- Email: [email protected]
Individual and combined mycotoxins deoxynivalenol, nivalenol, and fusarenon-X induced apoptosis in lymphoid tissues of mice after oral exposure
Toxicon 165 (2019) 83–94
Contents lists available at ScienceDirect
Toxicon journal homepage: www.elsevier.com/locate/toxicon
Individual and combined mycotoxins deoxynivalenol, nivalenol, and fusarenon-X induced apoptosis in lymphoid tissues of mice after oral exposure
T
Sawinee Aupanuna,b, Saranya Poapolathepa,b, Patchara Phuektesc, Mario Giorgid, Zhaowei Zhange, Isabelle P. Oswaldf, Amnart Poapolathepa,b,∗ a
.Department of Pharmacology, Faculty of Veterinary Medicine, Kasetsart University, Bangkok, 10900, Thailand Center for Advanced Studies for Agriculture and Food, KU Institute for Advanced Studies, Kasetsart University, CASAF, NRU-KU, Bangkok, 10900, Thailand Department of Pathobiology, Faculty of Veterinary Medicine, Khonkaen University, Khonkaen, 40002, Thailand d Department of Veterinary Sciences, University of Pisa, Via Livornese, San Piero a Grado, 56122, Pisa, Italy e Oil Crops Research Institute, Chinese Academy of Agricultural Sciences, Wuhan, 430062, China f Toxalim (Research Centre in Food Toxicology), Université de Toulouse, INRA, ENVT, INP-Purpan, UPS, Toulouse, France b c
A R T I C LE I N FO
A B S T R A C T
Keywords: Deoxynivalenol Nivalenol Fusarenon-X Mycotoxin combination Lymphoid tissues
Lymphocytes are involved in the adaptive immune response and are highly sensitive to type B trichothecenes. In grains and their products, deoxynivalenol (DON) is the most widely distributed trichothecene. It usually cooccurs with other type B members, such as nivalenol (NIV) and fusarenon-X (FX), because they are all produced by the same Fusarium fungi. However, the combined effects of mycotoxins are complex and cannot be predicted based on individual toxicity. Thus, the adverse effects of combined toxins are of increasing concern. The aim of this study was to compare the toxicity to lymphoid tissues of mice of DON alone or mixed with NIV or FX. Forty, 3-week-old male ICR mice were given a single oral administration of a vehicle control, one toxin, binary, or ternary mixtures and then sacrificed at 12 h after exposure. Mice treated with FX alone showed marked nuclear condensation and fragmentation of lymphocytes in the cortical thymus and germinal center of Peyer's patches and spleen. Similarly, these animals clearly displayed TUNEL- and Caspase-3-positive cells in the regions. In contrast, minimal changes were noticed in the lymphoid tissues of mice receiving combined toxins when compared to this toxin alone. In addition, oral exposure to FX alone significantly up-regulated the relative expression of Bax, Caspase-3, Caspase-9, and Trp53. These data increase our understanding of the toxic actions of DON, NIV, and FX alone or in combination to lymphocytes and can be used to assess the possible risk associated with their co-occurrences in foodstuffs to human and animal health.
1. Introduction Mycotoxins are defined as hazardous substances to humans and animals in term of chronic toxicity after prolonged exposure (Berthiller et al., 2007; Streit et al., 2012). Their contamination of agricultural commodities are of public health and economic concern. Over 80% of agricultural commodities are contaminated by at least one mycotoxin (Kovalsky et al., 2016; Streit et al., 2013). Among type B trichothecenes, DON is the mycotoxin predominantly found in grains and their products. Maize plants collected in southwest Germany were positive for DON, 15-ADON, NIV, 3-ADON, and FX at 64, 60, 37, 36, and 6%, respectively (Schollenberger et al., 2012). According to Rodrigues and
Naehrer (2012) 59% of 7049 feedstuff samples sourced in the Americas, Europe, and Asia were positive for DON. In Spain, mycotoxins found most commonly in wheat-based samples were DON, HT-2, and NIV with an overall incidence of 79.8%, 16.8% and 13.4%, respectively (Rodríguez-Carrasco et al., 2013). Moreover, more than 60% of milled grain-based products collected in Spain showed DON contamination, followed by NIV with a frequency of 10.4% (Rodríguez-Carrasco et al., 2014). Regarding type B trichothecenes, they can produce by the same fungi. For example, DON is mainly produced by Fusarium culmorum, F. graminearum, and F. sporotrichioides whereas NIV and FX are produced by F. nivale, F. graminearum, and F. crookwellense (Hussein and Brasel, 2001; IARC, 1993). Thus, their co-contamination is usually observed in
∗ Corresponding author. Amnart Poapolathep Department of Pharmacology, Faculty of Veterinary Medicine Kasetsart University, Chatuchak Bangkok, 10900, Thailand. E-mail addresses: [email protected], [email protected] (A. Poapolathep).
https://doi.org/10.1016/j.toxicon.2019.04.017 Received 18 January 2019; Received in revised form 15 April 2019; Accepted 24 April 2019 Available online 02 May 2019 0041-0101/ © 2019 Elsevier Ltd. All rights reserved.
Toxicon 165 (2019) 83–94
S. Aupanun, et al.
(354.355 g/mol) were purchased from Wako Pure Chemical Industries Ltd. (Kyoto, Japan), and dissolved in 10% dimethyl sulfoxide (DMSO) in water to a final concentration of 1 mg/mL for oral administration. Stock solutions of mycotoxins were maintained at −20 °C in the dark. Anti-cleaved caspase-3 (Asp175) was purchased from Cell Signaling Technology (Danvers, USA). E.Z.N.A total RNA kit I was obtained from Omega Bio-tek (Georgia, USA). Im Prom II reverse transcription system was purchased from Promega Corporation (Sydney, Australia). SYBR Green Supermix was obtained from Bio-Rad Laboratories (California, USA).
Table 1 Comparative LD50 values (mg/kg) between DON, NIV, and FX by various routes of administration in mice. Mycotoxin
Animals
LD50 (mg/ kg BW)
Route of administration
References
DON
mice
46–78
Oral
mice
49–70
Intraperitoneal
mice mice mice mice mice
38.9 5–10 5–10 5–10 3–5
Oral Intraperitoneal Subcutaneous Intravenous Irrespective of route of administration
Sobrova et al. (2010) Sobrova et al. (2010) EC, 2000 EC, 2000 EC, 2000 EC, 2000 Ueno (1983)
NIV
FX
2.2. Animals Forty 2-week old male ICR mice were acclimatized to the environment for a week. They were housed in stainless-steel cages (5 mice/ cage) under controlled conditions (temperature: 23 ± 2 °C; 12 h-light/ 12 h-dark) at the Laboratory Animal Unit, Faculty of Veterinary Medicine, Kasetsart University, Bangkok, Thailand. Experimental procedures carried out on animals were approved by the Animal Ethics Research Committee of the Faculty of Veterinary Medicine, Kasetsart University. In addition, the animals were fed commercial feed pellets without DON, NIV, and FX and water ad libitum.
food commodities. To ensure food safety, the FDA has set the limits of DON at 500–2000 ppb in foods and at 5–10,000 ppb in feeds (Mazumder and Sasmal, 2001). DON is the most widely distributed trichothecene but it is less toxic than other members in the family. NIV and FX evoked prolonged feed refusal in mice greater than DON for both intraperitoneal and oral exposure (Wu et al., 2012). Likewise, NIV and FX were of stronger potency than DON by both intraperitoneal and oral administration in the mink emesis model (Wu et al., 2013). Comparative LD50 values (mg/kg) between DON, NIV, and FX by various routes of administration in mice were shown in Table 1. Immune cells are very sensitive to DON because of the induction of ribotoxic stress, ER stress, calcium release, and oxidative stress (Katika et al., 2015). Nevertheless, the degree and mechanism of toxicity of trichothecenes on the immune system is complex. They are immunostimulatory or immunosuppressive depending on dose, exposure frequency and timing of functional immune assays (Pestka et al., 2004). DON significantly upregulated IL-2 and IL-8 production at concentrations of 62.5–500 ng/mL, whereas it significantly increased apoptosis in Jurkat T cells at concentrations of 500–1000 ng/mL (Pestka et al., 2005). DON-induced apoptosis was the result of DNA fragmentation, promoting the activation of cytochrome c and caspases, and changing Bcl-2, Bax, and Bid expression (Bensassi et al., 2009, 2012; Ma et al., 2012). NIV (10–100 μM) significantly stimulated apoptosis in J774A.1 macrophages mediated by caspase-3 activation and cell cycle blocking in the G0/G1 phase (Marzocco et al., 2009). The development of apoptosis was also detected in the thymus, spleen, and Peyer's patch of mice receiving 10 and 15 mg NIV/kg BW (Poapolathep et al., 2002). Intraperitoneal injection of FX (1.5–6 mg/kg BW) provoked thymic atrophy and disappearance of thymocytes in the thymic cortex of mice (Miura et al., 1998). Moreover, repeated exposure to low doses of FX caused lymphocyte mortality in the lymphoid tissues of mice through mitochondrial apoptotic pathway (Aupanun et al., 2015, 2016). Regarding natural co-incidence, humans and animals are commonly exposed to mycotoxin combinations. However, most investigations concern the effect of single toxins. Nowadays, data on the health risks from mycotoxin mixtures are still limited. Furthermore, the toxicity of toxin mixtures is complex and cannot be predicted based on their individual effects (Alassane-Kpembi et al., 2013, 2015). Thus, it would be interesting to assess the effects of mycotoxin mixtures compared to that with each toxin alone. In the present study, the development of apoptosis was determined in the lymphoid tissues of mice after oral exposure to three major type B members (DON, NIV, and FX) alone or in combination.
2.3. Experimental design Animals were randomly divided into 8 groups as follows; (1) Control: 10% DMSO in water served as vehicle control, (2) DON: 2 mg/ kg BW DON, (3) NIV: 5 mg/kg BW NIV, (4) FX: 2.5 mg/kg BW FX, (5) DON + NIV: 2 mg/kg BW DON mixed with 5 mg/kg BW NIV, (6) DON + FX: 2 mg/kg BW DON mixed with 2.5 mg/kg BW FX, (7) NIV + FX: 5 mg/kg BW NIV mixed with 2.5 mg/kg BW FX, and (8) DON + NIV + FX: 2 mg/kg BW DON mixed with 5 mg/kg BW NIV and 2.5 mg/kg BW FX. The dose levels of mycotoxins in the present study was selected based on their LD50 values. Thus, the dose levels of DON, NIV and FX were selected depending on a preliminary study. Five mice in each group were given a single orally administered dose of the substances above. After 12 h of exposure, animals were killed by cervical decapitation under ether anesthesia. Then the thymus, Peyer's patches, and spleen were collected. Half of each tissue sample was kept in 10% neutral buffered formalin for histopathological and immunohistochemical studies. The remaining samples were kept at −80 °C for the determination of apoptosis-related gene expression. 2.4. Histopathological assessment Tissue samples were immediately fixed in 10% neutral buffered formalin. Paraffin sections (4 μM) were stained using hematoxylin and eosin (H&E) staining and observed under a light microscope. Additional paraffin sections were subjected to in situ detection of DNA fragmentation (TUNEL assay) and immunohistochemical staining for cleaved caspase-3. 2.5. In situ detection of DNA fragmentation The modified TUNEL method was conducted to detect DNA fragmentation on the paraffin sections of thymus, Peyer's patches, and spleen of mice by a commercial apoptosis detection kit (ApopTag® Peroxidase in situ Apoptosis Detection Kit; Millipore Inc., Canada). Briefly, paraffin sections were deparaffinized with xylene, rehydrated in a graded series of alcohol solution, and washed in PBS. The sections were pretreated by microwaving 800 W for 5 min in citric acid (pH 6), left at room temperature (RT) for 20 min and washed in PBS. Endogenous peroxidase activity was inactivated with 3% hydrogen peroxide at RT for 10 min and then washed in PBS. The sections were incubated with equilibration buffer for 20 s and then incubated in a prepared deoxygenin labeled-terminal deoxynucleotidyl transferase
2. Materials and methods 2.1. Reagents Standards of DON (296.319 g/mol), NIV (312.318 g/mol), and FX 84
Toxicon 165 (2019) 83–94
S. Aupanun, et al.
Table 2 Lists of forward and reward primers for mRNA expression. Gene
Forward
Reverse
Accession number
Estimated PCR product (bp)
Trp53 Bax Bcl-2 Bid Caspase-3 Caspase-8 Caspase-9 GAPDH
GCTTCTCCGAAGACTGGATG TGCAGAGGATGATTGCTGAC CTGCAAATGCTGGACTGAAA CTCTGCGTTCAGCTTGAGTG TGTCATCTCGCTCTGGTACG GGCCTCCATCTATGACCTGA TGCCCTTGCCTCTGAGTAGT CCACCCAGAAGACTGTGGAT
CTTCACTTGGGCCTTCAAAA GATCAGCTCGGGCACTTTAG TCAGGAGGGTTTCCAGATTG CAGAAGCCCACCTACATGGT TCCCATAAATGACCCCTTCA TGTGGTTCTGTTGCTCGAAG AACAAAGAAACGCCCACAAC CACATTGGGGGTAGGAACAC
NM_011640.3 NM_007527.3 NM_009741.4 NM_007544.3 NM_009810.3 NM_009812.2 NM_001277932.1 NM_001289726.1
195 173 158 206 264 152 163 173
solution with film overlay at 37 °C. After 1 h, films were removed and the sections were incubated in stop wash buffer at RT for 10 min. Then antideoxygenin-labeled peroxidase was dropped onto the sections with film overlay and incubated at RT for 30 min. After that, sections were incubated with diaminobenzidine solution at RT for 5 min, washed in tap water, counterstained by hematoxylin, and observed under light microscope. The TUNEL-positive nuclei stained dark brown. The ratio of TUNEL positive cells to total lymphocytes counted in two randomized fields for each of two sections per animal was calculated and presented as the mean percentage ± SD (TUNEL index = positive nuclei/total lymphocytes ✗ 100) for each group.
