Indispensable role for mouse ELP3 in embryonic stem cell maintenance and early development

Biochemical and Biophysical Research Communications 478 (2016) 631e636

Contents lists available at ScienceDirect

Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc

Indispensable role for mouse ELP3 in embryonic stem cell maintenance and early development Hyunjin Yoo 1, Dabin Son 1, Young-Joo Jang, Kwonho Hong* Department of Nanobiomedical Science & BK21 PLUS NBM Global Research Center for Regenerative Medicine, Dankook University, Cheonan, 330-714, Republic of Korea

a r t i c l e i n f o

a b s t r a c t

Article history: Received 7 June 2016 Accepted 28 July 2016 Available online 29 July 2016

ELP3, a core component of Elongator, has been implicated in translational regulation via modification of tRNA at the wobble position. However, the precise biological function of ELP3 in early mouse development has not yet been defined. We here provide evidence that ELP3 plays crucial roles in mouse embryonic stem cell (ESC) maintenance and early development. ELP3 was detected ubiquitously in blastocysts and E10.5 embryos and shown to be increased during ESC differentiation. Depletion of ELP3 in ESC led to aberrant cell cycle progression, along with reduced expression of genes for pluripotency. Interestingly, our analyses revealed that, although the mRNA levels of the genes related to cell cycle were increased, protein levels were diminished in knockdown (KD) ESCs. The data, therefore, suggest that ELP3 function is critical for translational efficiency of the genes. Consistent with a proliferation defect in KD cells, Elp3 knockout (KO) embryos suffered from severe growth retardation and failed to develop beyond E12.5. In conclusion, we have demonstrated that ELP3 plays an indispensable role in ESC survival, differentiation and embryonic development in mouse. © 2016 Elsevier Inc. All rights reserved.

Keywords: Elongator ELP3 Embryonic stem cell Mouse development

1. Introduction A self-renewal capacity and differentiation potential into all three germ-layers are central characteristics of embryonic stem cell (ESC). Multiple layers of regulatory mechanisms have shown to be involved in orchestrating the processes [1,2]. Among them, recent studies revealed that posttranscriptional modification of RNA species essentially ensures the precise synthesis of proteins critical for ESC maintenance and developmental potential. Studies have demonstrated that N6-methyl-adenosine (m6A) modification, which is the most widespread mRNA modification, is highly enriched at the 30 end of mRNAs in ESCs [3e6]. Depletion of Mettl3, an enzyme responsible for the m6A modification, caused a

Abbreviations: ESC, embryonic stem cell; m6A, N6-methyl-adenosine; HAT, histone acetyltransferase; SSUP, small subunit processome; SAM, S-adenosylmethionine; KD, knockdown; KO, knockout; LIF, leukemia inhibitory factor; shELP3, short hairpin RNA for Elp3; shCont, short hairpin RNA for control; qPCR, quantitative real-time PCR; PI, propidium iodide; IF, Immunofluorescent; AP, alkaline phosphatase; DAPI, 40 ,6-diamidino-2-phenylindole; TBS, tris-buffered saline; ICM, inner cell mass; TE, trophectoderm; EB, embryoid body. * Corresponding author. E-mail address: [email protected] (K. Hong). 1 These authors equally contributed to this work. http://dx.doi.org/10.1016/j.bbrc.2016.07.120 0006-291X/© 2016 Elsevier Inc. All rights reserved.

