- Email: [email protected]
Inducible nitric oxide synthase plays a critical role in resolving intestinal inflammation
GASTROENTEROLOGY 1997;112:1022–1027
RAPID COMMUNICATIONS Inducible Nitric Oxide Synthase Plays a Critical Role in Resolving Intestinal Inflammation DONNA–MARIE MCCAFFERTY,* JOHN S. MUDGETT,‡ MARK G. SWAIN,* and PAUL KUBES* *Gastrointestinal and Immunology Research Groups, University of Calgary, Calgary, Alberta, Canada; and ‡Merck Research Laboratories, Rathway, New Jersey
Background & Aims: Overproduction of nitric oxide by inducible nitric oxide synthase (iNOS) has been proposed as a pathogenic factor in colitis. The objective of this study was to examine the role of iNOS using iNOS-deficient mice in experimental colitis. Methods: Colitis was induced by intrarectal instillation of 3% acetic acid and assessed for neutrophilic infiltration and intestinal injury over 7 days. iNOS messenger RNA expression was also measured. Results: At 24 hours, acetic acid induced a mild colitis in wild-type mice. An increase in neutrophil infiltration and tissue edema was also observed. In the iNOS-deficient mice, a twofold increase in macroscopic damage was observed. Neutrophil infiltration and tissue edema were similar to those in wild-type animals at this time point. Although inflammation in wild-type mice had resolved by 7 days, a sevenfold increase in damage score and elevated myeloperoxidase level were still evident in iNOS-deficient mice. A striking increase in the message for iNOS was observed in inflamed wild-type mice at 24 hours and was still present at 72 hours. No message was found in iNOS-deficient mice. Conclusions: Induction of iNOS seems to be a critical protective response to injury in intestinal inflammation possibly by reducing leukocytic infiltration.
I
nflammatory bowel diseases, including ulcerative colitis and Crohn’s disease, are chronic disorders of unknown etiology. They follow an unpredictable clinical course undergoing a succession of exacerbations and remissions of variable intensity. Many factors have been implicated in the pathogenesis of these diseases, such as inappropriate neutrophil infiltration and overproduction of proinflammatory mediators (cytokines1 and arachidonate metabolites2). Recently attention has been focused on the overproduction of nitric oxide as a key player in the pathogenesis of inflammatory bowel disease. This view is based on the fact that NO levels have been shown to be elevated in the rectal dialysates of patients with ulcerative colitis.3 Increased activity of NO synthase (NOS) in the colonic mucosa of patients with ulcerative / 5e19$$0061
02-18-97 13:35:56
gasa
colitis has been shown to be largely calcium independent, suggesting the presence of induced NOS (iNOS).4 In animal models of colitis there is evidence of increased luminal nitrate and nitrite levels, increased iNOS immunoreactivity, and increased enzymatic conversion of Larginine to L-citrulline.5 – 9 A proportion of the colonic enzymatic activity was calcium independent, indicating the presence of iNOS. However, when inhibitors of NOS are used in various animal models of inflammatory bowel disease, ambiguous results have been achieved. For example, the nonspecific NOS inhibitor NG-nitro-L-arginine methyl ester (LNAME) has been effective in reducing intestinal inflammation associated with acetic acid,10 trinitrobenzene sulfonic acid,5,10 and peptidoglycan-polysaccharide.11 On the other hand, the same inhibitor, in the same or different models of intestinal inflammation, ameliorated some of the sequelae,12 provided no protection,13 or further exacerbated the inflammation.14 Similarly, dichotomous results have been obtained with purported selective inhibitors of iNOS.6,11,15 These results could partly be attributed to different drug regimens achieving partial or complete inhibition of constitutive NOS (cNOS), iNOS, or both enzymes. Therefore, use of these different inhibitors over prolonged periods of time continues to provide equivocal results. Advances in recombinant DNA technology have permitted the development of mice that specifically lack the capacity to express the iNOS gene.16 These animals produce NO constitutively but are unable to overproduce NO via the iNOS enzyme. We chose a very simple model of intestinal inflammation, acetic acid–induced colitis, which has an injury phase and a healing phase, to ask Abbreviations used in this paper: cNOS, constitutive nitric oxide synthesis; iNOS, inducible NOS; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; L-NAME, NG-nitro-L-arginine-methyl ester; MPO, myeloperoxidase; RT-PCR, reverse-transcription polymerase chain reaction. q 1997 by the American Gastroenterological Association 0016-5085/97/$3.00
WBS-Gastro
March 1997
THE ROLE OF iNOS IN COLITIS 1023
Determination of Tissue Myeloperoxidase Activity
Table 1. Macroscopic Damage Score 1. 2. 3. 4. 5. 6. 7. 8. 9. 10.
Erythema Hemorrhage Edema Stricture formation Ulceration Fecal blood Mucus Diarrhea Adhesions (0–1, mild; 2, severe) Maximal bowel wall thickness (mm)
NOTE. Each parameter is awarded 1 point if observed on examination of the mouse colon, with the exception of adhesions (maximal, 2) and bowel wall thickness (millimeters). Data from McCafferty and Zeitlin17 and Morris et al.19
the specific question, what is the role of iNOS in these two phases of inflammation?
Materials and Methods Mice deficient in iNOS were generated by gene targeting in embryonic stem cells as previously described by Dr. J. Mudgett and colleagues.16 The mice were from a mixed background of C57BI6 1 129Sv/Ev, and appropriate wildtype controls were used (Jackson Laboratories, Bar Harbor, ME). All animals were generated in specific pathogen–free facilities. In some cases both iNOS-deficient and wild-type animals were placed into conventional facilities for 2 weeks before experimentation. Results were not different from those of animals remaining in specific pathogen–free conditions.
Experimental Colitis Male or female mice weighing 20–30 g were used in all experiments. The experimental procedures were approved by the Animal Care Committee of the University of Calgary. Colitis was induced by intrarectal administration of 0.1 mL of 3% solution of acetic acid. The acetic acid was administered through a trocar needle approximately 4 cm proximal to the anus. After 10 seconds in situ, the acid was washed out with 0.9% saline (31 0.5 mL). This model has been described in detail previously.17,18 Controls received saline in place of acetic acid intrarectally in an identical manner and volume. Animals were killed 24 hours, 72 hours, or 7 days after induction of colitis.
Assessment of Severity of Colitis Groups of mice were killed by cervical dislocation, the colon was excised, and the severity of colonic damage was assessed using the criteria listed in Table 1 (adapted from previously described scoring systems17,19). This scoring system includes features of clinical colitis, macroscopically visible damage, presence and severity of adhesions, presence of diarrhea (diarrhea was defined as loose, watery stool), and maximal bowel wall thickness in millimeters.
