- Email: [email protected]
Increased salt and drought tolerance by D-pinitol production in transgenic Arabidopsis thaliana
Biochemical and Biophysical Research Communications xxx (2018) 1e6
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Increased salt and drought tolerance by D-pinitol production in transgenic Arabidopsis thaliana Chul-Hyun Ahn a, 1, Md. Amir Hossain a, b, 1, Eunjeong Lee a, Bashista Kumar Kanth a, Phun Bum Park a, * a b
Department of Bioscience and Biotechnology, University of Suwon, Hwaseong, South Korea Department of Genetics and Plant Breeding, Bangladesh Agricultural University, Mymensingh, Bangladesh
a r t i c l e i n f o
a b s t r a c t
Article history: Received 23 August 2018 Accepted 28 August 2018 Available online xxx
D-ononitol epimerase (OEP) catalyzes the conversion of D-ononitol to D-pinitol, which is the last step in the biosynthetic pathway, where myo-inositol is converted to pinitol in higher plants. In this study, OEP cDNA was isolated from Glycine max (GmOEP) and was functionally characterized, which confirmed that GmOEP expression was induced by high salinity and drought stress treatments. To understand the biological function of GmOEP, transgenic Arabidopsis plants overexpressing this protein were constructed. The transgenic Arabidopsis plants displayed enhanced tolerance to high salinity and drought stress treatments. © 2018 Published by Elsevier Inc.
Keywords: D-ononitol epimerase (OEP) D-pinitol Osmoprotectants Soybean Drought tolerance Salinity tolerance
1. Introduction Abiotic stress factors, such as high salinity, low temperature, drought, flooding, heat, oxidative stress, and heavy metal toxicity, impair plant growth and development resulting in reduced crop productivity. Because higher plants are sessile, they have evolved a set of genetic and physiological mechanisms to cope with these stresses [1,2]. A number of genes expressed in plants in response to abiotic stress factors have been identified, and the physiological roles of these gene products have been elucidated in terms of stress adaptation. The gene products expressed are involved in stress transduction pathways, protein turnover, transcriptional regulation, accumulation of osmoprotectants, and detoxification of reactive oxygen species [3e6]. In particular, water stress due to drought and high salinity cause plants to make osmotic adjustments such as increasing the amount of osmoprotectants present and maintaining turgor pressure at a lower water potential status [7,8]. These osmotic adjustments maintain metabolic activity and stabilize both
Abbreviations: IMT, myo-inositol methyltransferase; OEP, ononitol epimerase; Gm, Glycine max; GC-FID, gas chromatography-flame ionization detector; qRT-PCR, quantitative real-time polymerase chain reaction. * Corresponding author. E-mail address: [email protected] (P.B. Park). 1 These authors contributed equally to the article.
proteins and the cell membranes. Hence, accumulation of osmoprotectants during drought and high salinity conditions is common in plants [9]. Osmoprotectants can be categorized into three types:1) betaines and related compounds, such as dimethylsulfoniopropionate (DMSP) and choline-O-sulfate, 2) amino acids such as proline and ectoine, and 3) polyols and sugars such as mannitol, D-ononitol, Dpinitol, and trehalose [9,10]. D-pinitol plays a role in drought and high salinity stress, heat-induced water deficits, embryo development, and nodulation (in legumes) [11e18]. D-pinitol biosynthesis (1-D-3-O-methyl chiro-inositol) begins with a glucose phosphate precursor, which is converted to myoinositol by the action of two enzymes: myo-inositol 1-phosphate synthase (INPS) and myo-inositol monophosphatase (IMP) [19]. Then, D-pinitol is synthesized from myo-inositol by a two-step conversion process [20]. In the first step, myo-inositol methyltransferase (IMT) transfers a methyl group from S-adenosyl-Lmethionine (SAM) to myo-inositol producing D-ononitol (1-D-4-Omethylmyo-inositol). In the second step, D-ononitol is then converted to D-pinitol by the action of an ononitol epimerase, and the demethylation of D-pinitol gives rise to D-chiro-inositol [19]. Dononitol is a transient intermediate and is found at very low concentrations during D-pinitol production [21]. IMT genes have been cloned from various plants, including wild rice (Oryza sativa), soybean (Glycine max), and the halophytic ice plant
https://doi.org/10.1016/j.bbrc.2018.08.183 0006-291X/© 2018 Published by Elsevier Inc.
Please cite this article in press as: C.-H. Ahn, et al., Increased salt and drought tolerance by D-pinitol production in transgenic Arabidopsis thaliana, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.08.183
2
C.-H. Ahn et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e6
(Mesembryanthemum crystallinum L.), and transcription of all IMT genes has been found to be induced by osmotic stress [22e24]. Further, overexpression of McIMT1 in tobacco and GmIMT in Arabidopsis have enabled these plants to tolerate drought and highsalinity stress [22,24]. Glycine max contains D-pinitol as a major constituent, and drought stress is known to increase in accumulation of this substance in soybeans [12,25e27]. Likewise, salt stress results in the accumulation of pinitol in M. crystallinum [28]. To our knowledge, no enzyme epimerizing D-ononitol to D-pinitol has been characterized. In this study, the full length D-ononitol epimerase (OEP) cDNA was isolated from soybean (GmOEP) using information from the EST database, and a detailed analysis of GmOEP expression following abiotic stress treatments was performed. We also present results indicating that overexpression of GmOEP in Arabidopsis increases the tolerance of this plant to both drought and high salinity. 