significant reduction in m6A levels and developmental anomalies in knockout (KO) mice [6]. Indeed, the Mettl3-mediated m6A modification controls the half-life of mRNAs important for modulating the pluripotency network in ESCs [6]. More recently, function of small subunit processome (SSUP), a regulator of 18S rRNA biogenesis, was shown to be crucial for protein synthesis in ESCs [7]. The role of posttranscriptional tRNA modifications in ESC biology has been poorly understood. Elongator complex has been implicated in protein acetylation, transcriptional regulation and modification of tRNA nucleotides at the wobble position. The core complex (ELP1-3) of Elongator along with a sub-complex (ELP4-6) is required for histone acetyltransferase (HAT) activity [8]. ELP3 was shown to be responsible for the HAT activity through its HAT domain, which shares a high degree of homology with the HAT domain of GCN5 [9,10]. Ablation of ELP3 in yeast caused aberrant transcriptional regulation as observed in ELP3-depleted Drosophila melanogaster and HeLa cells [11e13]. The studies suggest that the essential function of Elongator might be conserved across species and be linked, at least in part, to gene transcription. Accumulating evidence suggests that Elongator exerts its regulatory role in protein synthesis by catalyzing uridine methylation of tRNAs in multiple organisms [14,15]. The notion was initially raised

632

H. Yoo et al. / Biochemical and Biophysical Research Communications 478 (2016) 631e636

because besides the HAT domain, ELP3 also contains evolutionally conserved radical S-adenosyl-methionine (SAM), a methyl donor, binding domain at amino terminus [16]. In fact, the biochemical mechanism underlying tRNA methylation was shown to be mediated by the SAM binding domain in ELP3 [17]. Depletion of ELP3 impaired the formation of 5-methoxycarbonylmethyl-2thiouridine (in tRNALysUUU, tRNAGlnUUG and tRNAGluUUC), 5methoxycarbonylmethyluridine (in tRNAArgUCU), and 5Pro carbamoylmethyluridine (in tRNA UGG) in yeast [14,18,19]. Until now, however, an understanding of ELP3 function with regard to the regulation of ESC maintenance and developmental processes remains elusive. In the present study, we showed that ELP3 depletion in ESCs evoked catastrophic cell cycle progression. Consistent with a defect in cell proliferation in Elp3 knockdown (KD) ESCs, Elp3 knockout (KO) caused early embryonic lethality with severe growth retardation. Our study, therefore, has uncovered an essential role for ELP3 in ESC survival and early mouse development, via regulation of both transcription and translation. 2. Materials and methods 2.1. ESC culture and differentiation E14TG2a ESCs were used for Elp3 KD and differentiation studies. The ESCs were maintained in DMEM supplemented with 20% fetal bovine serum, L-glutamine, MEM non-essential amino acids, penicillin/streptomycin, b-mercaptoethanol, and leukemia inhibitory factor (LIF). To induce ES cell differentiation, ES cell media without LIF was used and cells were grown in bacterial culture dishes. 2.2. ELP3 depletion To design Elp3 KD construct, Elp3 mRNA sequences (NCBI ID #: NR_045599) and a web-based siRNA designing tool (BLOCK-iT™ RNAi Designer, LifeTechnologies) were used. The sequences for Elp3 KD and control used in the study are as follows: shELP3-KD1: GCTGATGATGCTGACTATA, shELP3-KD2: CGGAGAGATTATGTTGC CAAT and shCont: GTTCAGATGTGCGGCGAGT. Synthetic oligos for Elp3 KD and shCont containing AgeI and MluI restriction sites were annealed and cloned into AgeI/MluI digested pTY-U6 vector. Lentiviruses were produced from 293 T cells. Cells were transduced using the FuGENE6® reagent (Promega). Puromycin selection was performed at 48 h after the transduction.