/ 5e19$$0061
02-18-97 13:35:56
gasa
Samples of distal colon were weighed, frozen on dry ice, and processed for determination of myeloperoxidase (MPO) activity. MPO is an enzyme found in cells of myeloid origin that has been used extensively as a biochemical marker of granulocyte (mainly neutrophil) infiltration into gastrointestinal tissues.19 – 21 The samples were stored at 0207C for no longer than 1 week before the MPO assay was performed. MPO activity was determined using an assay described previously,22 but with the volumes of each reagent modified for use in a 96-well enzyme-linked immunosorbent assay plate. Change in absorbance at 450 nm during a 90-second period was determined using a kinetic microplate reader (Molecular Devices, Canada).
Analysis of iNOS RNA Expression by Reverse-Transcription Polymerase Chain Reaction Tissue samples were weighed and placed in guanidinium isothiocyanate to extract total RNA.23 The final RNA concentrations were determined by absorbance using a GeneQuant spectrophotometer (Pharmacia, Piscataway, NJ). The reverse-transcription (RT) and polymerase chain reaction (PCR) steps were performed following the method described by Wong et al.24 Briefly, complementary DNA (cDNA) was generated using an RT reaction by incubating 2 mg of total RNA, 11 PCR buffer (10 mmol/L Tris-HCl, pH 9.0, 50 mmol/L KCl, and 1.5 mmol/L MgCl), 1 mm each of deoxynucleotide triphosphate (deoxyadenosine-, deoxyguanosine-, deoxycytidine-, and deoxyribosyl thymidine triphosphate), 30 U of placental ribonuclease inhibitor (RNA guard; Pharmacia, Piscataway, NJ), 200 U of Superscript reverse-transcriptase (GIBCO-BRL; Burlington, Ontario, Canada), and 1800 pmol of random hexamer oligodeoxynucleotides (Pharmacia) in a reaction volume of 20 mL. The RT reactions were performed for 10 minutes at 217C and 50 minutes at 427C and were then heated to 957C for 5 minutes to terminate the reaction. Reactions were performed in an Amplitron I Thermal Cycler (Barnstead/Thermolyne, Dubuque, IO). PCR reactions were performed using the primer dropping method as described by Wong et al.24 in 50-mL reaction volumes containing 2 mL of RT reaction product as template DNA, 11 PCR buffer, 80 mmol/L of each deoxynucleotide triphosphate, and 20 pmol of each specific 5* and 3* primers. The following primer sequences (5*–3*) were used for iNOS: the sense ACAACAGGAACCTACCAGCTCA and antisense GATGTTGTAGCGCTGTGTGTCA25 with a final PCR product size of 651 base pairs (bp). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA was coamplified as an internal control using the following primer sequences (5*–3*): sense CGGAGTCAACGGATTTGGTCGTAT and the antisense AGCCTTCTCCATGGTGGTGAAGAC24 with a final PCR product size of 302 bp. During the first denaturation step, 2 U of Taq DNA polymerase (Pharmacia) was added to each
WBS-Gastro
1024 MCCAFFERTY ET AL.
GASTROENTEROLOGY Vol. 112, No. 3
tube, then at the appropriate cycle number equal aliquots of secondary primer sets (20 pmol GAPDH) were added. Each PCR cycle consisted of a heat denaturation step at 947C for 1 minute, a primer annealing step at 557C for 30 seconds, and a polymerization step at 727C for 1 minute in an Amplitron I Thermal Cycler (Barnstead/Thermolyne). PCR cycle numbers were chosen to ensure that the amplification of PCR products was in the exponential range: 28 cycles for iNOS and 22 for GAPD. Approximately 10-mL aliquots of PCR products, equalized to give equivalent signals from the GADPH mRNA, were electrophoresed through 2% agarose gels (Ultrapure; Pharmacia) containing 0.5 mg/mL of ethidium bromide. Gels were visualized under UV light and photographed with Kodak Polaroid film (Eastman Kodak, Rochester, NY).
Statistical Analysis Data are expressed as the mean { SEM. Groups of data were compared using nonparametric Mann–Whitney U test or Kruskal–Wallis one-way analysis of variance (ANOVA) followed by a Dunns multiple comparison test. An associated probability (P) of °5% was considered significant.
Results Intrarectal administration of 3% acetic acid induces a mild inflammatory response in the colon as shown in Figure 1A. Twenty-four hours after receiving acetic acid, wild-type mice had a significantly increased mean damage score compared with saline-treated wild-type mice (2.2 { 1.0 vs. 0.5 { 0.05, respectively). This value mainly represents erythema and edema spread over approximately 2 cm of colon. MPO activity in the colonic tissue of the wild-type mice given 3% acetic acid was significantly increased compared with wild-type controls, indicating an increase in neutrophil infiltration into the colon (Figure 1B). A corresponding significant increase in tissue water content in the colon was also observed (Figure 1C). At 24 hours, iNOS gene–deficient mice also had a significantly increased macroscopic damage score. Erythema, edema, mucus, hemorrhage, and erosions of the mucosal surface were apparent, the latter two normally indicative of an inflammatory response induced by higher concentrations of acetic acid.17 There was a significantly higher level of colitis in the iNOS-deficient mice than in their wild-type littermates; however, similar increases in colonic tissue water content and neutrophil infiltration were observed. Saline-treated iNOS-deficient mice and their wild-type littermates showed normal levels in all parameters measured. Figure 2 shows the damage score, MPO activity, and tissue water content induced in wild-type and iNOS-deficient mice up to 7 days after 3% acetic acid administration. It is apparent that the damage in wildtype mice was still evident at 72 hours but had entirely resolved by 7 days. Interestingly, in the iNOS-defi/ 5e19$$0061
02-18-97 13:35:56
gasa
Figure 1. (A ) Macroscopic damage score, (B ) MPO activity, and (C ) percent tissue water content in colonic tissue from iNOS gene–deficient mice or their background wild-type controls. Colitis was induced by intrarectal administration of 3% acetic acid ( ). Control mice received 0.9% saline (j). n ¢ 6. *Significant increase from salinetreated controls. tSignificant increase from wild-type inflamed mice.
cient animals, the macroscopic damage score observed at 24 hours was maintained at a significantly increased level from saline-treated animals up to 7 days after intrarectal acetic acid. At 7 days, 60% of iNOS-deficient mice showed signs of inflammation including hemorrhage, edema, erythema, and ulceration, with stricture formation evident in some animals. The level of neutrophil infiltration observed at 24 hours in wildtype mice returned to control levels by day 3. A significant increase in neutrophil infiltration from the saline-treated control group was observed at 24 and 72 hours in the iNOS-deficient mice. The mean MPO activity was maintained at the 7-day time point, but this parameter was more variable (P Å 0.0776). Tissue WBS-Gastro
March 1997
THE ROLE OF iNOS IN COLITIS 1025
Figure 2. (A ) Macroscopic damage score, (B ) MPO activity, and (C ) percent tissue water content in colonic tissue from iNOS gene–deficient mice (j) or their background wild-type controls (h) treated with 3% acetic acid. n ¢ 5. *Significant increase from zero time point groups.