2. Materials and methods 2.1. Plant materials and stress treatment Soybean seeds (Glycine max cv Williams 82) were soaked in 70% ethanol and rinsed with sterilized water. Seedlings were then grown in soil in a 28 C growth chamber with a 14-h-light/10-hdark photoperiod, and four-week-old soybean seedlings were subjected to drought (10% polyethylene glycol (PEG)) and high salinity (300 mM NaCl) treatments for 0,1, 2, 4, 8,12 and 24 h. 2.2. RNA isolation and qRT-PCR Total RNA was isolated from normally grown soybean seedlings and from stress-treated seedlings using Trizol reagent (Gibco-BRL, Grand Island, NY). First strand cDNAs were synthesized using 2 mg of purified total RNA, M-Mulu™ reverse transcriptase (New England Biolabs, Beverly, MA) and an oligo (dT) primer in a total final volume of 25 mL. The RT reaction was incubated at 37 C overnight. These cDNAs were used as templates for qRT-PCR performed in an Applied Biosystems StepOnePlus Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA) using Power SYBR® Green PCR Master Mix (Thermo Fisher Scientific). The gene-specific forward primer, 50 AACCTCTCCTTTCACAAGGTG 30 , and reverse primer, 50 CAATTTCAGCATCACCAGGTC-30 , designed from the G. max ononitol epimerase (GmOEP) (XP_003538128, NCBI) sequence were then used in the amplification reaction, with the soybean actin gene amplified as an internal control to quantify the relative amounts of cDNA [29]. 2.3. Overexpression, purification of recombinant GmOEP, and ononitol epimerase assay To generate constructs for GmOEP expression in E. coli, the entire open reading frame (ORF) for this gene was amplified and cloned in-frame into the Xho I and SacI sites of modified pET15b, which had a new Sac I site. This construct was transformed and expressed in the E. coli BL21 (DE3) strain. Recombinant GmOEP protein, which was predominantly expressed in the bacterial pellet fraction, was solubilized in a buffer containing 20 mM Tris-HCl, 500 mM NaCl, 5 mM imidazole, and 2 mM PMSF at a pH of 7.0 and loaded onto an Ni-NTA resin column (Qiagen, Valencia, CA) under the same denaturing conditions. The bound protein fraction was subsequently eluted with a 20 mM Tris-HCl, 500 mM NaCl, and 500 mM imidazole solution at a pH of 7.0. The purified fractions were then dialyzed through a serial dilution of imidazole from 300 mM to an imidazole-free 100 mM Tris-HCl and 100 mM NaCl buffer at a pH of 7.0 for the complete removal of imidazole. The purified GmOEP
protein was confirmed on a 10% SDS-PAGE gel. The standard epimerase reaction was performed in 100 mM Tris-HCland10 mM MgCl2 at a pH of 7.9 and contained 0.1 mM NADþat 25 C [30]. To start the reaction, 1 mM of D-ononitol was added to the prewarmed enzyme solution and incubated for 1 h. The reaction product was analyzed by GC-FID as described previously [22]. 2.4. Generation of the 35S-GmOEP construct and the transformation of Arabidopsis The full-length GmOEP cDNA was inserted into the corresponding sites of the binary vector pPZP211, and the resulting fusion construct was then transferred into Agrobacterium tumefaciens strain GV3101 by freeze/thawing [31]. Arabidopsis transformation was then achieved using the floral dip method [32]. The seeds collected from the transformed plants were selected on a Gamborg B5 plate containing 25 mg/L hygromycin to obtain independent transgenic lines, and the presence of the transgene was confirmed by PCR. Homozygous T4 lines were obtained further by self-crossing. 3. Results & discussion 3.1. Isolation of full-length ononitol epimerase (OEP) cDNA from soybeans The Soybase (http://soybase.org/EstDB/LibSearchNew.php) and NCBI EST (http://www.ncbi.nlm.nih.gov/)databases were searched to obtain the drought-inducible epimerase in soybean, which was found in G. max (accession number XP_003538128). The ORF of this putative GmOEP was 1167 bp in length encoding 388 amino acids. Upon sequence analysis, it was found that GmOEP did not contain any signal peptides but did have an NAD binding domain, homodimer interface, and substrate binding sites. Its theoretical molecular weight was about 43 kDa and its pI value was 6.64. A comparison of this putative GmOEP amino acid sequence with that of other plant epimerases revealed that this putative GmOEP sequence shared 82% identity with Arabidopsis (NP_192834), 82% with rice (XP_015640233), and 81% with maize (NP_001105229). The NAD and substrate binding sites were nearly conserved (Supplementary Fig. 1). 3.2. GmOEP transcripts are both salt and drought inducible To analyze the expression level of GmOEP, qRT-PCR was performed using total RNA prepared from high salinity and drought stressed soybean leaves and roots. The four-week-old soybean seedlings were subjected to 300 mM NaCl (salinity stress) and 10% PEG (drought stress). After drought and salinity stress treatments, total RNA samples were prepared from leaf and root tissues at different time intervals, and relative GmOEP expression patterns were examined (Fig. 1). Due to the drought stress treatment, there were no detectable transcripts for up to 2 h in the leaves. However, after 4 h of the drought treatment, transcripts appeared in the leaves, and they reached their maximum at 24 h. In the roots, after 4 h of drought treatment, transcripts appeared, and they reached their maximum at 8 h. In the case of the high salinity stress treatment, GmOEP transcripts were detected at 4 h in leaves and gradually increased until 24 h. Similarly, in root tissues, transcripts began to appear at 1 h, reached their maximum at 4 h, and slowly decreased after that to 24 h. Thus, GmOEP transcripts such as GmIMT [22] are inducible via high salinity and drought. GmIMT transcripts accumulated only in the leaves, but GmOEP transcripts accumulated in both the roots and leaves. This suggests that Dononitol synthesis increased in leaves under drought and high
Please cite this article in press as: C.-H. Ahn, et al., Increased salt and drought tolerance by D-pinitol production in transgenic Arabidopsis thaliana, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.08.183
C.-H. Ahn et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e6