CATGGCCTTCCGTGTTCCTA and 50 -GCCTGCTTCACCACCTTCTT. 2.4. Immunofluorescent (IF) and alkaline phosphatase (AP) stainings, and western blot Cells and frozen sections were fixed with 4% PFA, permeabilized in 0.1% PBSTx100 (0.1% TritonX100 in PBS), blocked and incubated with primary antibodies. After primary antibody incubation, cells were washed, incubated with appropriate secondary antibodies and counterstained with DAPI. For AP staining, cells were fixed and subjected to AP staining as per the manufacturer's instructions (Sigma-Aldrich). For Western Blotting, cells were lysed in RIPA buffer containing protease inhibitors, and lysates were separated on SDS-PAGE. Proteins were transferred to a PVDF, and the primary antibodies were incubated in blocking solution (5% w/v BSA and 0.1% Tween20 in TBS). After incubation with proper secondary antibodies, protein signals were visualized using the ECL™ system (Amersham Biosciences). The following primary antibodies were used for IF staining and Western blot: OCT3/4 (Santa Cruz biotechnology), ELP3 (Sigma Aldrich), CYCA (Santa Cruz Biotechnology), CYCB1 (Santa Cruz Biotechnology), CYCD1 (Cell Signaling), CYCE (Cell Signaling), CDC2 p34 (Santa Cruz Biotechnology), and pCDC2 p34 (Thr14/Tyr15) (Santa Cruz Biotechnology). 2.5. Generation of Elp3 KO mouse To generate Elp3 KO strain, we took advantage of an ESC clone containing genetrap cassette (BayGenomics, clone ID: AQ0461). The Elp3 KO mice were generated and characterized in the laboratory of Dr. Yi Zhang, an investigator of Howard Hughes Medical Institute. After identification of insertion site of the trap cassette, chimeric mice were generated by using standard method [20]. Once chimeric mice were generated, germline transmission was confirmed by crossing with C57BL6 strain. KO mice were further backcrossed at least four generations with C57BL6. KO mouse studies were carried out on the hybrid background. Primers for PCR genotyping were as follows: forward - AACCAAGACAGCTGCCAAGTATGGCC, reverse e GTGCCAAGCTTTCTGATGGGACTTT, mutant reverse - AGGCTTCTAGGACAAGAGGGCGAGA. All animal procedures performed were reviewed and approved by the Institutional Animal Care and Use Committee (IACUC) of the University of North Carolina at Chapel Hill or Harvard University. 2.6. Statistical analyses

2.3. Flow cytometry, cell proliferation analysis and quantitative real-time PCR (qPCR) For flow cytometric analysis, 1  105 cells/mL were resuspended in 1 binding buffer (10 mM Hepes/NaOH (pH 7.4), 140 mM NaCl, 2.5 mM CaCl2) and incubated with the FITC-conjugated AnnexinV (BD Pharmingen) and propidium iodide (PI). The flow cytometric analysis was performed on a FACS Calibur (BD Biosciences), and the fluorescence signal was quantified by Cell Quest program. For cell proliferation assay, 2000 cells were seeded and counted on day 1, 3, and 5. One microgram of total RNA extracted from ESCs was used for cDNA synthesis (GeneAll). qPCR was performed on a StepOnePlus™ Systems (Applied Biosystems) using SYBR green reagent (Life Technologies). The following primers were used qPCR analysis; 1) Elp1: F-AGCTCCACTGCGAATAGCAT, R- CTCAGCTTCCACT GGCTTCT, 2) Elp2: F- AATGGGCAACCTTTCCTAGA, R-TCCTTGGTTTC GAAAGATGC, 3) Elp3: F- GCTGAGCTGATGATGCTGAC, R- TTGGC AGCTGTCTTGGTTTT, 4) Oct3/4; F- CCAATCAGCTTGGGCTAGAG, RCCTGGGAAAGGTGTCCTGTA, 5) Nanog: F- AAGCAGAAGATGCGG ACTGT, R- ATCTGCTGGAGGCTGAGGTA, 6) Sox2: F- GAACGCCTTCATGGTATGGT, R- TTGCTGATCTCCGAGTTGTG, 7) Gapdh, 50 -

