, and similar results were published by Kumata et al.,24 whereas Ohkido et al.26 described elevated expression of klotho by immunostaining that had a varying degree in different nodules of uremic hyperplastic parathyroid glands. However, in parathyroid adenomas from patients with primary hyperparathyroidism a decreased level of klotho protein has been found27 and an inactivating mutation in the klotho gene resulted in a human phenotype of severe hyperparathyroidism with elevated PTH in the presence of hypercalcemia.28 As such an enhanced or normal expression of klotho in our rat models is surprising. Furthermore, resistance to the suppressive action of FGF23 on the expression of PTH gene and on PTH secretion would be expected in uremia,29 as the uremic condition is associated with stimulated PTH gene activity and PTH secretion, despite extremely elevated FGF23 levels. Such a resistance could potentially be mediated through suppressed expression of the specific FGFR for FGF23 and of klotho as an obligatory co-receptor. In this study, however, both the expression of klotho and FGFR1 IIIC receptor genes were significantly enhanced. We performed three independent sets of investigations and each time the same elevated expression of klotho gene and protein and expression of FGFR gene was found. In this respect it is important, as pointed out by Ohkido et al.,26 to remember the difference between severe human hyperparathyroidism with nodular formation, where different nodules might have completely different expression of, for example, PTH and PTHrP,30 whereas the rat uremic model reflects pure, but severe parathyroid diffuse hyperplasia, and as such represents a more uniform picture of the abnormalities. Differences in experimental models, 5/6 nephrectomy, and HP diet against the adenine model might have contributed to different expressions of klotho. The regulatory mechanism of calcitriol synthesis in kidneys is positively controlled by PTH and negatively controlled by klotho, acting on the 25(OH)-vitamin D-1a hydroxylase gene.8 Calcitriol closes the negative feedback loop by positively controlling klotho gene expression in kidneys. As klotho gene and protein are expressed in parathyroid glands, we examined whether calcitriol also activates klotho gene expression in this tissue. First, in normal rats we injected either vehicle or a dose of 200 or 4000 ng of calcitriol, intraperitoneally, and measured the effect on PTH, CaR, VDR, klotho, and ATP1a1 gene activity after 24 h. The well-known effects of calcitriol were observed,31 with significantly suppressed PTH gene activity and significantly increased CaR and VDR gene activities,32,33 as shown in Figure 5. These effects were dose dependent. Although calcitriol had effects on PTH, CaR, and VDR gene activity, no significant effect was found in normal rats on parathyroid klotho gene activity, even at very high doses of calcitriol. As such, in contrast to what previously has been shown in the 1124