salinity stress conditions and that the D-ononitol produced is subsequently transported to the roots to synthesize D-pinitol. In this case, long distance transport of D-ononitol would occur from leaves to roots. Similar long-distance transport of D-ononitol from stems to leaves has been suggested in Vigna umbellata [33,34]. Hence, under salt and drought stress, it appears that D-pinitol accumulates in both the roots and shoots as an osmoprotectant. 3.3. Enzymatic properties of recombinant GmOEP expressed in E. coli To ascertain the biochemical properties of the recombinant GmOEP protein produced in E. coli, the ORF of GmOEP was amplified and fused to the modified pET15b (Promega, Madison, WI). The HisGmOEP fusion protein overexpressed in E. coli was purified from crude extracts using a Ni resin column (Fig. 2A). The product of the reaction in the presence of recombinant GmOEP, D-ononitol, and NADþ was analyzed by GC-FID. As shown in Fig. 2E, the D-pinitol peak increased and the D-ononitol peak decreased after incubation for 60 min at 25 C. These results demonstrated that recombinant GmOEP has ononitol epimerase enzyme activity. 3.4. Phenotypic analysis of GmOEP-overexpressing transgenic Arabidopsis Because D-pinitol can function as an osmoprotectant under high salinity and drought condition, GmOEP-overexpressing transgenic Arabidopsis plants were generated under the control of the CaMV35 promoter and were compared to wild type plants with regards to
A
tolerance to high salinity and drought conditions. A T4 transgenic line of plants that had accumulated GmOEP transcripts was chosen for the tolerance test (Fig. 3A). Wild type plants and GmOEP-overexpressing plants were subjected to water stress. These plants were grown for four weeks under normal watering condition and then grown for seven days without watering. Survival rates were determined three days after re-watering. The results revealed that 33.3% (11/33) of wild type plants survived after a re-watering treatment (Fig. 3C and E). In contrast, GmOEP-overexpressing transgenic plants were more tolerant to water stress than wild type plants were. The survival rate of the transgenic line was 67.4% (21/ 31) (Fig. 3C and E). Thus, overexpression of GmOEP conferred a marked enhancement in dehydration tolerance. Next, high salinity tolerance was investigated. The four-week-old wild type plants and GmOEP-overexpressing plants were subjected to high salinity stress. The 300 mM NaCl solution was applied once every seven days, and after 21 days, survival rates were determined. The results revealed that 3.6% (1/28) of wild type plants survived for at least 21 days after the high salinity treatment was applied (Fig. 3B and C), whereas GmOEP-overexpressing transgenic plants were more tolerant to high salinity stress than wild type plants were. The survival rate of the transgenic line was 17.2% (5/29) (Fig. 3C and E). These results suggested that GmOEP-overexpressed Arabidopsis plants were more tolerant to dehydration stress than wild type plants were. Because the gene for myo-inositol 1-phosphate synthase (INPS1), which is involved in the biosynthesis of myo-inositol from glucose phosphate, is not inducible by high salinity stress, it has been suggested that genes for IMT and OEP are missing in Arabidopsis [19]. If this suggestion was to be true, GmOEP-
B
30
3
30
Leaf-Drought Root-Drought 25
25
Leaf-Salt
20
15
10
5
0
Relative expression level of GmOEP
Relative expreesion level of GmOEP
Root-Salt 20
15
10
5
0
Fig. 1. Relative GmOEP expression pattern in the leaves and roots of soybean seedlings. GmOEP expression patterns in the leaves and roots of four-week-old soybean seedlings at 0, 1, 2, 4, 8, 12, and 24 h after drought (10% PEG) and high salinity (300 mM) treatments. Experiments were repeated three times (n ¼ 3). Error bars indicate standard error. The soybean actin gene was used as an internal control.
Please cite this article in press as: C.-H. Ahn, et al., Increased salt and drought tolerance by D-pinitol production in transgenic Arabidopsis thaliana, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.08.183
4
C.-H. Ahn et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e6
Fig. 2. SDS-PAGE of purified GmOEP and GC-FID results of GmOEP reaction in the presence of 1 mM D-ononitol. (A) 10% SDS-PAGE analysis of recombinant GmOEP produced in E. coli. Lane M, molecular weight markers; lane 1, purified 6XHis-GmOEP; lane 2, eluate obtained with washing buffer containing 80 mM imidazole; lane 3, eluate obtained with washing buffer containing 5 mM imidazole; lane 4, crude extracts from E. coli expressing GmOEP; lane 5, crude extracts from E. coli expressing only the modified pET15b vector. (B) Analysis of D-ononitol by GC-FID (retention time 7.797). (C) Analysis of D-pinitol by GC-FID (retention time 6.508). (D) Control assay reaction containing D-ononitol and NAD þ without GmOEP enzyme after 60 min incubation. The position of D-ononitol is indicated. (E) Assay reaction containing D-ononitol with purified GmOEP after 60 min incubation. The generated D-pinitol peak is indicated.
Please cite this article in press as: C.-H. Ahn, et al., Increased salt and drought tolerance by D-pinitol production in transgenic Arabidopsis thaliana, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.08.183
C.-H. Ahn et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e6
5
Fig. 3. Phenotypic analysis of GmOEP-overexpressing Arabidopsis transgenic plants under salt and drought stresses. (A) Transcript analysis of wild type (Col0) and GmOEP-overexpressing plants. (B) Survival rate of GmOEP-overexpressing transgenic Arabidopsis plants subjected to a high salinity stress treatment. (C) Survival rate of GmOEP-overexpressing transgenic Arabidopsis plants under drought stress. (D) Representative phenotype of wild type (Col0) and GmOEP transgenic plants under a high salinity stress treatment. (E) Representative phenotype of wild type (Col0) and GmOEP transgenic plants under a drought stress treatment. Error bars indicate the standard error (triplicates, n ¼ 30 each). ** indicates that the differences between transgenic and wild type plants were highly significant (p < 0.01).
overexpressing Arabidopsis plants would not be more tolerant than wild type plants because D-ononitol is present very small amount in plants [21]. Thus, it can be suggested that at least IMT in Arabidopsis is present and inducible by drought and high salinity stress treatments. Under conditions of dehydration stress, IMT was inducible and D-ononitol accumulated in Arabidopsis.
Acknowledgments This work was supported by the Technology Development Program for Food, Agriculture, Forestry, and Fisheries, in the Ministry of Agriculture, Food, and Rural Affairs, Republic of Korea.
