- Email: [email protected]
Indigenous plasmids of Bacillus megaterium WSH-002 involved in mutualism with Ketogulonicigenium vulgare WSH-001
Plasmid 70 (2013) 240–246
Contents lists available at SciVerse ScienceDirect
Plasmid journal homepage: www.elsevier.com/locate/yplas
Indigenous plasmids of Bacillus megaterium WSH-002 involved in mutualism with Ketogulonicigenium vulgare WSH-001 Jingwen Zhou a, Qiaoshuang Zheng a, Jie Liu b, Guocheng Du a,⇑, Jian Chen a,⇑ a b
School of Biotechnology and Key Laboratory of Industrial Biotechnology, Ministry of Education, Jiangnan University, 1800 Lihu Road, Wuxi, Jiangsu 214122, China Jiangsu Jiangshan Pharmaceutical Co. Ltd., Jingjiang 214500, China
a r t i c l e
i n f o
Article history: Received 17 December 2012 Accepted 9 May 2013 Available online 18 May 2013 Communicated by Dr. G.J. Phillips Keywords: Symbiosis Vitamin C L-ascorbic acid Plasmid elimination 2-Keto-L-gulonic acid
a b s t r a c t In the two-step vitamin C fermentation process, the precursor 2-keto-L-gulonic acid (2KLG) was synthesized using a mixed culture of Ketogulonicigenium vulgare WSH-001 and Bacillus megaterium WSH-002, which contained three plasmids, pBME1, pBME2 and pBME3. The cell growth of B. megaterium was not affected by the elimination of these plasmids. However, elimination of pBME2 and pBME3 significantly affected L-sorbose uptake and 2-KLG production. Sequence analysis of the plasmids showed that many of the pBME2 and pBME3 genes were of unknown function or could not be assigned to a specific metabolic pathway. The current work showed that the indigenous plasmids pBME2 and pBME3 of B. megaterium WSH-002 involved in mutualism with K. vulgare WSH-001. The results provided a promising new route to further demonstrate the mutualism process between the two bacteria. Ó 2013 Published by Elsevier Inc.
1. Introduction Widespread microorganisms and diverse microbial communities in biosphere play essential roles in materials circulation and species diversity. Diverse interactions between microorganisms are ubiquitous in microbial ecosystems, from simple ones contain only two strains to rather complex systems such as symbiotic human gut flora and sewage microbial flora (Raes and Bork, 2008). It was important for biologist to understand the interactions among different microorganisms at the molecular level for the further regulation or utilization of these systems (Raes and Bork, 2008). Vitamin C is a water-soluble vitamin that plays crucial roles in the health of human beings (Oguntibeju, 2008). Due to its antioxidant properties and biological functions, ⇑ Corresponding authors. Address: School of Biotechnology, Jiangnan University, 1800 Lihu Road, Wuxi, Jiangsu 214122, China. Fax: +86 510 85918309 (G. Du). E-mail addresses: [email protected] (G. Du), [email protected] (J. Chen). 0147-619X/$ - see front matter Ó 2013 Published by Elsevier Inc. http://dx.doi.org/10.1016/j.plasmid.2013.05.001
vitamin C has applications in many different fields, such as clinical medicine and the beverage, food and cosmetic industries (Marti et al., 2009; Wintergerst et al., 2006). A natural microbial consortium composed by Bacillus megaterium and Ketogulonigenium vulgare is widely used in vitamin C biosynthesis industry (Yan et al., 2006). The symbiotic system transforms L-sorbose to 2-keto-L-gulonic acid (2-KLG, the direct precursor of vitamin C) by coculturing B. megaterium and K. vulgare (Smirnoff, 2001). In the mixed culture fermentation process consisting of B. megaterium and K. vulgare, only K. vulgare is responsible for 2-KLG production, whereas B. megaterium, as a companion bacterium, does not directly yield any 2-KLG (Zhang et al., 2011). As a typical microbial symbiotic model as well as a core process of vitamin C biosynthesis industry, numerous studies were performed to elucidate the mechanism by means of different routes. Previous studies had shown that B. megaterium significantly stimulated K. vulgare propagation and 2-KLG production in the co-culture system (Lu et al., 2001; Zhang et al., 2010). The genomic sequencing provided total molecular parts list of the community and facilitated researchers to find out
241
J. Zhou et al. / Plasmid 70 (2013) 240–246
metabolic pathway gaps of K. vulgare (Liu et al., 2011a; Raes and Bork, 2008). The proteomic and metabolomic based researches (Ma et al., 2011; Zhou et al., 2011) revealed the metabolic cooperation relationship and inferred that sporulation of B. megaterium plays important roles in metabolic cooperation between two bacteria. Our previous works showed that K. vulgare cell propagation in fermentation medium was associated with spore stability as well as sporulation process of B. megaterium (Zhu et al., 2012). However, these efforts have yielded no definite conclusion on the mutualism mechanisms in terms of how B. megaterium promotes the growth and 2-KLG-producing capability induced in K. vulgare by the fermentation system. B. megaterium is a gram-positive spore-forming bacterium that is the object of study in many laboratories because of its interesting biochemical reactions and high capacity for exo-enzyme production (Eppinger et al., 2011; Vary et al., 2007). Plasmids in Bacillus and grampositive bacteria usually carry genes involved in virulence, metabolism, degradation of toxic compounds, antibiotic activity, heavy metal resistance and their own transfer among species or genera (Akhtar et al., 2009; Lioy et al., 2010). Most B. megaterium strains contain multiple indigenous plasmids, but many plasmids are cryptic in nature and only a few plasmid genes are known (Tao et al., 1992). As a widely investigated protein expression system, most of the indegenous plasmids of the B. megaterium wild type strains were eliminated to allow them to express heterologous proteins without significantly changing the phenotype of the strains (Tao et al., 1992). B. megaterium WSH-002 is an industrial strain provided by Jiangsu Jiangshan Pharmaceutical Co., Ltd. Genome sequencing of the strain revealed that it contained three indigenous plasmids, pBME1, pBME2 and pBME3, with sizes of 74.6 kb, 9.7 kb and 7 kb, respectively (Liu et al., 2011c). In this study, in order to understand the influence of indegenous plasmids on the mutualisms process, the indigenous plasmids in an industrial strain, B. megaterium WSH-002, were eliminated. Three different plasmid-cured B. megaterium derivatives were obtained by progressive heating and sodium dodecyl sulfate (SDS) co-treatment as well as acridine orange (AO) treatment. The resultant strains were used to investigate the effects of indigenous plasmids on the mutualism process and 2-KLG production of the two strains.