J Hofman-Bang et al.: Parathyroid expression of klotho in uremic rats

kidneys, no stimulatory effect was found in the parathyroids of calcitriol on klotho gene expression. These results point toward a tissue-specific regulation of klotho gene by calcitriol. The results of this investigation clearly showed that parathyroid klotho was not elevated in mild to moderate uremia. In severe uremia with severe hyperparathyroidism combined with hyperphosphatemia and hypocalcemia, parathyroid klotho mRNA and protein were significantly elevated in this experimental model. The elevated klotho levels were however clearly reduced by treatment with calcitriol, despite a further increase in plasma phosphate, suggesting that phosphate levels are not responsible for the changes on klotho expression in uremic parathyroids. The concomitant normalization of plasma Ca2 þ and CaR expression in parathyroid glands due to calcitriol might have contributed to the downregulation of klotho. The final answer to this question might need in vitro studies. Previous investigations on the parathyroids have shown that FGF23 suppressed PTH expression in vivo as well as in vitro,20 and at the same time increased klotho protein levels.4,5 It is well known that FGF23 levels are highly increased in the later stages of chronic kidney disease.34,35 Elevated FGF23 levels might stimulate the parathyroid klotho gene expression, as seen in this study, where a sixfold increase in plasma FGF23 levels was observed in uremic rats on an HP diet (see Table 2). PTH levels were also highly elevated. Therefore, the expression of four different fibroblast growth factor receptors (FGFR1–FGFR4) was examined. These receptors differ from one another in their ligand affinities and tissue distribution.36 As shown in Figure 4, sec. HPT and severe uremia significantly affected the expression of the FGFR genes. Kurosu and co-workers identified FGFR1 IIIC and FGFR3 IIIC as the major receptors for the specific binding of FGF23 and ability to convey a signal into the cell, whereas FGFR2 IIIC and FGFR4 only to a smaller degree bound FGF23.10,37 FGFR1 IIIC was significantly upregulated in the UHP group as compared to sham-operated rats, whereas the expression of FGFR3 IIIC was similar to that of sham-operated rats. The question therefore is how high levels of PTH can persist under very high levels of its own suppressor, FGF23, and high levels of the suppressors receptor and co-receptor (FGFR1 IIIC and klotho). One theoretical explanation could be that the reduced expression and activation of the calcium sensing receptor and hyperphosphatemia in the uremic setting oppose the suppressive effect of FGF23 on PTH gene expression and PTH secretion. Alternatively, FGF23 might have dual effects on the parathyroids such that the stimulatory effect on parathyroid klotho expression can activate another mechanism, which is promoting PTH secretion. At present, however, in the uremic setting the resistance toward FGF23 signaling in the parathyroid glands remains unexplained and similarly is the role of klotho in the uremic parathyroids not fully clarified. Brown E showed in 1983 that ouabain by blocking the Na þ /K þ -ATPase activity could suppress PTH secretion Kidney International (2010) 78, 1119–1127

J Hofman-Bang et al.: Parathyroid expression of klotho in uremic rats

in vitro.38 Recently, Imura and co-workers proposed the existence of a signaling pathway between the Na þ /K þ ATPase and increased PTH secretion in vivo.19,21 In the present UHP group, it was found that the ATP1a1 gene encoding the a subunit of the Na þ /K þ -ATPase was significantly upregulated together with an elevated expression of klotho, as shown in Figure 1. These findings correlated with the increased need to raise plasma PTH in response to uremia. Klotho might have a pivotal role in both the positive and negative signaling on PTH gene expression and secretion. It has been shown that FGF23 has suppressive effect on PTH secretion4,20 and that the effect of the Na þ /K þ -ATPase activity is to increase PTH secretion.19 It is therefore puzzling that both pathways are upregulated in a setting, where increased levels of PTH are required. Thus, in this model on uremia with severe sec. HPT associated with hyperphosphatemia, hypocalcemia, and highly elevated levels of plasma PTH, high levels of plasma FGF23 together with increased parathyroid expression of the FGFR1 IIIC gene and high expression of parathyroid klotho and ATP1a1 were found. However, despite normal or high mRNA and protein concentrations post-receptor disturbances (for example, for klotho and FGFRs) or unforeseen decreases in activity (for example, for Na þ /K þ -ATPase) could be responsible for the observed apparent resistance of the parathyroid gland to the extremely high serum FGF23 concentrations associated with severe uremia. The levels of plasma calcium might be of importance for klotho expression. As such decreasing klotho expression in the parathyroids of patients with primary hyperparathyroidism correlated with increasing plasma ionized calcium.27 A similar significant negative correlation between the expression of klotho gene and plasma Ca2 þ was found in the UHP group of this investigation, as shown in Figure 7. Therefore, low-ionized calcium might be permissive for an increase in klotho expression. Furthermore, a significant positive correlation was found between klotho and ATP1a1 (Figure 9). As such these findings support the work by Imura et al.,19 which showed that klotho and the Na þ /K þ -ATPase act as positive regulators of PTH secretion. In accordance with that PTH gene expression correlated significantly with the gene expressions of klotho as well as of ATP1a1 in this investigation (Figures 8 and 9). In conclusion, the results of this study clearly showed that the expression of parathyroid klotho gene and protein was significantly increased in an experimental model of severe uremia, combined with severe sec. HPT and characterized by pronounced hyperphosphatemia and hypocalcemia. Parathyroid klotho was not elevated in uremic rats with normal plasma phosphate and ionized calcium. Calcitriol treatment suppressed the parathyroid expression of klotho in severe uremia, despite a further increase in plasma phosphate, whereas calcitriol had no effect on klotho expression in parathyroids of normal rats. In uremia the elevated expresKidney International (2010) 78, 1119–1127