Transparency document Transparency document related to this article can be found online at https://doi.org/10.1016/j.bbrc.2018.08.183. Appendix A. Supplementary data Supplementary data related to this article can be found at https://doi.org/10.1016/j.bbrc.2018.08.183. References [1] J.K. Zhu, Salt and drought stress signal transduction in plants, Annu. Rev. Plant
Please cite this article in press as: C.-H. Ahn, et al., Increased salt and drought tolerance by D-pinitol production in transgenic Arabidopsis thaliana, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.08.183
6
C.-H. Ahn et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e6
Biol. 53 (2002) 247e273. [2] K. Shinozaki, K. Yamaguchi-Shinozaki, M. Seki, Regulatory network of gene expression in the drought and cold stress responses, Curr. Opin. Plant Biol. 6 (2003) 410e417. [3] P.E. Verslues, T.E. Juenger, Drought, metabolites, and Arabidopsis natural variation: a promising combination for understanding adaptation to waterlimited environments, Curr. Opin. Plant Biol. 14 (2011) 240e245. [4] J. Ingram, D. Bartels, The molecular basis of dehydration tolerance in plants, Annu. Rev. Plant Biol. 47 (1996) 377e403. [5] H.J. Bohnert, D.E. Nelson, R.G. Jensen, Adaptations to environmental stresses, Plant Cell 7 (1995) 1099e1111. [6] K. Shinozaki, K. Yamaguchi-Shinozaki, Molecular responses to dehydration and low temperature: differences and cross-talk between two stress signaling pathways, Curr. Opin. Plant Biol. 3 (2000) 217e223. [7] J.M. Morgan, Osmoregulation and water stress in higher plants, Annu. Rev. Plant Biol. 35 (1984) 299e319. [8] P.H. Yancey, Water stress, osmolytes and proteins, Am. Zool. 41 (2001) 699e709. [9] D. Rontein, G. Basset, A.D. Hanson, Metabolic engineering of osmoprotectant accumulation in plants, Metab. Eng. 4 (2002) 49e56. [10] T.H. Chen, N. Murata, Enhancement of tolerance of abiotic stress by metabolic engineering of betaines and other compatible solutes, Curr. Opin. Plant Biol. 5 (2002) 250e257. [11] F. Keller, M.M. Ludlow, Carbohydrate metabolism in drought-stressed leaves of pigeon pea (Cajanus cajan), J. Exp. Bot. 44 (1993) 1351e1359. [12] J.G. Streeter, D.G. Lohnes, R.J. Fioritto, Patterns of pinitol accumulation in soybean plants and relationships to drought tolerance, Plant Cell Environ. 24 (2001) 429e438. [13] J. Gorham, E. McDonnell, R.W. Jones, Salt tolerance in the triticeae: Leymus sabulosus, J. Exp. Bot. 35 (1984) 1200e1209. [14] C. Guo, D.M. Oosterhuis, Pinitol occurrence in soybean plants as affected by temperature and plant growth regulators, J. Exp. Bot. 46 (1995) 249e253. [15] T.M. Kuo, C.A. Lowell, T.C. Nelsen, Occurrence of pinitol in developing soybean seed tissues, Phytochemistry 45 (1997) 29e35. €sslova , H. Svobodova , H. Lipavska , J. Albrechtova , D. Vreugdenhil, [16] M. Go Comparing carbohydrate status during Norway spruce seed development and somatic embryo formation, Vitro Cell Dev. Biol. Plant 37 (2001) 24e28. [17] C.I. Gomes, R.L. Obendorf, M. Horbowicz, Myo-Inositol, D-chiro-inositol, and Dpinitol synthesis, transport, and galactoside formation in soybean explants, Crop Sci. 45 (2005) 1312e1319. [18] J.G. Streeter, Carbohydrates in soybean nodules: II. Distribution of compounds
[19]
[20] [21] [22]
[23]
[24]
[25] [26] [27]
[28] [29] [30]
[31] [32] [33]
[34]
in seedlings during the onset of nitrogen fixation, Plant Physiol. 66 (1980) 471e476. M. Ishitani, A.L. Majumder, A. Bornhouser, C.B. Michalowski, R.G. Jensen, H.J. Bohnert, Coordinate transcriptional induction of myo-inositol metabolism during environmental stress, Plant J. 9 (1996) 537e548. P. Dittrich, A. Brandl, Revision of the pathway of D-pinitol formation in Leguminosae, Phytochemistry 26 (1987) 1925e1926. J.G. Streeter, Identification and distribution of ononitol in nodules of Pisum sativum and Glycine max, Phytochemistry 24 (1985) 174e176. C. Ahn, U. Park, P.B. Park, Increased salt and drought tolerance by D-ononitol production in transgenic Arabidopsis thaliana, Biochem. Biophys. Res. Commun. 415 (2011) 669e674. S. Sengupta, B. Patra, S. Ray, A.L. Majumder, Inositol methyl transferase from a halophytic wild rice, Porteresia coarctata Roxb. (Tateoka): regulation of pinitol synthesis under abiotic stress, Plant Cell Environ. 10 (2008) 1442e1459. D.M. Vernon, H.J. Bohnert, A novel methyl transferase induced by osmotic stress in the facultative halophyte Mesembryanthemum crystallinum, EMBO J. 11 (1992) 2077e2085. D.V. Phillips, A.E. Smith, Soluble carbohydrates in soybean, Can. J. Bot. 52 (1974) 2447e2452. D.V. Phillips, D.E. Dougherty, A.E. Smith, Cyclitols in soybean, J. Agric. Food Chem. 30 (1982) 456e458. J.G. Streeter, D.G. Lohnes, R.J. Fioritto, Patterns of pinitol accumulation in soybean plants and relationships to drought tolerance, Plant Cell Environ. 24 (2001) 429e438. M.J. Paul, W. Cockburn, Pinitol, a compatible solute in Mesembryanthemum crystallinum L.? J. Exp. Bot. 40 (1989) 1093e1098. D.M. Shah, R.C. Hightower, R.B. Meagher, Complete nucleotide sequence of a soybean actin gene, Proc. Natl. Acad. Sci. U.S.A. 79 (1982) 1022e1026. €sti, A. Rawat, K. Findlay, K. Roberts, G.J. Seifert, Distinct propC. Barber, J. Ro erties of the five UDP-D-glucose/UDP-D-galactose 4-epimerase isoforms of Arabidopsis thaliana, J. Biol. Chem. 25 (2006) 17276e17285. A.A. Wise, Z. Liu, A.N. Binns, Three methods for the introduction of foreign DNA into Agrobacterium, Meth. Mol. Biol. 343 (2006) 43e53. S.J. Clough, A.F. Bent, Floral dip: a simplified method for Agrobacteriummediated transformation of Arabidopsis thaliana, Plant J. 16 (1998) 735e743. W. Wanek, A. Richter, Biosynthesis and accumulation of D-ononitol in Vigna umbellata in response to drought stress, Physiol. Plantarum 101 (1997) 416e424. N. Noiraud, L. Maurousset, R. Lemoine, Transport of polyols in higher plants, Plant Physiol. Biochem. (Paris) 39 (2001) 717e728.