260/280 ratio between 2.0 and 2.1. 2.8. Expression of apoptosis-related genes The first strand cDNA was synthesized using Im Prom II reverse transcription system (Sydney, Australia). Briefly, total RNA (100 ng/μL) was mixed with 1 μL of random primer and nuclease-free water (NFW) to a final volume of 5 μL per RT reaction. The mixture was preheated at 70 °C for 5 min and immediately chilled on ice for at least 5 min. The RT-reaction mixture containing 4 μL of 5X reaction buffer, 1.2 μL of MgCl2, 1 μL of dNTPs mixture, 0.5 μL of Ricombinant RNASin®, 1 μL of RT-transcriptase, and NFW adding to make a final volume of 15 μL per cDNA synthesis reaction was prepared. The RT-reaction mixture was added to 5 μL of the RNA-primer mix to make a final reaction volume of 20 μL. A thermal cycler (iCycler®, Bio-Rad Laboratories, Hercules, CA) was used with the following PCR conditions: 25 °C for 5 min, 42 °C for 1 h, followed by 72 °C for 15 min, and then kept at 4 °C until analysis. The cDNA concentration was quantified using a NanoDrop® Spectrophotometer ND-1000. The qPCR was performed by preparing the reaction mixture containing 300 nM forward and reverse primers corresponding to the cDNA sequences of mouse mRNA (Table 2), 100 ng of cDNA template, 5 μL of iQ™ SYBR® Green supermix (Bio-Rad Laboratories, Hercules, CA), and water added to make a final volume of 10 μL per reaction. Cycling conditions were as follows; pre-denaturation at 95 °C for 3 min, denaturation at 95 °C for 15 s, annealing at 55 °C for 30 s (40 cycles), extension at 72 °C for 30 s, and termination at 95 °C for 10 s. The analyzed melting curve was 95 °C, with 0.5 °C increment steps using the CFX96 Real-Time PCR system thermal cycler (Bio-Rad Laboratories, Hercules, CA). Cycle threshold (CT) of each of the target genes was normalized to CT of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as follows;
2.6. Immunohistochemistry for cleaved Caspase-3 The paraffin sections of thymus, Peyer's patches, and spleen of mice were subjected to immunohistochemistry for cleaved caspase-3 using the avidin-biotin-peroxidase complex (ABC) method and a VECTASTAIN Elite ABC kit (Vector Laboratories, USA). Monoclonal anti-cleaved caspase-3 (clone Asp175, 1:200 dilution) rabbit antibody (Danvers, USA) was used as the primary antibody. Biotinylated goat anti-rabbit IgG antibody from the VECTASTAIN ABC kit served as the secondary antibody. The sections were incubated with diaminobenzidine solution for visualizing caspase-3-positive nuclei, counterstained with hematoxylin, and observed under a light microscope. The ratio of caspase-3 positive cells to total lymphocytes counted in two randomized fields for each of two sections per animal was calculated and presented as the mean percentage ± SD (Caspase-3 index = positive nuclei/total lymphocytes ✗ 100) for each group. 2.7. RNA extraction Total RNA was extracted from frozen thymus or Peyer's patches using the E.Z.N.A.™ Total RNA kit I (Georgia, USA) following the manufacturer's protocol with minimal modification. Briefly, ten milligrams of frozen sample was ground with a ceramic mortar and pestle, then homogenized with TRK lysis buffer, and centrifuged at 4 °C 13,000✗g for 5 min. The cleared supernatant was carefully transferred to a clean 1.5 mL centrifuge tube, then 350 μL of 70% ethanol was added, and the solution mixed thoroughly 3–5 times. The samples were applied to a HiBind RNA spin column placed into a 2 mL collection tube, centrifuged at 10,000✗g for 1 min, and flow-through was then discarded. After that, 500 μL of RNA wash buffer I was added onto the HiBind RNA, centrifuged at 10,000✗g for 1 min, and flow-through was then discarded. Then 500 μL of RNA wash buffer II was applied onto the HiBind RNA, centrifuged at 10,000✗g for 1 min, and flow-through was then discarded. The RNA wash buffer II step was performed twice. Finally, the HiBind RNA column was placed in a new collection tube, centrifuged at 4 °C 13,000✗g for 2 min to completely dry the HiBind matrix, and then the column was transferred into a clean 1.5 mL centrifuge tube. 50 μL of DEPC-treated water was added onto the center of the column matrix for eluting RNA and then centrifuged at maximum speed for 2 min. RNA quantity and purity were determined using a NanoDrop® Spectrophotometer ND-1000. All RNA samples showed a
ΔΔCT = ΔCT(treat) − ΔCT(control) ΔCT is the difference in CT between target gene and GAPDH. The fold difference for each treated sample relative to the control sample equals 2−ΔΔCT. 2.9. Statistical analysis The TUNEL and caspase-3 indices as well as the expression of relative mRNA levels are shown as the mean ± standard deviation (SD) of five mice per group. The differences between groups were compared using one-way ANOVA analysis and the Tukey test for pairwise multiple comparisons. Statistical analysis of data was performed using GraphPad Prism version 5.0. (GraphPad Software, Inc. CA, USA). A p-value less than 0.05 was considered statistically significant. 3. Results 3.1. Histopathological finding In the thymus, mice exposed to mycotoxins alone or in combination displayed decreased numbers of lymphocytes when compared to 85
Toxicon 165 (2019) 83–94
S. Aupanun, et al.
Fig. 1. H&E staining of the thymus of mice at 12 HAT. (A) Control, (B) 2 mg/kg DON, (C) 5 mg/kg NIV, (D) 2.5 mg/kg FX, (E) 2 mg/kg DON + 5 mg/kg NIV, (F) 2 mg/kg DON + 2.5 mg/kg FX, (G) 5 mg/kg NIV + 2.5 mg/kg FX, (H) 2 mg/kg DON + 5 mg/kg NIV + 2.5 mg/kg FX. HE x40. Arrows indicate pyknotic nuclei.
the germinal centers of white pulp regions. Marked splenic lesions were seen in mice exposed to FX alone while the changes were less evident in other toxin-treated groups and control animals.
control animals. The main histological lesions observed in the thymus were lymphocytes showing nuclear condensation or fragmentation throughout the cortex and along the cortico-medullary junction. The lesions were clearly seen in animals exposed to FX or NIV alone. However, minimal changes were noted in the thymus of DON-treated animals and all combined mycotoxin-treated groups (Fig. 1). Samples of aggregated lymphoid nodules were collected from the distal jejunum and ileum for histopathological analysis. In the Peyer's patches, nuclear condensation or fragmentation were clearly seen throughout the germinal centers. The lesions were observed in all animals receiving mycotoxins (Fig. 2). Changes in the spleen were mild and characterized by the depletion of lymphocytes and lymphocytes presenting nuclear condensation in
3.2. TUNEL index The in situ detection of DNA fragmentation was carried out on the paraffin sections of the thymus, Peyer's patches, and spleen of mice using the modified TUNEL method. The TUNEL staining of thymus and Peyer's patches of mice are depicted in Figs. 3 and 4, respectively. Nuclear condensation or fragmentation of lymphocytes was strongly TUNEL-positive. The positive nuclei were clearly observed in the cortical thymus and along cortico-medullary junctions of mice exposed to 86
Toxicon 165 (2019) 83–94
S. Aupanun, et al.
Fig. 2. H&E staining of the Peyer's patches of mice at 12 HAT. (A) Control, (B) 2 mg/kg DON, (C) 5 mg/kg NIV, (D) 2.5 mg/kg FX, (E) 2 mg/kg DON + 5 mg/kg NIV, (F) 2 mg/kg DON + 2.5 mg/kg FX, (G) 5 mg/kg NIV + 2.5 mg/kg FX, (H) 2 mg/kg DON + 5 mg/kg NIV + 2.5 mg/kg FX. HE x40. Arrows indicate pyknotic nuclei.
index of apoptotic cells in different lymphoid tissues are presented in Fig. 5. Animals exposed to FX alone had significantly increased percentages of TUNEL index in all lymphoid tissues compared to animals receiving DON alone, NIV alone, binary, ternary combinations, or vehicle control. Nevertheless, the thymus and spleen of NIV-treated animals had greater indices than mice exposed to DON alone, combined mycotoxins, or vehicle control. Thus, the TUNEL indices in groups receiving mycotoxin mixtures seem to be lower than that of single toxin treatment in all lymphoid tissues but no significant differences among animals exposed to mycotoxin combinations was observed. In addition, higher TUNEL index were noted in Peyer's patches than that of other lymphoid tissues.
single toxins, especially FX or NIV, compared to those exposed to combined mycotoxin and vehicle control (Fig. 3). In addition, the nuclei of lymphocytes positive to TUNEL were markedly evident in the germinal centers of Peyer's patches of single toxin-treated animals whereas a small number of these nuclei were present in the aggregated lymphoid nodules of binary or ternary mycotoxin-treated mice (Fig. 4). In spleen, the positive nuclei were less common. However, the positive cells can be clearly observed in the germinal centers of white pulp areas in groups receiving single toxins compared to mycotoxin combinations and control groups. The expression of nuclear condensation in lymphoid tissues was then estimated by counting strongly TUNEL-positive cells. The TUNEL 87
Toxicon 165 (2019) 83–94
S. Aupanun, et al.
Fig. 3. TUNEL staining of the thymus of mice at 12 HAT. (A) Control, (B) 2 mg/kg DON, (C) 5 mg/kg NIV, (D) 2.5 mg/kg FX, (E) 2 mg/kg DON + 5 mg/kg NIV, (F) 2 mg/kg DON + 2.5 mg/kg FX, (G) 5 mg/kg NIV + 2.5 mg/kg FX, (H) 2 mg/kg DON + 5 mg/kg NIV + 2.5 mg/kg FX. HE x40. Arrows indicate TUNEL-positive cells.
less Caspase-3 activity in all lymphoid tissues than those given individual mycotoxin treatment. However, no significant differences in Caspase-3 indices among the groups administered mycotoxin mixtures were noted.
3.3. Caspase-3 index The immunoexpression of cleaved caspase-3 in the lymphoid tissues was quantified by counting intensely positive immunostaining of lymphocytes. The Caspase-3 indices in different lymphoid tissues are demonstrated in Fig. 6. Relative to TUNEL indices, a significant increase in Caspase-3 indices was observed in all lymphoid tissues of animals receiving FX alone compared to individual DON, NIV, binary, ternary mixtures, or vehicle control. Furthermore, the oral administration of NIV alone significantly increased the percentages of Caspase-3 in the thymus and spleen when compared to control animals. As with the TUNEL indices, animals exposed to mycotoxin combinations showed
3.4. Expression of apoptosis-related genes The expressions of apoptosis-related genes and the reference gene GAPDH after individual or combined mycotoxin treatment were quantified in the thymus and Peyer's patches of mice by qPCR (Table 2). The Bax, and Trp53 mRNA expressions from the thymus of animals treated with FX alone were significantly up-regulated when compared to the 88
Toxicon 165 (2019) 83–94
S. Aupanun, et al.
Fig. 4. TUNEL staining of the Peyer's patches of mice at 12 HAT. (A) Control, (B) 2 mg/kg DON, (C) 5 mg/kg NIV, (D) 2.5 mg/kg FX, (E) 2 mg/kg DON + 5 mg/kg NIV, (F) 2 mg/kg DON + 2.5 mg/kg FX, (G) 5 mg/kg NIV + 2.5 mg/kg FX, (H) 2 mg/kg DON + 5 mg/kg NIV + 2.5 mg/kg FX. HE x40. Arrows indicate TUNELpositive cells.
control mice.