water content levels returned to normal in both wildtype and iNOS-deficient mice by day 3. Figure 3 shows levels of iNOS mRNA expression from representative animals in wild-type control, wild-type inflamed, and iNOS-deficient inflamed groups of mice at 24 and 72 hours, respectively. Expression of iNOS mRNA was observed in all wild-type mice. However, 24 hours after acetic acid administration, a striking increase in iNOS mRNA expression was observed. This trend was still evident at 72 hours. No detectable levels of iNOS mRNA were noted in iNOS-deficient mice.
compared with mild erythema). At 1 week, the intestine was completely healed in wild-type mice consistent with previously reported data.18 In contrast, the iNOS-deficient mice, which lack the ability to overproduce NO, had persistent macroscopic damage over the 7 days. The wild-type animals had evidence of induction of iNOS message at both 24 and 72 hours of inflammation. These data clearly show that the iNOS-deficient mice have an inability to resolve the intestinal inflammation associated with acetic acid treatment. These data are consistent with our unpublished observations that these mice have difficulty resolving skin lesions after scratches and bites. The persistence of the neutrophil infiltration is entirely consistent with our observation that the constitutive production of NO prevents neutrophil infiltration under normal conditions and that supplementation with excess NO reduces neutrophil adhesion in inflammation.26 – 28 These data are also consistent with results showing that supplementation of NO down-regulates adhesion molecule expression and leukocyte-endothelial cell interactions29 and that inhibition of NO increases circulating levels of cytokines (IL-6 and tumor necrosis factor) that up-regulate adhesion molecule expression in inflammation.30 Recent evidence shows that, in endothelial cells, NO can inhibit the activation of NF-kB, the transcription factor for a wide range of genes with a central role in inflammatory processes through the activation of IkB, the inhibitor protein for NF-kB.31 It is important to note that the first 24 hours of acetic acid–induced injury occur independently of neutrophils32 despite the fact that neutrophils infiltrate the tissue. In this study, neutrophil infiltration at 24 hours was elevated to the same degree in both wild-type and iNOS-deficient mice, yet the injury was greater in the iNOS-deficient mice. Despite this, if iNOS functions to dampen neutrophil reactivity (by inhibition of superoxide production and other proinflammatory mediators33), at 24 hours, neutrophils in the iNOS-deficient animals may contribute to the injury at later time points. Indeed, our unpublished results (D.-M. McCafferty and P. Kubes)
Discussion This study shows that, in an injury model of the intestine induced by low-dose acetic acid, the injury that occurs at 24 hours is similar in terms of white cell infiltration and edema formation in all inflamed animals. As early as 24 hours the macroscopic damage was worse in the iNOS-deficient mice (hemorrhage and ulceration / 5e19$$0061
02-18-97 13:35:56
gasa
Figure 3. A representative 2% agarose gel of RT-PCR products. Base pair markers denoting DNA size are shown in the far left lane. GAPDH (internal marker) and iNOS RT-PCR products are shown for wild-type control tissue (1), wild-type inflamed tissue at 24 hours (2) and 72 hours (4), and iNOS-deficient inflamed tissue at 24 hours (3) and 72 hours (5).
WBS-Gastro
1026 MCCAFFERTY ET AL.
GASTROENTEROLOGY Vol. 112, No. 3
suggest that mice lacking the ability to recruit neutrophils (adhesion molecule–deficient animals) have greatly reduced intestinal injury between 24 and 72 hours after acetic acid administration compared with their wild-type littermates. A criticism that can be levied against the use of genedeleted animals is that they adapt and compensate for the lack of the specific gene, in this case iNOS. However, if this were the case, then one would predict identical or similar responses in the wild-type and iNOS-deficient animals. Our data suggests that there is no compensation for the iNOS gene because the iNOS-deficient mice were not able to resolve the intestinal inflammation. Furthermore, our results suggest that iNOS has a regulatory role in this type of inflammation in the colon. It is intriguing therefore that L-NAME has been shown to completely inhibit the acetic acid–induced injury in the rat.10 Although it is possible that cNOS may be responsible for the increased damage observed, in our animals it would require that cNOS alone produced more NO than cNOS and iNOS in wild-type littermates. This seems extremely unlikely because the levels of cNOS mRNA expression are the same in both groups of animals.16 Alternatively, L-NAME may have affected intestinal blood flow, metabolism, or many other parameters not evident from the available data.16 There is a growing body of evidence that the presence of bacteria in the gut may contribute to the development of inflammatory bowel disease. For example, inflammation in the gastrointestinal tract of interleukin 10–deficient mice is more widespread and exacerbated when the animals are kept in conventional facilities.34 In this study it seemed to make little difference whether the animals were kept in specific pathogen–free or conventional facilities. This may reflect one of the limitations of this model of experimental colitis in its relevance to inflammatory bowel disease; however, this model does allow us to follow acute injury and resolution of that injury in the colon. Clearly, iNOS-deficient mice are more susceptible to a mild colonic insult than their wild-type littermates and lack the capacity to heal. In other words, our data show that iNOS is critical in everyday responses to injury in the intestine and perhaps all other tissues. On the basis of our data, iNOS is possibly a normal component of the inflammatory response and only under very particular situations does iNOS actually contribute to an inappropriate inflammatory situation. Indeed, most inflammatory responses resolve without incident in the presence of iNOS induction. However, it cannot be excluded that in the inappropriate, complex inflammatory bowel disease condition iNOS may be a contributing factor to the inflammation.
References 1. Sartor RB. Pathogenic and clinical relevance of cytokines in inflammatory bowel disease. Immunol Res 1991;10:465–471.