2. Materials and methods 2.1. Microorganisms B. megaterium WSH-002 and K. vulgare WSH-001 used in this study were obtained from Jiangsu Jiangshan Pharmaceutical Co., Ltd. (Jingjiang, Jiangsu, China) (Zhu et al., 2012) (Table 1). 2.2. Culture conditions The composition of the seed medium of the mixed culture (medium A) was (per litre): 20 g L-sorbose, 3 g yeast extract, 10 g peptone, 3 g beef extract, 1.5 g corn steep liquor, 1 g urea, 0.2 g MgSO4, 1 g KH2PO4, 1 g CaCO3 and tap water. The medium for B. megaterium culture was Luria–Bertani (LB). Two percent agar was added to medium A/ LB for slant culture and isolation culture. The fermentation medium of the mixed culture (medium B) consisted of (per litre): 80 g L-sorbose, 5 g corn steep liquor, 12 g urea, 0.1 g MgSO4, 1 g KH2PO4, 5 g CaCO3 and tap water. L-Sorbose and CaCO3 were sterilized separately with other components. The initial pH values of all media were adjusted to 6.7 before sterilization at 121 °C for 15 min (Zhu et al., 2012). 2.3. Elimination of plasmids in B. megaterium WSH-002 Three different methods were used for plasmid elimination because of the different stabilities of the indigenous plasmids. (1) LB media with concentrations of SDS from 0.004% to 0.04% were inoculated with a stationary-phase culture of B. megaterium grown in LB medium. After shaking at 30 °C for 10 h, the sublethal concentration of SDS was determined by plating the samples on LB media agar without SDS. (2) A 10-h culture of B. megaterium in LB medium was used to inoculate fresh LB medium with a 0.4% inoculum, and incubated for 10 h at 34 °C, after which the cell growth was checked by plating the culture on LB medium agar followed by 10 h incubation at normal temperature (30 °C). At the same time, this culture was subcultured into the same medium and incubated at 38 °C. These steps were repeated with heating at progressively higher temperatures (3–4 °C each time) until only 10–20 single colonies were grown on the plate. Then, the culture cultivated at this temperature was sub-cultured (0.8% inoculum) into fresh medium and incubated at 30 °C for proliferation. Finally, the proliferation culture was trans-
Table 1 Strains and mixed cultures used in this study. Strain
Description
Source
K. vulgare D0 D1 D13 D123 H0 H1 H13 H123
K. vulgare WSH-001, wild-type B. megaterium WSH-002, wild-type B. megaterium without pBME1 B. megaterium without pBME1 and pBME3 B. megaterium without any plasmids Mixed culture of D0 and K. vulgare Mixed culture of D1 and K. vulgare Mixed culture of D13 and K. vulgare Mixed culture of D123 and K. vulgare
Liu et al. (2011b) Liu et al. (2011c) This study This study This study Zhang et al. (2011) This study This study This study
242
J. Zhou et al. / Plasmid 70 (2013) 240–246 Table 2 Primers used for the detection of indigenous plasmids.a
a
Primer
Sequences (50 –30 )
Product size (bp)
Usage
pBME1-F pBME1-R pBME2-F pBME2-R pBME3-F pBME3-R
CCGTGTAAGCAGCCGAGAT ACAAGGGTTGGTGCGTCAT GGGGTCACTCAATCCGTTTA TTGCTTGCGGTATGTCTGG TCAATCCTGGCAAACCTACC AGAATGAGCCTGAGCCTAAGAA
1950
Detection of pBME1
2277
Detection of pBME2
2162
Detection of pBME3
The underlined nucleotides in bold are the corresponding restriction enzyme recognition sites.
ferred into LB medium containing the sublethal concentration of SDS with a 0.4% inoculum. After incubation at 30 °C for 10 h, the culture was plated on LB media with agar without SDS, following which about 20 individual colonies were randomly picked up from the plates for plasmid tests. (3) After 10 h, an exponentially growing culture of B. megaterium was treated with AO as previously reported by Keyhani et al. (2006). The resulting single colonies were picked up for plasmids tests.
The seed culture of the mixture of K. vulgare and B. megaterium was cultivated at 30 °C and 200 rpm in a 750-mL flask containing 75 mL medium A on a rotary shaker for 18 h. The fermentation cultures were performed in 750-mL flasks charged with 75 mL medium B and incubated at 30 °C and 200 rpm for 72 h; the inoculum amount was 10% (v/v). All biological experiments were done in triplicate. 2.6. L-Sorbose and 2-KLG assays
2.4. Plasmid DNA extraction and analysis Individual colonies obtained through the above steps were then inoculated into fresh LB media without any elimination agents for proliferation at normal temperature. Plasmids were extracted with EZ-10 Spin Column Plasmid DNA Minipreps Kit (Sangon, Shanghai, China). Lysozyme at 10 lg/mL was added to the cell pellets to enhance the cell lysis process. Specific DNA fragments of the three plasmids of B. megaterium were PCR amplified for plasmid detection with the primers (Table 2) designed by Primer Premier 5 (PREMIER Biosoft, Palo Alto, CA) according to the whole plasmid nucleotide sequence. Positive control were performed with the wild type strain B. megaterium WSH-002 with all of the indigenous plasmids. Negative controls were performed with the purified genomic DNA of B. megaterium MS941 (Yang et al., 2007), which is the Dnpr of the B. megaterium DSM319 without indigenous plasmids for the genome sequence results of the two strains are highly similar (Eppinger et al., 2011). PCR products were electrophoresed on 1% (w/v) agarose gels to verify the existence of the corresponding plasmid DNA (Ruan and Xu, 2007). 2.5. Preparation of the mixed culture of K. vulgare and B. megaterium A single strain was inoculated on the isolating plates through plate streaking and incubated at 30 °C for 10 h (B. megaterium) or 36 h (K. vulgare). 20–30 individual colonies of K. vulgare on the isolating plates were transferred to 3 mL sterilized water and co-suspended with a minute quantity of B. megaterium cells picked up by a toothpick. Then, 200 lL of suspension was spread on a fresh slant and cultivated at 30 °C for 36 h (Yan et al., 2006). The mixed culture grown on the slant was finally washed with 10 mL sterilized physiological saline (0.90% w/v of NaCl), and 200 lL of the suspension of the mixed culture was transferred to medium A for seed culture.
2-KLG and L-sorbose concentrations were measured by HPLC using an Aminex HPX-87H column (Bio-Rad, Herculas, CA) at 35 °C with a flow rate of 0.6 mL/min and 0.0275% (v/v) H2SO4 as the eluent (Urbance et al., 2001). Bacterial growth was monitored by measuring optical density at 650 nm (OD650) after dissolving the calcium carbonate in the medium by adding a suitable amount of 2 mol/L HCl. 2.7. Bioinformatics analysis Identification of open reading frames (ORFs) and homology searches utilized the BLAST series of programs provided by the National Center for Biotechnology Information (http://www.ncbi.nih.gov/) (Altschul et al., 1990) and Gene Mark HMM (http://opal.biology.gatech.edu/ GeneMark/hmmchoice.html) (Azad and Borodovsky, 2004). The annotation results were given in the Supplementary File (Table S1). 3. Results and discussion 3.1. Plasmid elimination and confirmation In order to investigate 2-KLG production using the mixed culture of K. vulgare and B. megaterium, it was important to know whether any of the plasmids of B. megaterium could affect 2-KLG production. The parent B. megaterium WSH-002 with all three indigenous plasmids (D0) was sub-cultured by gradually increasing the culture temperature. The growth rate significantly decreased when the temperature was set to 40 °C and above. No growth was observed when the temperature surpassed 48 °C. Therefore, the proliferation culture of the broth treated at 48 °C was transferred into LB medium containing the sub-lethal concentration of SDS (0.014%). After treatment, the culture was plated on LB agar plates. 200 single colo-
J. Zhou et al. / Plasmid 70 (2013) 240–246
nies were tested by PCR for the existence of the plasmids by the corresponding primer pairs (Table 2). To ensure that this procedure resulted in permanently curing rather than decreasing the copy number, the plasmids of the derived strains were extracted and further confirmed by PCR detection after streaking for an extra three times on LB plates. Then, the PCR products were examined on 1% (w/v) agarose gels with the parent strain’s plasmids used as the control throughout the plasmid extraction and PCR amplification process. After several treatments of the cells by different methods, two derivative strains with plasmids pBME1 and pBME1/pBME3 missing were obtained and named D1 and D13, respectively (Fig. 1). To eliminate plasmid pBME2, strain D13 was further treated by AO. The effect of AO on the cell growth of B. megaterium was first tested. When the concentration of AO was more than 100 lg/mL, B. megaterium could not grow. After one sub-culture in the presence of 100 lg/mL AO, the samples were plated on LB agar plates, and 100 individual colonies from these plates were picked up and tested for plasmid pBME2 using the same method as described above. The strain that had lost all three plasmids was named D123. Strain D123 was also further confirmed by PCR detection after streaking for three generations (Fig. 1).