Please cite this article in press as: C.-H. Ahn, et al., Increased salt and drought tolerance by D-pinitol production in transgenic Arabidopsis thaliana, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.08.183
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Increased salt and drought tolerance by D-pinitol production in transgenic Arabidopsis thaliana Chul-Hyun Ahn a, 1, Md. Amir Hossain a, b, 1, Eunjeong Lee a, Bashista Kumar Kanth a, Phun Bum Park a, * a b
Department of Bioscience and Biotechnology, University of Suwon, Hwaseong, South Korea Department of Genetics and Plant Breeding, Bangladesh Agricultural University, Mymensingh, Bangladesh
a r t i c l e i n f o
a b s t r a c t
Article history: Received 23 August 2018 Accepted 28 August 2018 Available online xxx
D-ononitol epimerase (OEP) catalyzes the conversion of D-ononitol to D-pinitol, which is the last step in the biosynthetic pathway, where myo-inositol is converted to pinitol in higher plants. In this study, OEP cDNA was isolated from Glycine max (GmOEP) and was functionally characterized, which confirmed that GmOEP expression was induced by high salinity and drought stress treatments. To understand the biological function of GmOEP, transgenic Arabidopsis plants overexpressing this protein were constructed. The transgenic Arabidopsis plants displayed enhanced tolerance to high salinity and drought stress treatments. © 2018 Published by Elsevier Inc.
Keywords: D-ononitol epimerase (OEP) D-pinitol Osmoprotectants Soybean Drought tolerance Salinity tolerance
1. Introduction Abiotic stress factors, such as high salinity, low temperature, drought, flooding, heat, oxidative stress, and heavy metal toxicity, impair plant growth and development resulting in reduced crop productivity. Because higher plants are sessile, they have evolved a set of genetic and physiological mechanisms to cope with these stresses [1,2]. A number of genes expressed in plants in response to abiotic stress factors have been identified, and the physiological roles of these gene products have been elucidated in terms of stress adaptation. The gene products expressed are involved in stress transduction pathways, protein turnover, transcriptional regulation, accumulation of osmoprotectants, and detoxification of reactive oxygen species [3e6]. In particular, water stress due to drought and high salinity cause plants to make osmotic adjustments such as increasing the amount of osmoprotectants present and maintaining turgor pressure at a lower water potential status [7,8]. These osmotic adjustments maintain metabolic activity and stabilize both
Abbreviations: IMT, myo-inositol methyltransferase; OEP, ononitol epimerase; Gm, Glycine max; GC-FID, gas chromatography-flame ionization detector; qRT-PCR, quantitative real-time polymerase chain reaction. * Corresponding author. E-mail address: [email protected] (P.B. Park). 1 These authors contributed equally to the article.
proteins and the cell membranes. Hence, accumulation of osmoprotectants during drought and high salinity conditions is common in plants [9]. Osmoprotectants can be categorized into three types:1) betaines and related compounds, such as dimethylsulfoniopropionate (DMSP) and choline-O-sulfate, 2) amino acids such as proline and ectoine, and 3) polyols and sugars such as mannitol, D-ononitol, Dpinitol, and trehalose [9,10]. D-pinitol plays a role in drought and high salinity stress, heat-induced water deficits, embryo development, and nodulation (in legumes) [11e18]. D-pinitol biosynthesis (1-D-3-O-methyl chiro-inositol) begins with a glucose phosphate precursor, which is converted to myoinositol by the action of two enzymes: myo-inositol 1-phosphate synthase (INPS) and myo-inositol monophosphatase (IMP) [19]. Then, D-pinitol is synthesized from myo-inositol by a two-step conversion process [20]. In the first step, myo-inositol methyltransferase (IMT) transfers a methyl group from S-adenosyl-Lmethionine (SAM) to myo-inositol producing D-ononitol (1-D-4-Omethylmyo-inositol). In the second step, D-ononitol is then converted to D-pinitol by the action of an ononitol epimerase, and the demethylation of D-pinitol gives rise to D-chiro-inositol [19]. Dononitol is a transient intermediate and is found at very low concentrations during D-pinitol production [21]. IMT genes have been cloned from various plants, including wild rice (Oryza sativa), soybean (Glycine max), and the halophytic ice plant
https://doi.org/10.1016/j.bbrc.2018.08.183 0006-291X/© 2018 Published by Elsevier Inc.
Please cite this article in press as: C.-H. Ahn, et al., Increased salt and drought tolerance by D-pinitol production in transgenic Arabidopsis thaliana, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.08.183
2
C.-H. Ahn et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e6
(Mesembryanthemum crystallinum L.), and transcription of all IMT genes has been found to be induced by osmotic stress [22e24]. Further, overexpression of McIMT1 in tobacco and GmIMT in Arabidopsis have enabled these plants to tolerate drought and highsalinity stress [22,24]. Glycine max contains D-pinitol as a major constituent, and drought stress is known to increase in accumulation of this substance in soybeans [12,25e27]. Likewise, salt stress results in the accumulation of pinitol in M. crystallinum [28]. To our knowledge, no enzyme epimerizing D-ononitol to D-pinitol has been characterized. In this study, the full length D-ononitol epimerase (OEP) cDNA was isolated from soybean (GmOEP) using information from the EST database, and a detailed analysis of GmOEP expression following abiotic stress treatments was performed. We also present results indicating that overexpression of GmOEP in Arabidopsis increases the tolerance of this plant to both drought and high salinity. 