/ 5e19$$0061
02-18-97 13:35:56
gasa
2. Lobos EA, Sharon P, Stenson WF. Chemotactic activity in inflammatory bowel disease. Role of leukotriene B4 . Dig Dis Sci 1987;32:1380–1388. 3. Roediger WEW, Lawson MJ, Nance SH, Radcliffe BC. Detectable colonic nitrate levels in inflammatory bowel disease—mucosal or bacterial malfunction. Digestion 1986;35:199–204. 4. Boughton-Smith NK, Evans SM, Hawkey CJ, Cole AT, Balsitis M, Whittle BJR, Moncada S. Nitric oxide synthase activity in ulcerative colitis and Crohn’s disease. Lancet 1993;342:338–340. 5. Miller MJS, Sadowska-Krowicka H, Chotinaruemol S, Kakkis JL, Clark DA. Amelioration of chronic ileitis by nitric oxide synthase inhibition. J Pharmacol Exp Ther 1992;264:11–16. 6. Thompson JA, Sadowska-Krowicka H, Rossi J, Clark DA, Miller MJS. Inducible nitric oxide synthase gene expression in guinea pig ileitis: a model of IBD prevented by aminoguanidine (abstr). Gastroenterology 1994;106:A782. 7. Florquin S, Amraoui Z, Dubois C, Decuyper J, Goldman M. The protective role of endogenously synthesized nitric oxide in staphylococcal enterotoxin B–induced shock in mice. J Exp Med 1994; 180:1153–1158. 8. Yamada T, Sartor RB, Marshall S, Specian RD, Grisham MB. Mucosal injury and inflammation in a model of chronic granulomatous colitis rats. Gastroenterology 1993;104:759–771. 9. Ribbons KA, Zhang X-J, Thompson JH, Greenberg SS, Moore WM, Kornmeier CM, Currie MG, Lerche N, Blanchard J, Clark DA, Miller MJS. Potential role of nitric oxide in a model of chronic colitis in Rhesus macaques. Gastroenterology 1995;108:705–711. 10. Rachmilewitz D, Karmeli F, Okon E, Bursztyn M. Experimental colitis is ameliorated by inhibition of nitric oxide synthase activity. Gut 1995;37:247–255. 11. Grisham MB, Specian RD, Zimmerman TE. Effects of nitric oxide synthase inhibition on the pathophysiology observed in a model of chronic colitis. J Pharmacol Exp Ther 1994;271:1114–1121. 12. Hogaboam CM, Jacobson K, Collins SM, Blennerhassett MG. The selective beneficial effects of nitric oxide inhibition in experimental colitis. Am J Physiol 1995;268:G673–G684. 13. Conner EM, Chen Y, Grisham MB. Effect of nitric oxide synthase (NOS) inhibition on dextran sulfate sodium (DSS)-induced colitis in rats and mice (abstr). Gastroenterology 1995;108:A801. 14. Pfeiffer CJ, Qiu BS. Effects of chronic nitric oxide synthase inhibition on TNB-induced colitis in rats. J Pharm Pharmacol 1995;47: 827–832. 15. Ribbons KA, Clark DA, Currie MG, Moore WM, Miller MJS. Inducible nitric oxide synthase and idiopathic colitis in rhesus macaques (abstr). Gastroenterology 1995;108:A903. 16. MacMicking JD, Nathan C, Hom G, Chartain N, Fletcher DS, Trumbauer M, Stevens K, Xie Q-W, Sokol K, Hutchinson N, Chen H, Mudgett JS. Altered responses to bacterial infection and endotoxic shock in mice lacking inducible nitric oxide synthase. Cell 1995;81:641–650. 17. McCafferty D-M, Zeitlin IJ. Short chain fatty acid induced colitis in mice. Int J Tissue React 1989;11:165–168. 18. McCafferty D-M. Studies on a short chain fatty acid–incuced colitis in mice. Ph.D. Thesis, University of Strathclyde, Glasgow, Scotland, 1991. 19. Morris GP, Beck PL, Herridge MS, Depew WT, Szewczuk MR, Wallace JL. Hapten-induced model of chronic inflammation and ulceration in the rat. Gastroenterology 1989;96:795–803. 20. Krawisz JE, Sharon P, Stenson WF. Quantitative assay for acute inflammation based on myeloperoxidase activity: assessment of inflammation in the rat and hamster models. Gastroenterology 1984;87:1344–1350. 21. Boughton-Smith NK, Dahlstrom A, Johansson L, Ahlman H. Relationship between arachidonic acid metabolism, myeloperoxidase activity and leukocyte infiltration in a rat model of inflammatory bowel disease. Agents Actions 1988;25:115–123. 22. Wallace JL, MacNaughton WK, Morris GP, Beck PL. Inhibition of
WBS-Gastro
March 1997
23.
24.
25.
26.
27.
28.
29.
30.
THE ROLE OF iNOS IN COLITIS 1027
leukotriene synthesis markedly accelerates healing in a rat model of inflammatory bowel disease. Gastroenterology 1989; 96:29–36. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium tiocyanate–phenol–chloroform extraction. Anal Biochem 1987;162:156–159. Wong H, Anderson WD, Cheng T, Riabowol KT. Monitoring mRNA expression by polymerase chain reaction: the ‘‘primer dropping’’ method. Anal Biochem 1994;223:251–258. Lyons CR, Orloff GJ, Cunnigham JM. Molecular cloning and functional expression of an inducible nitric oxide synthase from a murine macrophage cell line. J Biol Chem 1992;267:6370– 6374. Kubes P, Kurose I, Granger DN. NO donors prevent integrin-induced leukocyte adhesion but not P-selectin–dependent rolling in postischemic venules. Am J Physiol 1994;267:H931–H937. Kubes P, Suzuki M, Granger DN. Nitric oxide: an endogenous modulator of leukocyte adhesion. Proc Natl Acad Sci USA 1991; 88:4651–4655. Gaboury JP, Niu X-F, Kubes P. Nitric oxide inhibits numerous features of mast cell–induced inflammation. Circ 1996;93:318– 326. De Caterina R, Libby P, Peng H-B, Thannickal VJ, Rajavashisth TB, Gimbrone MA, Shin WS, Liao JK. Nitric oxide decreases cytokineinduced endothelial activation. J Clin Invest 1995;96:60–68. Tiao G, Rafferty J, Ogle C, Fischer JE, Hasselgren P-O. Detrimental effect of nitric oxide synthase inhibition during endotoxemia may
/ 5e19$$0061
02-18-97 13:35:56
gasa
31.
32.
33. 34.
be caused by high levels of tumor necrosis factor and interleukin6. Surgery 1994;116:332–338. Peng HB, Libby P, Liao J. Induction and stabilization of I-kB by nitric oxide mediates inhibition of NF-kB. J Biol Chem 1995;270: 214–219. Yamada T, Zimmerman BJ, Specian RD, Grisham MB. Role of neutrophils in acetic acid–induced colitis in rats. Inflammation 1991;15:339–411. Alican I, Kubes P. A critical role for nitric oxide in intestinal barrier fuction and dysfunction. Am J Physiol 1996;270:G225–G237. Kuhn R, Lohler J, Rennick D, Rajewsky K, Muller W. Interleukin10–deficient mice develop chronic enterocolitis. Cell 1993;75: 263–274.
Received October 4, 1996. Accepted December 10, 1996. Address requests for reprints to: Paul Kubes, Ph.D., Immunology Research Group, University of Calgary, Health Sciences Centre, 3330 Hospital Drive Northwest, Calgary, Alberta T2N 4N1, Canada. Supported by a grant from the Crohn’s and Colitis Foundation of Canada. Dr. P. Kubes is a Medical Research Council (MRC) and Alberta Heritage Foundation for Medical Research (AHFMR) scholar. Dr. M. G. Swain is an AHFMR clinical investigator and an MRC scholar. The authors thank Tai T. Le and Lesley Marshall for technical assistance and Drs. C. Nathan and J. MacMicking, Cornell University Medical College, New York, New York, for help in obtaining the inducible nitric oxide–deficient mice.