243
A
B
3.2. Growth of the different plasmid-cured B. megaterium derivatives The growth patterns of the strains D0, D1, D13 and D123 were examined to determine their growth phenotypes (Fig. 2). All of the strains had the same lag time and all could achieve an OD650 nm of 0.7–0.8 after culture for 10 h in LB media. Furthermore, after 15 h incubation, the three derivatives began to form spores as did the parent strain, D0. In addition, the colony morphologies of the three derivatives were also investigated (Fig. 3). Interestingly, there was no change in colony morphology although many genes had been removed from the cells along with the indigenous plasmids. These results indicated that D1, D13 and D123 had the same substantial growth characteristics as D0, from which they were derived under the condition we tested. This suggested that the indigenous plasmids were not essential for the growth of B. megaterium in the culture media tested. This result was similar to a previous report about plasmid elimination in B. megaterium QM B1551 (Sussman et al., 1988). 3.3. 2-KLG production of the different B. megaterium WSH002 derivatives The three different B. megaterium WSH-002 derivatives (D1, D13 and D123) and the parent strain (D0) were collocated with K. vulgare WSH-001. The corresponding mixed cultures were named H1, H13, H123 and H0, respectively. No significant differences in 2-KLG production or L-sorbose consumption were detected between H1 and H0 (Fig. 4). However, the yields of 2-KLG produced by H13 (53.3 g/L) and H123 (45.2 g/L) had decreased by 24.8% and 36.2%, respectively, compared to H0. At the same time, the con-
C
Fig. 1. PCR confirmation of plasmid elimination. (A) Elimination of pBME1. M, DL2000 DNA Marker; lanes 1, 2, 3, negative control; lanes 4, 5, 6, PCR products amplified from the plasmids of the parent strain D0 by primer pairs DFR1-F/R, DFR2-F/R, DFR3-F/R, respectively; lanes 7, 8, 9, PCR product amplified from the plasmids of D1 strain by primer pairs DFR1-F/R, DFR2-F/R and DFR3-F/R, respectively. (B) Elimination of pBME1 and pBME3. M, DL2000 DNA Marker; lanes 1, 2, 3, negative control; lanes 4, 5, 6, PCR product amplified from the plasmids of the parent strain D0 by primers DFR1-F/R, DFR2-F/R, DFR3-F/R, respectively; lanes 7, 8, 9, PCR product amplified from the plasmids of D13 strain by primer pairs DFR1F/R, DFR2-F/R, DFR3-F/R, respectively. (C) Elimination of all of the plasmids. M, DL2000 DNA Marker; lanes 1, 2, 3, negative control; lanes 4, 5, 6, PCR product amplified from the plasmids of the parent strain D0 by primer pairs DFR1, DFR2, DFR3, respectively; lanes 7, 8, 9, PCR product amplified from the plasmids of D123 strain by primer pairs DFR1-F/R, DFR2-F/R, DFR3-F/R, respectively.
sumptions of L-sorbose decreased by 13.7% and 24.1%, respectively.
244
J. Zhou et al. / Plasmid 70 (2013) 240–246
Fig. 2. Growth curves of the different plasmid-cured B. megaterium derivatives. Blank squares: D0; solid circles: D1; solid squares: D13; solid triangles: D123 (Table 1).
Considering that the elimination of the plasmids did not affect the cell growth (Fig. 2), these results showed that lower 2-KLG production was not caused by the lack of sufficient B. megaterium biomass. The results also showed that the plasmids pBME2 and pBME3 of B. megaterium may affect the mutualism process whereas the plasmid pBME1 had no effect on it. Therefore, it could be concluded that some genes encoding essential components for promoting the production of 2-KLG by K. vulgare may located on the plasmid pBME2 and/or pBME3. 3.4. Sequence analysis of the three plasmids B. megaterium WSH-002 was sequenced and found to harbor three plasmids, pBME1, pBME2 and pBME3 (Liu
et al., 2011c) (Table 3). The sizes of pBME1 (GenBank accession No.: NC_017139.1), pBME2 (GenBank accession No.: NC_017140.1) and pBME3 (GenBank accession No.: NC_017141.1) are 74,163 bp, 9699 bp and 7006 bp, with a G + C content of 36%, 32.22% and 33.21%, respectively. The three plasmids harbored 69, 11 and 14 putative ORFs. Of all the ORFs, 9 ORFs had no homology to any proteins in GenBank, and 36 ORFs possessed similarity to proteins of unknown functions. In addition, pBME1 was found to contain a rRNA operon. The results of a computer analysis of the predicted ORFs and their closest relatives are shown in Table 3. Some of the ORFs are known for the function of plasmid replication, such as ORF20 of pBME1, ORF4 of pBME2, and ORF14 of pBME3. A majority of the ORFs on pBME1 were found to correspond to several encoded products similar to the hypothetical proteins of unknown function on the plasmids of B. megaterium QM B1551. Other gene products encoded by pBME1 included glycosyl transferase (ORF 35, 44, 47, 48, 49, 51, 53), spore coat protein (ORF 24, 40, 41, 42), peptidase (ORF 25, 55, 60) and dehydratase (ORF 54, 57, 58). Since elimination of the pBME1 did not significantly affected the mutualism process, the metabolic pathways or cell signal transduction processes associated with the genes in pBME1 should not involved in facilitating the cell growth or 2-KLG production by K. vulgare. Since elimination of pBME2 and pBME3 could affect the mutualism process, the genes on these two plasmids may involved in some pathways or functions associated with the process. The ORFs with known functions on pBME2 and pBME3 could be mainly divided into three groups: (1) Transcriptional regulators, such as ORF9 on pBME2, ORF6 on pBME3; (2) Redox related proteins, such as ORF1 on pBME2, ORF5 and ORF7 on pBME3. ORF1 on pBME2 encoded a putative thioredoxin, which plays an
A
B
C
D
Fig. 3. Colony morphologies of the different B. megaterium derivatives. (A) The parent strain D0; (B) D1; (C) D13; (D) D123.
245
J. Zhou et al. / Plasmid 70 (2013) 240–246
L-Sorbose (g/L)
A
80 60 40 20 0
0
20
40
60
80
60
80
Time (h) B
80
2-KLG (g/L)
60 40 20 0
0
20
40
Time (h)
Fig. 4. 2-KLG fermentation processes involving the different plasmid-cured B. megaterium derivatives. (A) Effect of plasmid(s) elimination on L-sorbose consumption; (B) effect of plasmid(s) elimination on 2-KLG production. Blank squares: original mixed culture system (H0); solid squares: mixed culture system without pBME1 (H1); solid circles: mixed culture system without pBME1 and pBME3 (H13); solid triangles: mixed culture system without plasmids (H123) (Table 1).