original article

sion of the parathyroid klotho gene was reduced again, when calcium levels became normalized. The expression of the specific FGF23 receptor, the FGFR1 IIIC gene, and Na þ /K þ ATPase gene was similarly significantly increased in the uremic parathyroids. Klotho gene and protein expression correlated significantly with PTH gene expression, indicating a potential new role of klotho on PTH signaling in the parathyroids, where klotho may act as a positive regulator of PTH expression and secretion in the model of severe, sec. HPT in uremic rats. MATERIALS AND METHODS Animals The experimental studies were performed in accordance with the Danish law and approved by Ministry of Justice. Adult male Wistar rats, 250 g (Taconic A/S, Ejby, Denmark), were fed a standard diet (0.9% calcium, 0.7% phosphorus, and vitamin D, 1000 IU/kg) or an HP diet (0.9% calcium, 1.2% phosphorus, and vitamin D, 1000 IU/kg) with free access to food and water. 5/6 Nephrectomy Chronic renal failure was induced by one-step 5/6 nephrectomy.39 One group was given a standard diet. To induce severe HPT, we gave HP diet to another group. Duration of uremia was 8 weeks. The rats received anesthesia with hypnorm/midazolam, 200 ml/100 g rat subcutaneously. Buprenorfin (0.3 mg/ml, at a dose of 200 ml per rat; Schering-Plough, Copenhagen, Denmark) and rimadyl (50 mg/ ml, at a dose of 30 ml per rat) were used as pain relief. Parathyroidectomy Parathyroid glands were removed by microsurgery and frozen in liquid nitrogen. Effect of uremia Uremic rats were fed either a standard diet (n ¼ 8) or an HP diet (n ¼ 32) for 8 weeks and then killed. Parathyroids were obtained for analysis of gene activity and protein determination. Nineteen shamoperated rats were examined. Effect of calcitriol The effect of calcitriol (Leo Pharma, Ballerup, Denmark) was first examined in normal rats by intraperitoneal injection of increasing doses: 0, 200, or 4000 ng. Parathyroids were harvested after 24 h. Next, effect of a single dose of 200 ng of calcitriol or vehicle was assessed in UHP rats (n ¼ 10) and compared to sham-operated rats (n ¼ 9) and parathyroids harvested after 24 h. Plasma determinations Plasma phosphate, urea, and creatinine were analyzed by Vitros 250 (Ortho-Clinical Diagnostics, Raritan, NJ, USA); Ca2 þ by ABL 505 (Radiometer, Copenhagen, Denmark); and FGF23 by a human FGF23 ELISA kit (Kainos Laboratories, Tokyo, Japan), measuring fulllength FGF23 and PTH by a rat bioactive intact PTH ELISA assay (Immunotopics, San Clemente, CA, USA). RNA isolation and reverse transcription–PCR Total RNA of parathyroid glands was extracted with TRIzol (SigmaAldrich, St Louis, MO, USA). First-strand cDNA was synthesized from 0.5 mg of RNA with Superscript III cDNA kit (Invitrogen, 1125

original article

J Hofman-Bang et al.: Parathyroid expression of klotho in uremic rats

Table 3 | PCR primers used for real-time PCR

PTH CaR VDR Klotho ATP1a1 FGFR1 FGFR1 IIIC FGFR2 FGFR3 FGFR3 IIIC FGFR4 ARBP B2M EEF1a

Forward

Reverse

TTGTCTCCTTACCCAGGCAGAT TTCTCCAGAGAGGTGCCTTTCT CCAGGATTCAGGGATCTCACCT CGTGAATGAGGCTCTGAAAGC ATGGGGATTGTTGGCTCGGATGT TGGCACCTGAGGCATTGTT GCATGGTTGACCGTTCTGGAA ACCAACTGCACCAATGAACTGT TGCCTGCTGACCCCAAGT CTGAAGCACGTGGAGGTGAA CCGGCCAGACCAAACC AAAGGGTCCTGGCTTTGTCT TGACCGTGATCTTTCTGGTG CATCGTCGTAATTGGACACG