WBS-Gastro
RAPID COMMUNICATIONS Inducible Nitric Oxide Synthase Plays a Critical Role in Resolving Intestinal Inflammation DONNA–MARIE MCCAFFERTY,* JOHN S. MUDGETT,‡ MARK G. SWAIN,* and PAUL KUBES* *Gastrointestinal and Immunology Research Groups, University of Calgary, Calgary, Alberta, Canada; and ‡Merck Research Laboratories, Rathway, New Jersey
Background & Aims: Overproduction of nitric oxide by inducible nitric oxide synthase (iNOS) has been proposed as a pathogenic factor in colitis. The objective of this study was to examine the role of iNOS using iNOS-deficient mice in experimental colitis. Methods: Colitis was induced by intrarectal instillation of 3% acetic acid and assessed for neutrophilic infiltration and intestinal injury over 7 days. iNOS messenger RNA expression was also measured. Results: At 24 hours, acetic acid induced a mild colitis in wild-type mice. An increase in neutrophil infiltration and tissue edema was also observed. In the iNOS-deficient mice, a twofold increase in macroscopic damage was observed. Neutrophil infiltration and tissue edema were similar to those in wild-type animals at this time point. Although inflammation in wild-type mice had resolved by 7 days, a sevenfold increase in damage score and elevated myeloperoxidase level were still evident in iNOS-deficient mice. A striking increase in the message for iNOS was observed in inflamed wild-type mice at 24 hours and was still present at 72 hours. No message was found in iNOS-deficient mice. Conclusions: Induction of iNOS seems to be a critical protective response to injury in intestinal inflammation possibly by reducing leukocytic infiltration.
I
nflammatory bowel diseases, including ulcerative colitis and Crohn’s disease, are chronic disorders of unknown etiology. They follow an unpredictable clinical course undergoing a succession of exacerbations and remissions of variable intensity. Many factors have been implicated in the pathogenesis of these diseases, such as inappropriate neutrophil infiltration and overproduction of proinflammatory mediators (cytokines1 and arachidonate metabolites2). Recently attention has been focused on the overproduction of nitric oxide as a key player in the pathogenesis of inflammatory bowel disease. This view is based on the fact that NO levels have been shown to be elevated in the rectal dialysates of patients with ulcerative colitis.3 Increased activity of NO synthase (NOS) in the colonic mucosa of patients with ulcerative / 5e19$$0061
02-18-97 13:35:56
gasa
colitis has been shown to be largely calcium independent, suggesting the presence of induced NOS (iNOS).4 In animal models of colitis there is evidence of increased luminal nitrate and nitrite levels, increased iNOS immunoreactivity, and increased enzymatic conversion of Larginine to L-citrulline.5 – 9 A proportion of the colonic enzymatic activity was calcium independent, indicating the presence of iNOS. However, when inhibitors of NOS are used in various animal models of inflammatory bowel disease, ambiguous results have been achieved. For example, the nonspecific NOS inhibitor NG-nitro-L-arginine methyl ester (LNAME) has been effective in reducing intestinal inflammation associated with acetic acid,10 trinitrobenzene sulfonic acid,5,10 and peptidoglycan-polysaccharide.11 On the other hand, the same inhibitor, in the same or different models of intestinal inflammation, ameliorated some of the sequelae,12 provided no protection,13 or further exacerbated the inflammation.14 Similarly, dichotomous results have been obtained with purported selective inhibitors of iNOS.6,11,15 These results could partly be attributed to different drug regimens achieving partial or complete inhibition of constitutive NOS (cNOS), iNOS, or both enzymes. Therefore, use of these different inhibitors over prolonged periods of time continues to provide equivocal results. Advances in recombinant DNA technology have permitted the development of mice that specifically lack the capacity to express the iNOS gene.16 These animals produce NO constitutively but are unable to overproduce NO via the iNOS enzyme. We chose a very simple model of intestinal inflammation, acetic acid–induced colitis, which has an injury phase and a healing phase, to ask Abbreviations used in this paper: cNOS, constitutive nitric oxide synthesis; iNOS, inducible NOS; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; L-NAME, NG-nitro-L-arginine-methyl ester; MPO, myeloperoxidase; RT-PCR, reverse-transcription polymerase chain reaction. q 1997 by the American Gastroenterological Association 0016-5085/97/$3.00
WBS-Gastro
March 1997
THE ROLE OF iNOS IN COLITIS 1023
Determination of Tissue Myeloperoxidase Activity
Table 1. Macroscopic Damage Score 1. 2. 3. 4. 5. 6. 7. 8. 9. 10.
Erythema Hemorrhage Edema Stricture formation Ulceration Fecal blood Mucus Diarrhea Adhesions (0–1, mild; 2, severe) Maximal bowel wall thickness (mm)
NOTE. Each parameter is awarded 1 point if observed on examination of the mouse colon, with the exception of adhesions (maximal, 2) and bowel wall thickness (millimeters). Data from McCafferty and Zeitlin17 and Morris et al.19
the specific question, what is the role of iNOS in these two phases of inflammation?
Materials and Methods Mice deficient in iNOS were generated by gene targeting in embryonic stem cells as previously described by Dr. J. Mudgett and colleagues.16 The mice were from a mixed background of C57BI6 1 129Sv/Ev, and appropriate wildtype controls were used (Jackson Laboratories, Bar Harbor, ME). All animals were generated in specific pathogen–free facilities. In some cases both iNOS-deficient and wild-type animals were placed into conventional facilities for 2 weeks before experimentation. Results were not different from those of animals remaining in specific pathogen–free conditions.
Experimental Colitis Male or female mice weighing 20–30 g were used in all experiments. The experimental procedures were approved by the Animal Care Committee of the University of Calgary. Colitis was induced by intrarectal administration of 0.1 mL of 3% solution of acetic acid. The acetic acid was administered through a trocar needle approximately 4 cm proximal to the anus. After 10 seconds in situ, the acid was washed out with 0.9% saline (31 0.5 mL). This model has been described in detail previously.17,18 Controls received saline in place of acetic acid intrarectally in an identical manner and volume. Animals were killed 24 hours, 72 hours, or 7 days after induction of colitis.
Assessment of Severity of Colitis Groups of mice were killed by cervical dislocation, the colon was excised, and the severity of colonic damage was assessed using the criteria listed in Table 1 (adapted from previously described scoring systems17,19). This scoring system includes features of clinical colitis, macroscopically visible damage, presence and severity of adhesions, presence of diarrhea (diarrhea was defined as loose, watery stool), and maximal bowel wall thickness in millimeters.