Table 3 Features of the B. megaterium WSH-002 plasmids. Feature
pBME1
pBME2
pBME3
Size (bp) G + C content (%) Number of ORFs Coding sequence content (%) Number of proteins with known functions Number of proteins with unknown functions Number with no significant homology tRNA rRNA operon
74,613 36.00 69 70.7 36 28 5 0 1
9699 32.22 11 73.4 6 5 0 0 0
7006 33.21 14 69.3 7 3 4 0 0
important role in the response of microorganisms to reactive oxygen species (ROS) (Sengupta and Holmgren, 2012). ORF5 on pBME3 encoded a predicted protein that had similarity to the toxin–antitoxin system proteins encoded by
Bryantella formatexigens DSM 14469; (3) Other genes involved in mobilization or transportation, such as ORF7 on pBME2 and ORF9 on pBME3. ORF7 on pBME2 had significant similarities to mobA/mobL family protein from B.
246
J. Zhou et al. / Plasmid 70 (2013) 240–246
megaterium QM B1551 and mobilization protein from Escherichia coli, suggesting that this plasmid was associated with mobilization. In addition to these possible proteins of known function, several ORFs on the plasmids pBME2 and pBME3 showed similarities to Bacillus gene products of unknown function or had no homology to any proteins found in the database, and pBME3 (14 ORFs in all) contained 4 ORFs like this. Moreover, the E values of the BLAST results for pBME3 were all on the high side (the lower the E value, the higher the credibility). These results indicated that the encoded proteins might be candidates for unusual reactions and pathways yet to be discovered, since many of the genes were of unknown function or could only be assigned as ‘‘an ABC transporter’’ or a ‘‘kinase’’ but could not be assigned to a specific metabolic pathway. Although no systematic mechanisms linking the plasmids pBME2 and pBME3 and the mutualism of the two bacteria and 2-KLG production could be determined from these results, they did provide some important clues for investigations that may follow on the mutualism mechanisms between B. megaterium and K. vulgare.
4. Conclusion In this report, three different plasmid-cured B. megaterium WSH-002 derivatives were obtained. Elimination of all the plasmids had no obvious impact on the cell growth of B. megaterium, whereas the elimination of pBME2 and pBME3 affected 2-KLG production. Therefore, it can be concluded that some genes located on pBME2 and pBME3 play important roles in promoting the production of 2-KLG by K. vulgare. Unfortunately, most of the putative proteins encoded by the plasmids were of unknown function, indicating that these genes might be involved in some unusual pathways yet to be discovered.
Acknowledgments This work was supported by grants from the Major State Basic Research Development Program of China (973 Program, 2012CB720806), the National High Technology Research and Development Program of China (863 Program, 2012AA022103), the Program for New Century Excellent Talents in University (NCET-12-0876), and the Foundation for the Author of National Excellent Doctoral Dissertation of PR China (FANEDD, 2011046).
Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/ j.plasmid.2013.05.001.
References Akhtar, P. et al., 2009. The tubulin-like RepX protein encoded by the pXO1 plasmid forms polymers in vivo in Bacillus anthracis. J. Bacteriol. 191, 2493–2500. Altschul, S.F. et al., 1990. Basic local alignment search tool. J. Mol. Biol. 215, 403–410. Azad, R.K., Borodovsky, M., 2004. Probabilistic methods of identifying genes in prokaryotic genomes: connections to the HMM theory. Brief. Bioinform. 5, 118–130. Eppinger, M. et al., 2011. Genome sequences of the biotechnologically important Bacillus megaterium strains QM B1551 and DSM319. J. Bacteriol. 193, 4199–4213. Keyhani, J. et al., 2006. Sensitivity to detergents and plasmid curing in Enterococcus faecalis. J. Ind. Microbiol. Biotechnol. 33, 238–242. Lioy, V.S. et al., 2010. A toxin–antitoxin module as a target for antimicrobial development. Plasmid 63, 31–39. Liu, L. et al., 2011a. Gelatin enhances 2-keto-L-gulonic acid production based on Ketogulonigenium vulgare genome annotation. J. Biotechnol. 156, 182–187. Liu, L. et al., 2011b. Complete genome sequence of the industrial strain Ketogulonicigenium vulgare WSH-001. J. Bacteriol. 193, 6108–6109. Liu, L.M. et al., 2011c. Complete genome sequence of the industrial strain Bacillus megaterium WSH-002. J. Bacteriol. 193, 6389–6390. Lu, S. et al., 2001. The effect of Bacillus megaerium in vitamin C two-step fermentation. Microbiology 28, 10–13. Ma, Q. et al., 2011. Integrated proteomic and metabolomic analysis of an artificial microbial community for two-step production of vitamin C. PLoS One 6, e26108. Marti, N. et al., 2009. Vitamin C and the role of citrus juices as functional food. Nat. Prod. Commun. 4, 677–700. Oguntibeju, O.O., 2008. The biochemical, physiological and therapeutic roles of ascorbic acid. Afr. J. Biotechnol. 7, 4700–4705. Raes, J., Bork, P., 2008. Molecular eco-systems biology: towards an understanding of community function. Nat. Rev. Microbiol. 6, 693– 699. Ruan, L., Xu, X., 2007. Sequence analysis and characterizations of two novel plasmids isolated from Thermus sp. 4C. Plasmid 58, 84–87. Sengupta, R., Holmgren, A., 2012. The role of thioredoxin in the regulation of cellular processes by S-nitrosylation. Biochim. Biophys. Acta 1820, 689–700. Smirnoff, N., 2001. L-ascorbic acid biosynthesis. Vitam. Horm. 61, 241– 266. Sussman, M.D. et al., 1988. Integration and mapping of Bacillus megaterium genes which code for small, acid-soluble spore proteins and their protease. J. Bacteriol. 170, 4942–4945. Tao, Y.P. et al., 1992. Cloning and sequencing of the Bacillus megaterium spoIIA operon. Biochimie 74, 695–704. Urbance, J.W. et al., 2001. Taxonomic characterization of Ketogulonigenium vulgare gen. nov., sp. nov. and Ketogulonigenium robustum sp. nov., which oxidize L-sorbose to 2-keto-L-gulonic acid. Int. J. Syst. Evol. Microbiol. 51, 1059–1070. Vary, P.S. et al., 2007. Bacillus megaterium – from simple soil bacterium to industrial protein production host. Appl. Microbiol. Biotechnol. 76, 957–967. Wintergerst, E.S. et al., 2006. Immune-enhancing role of vitamin C and zinc and effect on clinical conditions. Ann. Nutr. Metab. 50, 85–94. Yan, B. et al., 2006. Accumulation of 2-keto-L-gulonate at 33 degrees C by a thermotolerant Gluconobacter oxydans mutant obtained by ion beam implantation. Plasma Sci. Technol. 8, 237–241. Yang, Y. et al., 2007. Codon optimized Thermobifida fusca hydrolase secreted by Bacillus megaterium. Biotechnol. Bioeng. 96, 780–794. Zhang, J. et al., 2010. Manipulation of B. megaterium growth for efficient 2KLG production by K. vulgare. Process Biochem. 45, 602–606. Zhang, J. et al., 2011. Development of chemically defined media supporting high cell density growth of Ketogulonicigenium vulgare and Bacillus megaterium. Bioresour. Technol. 102, 4807–4814. Zhou, J. et al., 2011. Metabolome profiling reveals metabolic cooperation between Bacillus megaterium and Ketogulonigenium vulgare during induced swarm motility. Appl. Environ. Microbiol. 77, 7023–7030. Zhu, Y. et al., 2012. Sporulation and spore stability of Bacillus megaterium enhance Ketogulonigenium vulgare propagation and 2-keto-L-gulonic acid biosynthesis. Bioresour. Technol. 107, 399–404.