CTTCTTGGTGGGCCTCTGGTAAC GGCACTCGCATCTGTCTCTCCA GTGTGCCCAGCTTTGGAGACAT GAGCGGTCACTAAGCGAATACG CAGGGGCAGTGGAATGTTTG AAGAGCACCCCAAAAGACCAC AGCCCACCATACAGGAGATCAG TTAAACGTGGGCCTCTGTGA CCTGTCCAAAGCAGCCTTCT TTAGCTCCTGCAGTCTTGAG TCAGGTCTGCCAAATCCTTGT GCAAATGCAGATGGATCG ATCTGAGGTGGGTGGAACTG CACGCTCAGCTTTCAGTTTG

Abbreviations: ARBP, acidic ribosomal phosphoprotein P0; ATP1a1, Na+/K+-ATPase a 1 subunit; B2M, beta-2-microglobulin; CaR, calcium sensing receptor; EEF1a, eukaryotic translation elongation factor 1 alpha; FGFR, fibroblast growth factor receptor; PTH, parathyroid hormone; VDR, vitamin D receptor. Sequences are listed as 50 -30 .

Carlsbad, CA, USA). Lightcycler 480 II (Roche, Basel, Switzerland) and Stratagene Brilliant II SYBR kit (Stratagene, La Jolla, CA, USA) were used for quantitative real-time PCR. Primers are listed in Table 3. All samples were run in duplicate. PCR product was confirmed on 2% agarose gels. Gene activity was normalized to the mean of three different housekeeping genes (ARBP, B2M, and EEF1a).

2.

3.

4. 5.

Western blot analysis Total protein (12 mg) was separated by 7.5% SDS–polyacrylamide gel electrophoresis (Bio-Rad, Copenhagen, Denmark; cat. no. 161-1172) and transferred onto nitrocellulose membranes (Thermo Scientific, Bonn, Germany; cat. no. 88013). Membranes were blocked with 5% milk in TBST buffer before incubation with the primary antibody overnight at 41C. Antibodies used were Klotho KM2076 (1:6000), kindly donated by Kyowa Hakko Kirin, Pharmacological Research Laboratories (Hisashi Hasegawa, Japan), and anti-rat Dako P0450 secondary antibody (1:1000; Dako, Glostrup, Denmark); Na þ /K þ -ATPase (1:1000, cat. no. sc-28800) and anti-rabbit Dako P0448 secondary antibody (1:2000); VDR (1:1000, cat. no. sc-1008; Santa Cruz Biotechnology, Santa Cruz, CA, USA) and anti-rabbit Dako P0448 secondary antibody (1:2000); B2M (1:1000, cat. no. sc-15366; Santa Cruz) and anti-rabbit Dako P0448 secondary antibody (1:2000). Statistic calculations Student’s t-test or Mann–Whitney test were used and data are presented as mean±standard error of the mean (s.e.m.). Po0.05 was considered statistically significant.

6. 7. 8.

9.

10. 11. 12.

13.

14.

15.

DISCLOSURE

All the authors declared no competing interests. 16.

ACKNOWLEDGMENTS

The technicians, Kirsten Bang and Ulla Steen Petersen, are acknowledged for their excellent and skillful technical work. The klotho antibody was a gift, most kindly received from Kyowa Hakko Kirin, Pharmacological Research Laboratories, Hisashi Hasegawa, Japan.

17.

18.

19.

REFERENCES 1. Kuro-o M, Matsumura Y, Aizawa H et al. Mutation of the mouse klotho gene leads to a syndrome resembling ageing. Nature 1997; 390: 45–51.

1126

20.