/ 5e19$$0061
02-18-97 13:35:56
gasa
Samples of distal colon were weighed, frozen on dry ice, and processed for determination of myeloperoxidase (MPO) activity. MPO is an enzyme found in cells of myeloid origin that has been used extensively as a biochemical marker of granulocyte (mainly neutrophil) infiltration into gastrointestinal tissues.19 – 21 The samples were stored at 0207C for no longer than 1 week before the MPO assay was performed. MPO activity was determined using an assay described previously,22 but with the volumes of each reagent modified for use in a 96-well enzyme-linked immunosorbent assay plate. Change in absorbance at 450 nm during a 90-second period was determined using a kinetic microplate reader (Molecular Devices, Canada).
Analysis of iNOS RNA Expression by Reverse-Transcription Polymerase Chain Reaction Tissue samples were weighed and placed in guanidinium isothiocyanate to extract total RNA.23 The final RNA concentrations were determined by absorbance using a GeneQuant spectrophotometer (Pharmacia, Piscataway, NJ). The reverse-transcription (RT) and polymerase chain reaction (PCR) steps were performed following the method described by Wong et al.24 Briefly, complementary DNA (cDNA) was generated using an RT reaction by incubating 2 mg of total RNA, 11 PCR buffer (10 mmol/L Tris-HCl, pH 9.0, 50 mmol/L KCl, and 1.5 mmol/L MgCl), 1 mm each of deoxynucleotide triphosphate (deoxyadenosine-, deoxyguanosine-, deoxycytidine-, and deoxyribosyl thymidine triphosphate), 30 U of placental ribonuclease inhibitor (RNA guard; Pharmacia, Piscataway, NJ), 200 U of Superscript reverse-transcriptase (GIBCO-BRL; Burlington, Ontario, Canada), and 1800 pmol of random hexamer oligodeoxynucleotides (Pharmacia) in a reaction volume of 20 mL. The RT reactions were performed for 10 minutes at 217C and 50 minutes at 427C and were then heated to 957C for 5 minutes to terminate the reaction. Reactions were performed in an Amplitron I Thermal Cycler (Barnstead/Thermolyne, Dubuque, IO). PCR reactions were performed using the primer dropping method as described by Wong et al.24 in 50-mL reaction volumes containing 2 mL of RT reaction product as template DNA, 11 PCR buffer, 80 mmol/L of each deoxynucleotide triphosphate, and 20 pmol of each specific 5* and 3* primers. The following primer sequences (5*–3*) were used for iNOS: the sense ACAACAGGAACCTACCAGCTCA and antisense GATGTTGTAGCGCTGTGTGTCA25 with a final PCR product size of 651 base pairs (bp). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA was coamplified as an internal control using the following primer sequences (5*–3*): sense CGGAGTCAACGGATTTGGTCGTAT and the antisense AGCCTTCTCCATGGTGGTGAAGAC24 with a final PCR product size of 302 bp. During the first denaturation step, 2 U of Taq DNA polymerase (Pharmacia) was added to each
WBS-Gastro
1024 MCCAFFERTY ET AL.
GASTROENTEROLOGY Vol. 112, No. 3
tube, then at the appropriate cycle number equal aliquots of secondary primer sets (20 pmol GAPDH) were added. Each PCR cycle consisted of a heat denaturation step at 947C for 1 minute, a primer annealing step at 557C for 30 seconds, and a polymerization step at 727C for 1 minute in an Amplitron I Thermal Cycler (Barnstead/Thermolyne). PCR cycle numbers were chosen to ensure that the amplification of PCR products was in the exponential range: 28 cycles for iNOS and 22 for GAPD. Approximately 10-mL aliquots of PCR products, equalized to give equivalent signals from the GADPH mRNA, were electrophoresed through 2% agarose gels (Ultrapure; Pharmacia) containing 0.5 mg/mL of ethidium bromide. Gels were visualized under UV light and photographed with Kodak Polaroid film (Eastman Kodak, Rochester, NY).
Statistical Analysis Data are expressed as the mean { SEM. Groups of data were compared using nonparametric Mann–Whitney U test or Kruskal–Wallis one-way analysis of variance (ANOVA) followed by a Dunns multiple comparison test. An associated probability (P) of °5% was considered significant.
Results Intrarectal administration of 3% acetic acid induces a mild inflammatory response in the colon as shown in Figure 1A. Twenty-four hours after receiving acetic acid, wild-type mice had a significantly increased mean damage score compared with saline-treated wild-type mice (2.2 { 1.0 vs. 0.5 { 0.05, respectively). This value mainly represents erythema and edema spread over approximately 2 cm of colon. MPO activity in the colonic tissue of the wild-type mice given 3% acetic acid was significantly increased compared with wild-type controls, indicating an increase in neutrophil infiltration into the colon (Figure 1B). A corresponding significant increase in tissue water content in the colon was also observed (Figure 1C). At 24 hours, iNOS gene–deficient mice also had a significantly increased macroscopic damage score. Erythema, edema, mucus, hemorrhage, and erosions of the mucosal surface were apparent, the latter two normally indicative of an inflammatory response induced by higher concentrations of acetic acid.17 There was a significantly higher level of colitis in the iNOS-deficient mice than in their wild-type littermates; however, similar increases in colonic tissue water content and neutrophil infiltration were observed. Saline-treated iNOS-deficient mice and their wild-type littermates showed normal levels in all parameters measured. Figure 2 shows the damage score, MPO activity, and tissue water content induced in wild-type and iNOS-deficient mice up to 7 days after 3% acetic acid administration. It is apparent that the damage in wildtype mice was still evident at 72 hours but had entirely resolved by 7 days. Interestingly, in the iNOS-defi/ 5e19$$0061
02-18-97 13:35:56
gasa
Figure 1. (A ) Macroscopic damage score, (B ) MPO activity, and (C ) percent tissue water content in colonic tissue from iNOS gene–deficient mice or their background wild-type controls. Colitis was induced by intrarectal administration of 3% acetic acid ( ). Control mice received 0.9% saline (j). n ¢ 6. *Significant increase from salinetreated controls. tSignificant increase from wild-type inflamed mice.
cient animals, the macroscopic damage score observed at 24 hours was maintained at a significantly increased level from saline-treated animals up to 7 days after intrarectal acetic acid. At 7 days, 60% of iNOS-deficient mice showed signs of inflammation including hemorrhage, edema, erythema, and ulceration, with stricture formation evident in some animals. The level of neutrophil infiltration observed at 24 hours in wildtype mice returned to control levels by day 3. A significant increase in neutrophil infiltration from the saline-treated control group was observed at 24 and 72 hours in the iNOS-deficient mice. The mean MPO activity was maintained at the 7-day time point, but this parameter was more variable (P Å 0.0776). Tissue WBS-Gastro
March 1997
THE ROLE OF iNOS IN COLITIS 1025
Figure 2. (A ) Macroscopic damage score, (B ) MPO activity, and (C ) percent tissue water content in colonic tissue from iNOS gene–deficient mice (j) or their background wild-type controls (h) treated with 3% acetic acid. n ¢ 5. *Significant increase from zero time point groups.