control but no differences were noted for the other toxins-treated groups. (Fig. 7). In the Peyer's patches, significant upregulation of Bax and Trp53 was observed in animals receiving FX alone when compared to ternary combination and vehicle control (Fig. 8). A significant increase of Caspase-3 mRNA was noted in the thymus and Peyer's patches of mice exposed to FX alone compared to animals receiving DON alone, binary combination of DON and NIV, or the vehicle control (Figs. 7 and 8). Furthermore, the expression of Caspase-9 gene was significantly increased in the thymus and Peyer's patches of animals receiving FX alone. In contrast, the relative expressions of Caspase-8, Bid, Bcl, FAS, and TNF mRNA in both thymus and Peyer's patches remained unchanged in all groups exposed to tested toxins when compared to
4. Discussion The toxicity of mycotoxin combinations is complicated and cannot be predicted based on the toxicity of individual toxins (AlassaneKpembi et al., 2013, 2015). In this work, mice were exposed to three major type B trichothecenes (DON, NIV, and FX) alone or in combination. DON is a common fusariotoxin contaminate in cereals (Rodríguez-Carrasco et al., 2013; 2014; Schollenberger et al., 2012), NIV and FX have higher toxic potency than other members in the family (Wu et al., 2012, 2013). The development of apoptosis was detected in 89
Toxicon 165 (2019) 83–94
S. Aupanun, et al.
Fig. 5. Changes in the TUNEL index of thymus (A), Peyer's patches (B), and spleen (C) of mice after single or combined mycotoxins administration. Each value represents mean ± SD of 5 mice (n = 5). Different letters represent significant difference (p < 0.05).
to DON, NIV, and FX. As in the thymus, we observed minimal changes in mice receiving mycotoxin combinations. The spleen is the largest secondary immune organ in the body. The white pulp of the spleen consists of B- and T cell compartments (Cesta, 2006; van Krieken, 1997). Bracarense et al. (2016) demonstrated that rats exposed to a DON-contaminated diet displayed lymphocyte depletion and characteristics of lymphocyte apoptosis in the spleen. Correspondingly, we found a small number of lymphocytes with nuclear condensation in the germinal centers of all mice receiving mycotoxins when compared to vehicle control. Marked changes were detected in mice exposed to FX alone. However, the changes were less evident in other toxin-treated groups and control animals. TdT-mediated dUTP-biotin nick end labeling (TUNEL) staining is one of the most widely used technique to detect DNA damage in situ (Gavrieli et al., 1992). It is a method for staining cells that exhibit the biochemical hallmark of apoptosis and internucleosomal DNA fragmentation (Bortner et al., 1995). Nevertheless, TUNEL staining may also detect DNA damage associated with necrotic cell death (Ansari et al., 1993) and cells undergoing active DNA repair (Kanoh et al., 1999). Thus, this technique may be considered generally as a method for the detection of DNA fragmentation, it can be assumed that TUNELpositive cells are apoptotic cells. Poapolathep and coworkers (Poapolathep et al., 2002) reported that the nuclei of lymphocytes presenting with nuclear condensation or fragmentation were strongly stained by TUNEL. Accordingly, we found that lymphocytes showing ultrastructural characteristics of apoptosis stained intensely with the TUNEL method. These TUNEL-positive cells were clearly seen in the cortex of the thymus and the germinal centers of Peyer's patches and the spleen of mice given FX alone when compared to the latter groups and control animals. However, the TUNEL index was much lower in the
lymphoid tissues of mice after oral administration. The cortex of the thymus is largely populated by active immature lymphocytes while the corticomedullary junction and medulla region are less densely cellular than the cortex (Pearse, 2006). In this study, nuclear condensation and fragmentation of lymphocytes were clearly observed in the cortical thymus after mycotoxin treatment when compared to control (Fig. 1.). Accordingly, mice receiving 5, 10, 15 mg NIV/kg BW exhibited marked condensation of nuclear chromatin and fragmentation of nuclei throughout the cortex and the border between the cortex and medulla (Poapolathep et al., 2002). Recently, Aupanun et al. (2015) demonstrated nuclei of lymphocytes showing nuclear condensation or fragmentation in the cortical thymus of FX-treated mice. Furthermore, co-exposure of lipopolysaccharide and DON markedly increased the characteristic features of lymphocyte apoptosis in the thymus of mice (Zhou et al., 2000). These data indicated that immature lymphocytes in the cortex area are sensitive to DON, NIV, and FX. In contrast, we observed the changes of lymphocytes were less evident in these regions after combined mycotoxins treatment. Peyer's patches are considered to be the immune sensors of the intestine (Jung et al., 2010). The germinal center contains proliferating Blymphocytes, follicular dendritic cells and macrophages. In this work, lymphocyte depletion and condensation of nuclear chromatin were noted in these regions after mycotoxins treatment (Fig. 2.). Similarly, there was a dose-dependent increase in the number of lymphocytes showing nuclear condensation in all Peyer's patch structures of NIV only-treated animals (Poapolathep et al., 2002). Likewise, 14-day repeated FX exposure evoked the reduction of lymphocytes numbers and condensation of nuclear chromatin in the germinal center at sites of B cell proliferation (Aupanun et al., 2015). These results indicated that lymphocytes in the germinal center of Peyer's patches were susceptible 90
Toxicon 165 (2019) 83–94
S. Aupanun, et al.
Fig. 6. Changes in the caspase-3 index of thymus (A), Peyer's patches (B), and spleen (C) of mice after single or combined mycotoxins administration. Each value represents mean ± SD of 5 mice (n = 5). Different letters represent significant difference (p < 0.05).
lymphocytes for all tested mycotoxins is not reliant on the death receptor pathway. The intrinsic signaling pathway involves the alteration of the inner mitochondrial membrane, contributing to an opening of the mitochondrial permeability transition (MPT) pore, loss of mitochondrial transmembrane potential, and release of pro-apoptotic proteins from the intermembrane space into the cytosol (Elmore, 2007; Saelens et al., 2004). The family of Bcl-2 proteins regulates the apoptotic mitochondrial events (Elmore, 2007). It consists of two functional classes of proteins including anti-apoptotic members, such as Bcl-2, Bcl-xL, and Bcl-w, and pro-apoptotic molecules, such as Bax, Bad, Bak, Bid (Ma et al., 2012; Tsujimoto and Shimizu, 2000). Furthermore, the tumor suppressor protein p53 has a critical role in regulation of the Bcl-2 family of proteins (Elmore, 2007). Formerly, it has been shown that DON acts as a direct genotoxin agent, leading to a p53 and mitochondriarelated caspase-dependent apoptotic pathway (Bensassi et al., 2009, 2012; Ma et al., 2012). Additionally, the induction of apoptosis in developing mouse brain in FX-treated dams was defined as an intrinsic apoptotic incident (Sutjarit et al., 2014). Similarly, 14-day repeated exposure of FX exerted apoptosis in lymphocytes through an effect on p53 and caspase-dependent mitochondrial events (Aupanun et al., 2016). Considering the results, we found that the significant upregulation of Bax, Trp53, Caspase-9, and Caspase-3 mRNA was clearly seen in the thymus and Peyer's patches of mice receiving only FX. Type B trichothecenes consist of an epoxytrichothecene nucleus with the presence of hydroxyl or acetyl groups at the appropriate
lymphoid tissues of mice receiving mycotoxin mixtures. The increase in the mortality of lymphocytes after mycotoxin treatment was confirmed by immunostaining for cleaved caspase-3. Induction of lymphocyte apoptosis by DON, NIV, and FX has been previously evaluated with in vivo or in vitro models (Aupanun et al., 2015, 2016; Bracarense et al., 2016; Gerez et al., 2015; Poapolathep et al., 2002; Zhou et al., 2000). In the present study, we confirmed that all tested toxins induced lymphocyte mortality through caspase-3 activity. In addition, mycotoxin combinations seemed to be less potent to lymphocytes than single toxins. Furthermore, Peyer's patches and thymus were more affected by these toxins than the spleen. The mechanisms of apoptosis are highly complicated. To date, two main apoptotic pathways have been revealed. In the death receptor pathway, five different death receptors are known including tumor necrosis factor (TNF) receptor-1, CD95 (Fas/APO-1), TNF-receptor-related apoptosis-mediated protein (TRAMP) and TNF-related apoptosisinducing ligand (TRAIL) receptor-1 and -2 (Schulze-Osthoff et al., 1998). The sequence of events that define the extrinsic phase of apoptosis are best characterized with the FasL/FasR and TNF-α/TNFR1 ligands (Elmore, 2007). Once caspase-8 is activated, the execution phase of apoptosis is triggered (Elmore, 2007). Previously, 14-days of FX exposure did not upregulate the expression of gene-related extrinsic apoptotic events (Aupanun et al., 2016). In the present study, the relative expressions of TNF, FAS, and Caspase-8 mRNA in Peyer's patches and thymus of all treatment groups remain unchanged when compared to the control group. These results suggest that the toxic effects on 91
Toxicon 165 (2019) 83–94
S. Aupanun, et al.
Fig. 7. Relative expression levels of apoptosis-related genes in the thymus from mycotoxin-treated mice. Each value represents the mean ± SD from five mice in each group. Different letters represent significant difference (p < 0.05).
the potential to modulate the transmembrane efflux of other co-occurring P glycoprotein-substrates (Ivanova et al., 2018). In our previous study, the most combined toxicity between DON, NIV, and FX in Jurkat T cells showed antagonistic effects, especially the ternary combination (Aupanun et al., 2019). The antagonism was also observed in the combination between DON and FX in IPEC-1 cells (Alassane Kpembi et al., 2015) and the tertiary combination of DON, NIV, and FX in Caco2 cells (Alassane Kpembi et al., 2013). Conversely, synergistic effect was noticed in the mixtures of DON and NIV in IPEC-1 and Caco-2 cells (Alassane-Kpembi et al., 2013, 2015) and DON and FX mixtures in Caco-2 cells (Alassane Kpembi et al., 2013). Thus, the effects of mycotoxin mixtures differ in the mixtures of mycotoxins, ratio and/or concentrations for each mycotoxin combination, type of cell lines, as well as the method used to determine the dose-effect relationship (Aupanun et al., 2019). Interestingly, the present study demonstrated that the combined treatment caused lymphocyte apoptosis that was less than
positions. They are small molecules that are likely to absorb rapidly in the gastrointestinal tract (Cavret and Lecoeur, 2006). Thus, the mode of molecular absorption may account for the complexity in toxicity for mycotoxins in combination. The more lipophilic a molecule is, the better it crosses intestinal barrier (Wils et al., 1994). FX is more lipophilic than NIV, so it is absorbed from the gastrointestinal tract more rapidly than NIV (Poapolathep et al., 2003). Furthermore, NIV is less lipophilic than DON (Cavret and Lecoeur, 2006). In mice, DON crosses the intestinal barrier faster than NIV (Azcona-Olivera et al., 1995; Cavret and Lecoeur, 2006). Regarding to intestinal absorptions in vitro, absorption rates of DON and NIV were 51% and 21%, respectively (Avantaggiato et al., 2004). In addition to lipophilicity, cellular active transport systems might account for the differences in intrinsic toxicity of tested mycotoxins. It has been revealed that DON and NIV were substrates for both P-glycoprotein and MRP2 efflux transporters (Tep et al., 2007; Videmann et al., 2007). Moreover, DON appeared to have 92
Toxicon 165 (2019) 83–94
S. Aupanun, et al.
Fig. 8. Relative expression levels of apoptosis-related genes in the Peyer's patches from mycotoxin-treated mice. Each value represents the mean ± SD from five mice in each group. Different letters represent significant difference (p < 0.05).
that of individual exposure. It could be speculated that the tested mycotoxins have different efficacy for crossing the intestinal barrier and affinity to their targets. One tested mycotoxin might disturb the absorption or elimination of the other when they co-occur (Cavaliere et al., 2005). They could compete for binding transporters or target sites. Nevertheless, these hypotheses require further investigation.
present together. This data might assist with assessing the health risk in agricultural commodities. However, further investigation is needed.
5. Conclusions
Ethical form
The present study indicated that DON, NIV, and FX, individually, induce cell death through caspase-dependent mechanisms and via the intrinsic apoptotic pathway. Among type B trichothecenes, FX is the most toxic. Nevertheless, results suggest that combined toxins provoke less lymphocyte mortality than DON, NIV, or FX alone. This toxicological action is of practical importance as these toxins are often
Individual and combined mycotoxins deoxynivalenol, nivalenol, and fusarenon-X induced apoptosis in lymphoid tissues of mice after oral exposure All experimental procedures were performed according to the Guideline for All Experiments, and approved by the Ethics Research Committee of the Faculty of Veterinary Medicine, Kasetsart University.
Conflict of interest There is no conflict of interests in association with the present study.