Contents lists available at SciVerse ScienceDirect
Plasmid journal homepage: www.elsevier.com/locate/yplas
Indigenous plasmids of Bacillus megaterium WSH-002 involved in mutualism with Ketogulonicigenium vulgare WSH-001 Jingwen Zhou a, Qiaoshuang Zheng a, Jie Liu b, Guocheng Du a,⇑, Jian Chen a,⇑ a b
School of Biotechnology and Key Laboratory of Industrial Biotechnology, Ministry of Education, Jiangnan University, 1800 Lihu Road, Wuxi, Jiangsu 214122, China Jiangsu Jiangshan Pharmaceutical Co. Ltd., Jingjiang 214500, China
a r t i c l e
i n f o
Article history: Received 17 December 2012 Accepted 9 May 2013 Available online 18 May 2013 Communicated by Dr. G.J. Phillips Keywords: Symbiosis Vitamin C L-ascorbic acid Plasmid elimination 2-Keto-L-gulonic acid
a b s t r a c t In the two-step vitamin C fermentation process, the precursor 2-keto-L-gulonic acid (2KLG) was synthesized using a mixed culture of Ketogulonicigenium vulgare WSH-001 and Bacillus megaterium WSH-002, which contained three plasmids, pBME1, pBME2 and pBME3. The cell growth of B. megaterium was not affected by the elimination of these plasmids. However, elimination of pBME2 and pBME3 significantly affected L-sorbose uptake and 2-KLG production. Sequence analysis of the plasmids showed that many of the pBME2 and pBME3 genes were of unknown function or could not be assigned to a specific metabolic pathway. The current work showed that the indigenous plasmids pBME2 and pBME3 of B. megaterium WSH-002 involved in mutualism with K. vulgare WSH-001. The results provided a promising new route to further demonstrate the mutualism process between the two bacteria. Ó 2013 Published by Elsevier Inc.
1. Introduction Widespread microorganisms and diverse microbial communities in biosphere play essential roles in materials circulation and species diversity. Diverse interactions between microorganisms are ubiquitous in microbial ecosystems, from simple ones contain only two strains to rather complex systems such as symbiotic human gut flora and sewage microbial flora (Raes and Bork, 2008). It was important for biologist to understand the interactions among different microorganisms at the molecular level for the further regulation or utilization of these systems (Raes and Bork, 2008). Vitamin C is a water-soluble vitamin that plays crucial roles in the health of human beings (Oguntibeju, 2008). Due to its antioxidant properties and biological functions, ⇑ Corresponding authors. Address: School of Biotechnology, Jiangnan University, 1800 Lihu Road, Wuxi, Jiangsu 214122, China. Fax: +86 510 85918309 (G. Du). E-mail addresses: [email protected] (G. Du), [email protected] (J. Chen). 0147-619X/$ - see front matter Ó 2013 Published by Elsevier Inc. http://dx.doi.org/10.1016/j.plasmid.2013.05.001
vitamin C has applications in many different fields, such as clinical medicine and the beverage, food and cosmetic industries (Marti et al., 2009; Wintergerst et al., 2006). A natural microbial consortium composed by Bacillus megaterium and Ketogulonigenium vulgare is widely used in vitamin C biosynthesis industry (Yan et al., 2006). The symbiotic system transforms L-sorbose to 2-keto-L-gulonic acid (2-KLG, the direct precursor of vitamin C) by coculturing B. megaterium and K. vulgare (Smirnoff, 2001). In the mixed culture fermentation process consisting of B. megaterium and K. vulgare, only K. vulgare is responsible for 2-KLG production, whereas B. megaterium, as a companion bacterium, does not directly yield any 2-KLG (Zhang et al., 2011). As a typical microbial symbiotic model as well as a core process of vitamin C biosynthesis industry, numerous studies were performed to elucidate the mechanism by means of different routes. Previous studies had shown that B. megaterium significantly stimulated K. vulgare propagation and 2-KLG production in the co-culture system (Lu et al., 2001; Zhang et al., 2010). The genomic sequencing provided total molecular parts list of the community and facilitated researchers to find out
241
J. Zhou et al. / Plasmid 70 (2013) 240–246
metabolic pathway gaps of K. vulgare (Liu et al., 2011a; Raes and Bork, 2008). The proteomic and metabolomic based researches (Ma et al., 2011; Zhou et al., 2011) revealed the metabolic cooperation relationship and inferred that sporulation of B. megaterium plays important roles in metabolic cooperation between two bacteria. Our previous works showed that K. vulgare cell propagation in fermentation medium was associated with spore stability as well as sporulation process of B. megaterium (Zhu et al., 2012). However, these efforts have yielded no definite conclusion on the mutualism mechanisms in terms of how B. megaterium promotes the growth and 2-KLG-producing capability induced in K. vulgare by the fermentation system. B. megaterium is a gram-positive spore-forming bacterium that is the object of study in many laboratories because of its interesting biochemical reactions and high capacity for exo-enzyme production (Eppinger et al., 2011; Vary et al., 2007). Plasmids in Bacillus and grampositive bacteria usually carry genes involved in virulence, metabolism, degradation of toxic compounds, antibiotic activity, heavy metal resistance and their own transfer among species or genera (Akhtar et al., 2009; Lioy et al., 2010). Most B. megaterium strains contain multiple indigenous plasmids, but many plasmids are cryptic in nature and only a few plasmid genes are known (Tao et al., 1992). As a widely investigated protein expression system, most of the indegenous plasmids of the B. megaterium wild type strains were eliminated to allow them to express heterologous proteins without significantly changing the phenotype of the strains (Tao et al., 1992). B. megaterium WSH-002 is an industrial strain provided by Jiangsu Jiangshan Pharmaceutical Co., Ltd. Genome sequencing of the strain revealed that it contained three indigenous plasmids, pBME1, pBME2 and pBME3, with sizes of 74.6 kb, 9.7 kb and 7 kb, respectively (Liu et al., 2011c). In this study, in order to understand the influence of indegenous plasmids on the mutualisms process, the indigenous plasmids in an industrial strain, B. megaterium WSH-002, were eliminated. Three different plasmid-cured B. megaterium derivatives were obtained by progressive heating and sodium dodecyl sulfate (SDS) co-treatment as well as acridine orange (AO) treatment. The resultant strains were used to investigate the effects of indigenous plasmids on the mutualism process and 2-KLG production of the two strains.