The data were analyzed with SigmaPlot®12 program (Systat software). Two-way ANOVA test was used for the EB differentiation data. The Holm-Sidak test was applied for post hoc analysis. Student's t-test or t-test was used for other data analysis. The error bars represent standard error mean (SEM). Statistical significance was determined at P  0.05. 3. Results 3.1. Expression of core elongator components during ESC differentiation and development To delineate the role of Elongator in ESCs, we first investigated the expression pattern of core Elongator components (Elp1-3) during ESC differentiation. To that end, we performed qPCR analysis at different time points from LIF-withdrawal (D0, D3, D7 and D10). As shown in Fig. 1A, the expression of Elp1 reached a peak on D3 and then gradually decreased, and expressions of both Elp2 and Elp3 were gradually increased until D10. Having established the expression dynamics in differentiating ESCs, expression

H. Yoo et al. / Biochemical and Biophysical Research Communications 478 (2016) 631e636

633

Fig. 1. (A) Expression pattern of core Elongator components (Elp1-3) during ESC differentiation (n ¼ 2). *: p  0.05, ***: p  0.001 (B) ELP3 expression in blastocyst and E10.5 embryo. Scale bar: 50 mm (in blastocyst), 200 mm (E10.5 embryo).

pattern of ELP3 at different developmental stages was examined using IF staining. At the blastocycst stage, ELP3 was enriched in both inner cell mass (ICM) and trophectoderm (TE), suggesting

that ELP3 plays a role in ESC maintenance and/or differentiation. The ubiquitous expression pattern of ELP3 persisted in E10.5 embryos (Fig. 1B).

Fig. 2. Phenotypic analyses of ELP3 depletion in ESCs. (A) The efficiency of ELP3 KDs was analyzed by qPCR (n ¼ 3). p  0.001 (B) AP-positive ESC colonies were counted and categorized as fully, partially or no AP-positive colonies (n  3). Arrows indicate AP-negative cells. ***: p  0.001 (C) The cell proliferation rate (started with 2000 cells) was measured at different time points (D0, D1, D3, and D5) (n  3). (D) The transcript levels of the pluripotent marker genes were analyzed by qPCR (n ¼ 3). Mean values of transcript levels in both KD1 and KD2 were presented. (E) ESCs were subjected to differentiation in culture media without LIF for 5days.

634

H. Yoo et al. / Biochemical and Biophysical Research Communications 478 (2016) 631e636

3.2. ELP3 depletion affects ESCs maintenance and differentiation Using short hairpin (sh) RNA-mediated KD approach (Fig. 2A), we next sought to examine ELP3 function in ESC maintenance and differentiation potential. Elp3 KD ESCs formed many flat colonies containing alkaline phosphatase (AP)-negative cells and grew slowly (Fig. 2B and C). Quantitative RT-PCR analysis revealed that the expression of pluripotent genes, such as Nanog and Sox2, in KD ESCs were decreased when compared to shCont ESCs (Fig. 2D). Interestingly, as shown in Fig. 2E, when KD ESCs were subjected to differentiation in media without LIF, KD ESCs initially formed embryoid bodies (EBs) on D1, but failed to form mature floating EBs

and survive beyond D5. 3.3. ELP3 depletion causes catastrophic cell cycle progression via aberrant protein synthesis As KD ESCs displayed impaired cell proliferation, flow cytometric measurement was carried out to examine impact of ELP3 loss on cell death and cell cycle progression. As shown in Fig. 3A, massive cell death was detected upon Elp3 KD as judged by AnnexinV and PI signals. Interestingly, Elp3 KD does not cause changes in the period of each cell cycle phase of live cells (Fig. 3B). To gain better insight into what causes aberrant cell cycle

Fig. 3. Analysis of the cell cycle in Elp3 KD ESCs. (A) Flow cytometric measurement was performed using FITC-conjugated AnnexinV and propidium iodide (PI). (B) Per-cent of live cells in each cell cycle (n ¼ 2). (C) The levels of proteins related to cell cycle check-point were quantified using Western blotting and qPCR. Mean values of transcript levels in both KD1 and KD2 were presented. Note that although the mRNA levels of the genes were mildly increased, protein levels were drastically reduced in KD ESCs. *: p  0.05, ***: p  0.001 (D) Per-cent of codons that might be affected by ELP3 depletion in cell cycle-related proteins.