93
Toxicon 165 (2019) 83–94
S. Aupanun, et al.
Acknowledgements
Jung, J., Hugot, J.P., Barreau, F., 2010. Peyer's patches: the immune sensors of the intestine. Int. J. Inflamm. 1–12. Kanoh, M., Takemura, G., Misao, J., Hayakawa, Y., Aoyama, T., Nishigaki, K., Noda, T., Fujiwara, T., Fukuda, K., Minatoguchi, S., Fujiwara, H., 1999. Significance of myocytes with positive DNA in situ nick end-labeling (TUNEL) in hearts with dilated cardiomyopathy. Not apoptosis but DNA repair. Circulation 99, 2757–2764. Katika, M.R., Hendriksen, P.J.M., van Loveren, H., Peijnenburg, A.A.C.M., 2015. Characterization of the modes of action of deoxynivalenol (DON) in the human Jurkat T-cell line. J. Immunotoxicol. 12, 206–216. Kovalsky, P., Kos, G., Nährer, K., Schwab, C., Jenkins, T., Schatzmayr, G., Sulyok, M., Krska, R., 2016. Co-occurrence of regulated, masked and emerging mycotoxins and secondary metabolites in finished feed and maize—an extensive survey. Toxins 8 E363. Ma, Y., Zhang, A., Shi, Z., He, C., Ding, J., Wang, X., Ma, J., 2012. A mitochondria mediated apoptotic pathway induced by deoxynivalenol in human colon cancer cells. Toxicol. Vitro 26, 414–420. Marzocco, S., Russo, R., Bianco, G., Autore, G., Severino, L., 2009. Pro-apoptotic effects of nivalenol and deoxynivalenol trichothecenes in J774A.1 murine macrophages. Toxicol. Lett. 189, 21–26. Mazumder, P.M., Sasmal, D., 2001. Mycotoxins – limits and regulations. Ancient Sci. Life 20, 1–19. Miura, K., Nakajima, Y., Yamanaka, N., Terao, K., Shibato, T., Ishino, S., 1998. Induction of apoptosis with fusarenon-X in mouse thymocytes. Toxicology 127, 195–206. Pearse, G., 2006. Normal structure, function and histology of the thymus. Toxicol. Pathol. 34, 504–514. Pestka, J.J., Uzarski, R.L., Islam, Z., 2005. Induction of apoptosis and cytokine production in the Jurkat human T cells by deoxynivalenol: role of mitogen-activated protein kinases and comparison to other 8-ketotrichothecenes. Toxicology 206, 207–219. Pestka, J.J., Zhou, H.R., Moon, Y., Chung, Y.J., 2004. Cellular and molecular mechanisms for immune modulation by deoxynivalenol and other trichothecenes: unraveling a paradox. Toxicol. Lett. 153, 61–73. Poapolathep, P., Ohtsuka, R., Kiatipattanasakul, W., Ishigami, N., Nakayama, H., Doi, K., 2002. Nivalenol–induced apoptosis in thymus, spleen and Peyer's patches of mice. Exp. Toxicol. Pathol. 53, 441–446. Poapolathep, A., Sugita-Konishi, Y., Doi, K., Kumagai, S., 2003. The fates of trichothecene mycotoxins, nivalenol and fusarenon-X, in mice. Toxicon 41, 1047–1054. Rodrigues, I., Naehrer, K., 2012. A three-year survey on the worldwide occurrence of mycotoxins in feedstuffs and feed. Toxins 4, 663–675. Rodríguez-Carrasco, Y., Moltó, J.C., Berrada, H., Mañes, J., 2014. A survey of trichothecenes, zearalenone and patulin in milled grain-based products using GC– MS/ MS. Food Chem. 146, 212–219. Rodríguez-Carrasco, Y., Ruiz, M.J., Font, G., Berrada, H., 2013. Exposure estimates to Fusarium mycotoxins through cereals intake. Chemosphere 93, 2297–2303. Saelens, X., Festjens, N., Varde, Walle L., van Gurp, M., van Loo, G., Vandenabeele, P., 2004. Toxic proteins released from mitochondria in cell death. Oncogene 23, 2861–2874. Schollenberger, M., Müller, H.M., Ernst, K., Sondermann, S., Liebscher, M., Schlecker, C., Wischer, G., Drochner, W., Hartung, K., Piepho, H.P., 2012. Occurrence and distribution of 13 trichothecene toxins in naturally contaminated maize plants in Germany. Toxins 4, 778–787. Schulze-Osthoff, K., Ferrari, D., Los, M., Wesselborg, S., Peter, M.E., 1998. Apoptosis signaling by death receptors. Eur. J. Biochem. 254, 439–459. Sobrova, P., Adam, V., Vasatkova, A., Beklova, M., Zeman, L., Kizek, R., 2010. Deoxynivalenol and its toxicity. Interdiscip. Toxicol. 3, 94–99. Streit, E., Nährer, K., Rodrigues, I., Schatzmayr, G., 2013. Mycotoxin occurrence in feed and feed raw materials worldwide: long-term analysis with special focus on Europe and Asia. J. Sci. Food Agric. 93, 12. Streit, E., Schatzmayr, G., Tassis, P., Tzika, E., Marin, D., Taranu, I., Tabuc, C., Nicolau, A., Aprodu, I., Puel, O., Oswald, I.P., 2012. Current situation of mycotoxin contamination and co-occurrence in animal feed-focus on Europe. Toxins 4, 788–809. Sutjarit, S., Nakayama, S.M., Ikenaka, Y., Ishizuka, M., Banlunara, W., Rerkamnuaychoke, W., Kumagai, S., Poapolathep, A., 2014. Apoptosis and gene expression in the developing mouse brain of fusarenon-X treated pregnant mice. Toxicol. Lett. 229, 292–302. Tep, J., Videmann, B., Mazallon, M., Balleydier, S., Cavret, S., Lecoeur, S., 2007. Transepithelial transport of fusariotoxin nivalenol: mediation of secretion by ABC transporters. Toxicol. Lett. 170, 248–258. Tsujimoto, Y., Shimizu, S., 2000. Bcl-2 family: life-or-death switch. FEBS Lett. 466, 6–10. Ueno, Y., 1983. Trichothecenes - Chemical, Biological and Toxicological Aspects. Kodansha and Elsevier Science, Tokyo, Japan. van Krieken, J.H.J.M., 1997. Histology of the spleen: structure and cellular distribution in the normal spleen. Curr. Diagn. Pathol. 4, 100–105. Videmann, B., Tep, J., Cavret, S., Lecoeur, S., 2007. Epithelial transport of deoxynivalenol: Involvement of human P-glycoprotein (ABCB1) and multidrug resistanceassociated protein 2 (ABCC2). Food Chem. Toxicol. 45, 1938–1947. Wils, P., Warnery, A., Phung-Ba, V., Legrain, S., Scherman, D., 1994. High lipophilicity decreases drug transport across intestinal epithelial cells. J. Pharmacol. Exp. Ther. 269, 654–658. Wu, W., Flannery, B.M., Sugita-Konishi, Y., Watanabe, M., Zhang, H., Pestka, J.J., 2012. Comparison of murine anorectic responses to the 8-ketotrichothecenes 3- acetyldeoxynivalenol, 15-acetyldeoxynivalenol, fusarenon-X and nivalenol. Food Chem. Toxicol. 50, 2056–2061. Wu, W., Bates, M.A., Bursian, S.J., Link, J.E., Flannery, B.M., Sugita-Konishi, Y., Watanabe, M., Zhang, H., Pestka, J.J., 2013. Comparison of emetic potencies of the 8ketotrichothecenes deoxynivalenol, 15-aetyldeoxynivalenol, 3-acetyldeoxynivalenol, fusarenon-X and nivalenol. Toxicol. Sci. 131, 279–291. Zhou, H.R., Harkema, J.R., Hotchkiss, J.A., Yan, D., Roth, R.A., Pestka, J.J., 2000. Lipopolysaccharide and the trichothecene vomitoxin (deoxynivalenol) synergistically induce apoptosis in murine lymphoid organs. Toxicol. Sci. 53, 253–263.
This work was partially supported by the Center for Advanced Studies for Agriculture and Food Institute for Advanced Studies, Kasetsart University under the Higher Education Research Promotion and National Research University Project of Thailand, Office of the Higher Education Commission, Ministry of Education, Thailand. Authors acknowledge the English editing of the manuscript to Dr. H. Owen (University of Queensland, Australia). Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.toxicon.2019.04.017. References Alassane-Kpembi, I., Kolf-Clauw, M., Gauthier, T., Abrami, R., Biola, F.A., Oswald, I.P., Puel, O., 2013. New insights into mycotoxin mixtures: the toxicity of low doses of Type B trichothecenes on intestinal epithelial cells is synergistic. Toxicol. Appl. Pharmacol. 272, 191–198. Alassane-Kpembi, I., Oswald, I.P., Puel, O., 2015. Toxicological interactions between the mycotoxins deoxynivalenol, nivalenol and their acetylated derivatives in intestinal epithelial cells. Arch. Toxicol. 89, 1337–1346. Ansari, B., Coates, P.J., Greenstein, B.D., Hall, P.A., 1993. In situ end labeling detects DNA strand breaks in apoptosis and other physiological and pathological states. J. Pathol. 170, 1–8. Aupanun, S., Phuektes, P., Poapolathep, S., Alassane-Kpembi, I., Oswald, I.P., Poapolathep, A., 2019. Individual and combined cytotoxicity of major trichothecenes type B, deoxynivalenol, nivalenol, and fusarenon-X on Jurkat human T cells. Toxicon 160, 29–37. Aupanun, S., Phuektes, P., Poapolathep, S., Sutjarit, S., Giorgi, M., Poapolathep, A., 2016. Apoptosis and gene expression in Jurkat human T cells and lymphoid tissues of fusarenon-X-treated mice. Toxicon 123, 15–24. Aupanun, S., Poapolathep, S., Imsilp, K., Prapong, T., Poapolathep, A., 2015. Oral exposure of fusarenon-X induced apoptosis in Peyer's patches, thymus, and spleen of mice. Res. Vet. Sci. 102, 217–222. Avantaggiato, G., Havenaar, R., Visconti, A., 2004. Evaluation of the intestinal absorption of deoxynivalenol and nivalenol by an in vitro gastrointestinal model, and the binding efficacy of activated carbon and other adsorbent materials. Food Chem. Toxicol. 42, 817–824. Azcona-Olivera, J.I., Ouyang, Y., Murtha, J., Chu, F.S., Pestka, J.J., 1995. Induction of cytokine mRNAs in mice after oral exposure to the trichothecene vomitoxin (deoxynivalenol): relationship to toxin distribution and protein synthesis inhibition. Toxicol. Appl. Pharmacol. 133, 109–120. Bensassi, F., Gallerne, C., Sharaf, O., Dein, E.L., Lemaire, C., Hajlaoui, M.R., Bacha, H., 2012. Involvement of mitochondria-mediated apoptosis in deoxynivalenol cytotoxicity. Food Chem. Toxicol. 50, 1680–1689. Bensassi, F., Golli-Bennour, E.E., Abid-Essefi, S., Bouaziz, C., Hajlaoui, M.R., Bacha, H., 2009. Pathway of deoxynivalenol-induced apoptosis in human colon carcinoma cells. Toxicology 264, 104–109. Berthiller, F., Sulyok, M., Krska, R., Schuhmacher, R., 2007. Chromatographic methods for the simultaneous determination of mycotoxins and their conjugates in cereals. Int. J. Food Microbiol. 119, 33–37. Bortner, C.D., Oldenburg, N.B.E., Cidlowski, J.A., 1995. The role of DNA fragmentation in apoptosis. Trends Cell Biol. 5, 21–26. Bracarense, A.P.F.L., Bosso, K.M., da Silva, E.O., Payros, D., Oswald, I.P., 2016. Deoxynivalenol in the liver and lymphoid organs of rats: effects of dose and duration on immunohistological changes. World Mycotoxin J. 10, 89–96. Cavaliere, C., Foglia, P., Pastorini, E., Samperi, R., Laganà, A., 2005. Development of a multiresidue method for analysis of major Fusarium mycotoxins in corn meal using liquid chromatography/tandem mass spectrometry. Rapid Commun. Mass Spectrom. 19, 2085–2093. Cavret, S., Lecoeur, S., 2006. Fusariotoxin transfer in animal. Food Chem. Toxicol. 44, 444–453. Cesta, M.F., 2006. Normal structure, function, and histology of the spleen. Toxicol. Pathol. 34, 455–465. Elmore, S., 2007. Apoptosis: a review of programmed cell death. Toxicol. Pathol. 35, 495–516. European Commission, 2000. Scientific Committee on Food SCF/CS/CNTM/MYC/26 Final of 19 October 2000 Opinion of the Scientific Committee on Food on Fusarium Toxins Part 4: Nivalenol. Health & Consumer Protection Directorate-General C3. Gavrieli, Y., Sherman, Y., Ben-Sasson, S.A., 1992. Identification of programmed cell death in situ via specific labeling of nuclear DNA fragmentation. J. Cell Biol. 119, 493–501. Gerez, J.R., Pinton, P., Callu, P., Grosjean, F., Oswald, I.P., Bracarense, A.P.F.L., 2015. Deoxynivalenol alone or in combination with nivalenol and zearalenone induce systemic histological changes in pigs. Exp. Toxicol. Pathol. 67, 89–98. Hussein, H.S., Brasel, J.M., 2001. Toxicity, metabolism, and impact of mycotoxins on humans and animals. Toxicology 167, 101–134. IARC, 1993. Toxins derived from Fusarium graminearum, F. culmorum and F. crookwellense; zearalenone, deoxynivalenol, nivalenol and fusarenon-X. IARC Monographs on the Evaluation of Carcinogenic Risks to Humans, vol. 56. Ivanova, L., Fæste, C.K., Solhaug, A., 2018. Role of P-glycoprotein in deoxynivalenolmediated in vitro toxicity. Toxicol. Lett. 284, 21–28.