2. Materials and methods 2.1. Microorganisms B. megaterium WSH-002 and K. vulgare WSH-001 used in this study were obtained from Jiangsu Jiangshan Pharmaceutical Co., Ltd. (Jingjiang, Jiangsu, China) (Zhu et al., 2012) (Table 1). 2.2. Culture conditions The composition of the seed medium of the mixed culture (medium A) was (per litre): 20 g L-sorbose, 3 g yeast extract, 10 g peptone, 3 g beef extract, 1.5 g corn steep liquor, 1 g urea, 0.2 g MgSO4, 1 g KH2PO4, 1 g CaCO3 and tap water. The medium for B. megaterium culture was Luria–Bertani (LB). Two percent agar was added to medium A/ LB for slant culture and isolation culture. The fermentation medium of the mixed culture (medium B) consisted of (per litre): 80 g L-sorbose, 5 g corn steep liquor, 12 g urea, 0.1 g MgSO4, 1 g KH2PO4, 5 g CaCO3 and tap water. L-Sorbose and CaCO3 were sterilized separately with other components. The initial pH values of all media were adjusted to 6.7 before sterilization at 121 °C for 15 min (Zhu et al., 2012). 2.3. Elimination of plasmids in B. megaterium WSH-002 Three different methods were used for plasmid elimination because of the different stabilities of the indigenous plasmids. (1) LB media with concentrations of SDS from 0.004% to 0.04% were inoculated with a stationary-phase culture of B. megaterium grown in LB medium. After shaking at 30 °C for 10 h, the sublethal concentration of SDS was determined by plating the samples on LB media agar without SDS. (2) A 10-h culture of B. megaterium in LB medium was used to inoculate fresh LB medium with a 0.4% inoculum, and incubated for 10 h at 34 °C, after which the cell growth was checked by plating the culture on LB medium agar followed by 10 h incubation at normal temperature (30 °C). At the same time, this culture was subcultured into the same medium and incubated at 38 °C. These steps were repeated with heating at progressively higher temperatures (3–4 °C each time) until only 10–20 single colonies were grown on the plate. Then, the culture cultivated at this temperature was sub-cultured (0.8% inoculum) into fresh medium and incubated at 30 °C for proliferation. Finally, the proliferation culture was trans-
Table 1 Strains and mixed cultures used in this study. Strain
Description
Source
K. vulgare D0 D1 D13 D123 H0 H1 H13 H123
K. vulgare WSH-001, wild-type B. megaterium WSH-002, wild-type B. megaterium without pBME1 B. megaterium without pBME1 and pBME3 B. megaterium without any plasmids Mixed culture of D0 and K. vulgare Mixed culture of D1 and K. vulgare Mixed culture of D13 and K. vulgare Mixed culture of D123 and K. vulgare
Liu et al. (2011b) Liu et al. (2011c) This study This study This study Zhang et al. (2011) This study This study This study
242
J. Zhou et al. / Plasmid 70 (2013) 240–246 Table 2 Primers used for the detection of indigenous plasmids.a
a
Primer
Sequences (50 –30 )
Product size (bp)
Usage
pBME1-F pBME1-R pBME2-F pBME2-R pBME3-F pBME3-R
CCGTGTAAGCAGCCGAGAT ACAAGGGTTGGTGCGTCAT GGGGTCACTCAATCCGTTTA TTGCTTGCGGTATGTCTGG TCAATCCTGGCAAACCTACC AGAATGAGCCTGAGCCTAAGAA
1950
Detection of pBME1
2277
Detection of pBME2
2162
Detection of pBME3
The underlined nucleotides in bold are the corresponding restriction enzyme recognition sites.
ferred into LB medium containing the sublethal concentration of SDS with a 0.4% inoculum. After incubation at 30 °C for 10 h, the culture was plated on LB media with agar without SDS, following which about 20 individual colonies were randomly picked up from the plates for plasmid tests. (3) After 10 h, an exponentially growing culture of B. megaterium was treated with AO as previously reported by Keyhani et al. (2006). The resulting single colonies were picked up for plasmids tests.
The seed culture of the mixture of K. vulgare and B. megaterium was cultivated at 30 °C and 200 rpm in a 750-mL flask containing 75 mL medium A on a rotary shaker for 18 h. The fermentation cultures were performed in 750-mL flasks charged with 75 mL medium B and incubated at 30 °C and 200 rpm for 72 h; the inoculum amount was 10% (v/v). All biological experiments were done in triplicate. 2.6. L-Sorbose and 2-KLG assays
2.4. Plasmid DNA extraction and analysis Individual colonies obtained through the above steps were then inoculated into fresh LB media without any elimination agents for proliferation at normal temperature. Plasmids were extracted with EZ-10 Spin Column Plasmid DNA Minipreps Kit (Sangon, Shanghai, China). Lysozyme at 10 lg/mL was added to the cell pellets to enhance the cell lysis process. Specific DNA fragments of the three plasmids of B. megaterium were PCR amplified for plasmid detection with the primers (Table 2) designed by Primer Premier 5 (PREMIER Biosoft, Palo Alto, CA) according to the whole plasmid nucleotide sequence. Positive control were performed with the wild type strain B. megaterium WSH-002 with all of the indigenous plasmids. Negative controls were performed with the purified genomic DNA of B. megaterium MS941 (Yang et al., 2007), which is the Dnpr of the B. megaterium DSM319 without indigenous plasmids for the genome sequence results of the two strains are highly similar (Eppinger et al., 2011). PCR products were electrophoresed on 1% (w/v) agarose gels to verify the existence of the corresponding plasmid DNA (Ruan and Xu, 2007). 2.5. Preparation of the mixed culture of K. vulgare and B. megaterium A single strain was inoculated on the isolating plates through plate streaking and incubated at 30 °C for 10 h (B. megaterium) or 36 h (K. vulgare). 20–30 individual colonies of K. vulgare on the isolating plates were transferred to 3 mL sterilized water and co-suspended with a minute quantity of B. megaterium cells picked up by a toothpick. Then, 200 lL of suspension was spread on a fresh slant and cultivated at 30 °C for 36 h (Yan et al., 2006). The mixed culture grown on the slant was finally washed with 10 mL sterilized physiological saline (0.90% w/v of NaCl), and 200 lL of the suspension of the mixed culture was transferred to medium A for seed culture.
2-KLG and L-sorbose concentrations were measured by HPLC using an Aminex HPX-87H column (Bio-Rad, Herculas, CA) at 35 °C with a flow rate of 0.6 mL/min and 0.0275% (v/v) H2SO4 as the eluent (Urbance et al., 2001). Bacterial growth was monitored by measuring optical density at 650 nm (OD650) after dissolving the calcium carbonate in the medium by adding a suitable amount of 2 mol/L HCl. 2.7. Bioinformatics analysis Identification of open reading frames (ORFs) and homology searches utilized the BLAST series of programs provided by the National Center for Biotechnology Information (http://www.ncbi.nih.gov/) (Altschul et al., 1990) and Gene Mark HMM (http://opal.biology.gatech.edu/ GeneMark/hmmchoice.html) (Azad and Borodovsky, 2004). The annotation results were given in the Supplementary File (Table S1). 3. Results and discussion 3.1. Plasmid elimination and confirmation In order to investigate 2-KLG production using the mixed culture of K. vulgare and B. megaterium, it was important to know whether any of the plasmids of B. megaterium could affect 2-KLG production. The parent B. megaterium WSH-002 with all three indigenous plasmids (D0) was sub-cultured by gradually increasing the culture temperature. The growth rate significantly decreased when the temperature was set to 40 °C and above. No growth was observed when the temperature surpassed 48 °C. Therefore, the proliferation culture of the broth treated at 48 °C was transferred into LB medium containing the sub-lethal concentration of SDS (0.014%). After treatment, the culture was plated on LB agar plates. 200 single colo-
J. Zhou et al. / Plasmid 70 (2013) 240–246
nies were tested by PCR for the existence of the plasmids by the corresponding primer pairs (Table 2). To ensure that this procedure resulted in permanently curing rather than decreasing the copy number, the plasmids of the derived strains were extracted and further confirmed by PCR detection after streaking for an extra three times on LB plates. Then, the PCR products were examined on 1% (w/v) agarose gels with the parent strain’s plasmids used as the control throughout the plasmid extraction and PCR amplification process. After several treatments of the cells by different methods, two derivative strains with plasmids pBME1 and pBME1/pBME3 missing were obtained and named D1 and D13, respectively (Fig. 1). To eliminate plasmid pBME2, strain D13 was further treated by AO. The effect of AO on the cell growth of B. megaterium was first tested. When the concentration of AO was more than 100 lg/mL, B. megaterium could not grow. After one sub-culture in the presence of 100 lg/mL AO, the samples were plated on LB agar plates, and 100 individual colonies from these plates were picked up and tested for plasmid pBME2 using the same method as described above. The strain that had lost all three plasmids was named D123. Strain D123 was also further confirmed by PCR detection after streaking for three generations (Fig. 1).