H. Yoo et al. / Biochemical and Biophysical Research Communications 478 (2016) 631e636

regulation, the level of proteins related to cell cycle was examined by Western blot analysis. As shown in Fig. 3C, levels of CYCA, CYCB1, CYCD1, CYCE, and CDC2 and inhibitory phospho-CDC2 (G2 end and M end) proteins were decreased in KD ESCs without exception. In contrast to the decreased level of those proteins, however, transcript levels of the genes were even slightly increased in KD ESCs. We found that about 6e12% of putative codons might be affected by ELP3-mediated tRNA modifications were identified in the cell cycle-related genes (Fig. 3D). On the other hand, about 2.9% of codons were found in b-Actin mRNA as the putative ELP3 target codons. Therefore, the data suggest that ELP3 plays a crucial role in ESC viability via regulating translational efficiency of genes. 3.4. Elp3 KO causes embryonic lethality with growth retardation Finally, we sought to address the in vivo role for ELP3 in mouse embryogenesis. To that end, we generated a KO strain using a genetrap allele, in which the genetrap cassette nullified Elp3 expression by insertion in intron 3 (Fig. 4A and B). As shown in Fig. 4C, Elp3 KO causes embryonic lethality by E12.5 and severe growth retardation, which is reminiscent of Elp1 KO mice [21]. 4. Discussion The Elongator complex is known to be involved in transcriptional regulation and tRNA modification in many species and cell types. In the present study, using both KD and KO approaches, we have revealed an essential role for ELP3, a core Elongator component, in ESC survival and early embryogenesis. ELP3 was ubiquitously expressed in both ICM and TE and developing organs, and its expression was increased during ESC differentiation. Upon either Elp3 or Elp1 (data not shown) KD, both ESCs and differentiating cells exhibited aberrant cell cycle progression and underwent massive cell death. Consistent our result, ELP3 has been shown to be a critical regulator in mitotic cell cycle in plant and yeast [11,22,23]. A balanced ELP3 level seems to ensure cell viability as ELP3 overexpression in 293 T cell also inhibits cell cycle progression [24]. Our analyses suggest, therefore, that ELP3 acts in an organ or cell type non-specific manner. Eukaryotic Elongator was initially identified as a part of a

635

transcriptional machinery, in which it interacts with RNA polymerase II and Elongator components were conserved from yeast to human [8,9,25]. Studies showed that Elongator holoenzyme complex (ELP1-6) was required for acetylation at residue lysine (K)-14 of histone H3 and, presumably, K8 of histone H4 [10]. As ELP3 contains sequence homology with HAT, early studies focused on its role in transcriptional regulation via histone acetylation. Our qPCR analysis revealed decreased expression of pluripotent marker genes in KD ESCs. The data suggests that ELP3 function in ESCs is linked, at least in part, to transcriptional regulation. Besides its role in transcription, recent studies demonstrated that Elongator is a critical regulator of protein synthesis via uridine methylation at the wobble position of tRNA. Transfer RNAs such as tRNAGluUUC, tRNALysUUU, tRNAGlnUUG, tRNAArgUCU, and tRNAProUGG were identified as the most affected tRNAs in Elp3 KO yeast [14,18,19]. Our qPCR and Western blot analyses also revealed that failure of cell cycle progression was due to aberrant gene translation. The transcript levels of genes related to cell cycle control, such as Cyca, Cycb1, Cycd1, Cyce and Cdc2 were mildly increased, yet protein levels were drastically decreased in Elp3 KD ESCs. Therefore, our data further supports the notion that function of Elongator in translational regulation is conserved from species to species and from cell to cell. There are more than 20 types of RNA modifications in an organism, and an average of 13 and 11 modifications in single tRNA exist in humans and yeast, respectively [26]. It is thought that the RNA modification mainly functions to stabilize the unique secondary or tertiary structure of tRNAs. In particular, the tRNA modifications at the wobble position have been shown to be important for translational efficiency and fidelity, and prevention of frame-shifts [27]. We found that about 6e12% of putative codons in the cell cycle-related genes might be affected by ELP3-mediated tRNA modifications, based on data from yeast. However, about 2.9% of the putative codons were found in b-Actin mRNA. Therefore, the reduction in protein levels is most likely due to failure of translational progress. Finally, we showed that ELP3 function is essential in early mouse development. Previous studies on Elongator function have demonstrated its indispensable role in the viability of embryos and many biological processes in mice. A study showed that ELP1 was ubiquitously expressed and KO animals exhibited embryonic