Tsujikawa H, Kurotaki Y, Fujimori T et al. Klotho, a gene related to a syndrome resembling human premature aging, functions in a negative regulatory circuit of vitamin D endocrine system. Mol Endocrinol 2003; 17: 2393–2403. Li SA, Watanabe M, Yamada H et al. Immunohistochemical localization of Klotho protein in brain, kidney, and reproductive organs of mice. Cell Struct Funct 2004; 29: 91–99. Ben Dov IZ, Galitzer H, Lavi-Moshayoff V et al. The parathyroid is a target organ for FGF23 in rats. J Clin Invest 2007; 117: 4003–4008. Galitzer H, Ben Dov I, Lavi-Moshayoff V et al. Fibroblast growth factor 23 acts on the parathyroid to decrease parathyroid hormone secretion. Curr Opin Nephrol Hypertens 2008; 17: 363–367. Berndt T, Kumar R. Novel mechanisms in the regulation of phosphorus homeostasis. Physiology 2009; 24: 17–25. Yoshiko Y, Wang H, Minamizaki T et al. Mineralized tissue cells are a principal source of FGF23. Bone 2007; 40: 1565–1573. Ohnishi M, Nakatani T, Lanske B et al. Reversal of mineral ion homeostasis and soft-tissue calcification of klotho knockout mice by deletion of vitamin D 1alpha-hydroxylase. Kidney Int 2009; 75: 1166–1172. Shimada T, Kakitani M, Yamazaki Y et al. Targeted ablation of Fgf23 demonstrates an essential physiological role of FGF23 in phosphate and vitamin D metabolism. J Clin Invest 2004; 113: 561–568. Kurosu H, Ogawa Y, Miyoshi M et al. Regulation of fibroblast growth factor-23 signaling by klotho. J Biol Chem 2006; 281: 6120–6123. Kurosu H, Kuro O. The Klotho gene family as a regulator of endocrine fibroblast growth factors. Mol Cell Endocrinol 2009; 299: 72–78. Urakawa I, Yamazaki Y, Shimada T et al. Klotho converts canonical FGF receptor into a specific receptor for FGF23. Nature 2006; 444: 770–774. Kurosu H, Kuro-o M. The Klotho gene family and the endocrine fibroblast growth factors. Curr Opin Nephrol Hypertens 2008; 17: 368–372. Perwad F, Zhang MY, Tenenhouse HS et al. Fibroblast growth factor 23 impairs phosphorus and vitamin D metabolism in vivo and suppresses 25-hydroxyvitamin D-1alpha-hydroxylase expression in vitro. Am J Physiol Renal Physiol 2007; 293: F1577–F1583. Yoshida T, Fujimori T, Nabeshima Y. Mediation of unusually high concentrations of 1,25-dihydroxyvitamin D in homozygous klotho mutant mice by increased expression of renal 1alpha-hydroxylase gene. Endocrinology 2002; 143: 683–689. Cha SK, Ortega B, Kurosu H et al. Removal of sialic acid involving Klotho causes cell-surface retention of TRPV5 channel via binding to galectin-1. Proc Natl Acad Sci USA 2008; 105: 9805–9810. Chang Q, Hoefs S, van der Kemp AW et al. The beta-glucuronidase klotho hydrolyzes and activates the TRPV5 channel. Science 2005; 310: 490–493. Lewin E, Olgaard K. Klotho, an important new factor for the activity of Ca2+ channels, connecting calcium homeostasis, ageing and uraemia. Nephrol Dial Transplant 2006; 21: 1770–1772. Imura A, Tsuji Y, Murata M et al. Alpha-Klotho as a regulator of calcium homeostasis. Science 2007; 316: 1615–1618. Krajisnik T, Bjorklund P, Marsell R et al. Fibroblast growth factor-23 regulates parathyroid hormone and 1alpha-hydroxylase

Kidney International (2010) 78, 1119–1127

original article

J Hofman-Bang et al.: Parathyroid expression of klotho in uremic rats

21. 22.

23.

24.

25.

26.

27.

28.