243
A
B
3.2. Growth of the different plasmid-cured B. megaterium derivatives The growth patterns of the strains D0, D1, D13 and D123 were examined to determine their growth phenotypes (Fig. 2). All of the strains had the same lag time and all could achieve an OD650 nm of 0.7–0.8 after culture for 10 h in LB media. Furthermore, after 15 h incubation, the three derivatives began to form spores as did the parent strain, D0. In addition, the colony morphologies of the three derivatives were also investigated (Fig. 3). Interestingly, there was no change in colony morphology although many genes had been removed from the cells along with the indigenous plasmids. These results indicated that D1, D13 and D123 had the same substantial growth characteristics as D0, from which they were derived under the condition we tested. This suggested that the indigenous plasmids were not essential for the growth of B. megaterium in the culture media tested. This result was similar to a previous report about plasmid elimination in B. megaterium QM B1551 (Sussman et al., 1988). 3.3. 2-KLG production of the different B. megaterium WSH002 derivatives The three different B. megaterium WSH-002 derivatives (D1, D13 and D123) and the parent strain (D0) were collocated with K. vulgare WSH-001. The corresponding mixed cultures were named H1, H13, H123 and H0, respectively. No significant differences in 2-KLG production or L-sorbose consumption were detected between H1 and H0 (Fig. 4). However, the yields of 2-KLG produced by H13 (53.3 g/L) and H123 (45.2 g/L) had decreased by 24.8% and 36.2%, respectively, compared to H0. At the same time, the con-
C
Fig. 1. PCR confirmation of plasmid elimination. (A) Elimination of pBME1. M, DL2000 DNA Marker; lanes 1, 2, 3, negative control; lanes 4, 5, 6, PCR products amplified from the plasmids of the parent strain D0 by primer pairs DFR1-F/R, DFR2-F/R, DFR3-F/R, respectively; lanes 7, 8, 9, PCR product amplified from the plasmids of D1 strain by primer pairs DFR1-F/R, DFR2-F/R and DFR3-F/R, respectively. (B) Elimination of pBME1 and pBME3. M, DL2000 DNA Marker; lanes 1, 2, 3, negative control; lanes 4, 5, 6, PCR product amplified from the plasmids of the parent strain D0 by primers DFR1-F/R, DFR2-F/R, DFR3-F/R, respectively; lanes 7, 8, 9, PCR product amplified from the plasmids of D13 strain by primer pairs DFR1F/R, DFR2-F/R, DFR3-F/R, respectively. (C) Elimination of all of the plasmids. M, DL2000 DNA Marker; lanes 1, 2, 3, negative control; lanes 4, 5, 6, PCR product amplified from the plasmids of the parent strain D0 by primer pairs DFR1, DFR2, DFR3, respectively; lanes 7, 8, 9, PCR product amplified from the plasmids of D123 strain by primer pairs DFR1-F/R, DFR2-F/R, DFR3-F/R, respectively.
sumptions of L-sorbose decreased by 13.7% and 24.1%, respectively.
244
J. Zhou et al. / Plasmid 70 (2013) 240–246
Fig. 2. Growth curves of the different plasmid-cured B. megaterium derivatives. Blank squares: D0; solid circles: D1; solid squares: D13; solid triangles: D123 (Table 1).
Considering that the elimination of the plasmids did not affect the cell growth (Fig. 2), these results showed that lower 2-KLG production was not caused by the lack of sufficient B. megaterium biomass. The results also showed that the plasmids pBME2 and pBME3 of B. megaterium may affect the mutualism process whereas the plasmid pBME1 had no effect on it. Therefore, it could be concluded that some genes encoding essential components for promoting the production of 2-KLG by K. vulgare may located on the plasmid pBME2 and/or pBME3. 3.4. Sequence analysis of the three plasmids B. megaterium WSH-002 was sequenced and found to harbor three plasmids, pBME1, pBME2 and pBME3 (Liu
et al., 2011c) (Table 3). The sizes of pBME1 (GenBank accession No.: NC_017139.1), pBME2 (GenBank accession No.: NC_017140.1) and pBME3 (GenBank accession No.: NC_017141.1) are 74,163 bp, 9699 bp and 7006 bp, with a G + C content of 36%, 32.22% and 33.21%, respectively. The three plasmids harbored 69, 11 and 14 putative ORFs. Of all the ORFs, 9 ORFs had no homology to any proteins in GenBank, and 36 ORFs possessed similarity to proteins of unknown functions. In addition, pBME1 was found to contain a rRNA operon. The results of a computer analysis of the predicted ORFs and their closest relatives are shown in Table 3. Some of the ORFs are known for the function of plasmid replication, such as ORF20 of pBME1, ORF4 of pBME2, and ORF14 of pBME3. A majority of the ORFs on pBME1 were found to correspond to several encoded products similar to the hypothetical proteins of unknown function on the plasmids of B. megaterium QM B1551. Other gene products encoded by pBME1 included glycosyl transferase (ORF 35, 44, 47, 48, 49, 51, 53), spore coat protein (ORF 24, 40, 41, 42), peptidase (ORF 25, 55, 60) and dehydratase (ORF 54, 57, 58). Since elimination of the pBME1 did not significantly affected the mutualism process, the metabolic pathways or cell signal transduction processes associated with the genes in pBME1 should not involved in facilitating the cell growth or 2-KLG production by K. vulgare. Since elimination of pBME2 and pBME3 could affect the mutualism process, the genes on these two plasmids may involved in some pathways or functions associated with the process. The ORFs with known functions on pBME2 and pBME3 could be mainly divided into three groups: (1) Transcriptional regulators, such as ORF9 on pBME2, ORF6 on pBME3; (2) Redox related proteins, such as ORF1 on pBME2, ORF5 and ORF7 on pBME3. ORF1 on pBME2 encoded a putative thioredoxin, which plays an
A
B
C
D
Fig. 3. Colony morphologies of the different B. megaterium derivatives. (A) The parent strain D0; (B) D1; (C) D13; (D) D123.
245
J. Zhou et al. / Plasmid 70 (2013) 240–246
L-Sorbose (g/L)
A
80 60 40 20 0
0
20
40
60
80
60
80
Time (h) B
80
2-KLG (g/L)
60 40 20 0
0
20
40
Time (h)
Fig. 4. 2-KLG fermentation processes involving the different plasmid-cured B. megaterium derivatives. (A) Effect of plasmid(s) elimination on L-sorbose consumption; (B) effect of plasmid(s) elimination on 2-KLG production. Blank squares: original mixed culture system (H0); solid squares: mixed culture system without pBME1 (H1); solid circles: mixed culture system without pBME1 and pBME3 (H13); solid triangles: mixed culture system without plasmids (H123) (Table 1).