2. Materials and methods 2.1. Plant materials and stress treatment Soybean seeds (Glycine max cv Williams 82) were soaked in 70% ethanol and rinsed with sterilized water. Seedlings were then grown in soil in a 28 C growth chamber with a 14-h-light/10-hdark photoperiod, and four-week-old soybean seedlings were subjected to drought (10% polyethylene glycol (PEG)) and high salinity (300 mM NaCl) treatments for 0,1, 2, 4, 8,12 and 24 h. 2.2. RNA isolation and qRT-PCR Total RNA was isolated from normally grown soybean seedlings and from stress-treated seedlings using Trizol reagent (Gibco-BRL, Grand Island, NY). First strand cDNAs were synthesized using 2 mg of purified total RNA, M-Mulu™ reverse transcriptase (New England Biolabs, Beverly, MA) and an oligo (dT) primer in a total final volume of 25 mL. The RT reaction was incubated at 37 C overnight. These cDNAs were used as templates for qRT-PCR performed in an Applied Biosystems StepOnePlus Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA) using Power SYBR® Green PCR Master Mix (Thermo Fisher Scientific). The gene-specific forward primer, 50 AACCTCTCCTTTCACAAGGTG 30 , and reverse primer, 50 CAATTTCAGCATCACCAGGTC-30 , designed from the G. max ononitol epimerase (GmOEP) (XP_003538128, NCBI) sequence were then used in the amplification reaction, with the soybean actin gene amplified as an internal control to quantify the relative amounts of cDNA [29]. 2.3. Overexpression, purification of recombinant GmOEP, and ononitol epimerase assay To generate constructs for GmOEP expression in E. coli, the entire open reading frame (ORF) for this gene was amplified and cloned in-frame into the Xho I and SacI sites of modified pET15b, which had a new Sac I site. This construct was transformed and expressed in the E. coli BL21 (DE3) strain. Recombinant GmOEP protein, which was predominantly expressed in the bacterial pellet fraction, was solubilized in a buffer containing 20 mM Tris-HCl, 500 mM NaCl, 5 mM imidazole, and 2 mM PMSF at a pH of 7.0 and loaded onto an Ni-NTA resin column (Qiagen, Valencia, CA) under the same denaturing conditions. The bound protein fraction was subsequently eluted with a 20 mM Tris-HCl, 500 mM NaCl, and 500 mM imidazole solution at a pH of 7.0. The purified fractions were then dialyzed through a serial dilution of imidazole from 300 mM to an imidazole-free 100 mM Tris-HCl and 100 mM NaCl buffer at a pH of 7.0 for the complete removal of imidazole. The purified GmOEP
protein was confirmed on a 10% SDS-PAGE gel. The standard epimerase reaction was performed in 100 mM Tris-HCland10 mM MgCl2 at a pH of 7.9 and contained 0.1 mM NADþat 25 C [30]. To start the reaction, 1 mM of D-ononitol was added to the prewarmed enzyme solution and incubated for 1 h. The reaction product was analyzed by GC-FID as described previously [22]. 2.4. Generation of the 35S-GmOEP construct and the transformation of Arabidopsis The full-length GmOEP cDNA was inserted into the corresponding sites of the binary vector pPZP211, and the resulting fusion construct was then transferred into Agrobacterium tumefaciens strain GV3101 by freeze/thawing [31]. Arabidopsis transformation was then achieved using the floral dip method [32]. The seeds collected from the transformed plants were selected on a Gamborg B5 plate containing 25 mg/L hygromycin to obtain independent transgenic lines, and the presence of the transgene was confirmed by PCR. Homozygous T4 lines were obtained further by self-crossing. 3. Results & discussion 3.1. Isolation of full-length ononitol epimerase (OEP) cDNA from soybeans The Soybase (http://soybase.org/EstDB/LibSearchNew.php) and NCBI EST (http://www.ncbi.nlm.nih.gov/)databases were searched to obtain the drought-inducible epimerase in soybean, which was found in G. max (accession number XP_003538128). The ORF of this putative GmOEP was 1167 bp in length encoding 388 amino acids. Upon sequence analysis, it was found that GmOEP did not contain any signal peptides but did have an NAD binding domain, homodimer interface, and substrate binding sites. Its theoretical molecular weight was about 43 kDa and its pI value was 6.64. A comparison of this putative GmOEP amino acid sequence with that of other plant epimerases revealed that this putative GmOEP sequence shared 82% identity with Arabidopsis (NP_192834), 82% with rice (XP_015640233), and 81% with maize (NP_001105229). The NAD and substrate binding sites were nearly conserved (Supplementary Fig. 1). 3.2. GmOEP transcripts are both salt and drought inducible To analyze the expression level of GmOEP, qRT-PCR was performed using total RNA prepared from high salinity and drought stressed soybean leaves and roots. The four-week-old soybean seedlings were subjected to 300 mM NaCl (salinity stress) and 10% PEG (drought stress). After drought and salinity stress treatments, total RNA samples were prepared from leaf and root tissues at different time intervals, and relative GmOEP expression patterns were examined (Fig. 1). Due to the drought stress treatment, there were no detectable transcripts for up to 2 h in the leaves. However, after 4 h of the drought treatment, transcripts appeared in the leaves, and they reached their maximum at 24 h. In the roots, after 4 h of drought treatment, transcripts appeared, and they reached their maximum at 8 h. In the case of the high salinity stress treatment, GmOEP transcripts were detected at 4 h in leaves and gradually increased until 24 h. Similarly, in root tissues, transcripts began to appear at 1 h, reached their maximum at 4 h, and slowly decreased after that to 24 h. Thus, GmOEP transcripts such as GmIMT [22] are inducible via high salinity and drought. GmIMT transcripts accumulated only in the leaves, but GmOEP transcripts accumulated in both the roots and leaves. This suggests that Dononitol synthesis increased in leaves under drought and high
Please cite this article in press as: C.-H. Ahn, et al., Increased salt and drought tolerance by D-pinitol production in transgenic Arabidopsis thaliana, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.08.183
C.-H. Ahn et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e6