29. 30.

expression in cultured bovine parathyroid cells. J Endocrinol 2007; 195: 125–131. Razzaque MS. Klotho and Na+,K+-ATPase activity: solving the calcium metabolism dilemma? Nephrol Dial Transplant 2008; 23: 459–461. Carrillo-Lopez N, Roman-Garcia P, Rodriguez-Rebollar A et al. Indirect regulation of PTH by estrogens may require FGF23. J Am Soc Nephrol 2009; 20: 2009–2017. Galitzer H, Ben Dov IZ, Silver J et al. Parathyroid cell resistance to fibroblast growth factor 23 in secondary hyperparathyroidism of chronic kidney disease. Kidney Int 2010; 77: 211–218. Kumata C, Mizobuchi M, Ogata H et al. Involvement of alpha-klotho and fibroblast growth factor receptor in the development of secondary hyperparathyroidism. Am J Nephrol 2010; 31: 230–238. Komaba H, Goto S, Fujii H et al. Depressed expression of Klotho and FGF receptor 1 in hyperplastic parathyroid glands from uremic patients. Kidney Int 2010; 77: 232–238. Ohkido I, Yokoyama K, Imura A et al. Alpha-Klotho (a-Kl) expressions remained in the parathyroid glands of patients with secondary hyperparathyroidism. Nephrol Dial Transplant 2010; 25: 1007–1008. Bjorklund P, Krajisnik T, Akerstrom G et al. Type I membrane klotho expression is decreased and inversely correlated to serum calcium in primary hyperparathyroidism. J Clin Endocrinol Metab 2008; 93: 4152–4157. Ichikawa S, Imel EA, Kreiter ML et al. A homozygous missense mutation in human KLOTHO causes severe tumoral calcinosis. J Clin Invest 2007; 117: 2684–2691. Komaba H, Fukagawa M. FGF23-parathyroid interaction: implications in chronic kidney disease. Kidney Int 2010; 77: 292–298. Matsushita H, Hara M, Endo Y et al. Proliferation of parathyroid cells negatively correlates with expression of parathyroid hormone-related

Kidney International (2010) 78, 1119–1127

31.

32.

33.

34.

35.

36.

37. 38.

39.

protein in secondary parathyroid hyperplasia. Kidney Int 1999; 55: 130–138. Wang W, Lewin E, Olgaard K. 1,25(OH)2D3 only affects long-term levels of plasma Ca2+ but not the rapid minute-to-minute plasma Ca2+ homeostasis in the rat. Steroids 1999; 64: 726–734. Carrillo-Lopez N, Alvarez-Hernandez D, Gonzalez-Suarez I et al. Simultaneous changes in the calcium-sensing receptor and the vitamin D receptor under the influence of calcium and calcitriol. Nephrol Dial Transplant 2008; 23: 3479–3484. Naveh-Many T, Marx R, Keshet E et al. Regulation of 1,25dihydroxyvitamin D3 receptor gene expression by 1,25-dihydroxyvitamin D3 in the parathyroid in vivo. J Clin Invest 1990; 86: 1968–1975. Westerberg PA, Linde T, Wikstrom B et al. Regulation of fibroblast growth factor-23 in chronic kidney disease. Nephrol Dial Transplant 2007; 22: 3202–3207. Fliser D, Kollerits B, Neyer U et al. Fibroblast growth factor 23 (FGF23) predicts progression of chronic kidney disease: the Mild to Moderate Kidney Disease (MMKD) Study. J Am Soc Nephrol 2007; 18: 2600–2608. Eswarakumar VP, Lax I, Schlessinger J. Cellular signaling by fibroblast growth factor receptors. Cytokine Growth Factor Rev 2005; 16: 139–149. Liu S, Vierthaler L, Tang W et al. FGFR3 and FGFR4 do not mediate renal effects of FGF23. J Am Soc Nephrol 2008; 19: 2342–2350. Brown EM, Jones P, Adragna N. Effects of ouabain on [3H]ouabain binding, 86Rb uptake, cellular sodium and potassium, and parathyroid hormone secretion in dispersed bovine parathyroid cells. Endocrinology 1983; 113: 371–378. Lewin E, Garfia B, Almaden Y et al. Autoregulation in the parathyroid glands by PTH/PTHrP receptor ligands in normal and uremic rats. Kidney Int 2003; 64: 63–70.

1127