Fig. 4. Generation of Elp3 KO mouse. (A) Genomic structure of mouse Elp3 gene and identification of the insertion site of gene trap cassette. DNA sequencing analysis revealed that a gene trap cassette is inserted after 266th bp from 30 end of exon 3. For genotyping, primer sets “a” and “b” were used for WT allele and “a” and “c” were used for trapped allele. Wildtype and mutant bands represent 516bps and about 600bps, respectively. (B) A null mutation was confirmed in E9.5 embryos using qPCR analysis. (C) Phenotypes and genotyping score from Elp3gt/þ intercrosses. Scale bar: 200 mm.

636

H. Yoo et al. / Biochemical and Biophysical Research Communications 478 (2016) 631e636

lethality with severe growth retardation [21]. Lin et al. [28], recently demonstrated that deletion of Elp1 gene causes a global change in mRNA levels and tRNA modifications during mouse spermatogeneis. Collectively, our and others studies suggest that in vivo functions of Elongator require all the core components. Conflict of interest The authors declare that there is no conflict of interest in the study. Acknowledgements This work was supported by research grant of the Dankook University (2013 to K.H.). Authors are indebted to Dr. Yi Zhang, an investigator of Howard Hughes Medical Institute for allowing us to present the Elp3 KO data in the study. We also thank Dr. Sun-Yi Hyun and Ms. Uyanzul Ulziibayar for their technical supports.

[11]

[12]

[13] [14] [15]

[16]

[17]

[18]

[19]

References [1] J. Nichols, A. Smith, Pluripotency in the embryo and in culture, cold spring harb, Perspect. Biol. 4 (2012) a008128. [2] I. Kumar, N. Ivanova, Moving toward the ground state, Cell Stem Cell 17 (2015) 375e376. [3] P.J. Batista, B. Molinie, J. Wang, et al., m(6)A RNA modification controls cell fate transition in mammalian embryonic stem cells, Cell Stem Cell 15 (2014) 707e719. [4] J. Liu, Y. Yue, D. Han, et al., A METTL3-METTL14 complex mediates mammalian nuclear RNA N6-adenosine methylation, Nat. Chem. Biol. 10 (2014) 93e95. [5] X. Wang, Z. Lu, A. Gomez, et al., N6-methyladenosine-dependent regulation of messenger RNA stability, Nature 505 (2014) 117e120. [6] S. Geula1, S. Moshitch-Moshkovitz, D. Dominissini, et al., m6A mRNA methylation facilitates resolution of naïve pluripotency toward differentiation, Science 347 (2015) 1002e1006. [7] K.T. You, J. Park, V.N. Kim, Role of the small subunit processome in the maintenance of pluripotent stem cells, Genes. Dev. 29 (2015) 2004e2009. [8] G. Otero, J. Fellows, Y. Li, et al., Elongator, a multisubunit component of a novel RNA polymerase II holoenzyme for transcriptional elongation, Mol. Cell 3 (1999) 109e118. [9] B.O. Wittschieben, G. Otero, T.D. Bizemont, et al., A novel histone acetyltransferase is an integral subunit of elongating RNA polymerase II holoenzyme, Mol. Cell 4 (1999) 123e128. [10] G.S. Winkler, A. Kristjuhan, H. Erdjument-Bromage, et al., Elongator is a

[20] [21]

[22] [23] [24]