94
Contents lists available at ScienceDirect
Toxicon journal homepage: www.elsevier.com/locate/toxicon
Individual and combined mycotoxins deoxynivalenol, nivalenol, and fusarenon-X induced apoptosis in lymphoid tissues of mice after oral exposure
T
Sawinee Aupanuna,b, Saranya Poapolathepa,b, Patchara Phuektesc, Mario Giorgid, Zhaowei Zhange, Isabelle P. Oswaldf, Amnart Poapolathepa,b,∗ a
.Department of Pharmacology, Faculty of Veterinary Medicine, Kasetsart University, Bangkok, 10900, Thailand Center for Advanced Studies for Agriculture and Food, KU Institute for Advanced Studies, Kasetsart University, CASAF, NRU-KU, Bangkok, 10900, Thailand Department of Pathobiology, Faculty of Veterinary Medicine, Khonkaen University, Khonkaen, 40002, Thailand d Department of Veterinary Sciences, University of Pisa, Via Livornese, San Piero a Grado, 56122, Pisa, Italy e Oil Crops Research Institute, Chinese Academy of Agricultural Sciences, Wuhan, 430062, China f Toxalim (Research Centre in Food Toxicology), Université de Toulouse, INRA, ENVT, INP-Purpan, UPS, Toulouse, France b c
A R T I C LE I N FO
A B S T R A C T
Keywords: Deoxynivalenol Nivalenol Fusarenon-X Mycotoxin combination Lymphoid tissues
Lymphocytes are involved in the adaptive immune response and are highly sensitive to type B trichothecenes. In grains and their products, deoxynivalenol (DON) is the most widely distributed trichothecene. It usually cooccurs with other type B members, such as nivalenol (NIV) and fusarenon-X (FX), because they are all produced by the same Fusarium fungi. However, the combined effects of mycotoxins are complex and cannot be predicted based on individual toxicity. Thus, the adverse effects of combined toxins are of increasing concern. The aim of this study was to compare the toxicity to lymphoid tissues of mice of DON alone or mixed with NIV or FX. Forty, 3-week-old male ICR mice were given a single oral administration of a vehicle control, one toxin, binary, or ternary mixtures and then sacrificed at 12 h after exposure. Mice treated with FX alone showed marked nuclear condensation and fragmentation of lymphocytes in the cortical thymus and germinal center of Peyer's patches and spleen. Similarly, these animals clearly displayed TUNEL- and Caspase-3-positive cells in the regions. In contrast, minimal changes were noticed in the lymphoid tissues of mice receiving combined toxins when compared to this toxin alone. In addition, oral exposure to FX alone significantly up-regulated the relative expression of Bax, Caspase-3, Caspase-9, and Trp53. These data increase our understanding of the toxic actions of DON, NIV, and FX alone or in combination to lymphocytes and can be used to assess the possible risk associated with their co-occurrences in foodstuffs to human and animal health.
1. Introduction Mycotoxins are defined as hazardous substances to humans and animals in term of chronic toxicity after prolonged exposure (Berthiller et al., 2007; Streit et al., 2012). Their contamination of agricultural commodities are of public health and economic concern. Over 80% of agricultural commodities are contaminated by at least one mycotoxin (Kovalsky et al., 2016; Streit et al., 2013). Among type B trichothecenes, DON is the mycotoxin predominantly found in grains and their products. Maize plants collected in southwest Germany were positive for DON, 15-ADON, NIV, 3-ADON, and FX at 64, 60, 37, 36, and 6%, respectively (Schollenberger et al., 2012). According to Rodrigues and
Naehrer (2012) 59% of 7049 feedstuff samples sourced in the Americas, Europe, and Asia were positive for DON. In Spain, mycotoxins found most commonly in wheat-based samples were DON, HT-2, and NIV with an overall incidence of 79.8%, 16.8% and 13.4%, respectively (Rodríguez-Carrasco et al., 2013). Moreover, more than 60% of milled grain-based products collected in Spain showed DON contamination, followed by NIV with a frequency of 10.4% (Rodríguez-Carrasco et al., 2014). Regarding type B trichothecenes, they can produce by the same fungi. For example, DON is mainly produced by Fusarium culmorum, F. graminearum, and F. sporotrichioides whereas NIV and FX are produced by F. nivale, F. graminearum, and F. crookwellense (Hussein and Brasel, 2001; IARC, 1993). Thus, their co-contamination is usually observed in
∗ Corresponding author. Amnart Poapolathep Department of Pharmacology, Faculty of Veterinary Medicine Kasetsart University, Chatuchak Bangkok, 10900, Thailand. E-mail addresses: [email protected], [email protected] (A. Poapolathep).
https://doi.org/10.1016/j.toxicon.2019.04.017 Received 18 January 2019; Received in revised form 15 April 2019; Accepted 24 April 2019 Available online 02 May 2019 0041-0101/ © 2019 Elsevier Ltd. All rights reserved.
Toxicon 165 (2019) 83–94
S. Aupanun, et al.
(354.355 g/mol) were purchased from Wako Pure Chemical Industries Ltd. (Kyoto, Japan), and dissolved in 10% dimethyl sulfoxide (DMSO) in water to a final concentration of 1 mg/mL for oral administration. Stock solutions of mycotoxins were maintained at −20 °C in the dark. Anti-cleaved caspase-3 (Asp175) was purchased from Cell Signaling Technology (Danvers, USA). E.Z.N.A total RNA kit I was obtained from Omega Bio-tek (Georgia, USA). Im Prom II reverse transcription system was purchased from Promega Corporation (Sydney, Australia). SYBR Green Supermix was obtained from Bio-Rad Laboratories (California, USA).
Table 1 Comparative LD50 values (mg/kg) between DON, NIV, and FX by various routes of administration in mice. Mycotoxin
Animals
LD50 (mg/ kg BW)
Route of administration
References
DON
mice
46–78
Oral
mice
49–70
Intraperitoneal
mice mice mice mice mice
38.9 5–10 5–10 5–10 3–5
Oral Intraperitoneal Subcutaneous Intravenous Irrespective of route of administration
Sobrova et al. (2010) Sobrova et al. (2010) EC, 2000 EC, 2000 EC, 2000 EC, 2000 Ueno (1983)
NIV
FX
2.2. Animals Forty 2-week old male ICR mice were acclimatized to the environment for a week. They were housed in stainless-steel cages (5 mice/ cage) under controlled conditions (temperature: 23 ± 2 °C; 12 h-light/ 12 h-dark) at the Laboratory Animal Unit, Faculty of Veterinary Medicine, Kasetsart University, Bangkok, Thailand. Experimental procedures carried out on animals were approved by the Animal Ethics Research Committee of the Faculty of Veterinary Medicine, Kasetsart University. In addition, the animals were fed commercial feed pellets without DON, NIV, and FX and water ad libitum.
food commodities. To ensure food safety, the FDA has set the limits of DON at 500–2000 ppb in foods and at 5–10,000 ppb in feeds (Mazumder and Sasmal, 2001). DON is the most widely distributed trichothecene but it is less toxic than other members in the family. NIV and FX evoked prolonged feed refusal in mice greater than DON for both intraperitoneal and oral exposure (Wu et al., 2012). Likewise, NIV and FX were of stronger potency than DON by both intraperitoneal and oral administration in the mink emesis model (Wu et al., 2013). Comparative LD50 values (mg/kg) between DON, NIV, and FX by various routes of administration in mice were shown in Table 1. Immune cells are very sensitive to DON because of the induction of ribotoxic stress, ER stress, calcium release, and oxidative stress (Katika et al., 2015). Nevertheless, the degree and mechanism of toxicity of trichothecenes on the immune system is complex. They are immunostimulatory or immunosuppressive depending on dose, exposure frequency and timing of functional immune assays (Pestka et al., 2004). DON significantly upregulated IL-2 and IL-8 production at concentrations of 62.5–500 ng/mL, whereas it significantly increased apoptosis in Jurkat T cells at concentrations of 500–1000 ng/mL (Pestka et al., 2005). DON-induced apoptosis was the result of DNA fragmentation, promoting the activation of cytochrome c and caspases, and changing Bcl-2, Bax, and Bid expression (Bensassi et al., 2009, 2012; Ma et al., 2012). NIV (10–100 μM) significantly stimulated apoptosis in J774A.1 macrophages mediated by caspase-3 activation and cell cycle blocking in the G0/G1 phase (Marzocco et al., 2009). The development of apoptosis was also detected in the thymus, spleen, and Peyer's patch of mice receiving 10 and 15 mg NIV/kg BW (Poapolathep et al., 2002). Intraperitoneal injection of FX (1.5–6 mg/kg BW) provoked thymic atrophy and disappearance of thymocytes in the thymic cortex of mice (Miura et al., 1998). Moreover, repeated exposure to low doses of FX caused lymphocyte mortality in the lymphoid tissues of mice through mitochondrial apoptotic pathway (Aupanun et al., 2015, 2016). Regarding natural co-incidence, humans and animals are commonly exposed to mycotoxin combinations. However, most investigations concern the effect of single toxins. Nowadays, data on the health risks from mycotoxin mixtures are still limited. Furthermore, the toxicity of toxin mixtures is complex and cannot be predicted based on their individual effects (Alassane-Kpembi et al., 2013, 2015). Thus, it would be interesting to assess the effects of mycotoxin mixtures compared to that with each toxin alone. In the present study, the development of apoptosis was determined in the lymphoid tissues of mice after oral exposure to three major type B members (DON, NIV, and FX) alone or in combination.
2.3. Experimental design Animals were randomly divided into 8 groups as follows; (1) Control: 10% DMSO in water served as vehicle control, (2) DON: 2 mg/ kg BW DON, (3) NIV: 5 mg/kg BW NIV, (4) FX: 2.5 mg/kg BW FX, (5) DON + NIV: 2 mg/kg BW DON mixed with 5 mg/kg BW NIV, (6) DON + FX: 2 mg/kg BW DON mixed with 2.5 mg/kg BW FX, (7) NIV + FX: 5 mg/kg BW NIV mixed with 2.5 mg/kg BW FX, and (8) DON + NIV + FX: 2 mg/kg BW DON mixed with 5 mg/kg BW NIV and 2.5 mg/kg BW FX. The dose levels of mycotoxins in the present study was selected based on their LD50 values. Thus, the dose levels of DON, NIV and FX were selected depending on a preliminary study. Five mice in each group were given a single orally administered dose of the substances above. After 12 h of exposure, animals were killed by cervical decapitation under ether anesthesia. Then the thymus, Peyer's patches, and spleen were collected. Half of each tissue sample was kept in 10% neutral buffered formalin for histopathological and immunohistochemical studies. The remaining samples were kept at −80 °C for the determination of apoptosis-related gene expression. 2.4. Histopathological assessment Tissue samples were immediately fixed in 10% neutral buffered formalin. Paraffin sections (4 μM) were stained using hematoxylin and eosin (H&E) staining and observed under a light microscope. Additional paraffin sections were subjected to in situ detection of DNA fragmentation (TUNEL assay) and immunohistochemical staining for cleaved caspase-3. 2.5. In situ detection of DNA fragmentation The modified TUNEL method was conducted to detect DNA fragmentation on the paraffin sections of thymus, Peyer's patches, and spleen of mice by a commercial apoptosis detection kit (ApopTag® Peroxidase in situ Apoptosis Detection Kit; Millipore Inc., Canada). Briefly, paraffin sections were deparaffinized with xylene, rehydrated in a graded series of alcohol solution, and washed in PBS. The sections were pretreated by microwaving 800 W for 5 min in citric acid (pH 6), left at room temperature (RT) for 20 min and washed in PBS. Endogenous peroxidase activity was inactivated with 3% hydrogen peroxide at RT for 10 min and then washed in PBS. The sections were incubated with equilibration buffer for 20 s and then incubated in a prepared deoxygenin labeled-terminal deoxynucleotidyl transferase
2. Materials and methods 2.1. Reagents Standards of DON (296.319 g/mol), NIV (312.318 g/mol), and FX 84
Toxicon 165 (2019) 83–94
S. Aupanun, et al.
Table 2 Lists of forward and reward primers for mRNA expression. Gene
Forward
Reverse
Accession number
Estimated PCR product (bp)
Trp53 Bax Bcl-2 Bid Caspase-3 Caspase-8 Caspase-9 GAPDH
GCTTCTCCGAAGACTGGATG TGCAGAGGATGATTGCTGAC CTGCAAATGCTGGACTGAAA CTCTGCGTTCAGCTTGAGTG TGTCATCTCGCTCTGGTACG GGCCTCCATCTATGACCTGA TGCCCTTGCCTCTGAGTAGT CCACCCAGAAGACTGTGGAT
CTTCACTTGGGCCTTCAAAA GATCAGCTCGGGCACTTTAG TCAGGAGGGTTTCCAGATTG CAGAAGCCCACCTACATGGT TCCCATAAATGACCCCTTCA TGTGGTTCTGTTGCTCGAAG AACAAAGAAACGCCCACAAC CACATTGGGGGTAGGAACAC
NM_011640.3 NM_007527.3 NM_009741.4 NM_007544.3 NM_009810.3 NM_009812.2 NM_001277932.1 NM_001289726.1
195 173 158 206 264 152 163 173
solution with film overlay at 37 °C. After 1 h, films were removed and the sections were incubated in stop wash buffer at RT for 10 min. Then antideoxygenin-labeled peroxidase was dropped onto the sections with film overlay and incubated at RT for 30 min. After that, sections were incubated with diaminobenzidine solution at RT for 5 min, washed in tap water, counterstained by hematoxylin, and observed under light microscope. The TUNEL-positive nuclei stained dark brown. The ratio of TUNEL positive cells to total lymphocytes counted in two randomized fields for each of two sections per animal was calculated and presented as the mean percentage ± SD (TUNEL index = positive nuclei/total lymphocytes ✗ 100) for each group.