water content levels returned to normal in both wildtype and iNOS-deficient mice by day 3. Figure 3 shows levels of iNOS mRNA expression from representative animals in wild-type control, wild-type inflamed, and iNOS-deficient inflamed groups of mice at 24 and 72 hours, respectively. Expression of iNOS mRNA was observed in all wild-type mice. However, 24 hours after acetic acid administration, a striking increase in iNOS mRNA expression was observed. This trend was still evident at 72 hours. No detectable levels of iNOS mRNA were noted in iNOS-deficient mice.
compared with mild erythema). At 1 week, the intestine was completely healed in wild-type mice consistent with previously reported data.18 In contrast, the iNOS-deficient mice, which lack the ability to overproduce NO, had persistent macroscopic damage over the 7 days. The wild-type animals had evidence of induction of iNOS message at both 24 and 72 hours of inflammation. These data clearly show that the iNOS-deficient mice have an inability to resolve the intestinal inflammation associated with acetic acid treatment. These data are consistent with our unpublished observations that these mice have difficulty resolving skin lesions after scratches and bites. The persistence of the neutrophil infiltration is entirely consistent with our observation that the constitutive production of NO prevents neutrophil infiltration under normal conditions and that supplementation with excess NO reduces neutrophil adhesion in inflammation.26 – 28 These data are also consistent with results showing that supplementation of NO down-regulates adhesion molecule expression and leukocyte-endothelial cell interactions29 and that inhibition of NO increases circulating levels of cytokines (IL-6 and tumor necrosis factor) that up-regulate adhesion molecule expression in inflammation.30 Recent evidence shows that, in endothelial cells, NO can inhibit the activation of NF-kB, the transcription factor for a wide range of genes with a central role in inflammatory processes through the activation of IkB, the inhibitor protein for NF-kB.31 It is important to note that the first 24 hours of acetic acid–induced injury occur independently of neutrophils32 despite the fact that neutrophils infiltrate the tissue. In this study, neutrophil infiltration at 24 hours was elevated to the same degree in both wild-type and iNOS-deficient mice, yet the injury was greater in the iNOS-deficient mice. Despite this, if iNOS functions to dampen neutrophil reactivity (by inhibition of superoxide production and other proinflammatory mediators33), at 24 hours, neutrophils in the iNOS-deficient animals may contribute to the injury at later time points. Indeed, our unpublished results (D.-M. McCafferty and P. Kubes)
Discussion This study shows that, in an injury model of the intestine induced by low-dose acetic acid, the injury that occurs at 24 hours is similar in terms of white cell infiltration and edema formation in all inflamed animals. As early as 24 hours the macroscopic damage was worse in the iNOS-deficient mice (hemorrhage and ulceration / 5e19$$0061
02-18-97 13:35:56
gasa
Figure 3. A representative 2% agarose gel of RT-PCR products. Base pair markers denoting DNA size are shown in the far left lane. GAPDH (internal marker) and iNOS RT-PCR products are shown for wild-type control tissue (1), wild-type inflamed tissue at 24 hours (2) and 72 hours (4), and iNOS-deficient inflamed tissue at 24 hours (3) and 72 hours (5).
WBS-Gastro
1026 MCCAFFERTY ET AL.
GASTROENTEROLOGY Vol. 112, No. 3
suggest that mice lacking the ability to recruit neutrophils (adhesion molecule–deficient animals) have greatly reduced intestinal injury between 24 and 72 hours after acetic acid administration compared with their wild-type littermates. A criticism that can be levied against the use of genedeleted animals is that they adapt and compensate for the lack of the specific gene, in this case iNOS. However, if this were the case, then one would predict identical or similar responses in the wild-type and iNOS-deficient animals. Our data suggests that there is no compensation for the iNOS gene because the iNOS-deficient mice were not able to resolve the intestinal inflammation. Furthermore, our results suggest that iNOS has a regulatory role in this type of inflammation in the colon. It is intriguing therefore that L-NAME has been shown to completely inhibit the acetic acid–induced injury in the rat.10 Although it is possible that cNOS may be responsible for the increased damage observed, in our animals it would require that cNOS alone produced more NO than cNOS and iNOS in wild-type littermates. This seems extremely unlikely because the levels of cNOS mRNA expression are the same in both groups of animals.16 Alternatively, L-NAME may have affected intestinal blood flow, metabolism, or many other parameters not evident from the available data.16 There is a growing body of evidence that the presence of bacteria in the gut may contribute to the development of inflammatory bowel disease. For example, inflammation in the gastrointestinal tract of interleukin 10–deficient mice is more widespread and exacerbated when the animals are kept in conventional facilities.34 In this study it seemed to make little difference whether the animals were kept in specific pathogen–free or conventional facilities. This may reflect one of the limitations of this model of experimental colitis in its relevance to inflammatory bowel disease; however, this model does allow us to follow acute injury and resolution of that injury in the colon. Clearly, iNOS-deficient mice are more susceptible to a mild colonic insult than their wild-type littermates and lack the capacity to heal. In other words, our data show that iNOS is critical in everyday responses to injury in the intestine and perhaps all other tissues. On the basis of our data, iNOS is possibly a normal component of the inflammatory response and only under very particular situations does iNOS actually contribute to an inappropriate inflammatory situation. Indeed, most inflammatory responses resolve without incident in the presence of iNOS induction. However, it cannot be excluded that in the inappropriate, complex inflammatory bowel disease condition iNOS may be a contributing factor to the inflammation.
References 1. Sartor RB. Pathogenic and clinical relevance of cytokines in inflammatory bowel disease. Immunol Res 1991;10:465–471.