Table 3 Features of the B. megaterium WSH-002 plasmids. Feature
pBME1
pBME2
pBME3
Size (bp) G + C content (%) Number of ORFs Coding sequence content (%) Number of proteins with known functions Number of proteins with unknown functions Number with no significant homology tRNA rRNA operon
74,613 36.00 69 70.7 36 28 5 0 1
9699 32.22 11 73.4 6 5 0 0 0
7006 33.21 14 69.3 7 3 4 0 0
important role in the response of microorganisms to reactive oxygen species (ROS) (Sengupta and Holmgren, 2012). ORF5 on pBME3 encoded a predicted protein that had similarity to the toxin–antitoxin system proteins encoded by
Bryantella formatexigens DSM 14469; (3) Other genes involved in mobilization or transportation, such as ORF7 on pBME2 and ORF9 on pBME3. ORF7 on pBME2 had significant similarities to mobA/mobL family protein from B.
246
J. Zhou et al. / Plasmid 70 (2013) 240–246
megaterium QM B1551 and mobilization protein from Escherichia coli, suggesting that this plasmid was associated with mobilization. In addition to these possible proteins of known function, several ORFs on the plasmids pBME2 and pBME3 showed similarities to Bacillus gene products of unknown function or had no homology to any proteins found in the database, and pBME3 (14 ORFs in all) contained 4 ORFs like this. Moreover, the E values of the BLAST results for pBME3 were all on the high side (the lower the E value, the higher the credibility). These results indicated that the encoded proteins might be candidates for unusual reactions and pathways yet to be discovered, since many of the genes were of unknown function or could only be assigned as ‘‘an ABC transporter’’ or a ‘‘kinase’’ but could not be assigned to a specific metabolic pathway. Although no systematic mechanisms linking the plasmids pBME2 and pBME3 and the mutualism of the two bacteria and 2-KLG production could be determined from these results, they did provide some important clues for investigations that may follow on the mutualism mechanisms between B. megaterium and K. vulgare.
4. Conclusion In this report, three different plasmid-cured B. megaterium WSH-002 derivatives were obtained. Elimination of all the plasmids had no obvious impact on the cell growth of B. megaterium, whereas the elimination of pBME2 and pBME3 affected 2-KLG production. Therefore, it can be concluded that some genes located on pBME2 and pBME3 play important roles in promoting the production of 2-KLG by K. vulgare. Unfortunately, most of the putative proteins encoded by the plasmids were of unknown function, indicating that these genes might be involved in some unusual pathways yet to be discovered.
Acknowledgments This work was supported by grants from the Major State Basic Research Development Program of China (973 Program, 2012CB720806), the National High Technology Research and Development Program of China (863 Program, 2012AA022103), the Program for New Century Excellent Talents in University (NCET-12-0876), and the Foundation for the Author of National Excellent Doctoral Dissertation of PR China (FANEDD, 2011046).
Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/ j.plasmid.2013.05.001.
References Akhtar, P. et al., 2009. The tubulin-like RepX protein encoded by the pXO1 plasmid forms polymers in vivo in Bacillus anthracis. J. Bacteriol. 191, 2493–2500. Altschul, S.F. et al., 1990. Basic local alignment search tool. J. Mol. Biol. 215, 403–410. Azad, R.K., Borodovsky, M., 2004. Probabilistic methods of identifying genes in prokaryotic genomes: connections to the HMM theory. Brief. Bioinform. 5, 118–130. Eppinger, M. et al., 2011. Genome sequences of the biotechnologically important Bacillus megaterium strains QM B1551 and DSM319. J. Bacteriol. 193, 4199–4213. Keyhani, J. et al., 2006. Sensitivity to detergents and plasmid curing in Enterococcus faecalis. J. Ind. Microbiol. Biotechnol. 33, 238–242. Lioy, V.S. et al., 2010. A toxin–antitoxin module as a target for antimicrobial development. Plasmid 63, 31–39. Liu, L. et al., 2011a. Gelatin enhances 2-keto-L-gulonic acid production based on Ketogulonigenium vulgare genome annotation. J. Biotechnol. 156, 182–187. Liu, L. et al., 2011b. Complete genome sequence of the industrial strain Ketogulonicigenium vulgare WSH-001. J. Bacteriol. 193, 6108–6109. Liu, L.M. et al., 2011c. Complete genome sequence of the industrial strain Bacillus megaterium WSH-002. J. Bacteriol. 193, 6389–6390. Lu, S. et al., 2001. The effect of Bacillus megaerium in vitamin C two-step fermentation. Microbiology 28, 10–13. Ma, Q. et al., 2011. Integrated proteomic and metabolomic analysis of an artificial microbial community for two-step production of vitamin C. PLoS One 6, e26108. Marti, N. et al., 2009. Vitamin C and the role of citrus juices as functional food. Nat. Prod. Commun. 4, 677–700. Oguntibeju, O.O., 2008. The biochemical, physiological and therapeutic roles of ascorbic acid. Afr. J. Biotechnol. 7, 4700–4705. Raes, J., Bork, P., 2008. Molecular eco-systems biology: towards an understanding of community function. Nat. Rev. Microbiol. 6, 693– 699. Ruan, L., Xu, X., 2007. Sequence analysis and characterizations of two novel plasmids isolated from Thermus sp. 4C. Plasmid 58, 84–87. Sengupta, R., Holmgren, A., 2012. The role of thioredoxin in the regulation of cellular processes by S-nitrosylation. Biochim. Biophys. Acta 1820, 689–700. Smirnoff, N., 2001. L-ascorbic acid biosynthesis. Vitam. Horm. 61, 241– 266. Sussman, M.D. et al., 1988. Integration and mapping of Bacillus megaterium genes which code for small, acid-soluble spore proteins and their protease. J. Bacteriol. 170, 4942–4945. Tao, Y.P. et al., 1992. Cloning and sequencing of the Bacillus megaterium spoIIA operon. Biochimie 74, 695–704. Urbance, J.W. et al., 2001. Taxonomic characterization of Ketogulonigenium vulgare gen. nov., sp. nov. and Ketogulonigenium robustum sp. nov., which oxidize L-sorbose to 2-keto-L-gulonic acid. Int. J. Syst. Evol. Microbiol. 51, 1059–1070. Vary, P.S. et al., 2007. Bacillus megaterium – from simple soil bacterium to industrial protein production host. Appl. Microbiol. Biotechnol. 76, 957–967. Wintergerst, E.S. et al., 2006. Immune-enhancing role of vitamin C and zinc and effect on clinical conditions. Ann. Nutr. Metab. 50, 85–94. Yan, B. et al., 2006. Accumulation of 2-keto-L-gulonate at 33 degrees C by a thermotolerant Gluconobacter oxydans mutant obtained by ion beam implantation. Plasma Sci. Technol. 8, 237–241. Yang, Y. et al., 2007. Codon optimized Thermobifida fusca hydrolase secreted by Bacillus megaterium. Biotechnol. Bioeng. 96, 780–794. Zhang, J. et al., 2010. Manipulation of B. megaterium growth for efficient 2KLG production by K. vulgare. Process Biochem. 45, 602–606. Zhang, J. et al., 2011. Development of chemically defined media supporting high cell density growth of Ketogulonicigenium vulgare and Bacillus megaterium. Bioresour. Technol. 102, 4807–4814. Zhou, J. et al., 2011. Metabolome profiling reveals metabolic cooperation between Bacillus megaterium and Ketogulonigenium vulgare during induced swarm motility. Appl. Environ. Microbiol. 77, 7023–7030. Zhu, Y. et al., 2012. Sporulation and spore stability of Bacillus megaterium enhance Ketogulonigenium vulgare propagation and 2-keto-L-gulonic acid biosynthesis. Bioresour. Technol. 107, 399–404.