260/280 ratio between 2.0 and 2.1. 2.8. Expression of apoptosis-related genes The first strand cDNA was synthesized using Im Prom II reverse transcription system (Sydney, Australia). Briefly, total RNA (100 ng/μL) was mixed with 1 μL of random primer and nuclease-free water (NFW) to a final volume of 5 μL per RT reaction. The mixture was preheated at 70 °C for 5 min and immediately chilled on ice for at least 5 min. The RT-reaction mixture containing 4 μL of 5X reaction buffer, 1.2 μL of MgCl2, 1 μL of dNTPs mixture, 0.5 μL of Ricombinant RNASin®, 1 μL of RT-transcriptase, and NFW adding to make a final volume of 15 μL per cDNA synthesis reaction was prepared. The RT-reaction mixture was added to 5 μL of the RNA-primer mix to make a final reaction volume of 20 μL. A thermal cycler (iCycler®, Bio-Rad Laboratories, Hercules, CA) was used with the following PCR conditions: 25 °C for 5 min, 42 °C for 1 h, followed by 72 °C for 15 min, and then kept at 4 °C until analysis. The cDNA concentration was quantified using a NanoDrop® Spectrophotometer ND-1000. The qPCR was performed by preparing the reaction mixture containing 300 nM forward and reverse primers corresponding to the cDNA sequences of mouse mRNA (Table 2), 100 ng of cDNA template, 5 μL of iQ™ SYBR® Green supermix (Bio-Rad Laboratories, Hercules, CA), and water added to make a final volume of 10 μL per reaction. Cycling conditions were as follows; pre-denaturation at 95 °C for 3 min, denaturation at 95 °C for 15 s, annealing at 55 °C for 30 s (40 cycles), extension at 72 °C for 30 s, and termination at 95 °C for 10 s. The analyzed melting curve was 95 °C, with 0.5 °C increment steps using the CFX96 Real-Time PCR system thermal cycler (Bio-Rad Laboratories, Hercules, CA). Cycle threshold (CT) of each of the target genes was normalized to CT of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as follows;
2.6. Immunohistochemistry for cleaved Caspase-3 The paraffin sections of thymus, Peyer's patches, and spleen of mice were subjected to immunohistochemistry for cleaved caspase-3 using the avidin-biotin-peroxidase complex (ABC) method and a VECTASTAIN Elite ABC kit (Vector Laboratories, USA). Monoclonal anti-cleaved caspase-3 (clone Asp175, 1:200 dilution) rabbit antibody (Danvers, USA) was used as the primary antibody. Biotinylated goat anti-rabbit IgG antibody from the VECTASTAIN ABC kit served as the secondary antibody. The sections were incubated with diaminobenzidine solution for visualizing caspase-3-positive nuclei, counterstained with hematoxylin, and observed under a light microscope. The ratio of caspase-3 positive cells to total lymphocytes counted in two randomized fields for each of two sections per animal was calculated and presented as the mean percentage ± SD (Caspase-3 index = positive nuclei/total lymphocytes ✗ 100) for each group. 2.7. RNA extraction Total RNA was extracted from frozen thymus or Peyer's patches using the E.Z.N.A.™ Total RNA kit I (Georgia, USA) following the manufacturer's protocol with minimal modification. Briefly, ten milligrams of frozen sample was ground with a ceramic mortar and pestle, then homogenized with TRK lysis buffer, and centrifuged at 4 °C 13,000✗g for 5 min. The cleared supernatant was carefully transferred to a clean 1.5 mL centrifuge tube, then 350 μL of 70% ethanol was added, and the solution mixed thoroughly 3–5 times. The samples were applied to a HiBind RNA spin column placed into a 2 mL collection tube, centrifuged at 10,000✗g for 1 min, and flow-through was then discarded. After that, 500 μL of RNA wash buffer I was added onto the HiBind RNA, centrifuged at 10,000✗g for 1 min, and flow-through was then discarded. Then 500 μL of RNA wash buffer II was applied onto the HiBind RNA, centrifuged at 10,000✗g for 1 min, and flow-through was then discarded. The RNA wash buffer II step was performed twice. Finally, the HiBind RNA column was placed in a new collection tube, centrifuged at 4 °C 13,000✗g for 2 min to completely dry the HiBind matrix, and then the column was transferred into a clean 1.5 mL centrifuge tube. 50 μL of DEPC-treated water was added onto the center of the column matrix for eluting RNA and then centrifuged at maximum speed for 2 min. RNA quantity and purity were determined using a NanoDrop® Spectrophotometer ND-1000. All RNA samples showed a
ΔΔCT = ΔCT(treat) − ΔCT(control) ΔCT is the difference in CT between target gene and GAPDH. The fold difference for each treated sample relative to the control sample equals 2−ΔΔCT. 2.9. Statistical analysis The TUNEL and caspase-3 indices as well as the expression of relative mRNA levels are shown as the mean ± standard deviation (SD) of five mice per group. The differences between groups were compared using one-way ANOVA analysis and the Tukey test for pairwise multiple comparisons. Statistical analysis of data was performed using GraphPad Prism version 5.0. (GraphPad Software, Inc. CA, USA). A p-value less than 0.05 was considered statistically significant. 3. Results 3.1. Histopathological finding In the thymus, mice exposed to mycotoxins alone or in combination displayed decreased numbers of lymphocytes when compared to 85
Toxicon 165 (2019) 83–94
S. Aupanun, et al.
Fig. 1. H&E staining of the thymus of mice at 12 HAT. (A) Control, (B) 2 mg/kg DON, (C) 5 mg/kg NIV, (D) 2.5 mg/kg FX, (E) 2 mg/kg DON + 5 mg/kg NIV, (F) 2 mg/kg DON + 2.5 mg/kg FX, (G) 5 mg/kg NIV + 2.5 mg/kg FX, (H) 2 mg/kg DON + 5 mg/kg NIV + 2.5 mg/kg FX. HE x40. Arrows indicate pyknotic nuclei.
the germinal centers of white pulp regions. Marked splenic lesions were seen in mice exposed to FX alone while the changes were less evident in other toxin-treated groups and control animals.
control animals. The main histological lesions observed in the thymus were lymphocytes showing nuclear condensation or fragmentation throughout the cortex and along the cortico-medullary junction. The lesions were clearly seen in animals exposed to FX or NIV alone. However, minimal changes were noted in the thymus of DON-treated animals and all combined mycotoxin-treated groups (Fig. 1). Samples of aggregated lymphoid nodules were collected from the distal jejunum and ileum for histopathological analysis. In the Peyer's patches, nuclear condensation or fragmentation were clearly seen throughout the germinal centers. The lesions were observed in all animals receiving mycotoxins (Fig. 2). Changes in the spleen were mild and characterized by the depletion of lymphocytes and lymphocytes presenting nuclear condensation in
3.2. TUNEL index The in situ detection of DNA fragmentation was carried out on the paraffin sections of the thymus, Peyer's patches, and spleen of mice using the modified TUNEL method. The TUNEL staining of thymus and Peyer's patches of mice are depicted in Figs. 3 and 4, respectively. Nuclear condensation or fragmentation of lymphocytes was strongly TUNEL-positive. The positive nuclei were clearly observed in the cortical thymus and along cortico-medullary junctions of mice exposed to 86
Toxicon 165 (2019) 83–94
S. Aupanun, et al.
Fig. 2. H&E staining of the Peyer's patches of mice at 12 HAT. (A) Control, (B) 2 mg/kg DON, (C) 5 mg/kg NIV, (D) 2.5 mg/kg FX, (E) 2 mg/kg DON + 5 mg/kg NIV, (F) 2 mg/kg DON + 2.5 mg/kg FX, (G) 5 mg/kg NIV + 2.5 mg/kg FX, (H) 2 mg/kg DON + 5 mg/kg NIV + 2.5 mg/kg FX. HE x40. Arrows indicate pyknotic nuclei.
index of apoptotic cells in different lymphoid tissues are presented in Fig. 5. Animals exposed to FX alone had significantly increased percentages of TUNEL index in all lymphoid tissues compared to animals receiving DON alone, NIV alone, binary, ternary combinations, or vehicle control. Nevertheless, the thymus and spleen of NIV-treated animals had greater indices than mice exposed to DON alone, combined mycotoxins, or vehicle control. Thus, the TUNEL indices in groups receiving mycotoxin mixtures seem to be lower than that of single toxin treatment in all lymphoid tissues but no significant differences among animals exposed to mycotoxin combinations was observed. In addition, higher TUNEL index were noted in Peyer's patches than that of other lymphoid tissues.
single toxins, especially FX or NIV, compared to those exposed to combined mycotoxin and vehicle control (Fig. 3). In addition, the nuclei of lymphocytes positive to TUNEL were markedly evident in the germinal centers of Peyer's patches of single toxin-treated animals whereas a small number of these nuclei were present in the aggregated lymphoid nodules of binary or ternary mycotoxin-treated mice (Fig. 4). In spleen, the positive nuclei were less common. However, the positive cells can be clearly observed in the germinal centers of white pulp areas in groups receiving single toxins compared to mycotoxin combinations and control groups. The expression of nuclear condensation in lymphoid tissues was then estimated by counting strongly TUNEL-positive cells. The TUNEL 87
Toxicon 165 (2019) 83–94
S. Aupanun, et al.
Fig. 3. TUNEL staining of the thymus of mice at 12 HAT. (A) Control, (B) 2 mg/kg DON, (C) 5 mg/kg NIV, (D) 2.5 mg/kg FX, (E) 2 mg/kg DON + 5 mg/kg NIV, (F) 2 mg/kg DON + 2.5 mg/kg FX, (G) 5 mg/kg NIV + 2.5 mg/kg FX, (H) 2 mg/kg DON + 5 mg/kg NIV + 2.5 mg/kg FX. HE x40. Arrows indicate TUNEL-positive cells.
less Caspase-3 activity in all lymphoid tissues than those given individual mycotoxin treatment. However, no significant differences in Caspase-3 indices among the groups administered mycotoxin mixtures were noted.
3.3. Caspase-3 index The immunoexpression of cleaved caspase-3 in the lymphoid tissues was quantified by counting intensely positive immunostaining of lymphocytes. The Caspase-3 indices in different lymphoid tissues are demonstrated in Fig. 6. Relative to TUNEL indices, a significant increase in Caspase-3 indices was observed in all lymphoid tissues of animals receiving FX alone compared to individual DON, NIV, binary, ternary mixtures, or vehicle control. Furthermore, the oral administration of NIV alone significantly increased the percentages of Caspase-3 in the thymus and spleen when compared to control animals. As with the TUNEL indices, animals exposed to mycotoxin combinations showed
3.4. Expression of apoptosis-related genes The expressions of apoptosis-related genes and the reference gene GAPDH after individual or combined mycotoxin treatment were quantified in the thymus and Peyer's patches of mice by qPCR (Table 2). The Bax, and Trp53 mRNA expressions from the thymus of animals treated with FX alone were significantly up-regulated when compared to the 88
Toxicon 165 (2019) 83–94
S. Aupanun, et al.
Fig. 4. TUNEL staining of the Peyer's patches of mice at 12 HAT. (A) Control, (B) 2 mg/kg DON, (C) 5 mg/kg NIV, (D) 2.5 mg/kg FX, (E) 2 mg/kg DON + 5 mg/kg NIV, (F) 2 mg/kg DON + 2.5 mg/kg FX, (G) 5 mg/kg NIV + 2.5 mg/kg FX, (H) 2 mg/kg DON + 5 mg/kg NIV + 2.5 mg/kg FX. HE x40. Arrows indicate TUNELpositive cells.
control mice.