salinity stress conditions and that the D-ononitol produced is subsequently transported to the roots to synthesize D-pinitol. In this case, long distance transport of D-ononitol would occur from leaves to roots. Similar long-distance transport of D-ononitol from stems to leaves has been suggested in Vigna umbellata [33,34]. Hence, under salt and drought stress, it appears that D-pinitol accumulates in both the roots and shoots as an osmoprotectant. 3.3. Enzymatic properties of recombinant GmOEP expressed in E. coli To ascertain the biochemical properties of the recombinant GmOEP protein produced in E. coli, the ORF of GmOEP was amplified and fused to the modified pET15b (Promega, Madison, WI). The HisGmOEP fusion protein overexpressed in E. coli was purified from crude extracts using a Ni resin column (Fig. 2A). The product of the reaction in the presence of recombinant GmOEP, D-ononitol, and NADþ was analyzed by GC-FID. As shown in Fig. 2E, the D-pinitol peak increased and the D-ononitol peak decreased after incubation for 60 min at 25 C. These results demonstrated that recombinant GmOEP has ononitol epimerase enzyme activity. 3.4. Phenotypic analysis of GmOEP-overexpressing transgenic Arabidopsis Because D-pinitol can function as an osmoprotectant under high salinity and drought condition, GmOEP-overexpressing transgenic Arabidopsis plants were generated under the control of the CaMV35 promoter and were compared to wild type plants with regards to
A
tolerance to high salinity and drought conditions. A T4 transgenic line of plants that had accumulated GmOEP transcripts was chosen for the tolerance test (Fig. 3A). Wild type plants and GmOEP-overexpressing plants were subjected to water stress. These plants were grown for four weeks under normal watering condition and then grown for seven days without watering. Survival rates were determined three days after re-watering. The results revealed that 33.3% (11/33) of wild type plants survived after a re-watering treatment (Fig. 3C and E). In contrast, GmOEP-overexpressing transgenic plants were more tolerant to water stress than wild type plants were. The survival rate of the transgenic line was 67.4% (21/ 31) (Fig. 3C and E). Thus, overexpression of GmOEP conferred a marked enhancement in dehydration tolerance. Next, high salinity tolerance was investigated. The four-week-old wild type plants and GmOEP-overexpressing plants were subjected to high salinity stress. The 300 mM NaCl solution was applied once every seven days, and after 21 days, survival rates were determined. The results revealed that 3.6% (1/28) of wild type plants survived for at least 21 days after the high salinity treatment was applied (Fig. 3B and C), whereas GmOEP-overexpressing transgenic plants were more tolerant to high salinity stress than wild type plants were. The survival rate of the transgenic line was 17.2% (5/29) (Fig. 3C and E). These results suggested that GmOEP-overexpressed Arabidopsis plants were more tolerant to dehydration stress than wild type plants were. Because the gene for myo-inositol 1-phosphate synthase (INPS1), which is involved in the biosynthesis of myo-inositol from glucose phosphate, is not inducible by high salinity stress, it has been suggested that genes for IMT and OEP are missing in Arabidopsis [19]. If this suggestion was to be true, GmOEP-
B
30
3
30
Leaf-Drought Root-Drought 25
25
Leaf-Salt
20
15
10
5
0
Relative expression level of GmOEP
Relative expreesion level of GmOEP
Root-Salt 20
15
10
5
0
Fig. 1. Relative GmOEP expression pattern in the leaves and roots of soybean seedlings. GmOEP expression patterns in the leaves and roots of four-week-old soybean seedlings at 0, 1, 2, 4, 8, 12, and 24 h after drought (10% PEG) and high salinity (300 mM) treatments. Experiments were repeated three times (n ¼ 3). Error bars indicate standard error. The soybean actin gene was used as an internal control.
Please cite this article in press as: C.-H. Ahn, et al., Increased salt and drought tolerance by D-pinitol production in transgenic Arabidopsis thaliana, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.08.183
4
C.-H. Ahn et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e6
Fig. 2. SDS-PAGE of purified GmOEP and GC-FID results of GmOEP reaction in the presence of 1 mM D-ononitol. (A) 10% SDS-PAGE analysis of recombinant GmOEP produced in E. coli. Lane M, molecular weight markers; lane 1, purified 6XHis-GmOEP; lane 2, eluate obtained with washing buffer containing 80 mM imidazole; lane 3, eluate obtained with washing buffer containing 5 mM imidazole; lane 4, crude extracts from E. coli expressing GmOEP; lane 5, crude extracts from E. coli expressing only the modified pET15b vector. (B) Analysis of D-ononitol by GC-FID (retention time 7.797). (C) Analysis of D-pinitol by GC-FID (retention time 6.508). (D) Control assay reaction containing D-ononitol and NAD þ without GmOEP enzyme after 60 min incubation. The position of D-ononitol is indicated. (E) Assay reaction containing D-ononitol with purified GmOEP after 60 min incubation. The generated D-pinitol peak is indicated.
Please cite this article in press as: C.-H. Ahn, et al., Increased salt and drought tolerance by D-pinitol production in transgenic Arabidopsis thaliana, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.08.183
C.-H. Ahn et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e6
5
Fig. 3. Phenotypic analysis of GmOEP-overexpressing Arabidopsis transgenic plants under salt and drought stresses. (A) Transcript analysis of wild type (Col0) and GmOEP-overexpressing plants. (B) Survival rate of GmOEP-overexpressing transgenic Arabidopsis plants subjected to a high salinity stress treatment. (C) Survival rate of GmOEP-overexpressing transgenic Arabidopsis plants under drought stress. (D) Representative phenotype of wild type (Col0) and GmOEP transgenic plants under a high salinity stress treatment. (E) Representative phenotype of wild type (Col0) and GmOEP transgenic plants under a drought stress treatment. Error bars indicate the standard error (triplicates, n ¼ 30 each). ** indicates that the differences between transgenic and wild type plants were highly significant (p < 0.01).
overexpressing Arabidopsis plants would not be more tolerant than wild type plants because D-ononitol is present very small amount in plants [21]. Thus, it can be suggested that at least IMT in Arabidopsis is present and inducible by drought and high salinity stress treatments. Under conditions of dehydration stress, IMT was inducible and D-ononitol accumulated in Arabidopsis.
Acknowledgments This work was supported by the Technology Development Program for Food, Agriculture, Forestry, and Fisheries, in the Ministry of Agriculture, Food, and Rural Affairs, Republic of Korea.