/ 5e19$$0061
02-18-97 13:35:56
gasa
2. Lobos EA, Sharon P, Stenson WF. Chemotactic activity in inflammatory bowel disease. Role of leukotriene B4 . Dig Dis Sci 1987;32:1380–1388. 3. Roediger WEW, Lawson MJ, Nance SH, Radcliffe BC. Detectable colonic nitrate levels in inflammatory bowel disease—mucosal or bacterial malfunction. Digestion 1986;35:199–204. 4. Boughton-Smith NK, Evans SM, Hawkey CJ, Cole AT, Balsitis M, Whittle BJR, Moncada S. Nitric oxide synthase activity in ulcerative colitis and Crohn’s disease. Lancet 1993;342:338–340. 5. Miller MJS, Sadowska-Krowicka H, Chotinaruemol S, Kakkis JL, Clark DA. Amelioration of chronic ileitis by nitric oxide synthase inhibition. J Pharmacol Exp Ther 1992;264:11–16. 6. Thompson JA, Sadowska-Krowicka H, Rossi J, Clark DA, Miller MJS. Inducible nitric oxide synthase gene expression in guinea pig ileitis: a model of IBD prevented by aminoguanidine (abstr). Gastroenterology 1994;106:A782. 7. Florquin S, Amraoui Z, Dubois C, Decuyper J, Goldman M. The protective role of endogenously synthesized nitric oxide in staphylococcal enterotoxin B–induced shock in mice. J Exp Med 1994; 180:1153–1158. 8. Yamada T, Sartor RB, Marshall S, Specian RD, Grisham MB. Mucosal injury and inflammation in a model of chronic granulomatous colitis rats. Gastroenterology 1993;104:759–771. 9. Ribbons KA, Zhang X-J, Thompson JH, Greenberg SS, Moore WM, Kornmeier CM, Currie MG, Lerche N, Blanchard J, Clark DA, Miller MJS. Potential role of nitric oxide in a model of chronic colitis in Rhesus macaques. Gastroenterology 1995;108:705–711. 10. Rachmilewitz D, Karmeli F, Okon E, Bursztyn M. Experimental colitis is ameliorated by inhibition of nitric oxide synthase activity. Gut 1995;37:247–255. 11. Grisham MB, Specian RD, Zimmerman TE. Effects of nitric oxide synthase inhibition on the pathophysiology observed in a model of chronic colitis. J Pharmacol Exp Ther 1994;271:1114–1121. 12. Hogaboam CM, Jacobson K, Collins SM, Blennerhassett MG. The selective beneficial effects of nitric oxide inhibition in experimental colitis. Am J Physiol 1995;268:G673–G684. 13. Conner EM, Chen Y, Grisham MB. Effect of nitric oxide synthase (NOS) inhibition on dextran sulfate sodium (DSS)-induced colitis in rats and mice (abstr). Gastroenterology 1995;108:A801. 14. Pfeiffer CJ, Qiu BS. Effects of chronic nitric oxide synthase inhibition on TNB-induced colitis in rats. J Pharm Pharmacol 1995;47: 827–832. 15. Ribbons KA, Clark DA, Currie MG, Moore WM, Miller MJS. Inducible nitric oxide synthase and idiopathic colitis in rhesus macaques (abstr). Gastroenterology 1995;108:A903. 16. MacMicking JD, Nathan C, Hom G, Chartain N, Fletcher DS, Trumbauer M, Stevens K, Xie Q-W, Sokol K, Hutchinson N, Chen H, Mudgett JS. Altered responses to bacterial infection and endotoxic shock in mice lacking inducible nitric oxide synthase. Cell 1995;81:641–650. 17. McCafferty D-M, Zeitlin IJ. Short chain fatty acid induced colitis in mice. Int J Tissue React 1989;11:165–168. 18. McCafferty D-M. Studies on a short chain fatty acid–incuced colitis in mice. Ph.D. Thesis, University of Strathclyde, Glasgow, Scotland, 1991. 19. Morris GP, Beck PL, Herridge MS, Depew WT, Szewczuk MR, Wallace JL. Hapten-induced model of chronic inflammation and ulceration in the rat. Gastroenterology 1989;96:795–803. 20. Krawisz JE, Sharon P, Stenson WF. Quantitative assay for acute inflammation based on myeloperoxidase activity: assessment of inflammation in the rat and hamster models. Gastroenterology 1984;87:1344–1350. 21. Boughton-Smith NK, Dahlstrom A, Johansson L, Ahlman H. Relationship between arachidonic acid metabolism, myeloperoxidase activity and leukocyte infiltration in a rat model of inflammatory bowel disease. Agents Actions 1988;25:115–123. 22. Wallace JL, MacNaughton WK, Morris GP, Beck PL. Inhibition of
WBS-Gastro
March 1997
23.
24.
25.
26.
27.
28.
29.
30.
THE ROLE OF iNOS IN COLITIS 1027
leukotriene synthesis markedly accelerates healing in a rat model of inflammatory bowel disease. Gastroenterology 1989; 96:29–36. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium tiocyanate–phenol–chloroform extraction. Anal Biochem 1987;162:156–159. Wong H, Anderson WD, Cheng T, Riabowol KT. Monitoring mRNA expression by polymerase chain reaction: the ‘‘primer dropping’’ method. Anal Biochem 1994;223:251–258. Lyons CR, Orloff GJ, Cunnigham JM. Molecular cloning and functional expression of an inducible nitric oxide synthase from a murine macrophage cell line. J Biol Chem 1992;267:6370– 6374. Kubes P, Kurose I, Granger DN. NO donors prevent integrin-induced leukocyte adhesion but not P-selectin–dependent rolling in postischemic venules. Am J Physiol 1994;267:H931–H937. Kubes P, Suzuki M, Granger DN. Nitric oxide: an endogenous modulator of leukocyte adhesion. Proc Natl Acad Sci USA 1991; 88:4651–4655. Gaboury JP, Niu X-F, Kubes P. Nitric oxide inhibits numerous features of mast cell–induced inflammation. Circ 1996;93:318– 326. De Caterina R, Libby P, Peng H-B, Thannickal VJ, Rajavashisth TB, Gimbrone MA, Shin WS, Liao JK. Nitric oxide decreases cytokineinduced endothelial activation. J Clin Invest 1995;96:60–68. Tiao G, Rafferty J, Ogle C, Fischer JE, Hasselgren P-O. Detrimental effect of nitric oxide synthase inhibition during endotoxemia may
/ 5e19$$0061
02-18-97 13:35:56
gasa
31.
32.
33. 34.
be caused by high levels of tumor necrosis factor and interleukin6. Surgery 1994;116:332–338. Peng HB, Libby P, Liao J. Induction and stabilization of I-kB by nitric oxide mediates inhibition of NF-kB. J Biol Chem 1995;270: 214–219. Yamada T, Zimmerman BJ, Specian RD, Grisham MB. Role of neutrophils in acetic acid–induced colitis in rats. Inflammation 1991;15:339–411. Alican I, Kubes P. A critical role for nitric oxide in intestinal barrier fuction and dysfunction. Am J Physiol 1996;270:G225–G237. Kuhn R, Lohler J, Rennick D, Rajewsky K, Muller W. Interleukin10–deficient mice develop chronic enterocolitis. Cell 1993;75: 263–274.
Received October 4, 1996. Accepted December 10, 1996. Address requests for reprints to: Paul Kubes, Ph.D., Immunology Research Group, University of Calgary, Health Sciences Centre, 3330 Hospital Drive Northwest, Calgary, Alberta T2N 4N1, Canada. Supported by a grant from the Crohn’s and Colitis Foundation of Canada. Dr. P. Kubes is a Medical Research Council (MRC) and Alberta Heritage Foundation for Medical Research (AHFMR) scholar. Dr. M. G. Swain is an AHFMR clinical investigator and an MRC scholar. The authors thank Tai T. Le and Lesley Marshall for technical assistance and Drs. C. Nathan and J. MacMicking, Cornell University Medical College, New York, New York, for help in obtaining the inducible nitric oxide–deficient mice.
WBS-Gastro