[25]

[26]

[27]

[28]

histone H3 and H4 acetyltransferase important for normal histone acetylation levels in vivo, Proc. Natl. Acad. Sci. U. S. A. 99 (2002) 3517e3522. J. Walker, S.Y. Kwon, P. Badenhorst, et al., Role of elongator subunit Elp3 in Drosophila melanogaster larval development and immunity, Genetics 187 (2011) 1067e1075. Q. Li, A.M. Fazly, H. Zhou, et al., The elongator complex interacts with PCNA and modulates transcriptional silencing and sensitivity to DNA damage agents, PLoS Genet. 5 (2009) e1000684. F. Li, J. Ma, Y. Ma, et al., hElp3 directly modulates the expression of HSP70 gene in HeLa cells via HAT activity, PLoS One 6 (2011) e29303. €m, et al., An early step in wobble uridine B. Huang, M.J. Johansson, A.S. Bystro tRNA modification requires the Elongator complex, RNA 11 (2005) 424e436. C. Mehlgarten, D. Jablonowski, U. Wrackmeyer, et al., Elongator function in tRNA wobble uridine modification is conserved between yeast and plants, Mol. Microbiol. 76 (2010) 1082e1094. Y. Chinenov, A second catalytic domain in the Elp3 histone acetyltransferases: a candidate for histone demethylase activity? Trends Biochem. Sci. 27 (2002) 115e117. K. Selvadurai, P. Wang, J. Seimetz, et al., Archaeal Elp3 catalyzes tRNA wobble uridine modification at C5 via a radical mechanism, Nat. Chem. Biol. 10 (2014) 810e812. M.J. Johansson, A. Esberg, B. Huang, et al., Eukaryotic wobble uridine modifications promote a functionally redundant decoding system, Mol. Cell Biol. 28 (2008) 3301e3312. ndez-Va zquez, I. Vargas-Pe rez, M. Sanso , et al., Modification of J. Ferna tRNA(Lys) UUU by elongator is essential for efficient translation of stress mRNAs, PLoS Genet. 9 (2013) e1003647. B. Hogan, R. Beddington, F. Constantini, et al., Manipulating the Mouse Embryo, second ed., Cold Spring Harbor Laboratory Press, New York, 1994. Y.T. Chen, M.M. Hims, R.S. Shetty, et al., Loss of mouse Ikbkap, a subunit of elongator, leads to transcriptional deficits and embryonic lethality that can be rescued by human IKBKAP, Mol. Cell. Biol. 29 (2009) 736e744. D. Xu, W. Huang, Y. Li, et al., Elongator complex is critical for cell cycle progression and leaf patterning in Arabidopsis, Plant J. 69 (2012) 792e808. F. Bauer, A. Matsuyama, J. Candiracci, et al., Translational control of cell division by Elongator, Cell Rep. 1 (2012) 424e433. J. Gu, D. Sun, Q. Zheng, et al., Human Elongator complex is involved in cell cycle and suppresses cell growth in 293T human embryonic kidney cells, Acta Biochim. Biophys. Sin. (Shanghai) 41 (2009) 831e838. J.H. Kim, W.S. Lane, D. Reinberg, Human Elongator facilitates RNA polymerase II transcription through chromatin, Proc. Natl. Acad. Sci. U. S. A. 99 (2002) 1241e1246. M.A. Machnicka, K. Milanowska, O.O. Oglou, et al., MODOMICS: a database of RNA modification pathwayse2013 update, Nucleic Acids Res. 41 (2013) D262eD267. B. El Yacoubi, M. Bailly, V. de Crecy-Lagard, Biosynthesis and function of posttranscriptional modifications of transfer RNAs, Annu. Rev. Genet. 46 (2012) 69e95. F.J. Lin, L. Shen, C.W. Jang, et al., Ikbkap/Elp1 deficiency causes male infertility by disrupting meiotic progression, PLoS Genet. 9 (2013) e1003516.