Transparency document Transparency document related to this article can be found online at https://doi.org/10.1016/j.bbrc.2018.08.183. Appendix A. Supplementary data Supplementary data related to this article can be found at https://doi.org/10.1016/j.bbrc.2018.08.183. References [1] J.K. Zhu, Salt and drought stress signal transduction in plants, Annu. Rev. Plant
Please cite this article in press as: C.-H. Ahn, et al., Increased salt and drought tolerance by D-pinitol production in transgenic Arabidopsis thaliana, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.08.183
6
C.-H. Ahn et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e6
Biol. 53 (2002) 247e273. [2] K. Shinozaki, K. Yamaguchi-Shinozaki, M. Seki, Regulatory network of gene expression in the drought and cold stress responses, Curr. Opin. Plant Biol. 6 (2003) 410e417. [3] P.E. Verslues, T.E. Juenger, Drought, metabolites, and Arabidopsis natural variation: a promising combination for understanding adaptation to waterlimited environments, Curr. Opin. Plant Biol. 14 (2011) 240e245. [4] J. Ingram, D. Bartels, The molecular basis of dehydration tolerance in plants, Annu. Rev. Plant Biol. 47 (1996) 377e403. [5] H.J. Bohnert, D.E. Nelson, R.G. Jensen, Adaptations to environmental stresses, Plant Cell 7 (1995) 1099e1111. [6] K. Shinozaki, K. Yamaguchi-Shinozaki, Molecular responses to dehydration and low temperature: differences and cross-talk between two stress signaling pathways, Curr. Opin. Plant Biol. 3 (2000) 217e223. [7] J.M. Morgan, Osmoregulation and water stress in higher plants, Annu. Rev. Plant Biol. 35 (1984) 299e319. [8] P.H. Yancey, Water stress, osmolytes and proteins, Am. Zool. 41 (2001) 699e709. [9] D. Rontein, G. Basset, A.D. Hanson, Metabolic engineering of osmoprotectant accumulation in plants, Metab. Eng. 4 (2002) 49e56. [10] T.H. Chen, N. Murata, Enhancement of tolerance of abiotic stress by metabolic engineering of betaines and other compatible solutes, Curr. Opin. Plant Biol. 5 (2002) 250e257. [11] F. Keller, M.M. Ludlow, Carbohydrate metabolism in drought-stressed leaves of pigeon pea (Cajanus cajan), J. Exp. Bot. 44 (1993) 1351e1359. [12] J.G. Streeter, D.G. Lohnes, R.J. Fioritto, Patterns of pinitol accumulation in soybean plants and relationships to drought tolerance, Plant Cell Environ. 24 (2001) 429e438. [13] J. Gorham, E. McDonnell, R.W. Jones, Salt tolerance in the triticeae: Leymus sabulosus, J. Exp. Bot. 35 (1984) 1200e1209. [14] C. Guo, D.M. Oosterhuis, Pinitol occurrence in soybean plants as affected by temperature and plant growth regulators, J. Exp. Bot. 46 (1995) 249e253. [15] T.M. Kuo, C.A. Lowell, T.C. Nelsen, Occurrence of pinitol in developing soybean seed tissues, Phytochemistry 45 (1997) 29e35. €sslova , H. Svobodova , H. Lipavska , J. Albrechtova , D. Vreugdenhil, [16] M. Go Comparing carbohydrate status during Norway spruce seed development and somatic embryo formation, Vitro Cell Dev. Biol. Plant 37 (2001) 24e28. [17] C.I. Gomes, R.L. Obendorf, M. Horbowicz, Myo-Inositol, D-chiro-inositol, and Dpinitol synthesis, transport, and galactoside formation in soybean explants, Crop Sci. 45 (2005) 1312e1319. [18] J.G. Streeter, Carbohydrates in soybean nodules: II. Distribution of compounds
[19]
[20] [21] [22]
[23]
[24]
[25] [26] [27]
[28] [29] [30]
[31] [32] [33]
[34]
in seedlings during the onset of nitrogen fixation, Plant Physiol. 66 (1980) 471e476. M. Ishitani, A.L. Majumder, A. Bornhouser, C.B. Michalowski, R.G. Jensen, H.J. Bohnert, Coordinate transcriptional induction of myo-inositol metabolism during environmental stress, Plant J. 9 (1996) 537e548. P. Dittrich, A. Brandl, Revision of the pathway of D-pinitol formation in Leguminosae, Phytochemistry 26 (1987) 1925e1926. J.G. Streeter, Identification and distribution of ononitol in nodules of Pisum sativum and Glycine max, Phytochemistry 24 (1985) 174e176. C. Ahn, U. Park, P.B. Park, Increased salt and drought tolerance by D-ononitol production in transgenic Arabidopsis thaliana, Biochem. Biophys. Res. Commun. 415 (2011) 669e674. S. Sengupta, B. Patra, S. Ray, A.L. Majumder, Inositol methyl transferase from a halophytic wild rice, Porteresia coarctata Roxb. (Tateoka): regulation of pinitol synthesis under abiotic stress, Plant Cell Environ. 10 (2008) 1442e1459. D.M. Vernon, H.J. Bohnert, A novel methyl transferase induced by osmotic stress in the facultative halophyte Mesembryanthemum crystallinum, EMBO J. 11 (1992) 2077e2085. D.V. Phillips, A.E. Smith, Soluble carbohydrates in soybean, Can. J. Bot. 52 (1974) 2447e2452. D.V. Phillips, D.E. Dougherty, A.E. Smith, Cyclitols in soybean, J. Agric. Food Chem. 30 (1982) 456e458. J.G. Streeter, D.G. Lohnes, R.J. Fioritto, Patterns of pinitol accumulation in soybean plants and relationships to drought tolerance, Plant Cell Environ. 24 (2001) 429e438. M.J. Paul, W. Cockburn, Pinitol, a compatible solute in Mesembryanthemum crystallinum L.? J. Exp. Bot. 40 (1989) 1093e1098. D.M. Shah, R.C. Hightower, R.B. Meagher, Complete nucleotide sequence of a soybean actin gene, Proc. Natl. Acad. Sci. U.S.A. 79 (1982) 1022e1026. €sti, A. Rawat, K. Findlay, K. Roberts, G.J. Seifert, Distinct propC. Barber, J. Ro erties of the five UDP-D-glucose/UDP-D-galactose 4-epimerase isoforms of Arabidopsis thaliana, J. Biol. Chem. 25 (2006) 17276e17285. A.A. Wise, Z. Liu, A.N. Binns, Three methods for the introduction of foreign DNA into Agrobacterium, Meth. Mol. Biol. 343 (2006) 43e53. S.J. Clough, A.F. Bent, Floral dip: a simplified method for Agrobacteriummediated transformation of Arabidopsis thaliana, Plant J. 16 (1998) 735e743. W. Wanek, A. Richter, Biosynthesis and accumulation of D-ononitol in Vigna umbellata in response to drought stress, Physiol. Plantarum 101 (1997) 416e424. N. Noiraud, L. Maurousset, R. Lemoine, Transport of polyols in higher plants, Plant Physiol. Biochem. (Paris) 39 (2001) 717e728.
Please cite this article in press as: C.-H. Ahn, et al., Increased salt and drought tolerance by D-pinitol production in transgenic Arabidopsis thaliana, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/j.bbrc.2018.08.183