control but no differences were noted for the other toxins-treated groups. (Fig. 7). In the Peyer's patches, significant upregulation of Bax and Trp53 was observed in animals receiving FX alone when compared to ternary combination and vehicle control (Fig. 8). A significant increase of Caspase-3 mRNA was noted in the thymus and Peyer's patches of mice exposed to FX alone compared to animals receiving DON alone, binary combination of DON and NIV, or the vehicle control (Figs. 7 and 8). Furthermore, the expression of Caspase-9 gene was significantly increased in the thymus and Peyer's patches of animals receiving FX alone. In contrast, the relative expressions of Caspase-8, Bid, Bcl, FAS, and TNF mRNA in both thymus and Peyer's patches remained unchanged in all groups exposed to tested toxins when compared to
4. Discussion The toxicity of mycotoxin combinations is complicated and cannot be predicted based on the toxicity of individual toxins (AlassaneKpembi et al., 2013, 2015). In this work, mice were exposed to three major type B trichothecenes (DON, NIV, and FX) alone or in combination. DON is a common fusariotoxin contaminate in cereals (Rodríguez-Carrasco et al., 2013; 2014; Schollenberger et al., 2012), NIV and FX have higher toxic potency than other members in the family (Wu et al., 2012, 2013). The development of apoptosis was detected in 89
Toxicon 165 (2019) 83–94
S. Aupanun, et al.
Fig. 5. Changes in the TUNEL index of thymus (A), Peyer's patches (B), and spleen (C) of mice after single or combined mycotoxins administration. Each value represents mean ± SD of 5 mice (n = 5). Different letters represent significant difference (p < 0.05).
to DON, NIV, and FX. As in the thymus, we observed minimal changes in mice receiving mycotoxin combinations. The spleen is the largest secondary immune organ in the body. The white pulp of the spleen consists of B- and T cell compartments (Cesta, 2006; van Krieken, 1997). Bracarense et al. (2016) demonstrated that rats exposed to a DON-contaminated diet displayed lymphocyte depletion and characteristics of lymphocyte apoptosis in the spleen. Correspondingly, we found a small number of lymphocytes with nuclear condensation in the germinal centers of all mice receiving mycotoxins when compared to vehicle control. Marked changes were detected in mice exposed to FX alone. However, the changes were less evident in other toxin-treated groups and control animals. TdT-mediated dUTP-biotin nick end labeling (TUNEL) staining is one of the most widely used technique to detect DNA damage in situ (Gavrieli et al., 1992). It is a method for staining cells that exhibit the biochemical hallmark of apoptosis and internucleosomal DNA fragmentation (Bortner et al., 1995). Nevertheless, TUNEL staining may also detect DNA damage associated with necrotic cell death (Ansari et al., 1993) and cells undergoing active DNA repair (Kanoh et al., 1999). Thus, this technique may be considered generally as a method for the detection of DNA fragmentation, it can be assumed that TUNELpositive cells are apoptotic cells. Poapolathep and coworkers (Poapolathep et al., 2002) reported that the nuclei of lymphocytes presenting with nuclear condensation or fragmentation were strongly stained by TUNEL. Accordingly, we found that lymphocytes showing ultrastructural characteristics of apoptosis stained intensely with the TUNEL method. These TUNEL-positive cells were clearly seen in the cortex of the thymus and the germinal centers of Peyer's patches and the spleen of mice given FX alone when compared to the latter groups and control animals. However, the TUNEL index was much lower in the
lymphoid tissues of mice after oral administration. The cortex of the thymus is largely populated by active immature lymphocytes while the corticomedullary junction and medulla region are less densely cellular than the cortex (Pearse, 2006). In this study, nuclear condensation and fragmentation of lymphocytes were clearly observed in the cortical thymus after mycotoxin treatment when compared to control (Fig. 1.). Accordingly, mice receiving 5, 10, 15 mg NIV/kg BW exhibited marked condensation of nuclear chromatin and fragmentation of nuclei throughout the cortex and the border between the cortex and medulla (Poapolathep et al., 2002). Recently, Aupanun et al. (2015) demonstrated nuclei of lymphocytes showing nuclear condensation or fragmentation in the cortical thymus of FX-treated mice. Furthermore, co-exposure of lipopolysaccharide and DON markedly increased the characteristic features of lymphocyte apoptosis in the thymus of mice (Zhou et al., 2000). These data indicated that immature lymphocytes in the cortex area are sensitive to DON, NIV, and FX. In contrast, we observed the changes of lymphocytes were less evident in these regions after combined mycotoxins treatment. Peyer's patches are considered to be the immune sensors of the intestine (Jung et al., 2010). The germinal center contains proliferating Blymphocytes, follicular dendritic cells and macrophages. In this work, lymphocyte depletion and condensation of nuclear chromatin were noted in these regions after mycotoxins treatment (Fig. 2.). Similarly, there was a dose-dependent increase in the number of lymphocytes showing nuclear condensation in all Peyer's patch structures of NIV only-treated animals (Poapolathep et al., 2002). Likewise, 14-day repeated FX exposure evoked the reduction of lymphocytes numbers and condensation of nuclear chromatin in the germinal center at sites of B cell proliferation (Aupanun et al., 2015). These results indicated that lymphocytes in the germinal center of Peyer's patches were susceptible 90
Toxicon 165 (2019) 83–94
S. Aupanun, et al.
Fig. 6. Changes in the caspase-3 index of thymus (A), Peyer's patches (B), and spleen (C) of mice after single or combined mycotoxins administration. Each value represents mean ± SD of 5 mice (n = 5). Different letters represent significant difference (p < 0.05).
lymphocytes for all tested mycotoxins is not reliant on the death receptor pathway. The intrinsic signaling pathway involves the alteration of the inner mitochondrial membrane, contributing to an opening of the mitochondrial permeability transition (MPT) pore, loss of mitochondrial transmembrane potential, and release of pro-apoptotic proteins from the intermembrane space into the cytosol (Elmore, 2007; Saelens et al., 2004). The family of Bcl-2 proteins regulates the apoptotic mitochondrial events (Elmore, 2007). It consists of two functional classes of proteins including anti-apoptotic members, such as Bcl-2, Bcl-xL, and Bcl-w, and pro-apoptotic molecules, such as Bax, Bad, Bak, Bid (Ma et al., 2012; Tsujimoto and Shimizu, 2000). Furthermore, the tumor suppressor protein p53 has a critical role in regulation of the Bcl-2 family of proteins (Elmore, 2007). Formerly, it has been shown that DON acts as a direct genotoxin agent, leading to a p53 and mitochondriarelated caspase-dependent apoptotic pathway (Bensassi et al., 2009, 2012; Ma et al., 2012). Additionally, the induction of apoptosis in developing mouse brain in FX-treated dams was defined as an intrinsic apoptotic incident (Sutjarit et al., 2014). Similarly, 14-day repeated exposure of FX exerted apoptosis in lymphocytes through an effect on p53 and caspase-dependent mitochondrial events (Aupanun et al., 2016). Considering the results, we found that the significant upregulation of Bax, Trp53, Caspase-9, and Caspase-3 mRNA was clearly seen in the thymus and Peyer's patches of mice receiving only FX. Type B trichothecenes consist of an epoxytrichothecene nucleus with the presence of hydroxyl or acetyl groups at the appropriate
lymphoid tissues of mice receiving mycotoxin mixtures. The increase in the mortality of lymphocytes after mycotoxin treatment was confirmed by immunostaining for cleaved caspase-3. Induction of lymphocyte apoptosis by DON, NIV, and FX has been previously evaluated with in vivo or in vitro models (Aupanun et al., 2015, 2016; Bracarense et al., 2016; Gerez et al., 2015; Poapolathep et al., 2002; Zhou et al., 2000). In the present study, we confirmed that all tested toxins induced lymphocyte mortality through caspase-3 activity. In addition, mycotoxin combinations seemed to be less potent to lymphocytes than single toxins. Furthermore, Peyer's patches and thymus were more affected by these toxins than the spleen. The mechanisms of apoptosis are highly complicated. To date, two main apoptotic pathways have been revealed. In the death receptor pathway, five different death receptors are known including tumor necrosis factor (TNF) receptor-1, CD95 (Fas/APO-1), TNF-receptor-related apoptosis-mediated protein (TRAMP) and TNF-related apoptosisinducing ligand (TRAIL) receptor-1 and -2 (Schulze-Osthoff et al., 1998). The sequence of events that define the extrinsic phase of apoptosis are best characterized with the FasL/FasR and TNF-α/TNFR1 ligands (Elmore, 2007). Once caspase-8 is activated, the execution phase of apoptosis is triggered (Elmore, 2007). Previously, 14-days of FX exposure did not upregulate the expression of gene-related extrinsic apoptotic events (Aupanun et al., 2016). In the present study, the relative expressions of TNF, FAS, and Caspase-8 mRNA in Peyer's patches and thymus of all treatment groups remain unchanged when compared to the control group. These results suggest that the toxic effects on 91
Toxicon 165 (2019) 83–94
S. Aupanun, et al.
Fig. 7. Relative expression levels of apoptosis-related genes in the thymus from mycotoxin-treated mice. Each value represents the mean ± SD from five mice in each group. Different letters represent significant difference (p < 0.05).
the potential to modulate the transmembrane efflux of other co-occurring P glycoprotein-substrates (Ivanova et al., 2018). In our previous study, the most combined toxicity between DON, NIV, and FX in Jurkat T cells showed antagonistic effects, especially the ternary combination (Aupanun et al., 2019). The antagonism was also observed in the combination between DON and FX in IPEC-1 cells (Alassane Kpembi et al., 2015) and the tertiary combination of DON, NIV, and FX in Caco2 cells (Alassane Kpembi et al., 2013). Conversely, synergistic effect was noticed in the mixtures of DON and NIV in IPEC-1 and Caco-2 cells (Alassane-Kpembi et al., 2013, 2015) and DON and FX mixtures in Caco-2 cells (Alassane Kpembi et al., 2013). Thus, the effects of mycotoxin mixtures differ in the mixtures of mycotoxins, ratio and/or concentrations for each mycotoxin combination, type of cell lines, as well as the method used to determine the dose-effect relationship (Aupanun et al., 2019). Interestingly, the present study demonstrated that the combined treatment caused lymphocyte apoptosis that was less than
positions. They are small molecules that are likely to absorb rapidly in the gastrointestinal tract (Cavret and Lecoeur, 2006). Thus, the mode of molecular absorption may account for the complexity in toxicity for mycotoxins in combination. The more lipophilic a molecule is, the better it crosses intestinal barrier (Wils et al., 1994). FX is more lipophilic than NIV, so it is absorbed from the gastrointestinal tract more rapidly than NIV (Poapolathep et al., 2003). Furthermore, NIV is less lipophilic than DON (Cavret and Lecoeur, 2006). In mice, DON crosses the intestinal barrier faster than NIV (Azcona-Olivera et al., 1995; Cavret and Lecoeur, 2006). Regarding to intestinal absorptions in vitro, absorption rates of DON and NIV were 51% and 21%, respectively (Avantaggiato et al., 2004). In addition to lipophilicity, cellular active transport systems might account for the differences in intrinsic toxicity of tested mycotoxins. It has been revealed that DON and NIV were substrates for both P-glycoprotein and MRP2 efflux transporters (Tep et al., 2007; Videmann et al., 2007). Moreover, DON appeared to have 92
Toxicon 165 (2019) 83–94
S. Aupanun, et al.
Fig. 8. Relative expression levels of apoptosis-related genes in the Peyer's patches from mycotoxin-treated mice. Each value represents the mean ± SD from five mice in each group. Different letters represent significant difference (p < 0.05).
that of individual exposure. It could be speculated that the tested mycotoxins have different efficacy for crossing the intestinal barrier and affinity to their targets. One tested mycotoxin might disturb the absorption or elimination of the other when they co-occur (Cavaliere et al., 2005). They could compete for binding transporters or target sites. Nevertheless, these hypotheses require further investigation.
present together. This data might assist with assessing the health risk in agricultural commodities. However, further investigation is needed.
5. Conclusions
Ethical form
The present study indicated that DON, NIV, and FX, individually, induce cell death through caspase-dependent mechanisms and via the intrinsic apoptotic pathway. Among type B trichothecenes, FX is the most toxic. Nevertheless, results suggest that combined toxins provoke less lymphocyte mortality than DON, NIV, or FX alone. This toxicological action is of practical importance as these toxins are often
Individual and combined mycotoxins deoxynivalenol, nivalenol, and fusarenon-X induced apoptosis in lymphoid tissues of mice after oral exposure All experimental procedures were performed according to the Guideline for All Experiments, and approved by the Ethics Research Committee of the Faculty of Veterinary Medicine, Kasetsart University.
Conflict of interest There is no conflict of interests in association with the present study.
93
Toxicon 165 (2019) 83–94
S. Aupanun, et al.
Acknowledgements
Jung, J., Hugot, J.P., Barreau, F., 2010. Peyer's patches: the immune sensors of the intestine. Int. J. Inflamm. 1–12. Kanoh, M., Takemura, G., Misao, J., Hayakawa, Y., Aoyama, T., Nishigaki, K., Noda, T., Fujiwara, T., Fukuda, K., Minatoguchi, S., Fujiwara, H., 1999. Significance of myocytes with positive DNA in situ nick end-labeling (TUNEL) in hearts with dilated cardiomyopathy. Not apoptosis but DNA repair. Circulation 99, 2757–2764. Katika, M.R., Hendriksen, P.J.M., van Loveren, H., Peijnenburg, A.A.C.M., 2015. Characterization of the modes of action of deoxynivalenol (DON) in the human Jurkat T-cell line. J. Immunotoxicol. 12, 206–216. Kovalsky, P., Kos, G., Nährer, K., Schwab, C., Jenkins, T., Schatzmayr, G., Sulyok, M., Krska, R., 2016. Co-occurrence of regulated, masked and emerging mycotoxins and secondary metabolites in finished feed and maize—an extensive survey. Toxins 8 E363. Ma, Y., Zhang, A., Shi, Z., He, C., Ding, J., Wang, X., Ma, J., 2012. A mitochondria mediated apoptotic pathway induced by deoxynivalenol in human colon cancer cells. Toxicol. Vitro 26, 414–420. Marzocco, S., Russo, R., Bianco, G., Autore, G., Severino, L., 2009. Pro-apoptotic effects of nivalenol and deoxynivalenol trichothecenes in J774A.1 murine macrophages. Toxicol. Lett. 189, 21–26. Mazumder, P.M., Sasmal, D., 2001. Mycotoxins – limits and regulations. Ancient Sci. Life 20, 1–19. Miura, K., Nakajima, Y., Yamanaka, N., Terao, K., Shibato, T., Ishino, S., 1998. Induction of apoptosis with fusarenon-X in mouse thymocytes. Toxicology 127, 195–206. Pearse, G., 2006. Normal structure, function and histology of the thymus. Toxicol. Pathol. 34, 504–514. Pestka, J.J., Uzarski, R.L., Islam, Z., 2005. Induction of apoptosis and cytokine production in the Jurkat human T cells by deoxynivalenol: role of mitogen-activated protein kinases and comparison to other 8-ketotrichothecenes. Toxicology 206, 207–219. Pestka, J.J., Zhou, H.R., Moon, Y., Chung, Y.J., 2004. Cellular and molecular mechanisms for immune modulation by deoxynivalenol and other trichothecenes: unraveling a paradox. Toxicol. Lett. 153, 61–73. Poapolathep, P., Ohtsuka, R., Kiatipattanasakul, W., Ishigami, N., Nakayama, H., Doi, K., 2002. Nivalenol–induced apoptosis in thymus, spleen and Peyer's patches of mice. Exp. Toxicol. Pathol. 53, 441–446. Poapolathep, A., Sugita-Konishi, Y., Doi, K., Kumagai, S., 2003. The fates of trichothecene mycotoxins, nivalenol and fusarenon-X, in mice. Toxicon 41, 1047–1054. Rodrigues, I., Naehrer, K., 2012. A three-year survey on the worldwide occurrence of mycotoxins in feedstuffs and feed. Toxins 4, 663–675. Rodríguez-Carrasco, Y., Moltó, J.C., Berrada, H., Mañes, J., 2014. A survey of trichothecenes, zearalenone and patulin in milled grain-based products using GC– MS/ MS. Food Chem. 146, 212–219. Rodríguez-Carrasco, Y., Ruiz, M.J., Font, G., Berrada, H., 2013. Exposure estimates to Fusarium mycotoxins through cereals intake. Chemosphere 93, 2297–2303. Saelens, X., Festjens, N., Varde, Walle L., van Gurp, M., van Loo, G., Vandenabeele, P., 2004. Toxic proteins released from mitochondria in cell death. Oncogene 23, 2861–2874. Schollenberger, M., Müller, H.M., Ernst, K., Sondermann, S., Liebscher, M., Schlecker, C., Wischer, G., Drochner, W., Hartung, K., Piepho, H.P., 2012. Occurrence and distribution of 13 trichothecene toxins in naturally contaminated maize plants in Germany. Toxins 4, 778–787. Schulze-Osthoff, K., Ferrari, D., Los, M., Wesselborg, S., Peter, M.E., 1998. Apoptosis signaling by death receptors. Eur. J. Biochem. 254, 439–459. Sobrova, P., Adam, V., Vasatkova, A., Beklova, M., Zeman, L., Kizek, R., 2010. Deoxynivalenol and its toxicity. Interdiscip. Toxicol. 3, 94–99. Streit, E., Nährer, K., Rodrigues, I., Schatzmayr, G., 2013. Mycotoxin occurrence in feed and feed raw materials worldwide: long-term analysis with special focus on Europe and Asia. J. Sci. Food Agric. 93, 12. Streit, E., Schatzmayr, G., Tassis, P., Tzika, E., Marin, D., Taranu, I., Tabuc, C., Nicolau, A., Aprodu, I., Puel, O., Oswald, I.P., 2012. Current situation of mycotoxin contamination and co-occurrence in animal feed-focus on Europe. Toxins 4, 788–809. Sutjarit, S., Nakayama, S.M., Ikenaka, Y., Ishizuka, M., Banlunara, W., Rerkamnuaychoke, W., Kumagai, S., Poapolathep, A., 2014. Apoptosis and gene expression in the developing mouse brain of fusarenon-X treated pregnant mice. Toxicol. Lett. 229, 292–302. Tep, J., Videmann, B., Mazallon, M., Balleydier, S., Cavret, S., Lecoeur, S., 2007. Transepithelial transport of fusariotoxin nivalenol: mediation of secretion by ABC transporters. Toxicol. Lett. 170, 248–258. Tsujimoto, Y., Shimizu, S., 2000. Bcl-2 family: life-or-death switch. FEBS Lett. 466, 6–10. Ueno, Y., 1983. Trichothecenes - Chemical, Biological and Toxicological Aspects. Kodansha and Elsevier Science, Tokyo, Japan. van Krieken, J.H.J.M., 1997. Histology of the spleen: structure and cellular distribution in the normal spleen. Curr. Diagn. Pathol. 4, 100–105. Videmann, B., Tep, J., Cavret, S., Lecoeur, S., 2007. Epithelial transport of deoxynivalenol: Involvement of human P-glycoprotein (ABCB1) and multidrug resistanceassociated protein 2 (ABCC2). Food Chem. Toxicol. 45, 1938–1947. Wils, P., Warnery, A., Phung-Ba, V., Legrain, S., Scherman, D., 1994. High lipophilicity decreases drug transport across intestinal epithelial cells. J. Pharmacol. Exp. Ther. 269, 654–658. Wu, W., Flannery, B.M., Sugita-Konishi, Y., Watanabe, M., Zhang, H., Pestka, J.J., 2012. Comparison of murine anorectic responses to the 8-ketotrichothecenes 3- acetyldeoxynivalenol, 15-acetyldeoxynivalenol, fusarenon-X and nivalenol. Food Chem. Toxicol. 50, 2056–2061. Wu, W., Bates, M.A., Bursian, S.J., Link, J.E., Flannery, B.M., Sugita-Konishi, Y., Watanabe, M., Zhang, H., Pestka, J.J., 2013. Comparison of emetic potencies of the 8ketotrichothecenes deoxynivalenol, 15-aetyldeoxynivalenol, 3-acetyldeoxynivalenol, fusarenon-X and nivalenol. Toxicol. Sci. 131, 279–291. Zhou, H.R., Harkema, J.R., Hotchkiss, J.A., Yan, D., Roth, R.A., Pestka, J.J., 2000. Lipopolysaccharide and the trichothecene vomitoxin (deoxynivalenol) synergistically induce apoptosis in murine lymphoid organs. Toxicol. Sci. 53, 253–263.
This work was partially supported by the Center for Advanced Studies for Agriculture and Food Institute for Advanced Studies, Kasetsart University under the Higher Education Research Promotion and National Research University Project of Thailand, Office of the Higher Education Commission, Ministry of Education, Thailand. Authors acknowledge the English editing of the manuscript to Dr. H. Owen (University of Queensland, Australia). Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.toxicon.2019.04.017. References Alassane-Kpembi, I., Kolf-Clauw, M., Gauthier, T., Abrami, R., Biola, F.A., Oswald, I.P., Puel, O., 2013. New insights into mycotoxin mixtures: the toxicity of low doses of Type B trichothecenes on intestinal epithelial cells is synergistic. Toxicol. Appl. Pharmacol. 272, 191–198. Alassane-Kpembi, I., Oswald, I.P., Puel, O., 2015. Toxicological interactions between the mycotoxins deoxynivalenol, nivalenol and their acetylated derivatives in intestinal epithelial cells. Arch. Toxicol. 89, 1337–1346. Ansari, B., Coates, P.J., Greenstein, B.D., Hall, P.A., 1993. In situ end labeling detects DNA strand breaks in apoptosis and other physiological and pathological states. J. Pathol. 170, 1–8. Aupanun, S., Phuektes, P., Poapolathep, S., Alassane-Kpembi, I., Oswald, I.P., Poapolathep, A., 2019. Individual and combined cytotoxicity of major trichothecenes type B, deoxynivalenol, nivalenol, and fusarenon-X on Jurkat human T cells. Toxicon 160, 29–37. Aupanun, S., Phuektes, P., Poapolathep, S., Sutjarit, S., Giorgi, M., Poapolathep, A., 2016. Apoptosis and gene expression in Jurkat human T cells and lymphoid tissues of fusarenon-X-treated mice. Toxicon 123, 15–24. Aupanun, S., Poapolathep, S., Imsilp, K., Prapong, T., Poapolathep, A., 2015. Oral exposure of fusarenon-X induced apoptosis in Peyer's patches, thymus, and spleen of mice. Res. Vet. Sci. 102, 217–222. Avantaggiato, G., Havenaar, R., Visconti, A., 2004. Evaluation of the intestinal absorption of deoxynivalenol and nivalenol by an in vitro gastrointestinal model, and the binding efficacy of activated carbon and other adsorbent materials. Food Chem. Toxicol. 42, 817–824. Azcona-Olivera, J.I., Ouyang, Y., Murtha, J., Chu, F.S., Pestka, J.J., 1995. Induction of cytokine mRNAs in mice after oral exposure to the trichothecene vomitoxin (deoxynivalenol): relationship to toxin distribution and protein synthesis inhibition. Toxicol. Appl. Pharmacol. 133, 109–120. Bensassi, F., Gallerne, C., Sharaf, O., Dein, E.L., Lemaire, C., Hajlaoui, M.R., Bacha, H., 2012. Involvement of mitochondria-mediated apoptosis in deoxynivalenol cytotoxicity. Food Chem. Toxicol. 50, 1680–1689. Bensassi, F., Golli-Bennour, E.E., Abid-Essefi, S., Bouaziz, C., Hajlaoui, M.R., Bacha, H., 2009. Pathway of deoxynivalenol-induced apoptosis in human colon carcinoma cells. Toxicology 264, 104–109. Berthiller, F., Sulyok, M., Krska, R., Schuhmacher, R., 2007. Chromatographic methods for the simultaneous determination of mycotoxins and their conjugates in cereals. Int. J. Food Microbiol. 119, 33–37. Bortner, C.D., Oldenburg, N.B.E., Cidlowski, J.A., 1995. The role of DNA fragmentation in apoptosis. Trends Cell Biol. 5, 21–26. Bracarense, A.P.F.L., Bosso, K.M., da Silva, E.O., Payros, D., Oswald, I.P., 2016. Deoxynivalenol in the liver and lymphoid organs of rats: effects of dose and duration on immunohistological changes. World Mycotoxin J. 10, 89–96. Cavaliere, C., Foglia, P., Pastorini, E., Samperi, R., Laganà, A., 2005. Development of a multiresidue method for analysis of major Fusarium mycotoxins in corn meal using liquid chromatography/tandem mass spectrometry. Rapid Commun. Mass Spectrom. 19, 2085–2093. Cavret, S., Lecoeur, S., 2006. Fusariotoxin transfer in animal. Food Chem. Toxicol. 44, 444–453. Cesta, M.F., 2006. Normal structure, function, and histology of the spleen. Toxicol. Pathol. 34, 455–465. Elmore, S., 2007. Apoptosis: a review of programmed cell death. Toxicol. Pathol. 35, 495–516. European Commission, 2000. Scientific Committee on Food SCF/CS/CNTM/MYC/26 Final of 19 October 2000 Opinion of the Scientific Committee on Food on Fusarium Toxins Part 4: Nivalenol. Health & Consumer Protection Directorate-General C3. Gavrieli, Y., Sherman, Y., Ben-Sasson, S.A., 1992. Identification of programmed cell death in situ via specific labeling of nuclear DNA fragmentation. J. Cell Biol. 119, 493–501. Gerez, J.R., Pinton, P., Callu, P., Grosjean, F., Oswald, I.P., Bracarense, A.P.F.L., 2015. Deoxynivalenol alone or in combination with nivalenol and zearalenone induce systemic histological changes in pigs. Exp. Toxicol. Pathol. 67, 89–98. Hussein, H.S., Brasel, J.M., 2001. Toxicity, metabolism, and impact of mycotoxins on humans and animals. Toxicology 167, 101–134. IARC, 1993. Toxins derived from Fusarium graminearum, F. culmorum and F. crookwellense; zearalenone, deoxynivalenol, nivalenol and fusarenon-X. IARC Monographs on the Evaluation of Carcinogenic Risks to Humans, vol. 56. Ivanova, L., Fæste, C.K., Solhaug, A., 2018. Role of P-glycoprotein in deoxynivalenolmediated in vitro toxicity. Toxicol. Lett. 284, 21–28.
94