Induction of apoptosis in human breast cancer cells by nimbolide through extrinsic and intrinsic pathway

Toxicology Letters 215 (2012) 131–142

Contents lists available at SciVerse ScienceDirect

Toxicology Letters journal homepage: www.elsevier.com/locate/toxlet

Induction of apoptosis in human breast cancer cells by nimbolide through extrinsic and intrinsic pathway P. Elumalai, D.N. Gunadharini, K. Senthilkumar, S. Banudevi, R. Arunkumar, C.S. Benson, G. Sharmila, J. Arunakaran ∗ Department of Endocrinology, Dr. ALM Post Graduate Institute of Basic Medical Sciences, University of Madras, Taramani, Chennai 600113, India

h i g h l i g h t s

g r a p h i c a l

a b s t r a c t

 Nimbolide inhibits the breast cancer (MCF-7 and MDA MB-231) cell proliferation.  It increased the levels of proapoptotic proteins.  Anti-apoptotic proteins were decreased in nimbolide treated cells.  It activates caspase-8, caspase-9, caspase-3 and cleavage of PARP.  Nimbolide induced apoptosis mediated by both extrinsic and intrinsic pathway.

a r t i c l e

i n f o

Article history: Received 16 July 2012 Received in revised form 8 October 2012 Accepted 11 October 2012 Available online 23 October 2012 Keywords: Nimbolide Breast cancer cell lines Apoptosis Intrinsic and extrinsic

a b s t r a c t We aimed to investigate the cytotoxic effects of nimbolide, a limonoid present in leaves and flowers of the neem tree (Azadirachta indica) on human breast cancer cells. The molecular mechanisms involved in the apoptotic activity exerted by nimbolide were studied on the estrogen dependent (MCF-7) and estrogen independent (MDA-MB-231) human breast cancer cell lines. The growth inhibitory effect of nimbolide was assessed by MTT assay. Apoptosis induction by nimbolide treatment was determined by JC-1 mitochondrial membrane potential staining, cytochrome c release, caspase activation, cleavage of PARP and AO/EtBr dual staining. The modulation of apoptotic proteins (intrinsic pathway: Bax, bad, Bcl-2, Bcl-xL, Mcl-1, XIAP-1 and caspase-3, 9; extrinsic pathway: TRAIL, FasL, FADDR and Caspase-8) were studied by western blot and real time PCR analysis. Treatment with nimbolide resulted in dose and time-dependent inhibition of growth of MCF-7 and MDA-MB-231 cells. The occurrence of apoptosis in these cells was indicated by JC-1 staining, modulation of both intrinsic and extrinsic apoptotic signaling molecules expression and further apoptosis was confirmed by AO/EtBr dual staining. These events were associated with: increased levels of proapoptotic proteins Bax, Bad, Fas-L, TRAIL, FADDR, cytochrome c and reduced levels of the anti-apoptotic proteins Bcl-2, Bcl-xL, Mcl-1 and XIAP-1. Nimbolide induces the cleavage of pro-caspase-8, pro-caspase-3 and PARP. The above data suggest that nimbolide induces apoptosis by both the intrinsic and extrinsic pathways. With evidence of above data it is suggested that nimbolide exhibit anticancer effect through its apoptosis-inducing property. Thus, nimbolide raises new hope for its use in anticancer therapy. © 2012 Elsevier Ireland Ltd. All rights reserved.

1. Introduction

∗ Corresponding author. Tel.: +91 44 2454 7043; fax: +91 44 2454 0709. E-mail address: j [email protected] (J. Arunakaran). 0378-4274/$ – see front matter © 2012 Elsevier Ireland Ltd. All rights reserved. http://dx.doi.org/10.1016/j.toxlet.2012.10.008

Breast cancer is the most common malignancy in women. The incidence of breast cancer in India is on the rise and is rapidly becoming the number one cancer in females pushing the cervical

132

P. Elumalai et al. / Toxicology Letters 215 (2012) 131–142

cancer to the second spot. Current therapies are limited due to considerable side effects. It is therefore necessary to search for novel agents to treat breast cancer patients with less adverse effects. Great interest has raised recently to focus on the potential use of nimbolide as anti-cancer drug for cancer cells. Nimbolide was first derived from the leaves and flowers of neem (Azadirachta indica). Neem is a traditional medicinal plant, which is commonly used for treating various human ailments (Subapriya and Nagini, 2005). Many bioactive compounds are isolated from this plant among which, nimbolide belongs to the limonoid group. Nimbolide is a tetranortriterpenoid that consists of a classic limonoid skeleton with an ␣,␤-unsaturated ketone system and a ␦-lactone ring (Anitha et al., 2006). It has been shown to exhibit numerous types of biological activities, including, antimalarial (Rochanakij et al., 1985), anti-feedent (Suresh et al., 2002) and anticancer activity (Cohen et al., 1996; Gupta et al., 2011; Roy et al., 2007). The anticancer activity is linked to ␣,␤-unsaturated ketone structural element of nimbolide (Kigodi et al., 1989). Sastry et al. (2006) have tested the in vitro cytotoxicity of nimbolide against a panel of human cancer cell lines. Roy et al. (2007) investigated the inhibitory effect of nimbolide on the growth of leukemic (HL-60, U937 and THP-1) and melanoma (B16) cell lines. Nimbolide inhibited proliferation and induces apoptosis in human chorio carcinoma (BeWo) cells (Harish Kumar et al., 2009). Moreover, (Gupta et al., 2011) reported that nimbolide sensitizes tumor cells to TRAIL-induced apoptosis through three different mechanisms: reactive oxygen species (ROS) and extracellular signal-regulated kinase (ERK)-mediated up regulation of death receptor (DR5) and DR4, down-regulation of cell survival proteins, and up-regulation of proapoptotic proteins. Babykutty et al. (2012) demonstrated that nimbolide effectively inhibited proliferation of WiDr colon cancer cells and caused activation of caspase-mediated apoptosis through the inhibition of ERK1/2 pathway. Nimbolide exerts potent anticancer effects in HepG2 cells by abrogating NF-␬B activation, and its downstream events such as activation of Wnt/␤-catenin pathway and apoptosis evasion (Kavitha et al., 2012). In the current study, we have investigated the ability of nimbolide to induce apoptosis in a variety of human breast cancer derived cell lines, representing a range of breast cancer types graded upon hormone dependency and aggressiveness: the luminal MCF-7 (ER␣-positive) are weakly invasive (Thomas et al., 1999) and MDA-MB-231 (ER␣-negative) are highly invasive, basal cell line (Zhang et al., 2010) derived from metastatic (pleural effusion), infiltrating ductal breast carcinoma. Apoptosis is a cellular suicide or a programmed cell death which is mediated by the activation of an evolutionary conserved intracellular pathway. The relation of apoptosis and cancer has been emphasized and increasing evidence suggests that the process of neoplastic transformation, progression and metastasis involve alterations of normal apoptotic pathway (Bold et al., 1997). There are two major apoptosis signaling pathways. The death receptor (extrinsic) pathway and the mitochondria (intrinsic) mediated pathway. The extrinsic pathway is initiated by cell surface expressed death receptors of the tumor necrosis factor superfamily. One of the central pathways of apoptosis is initiated by cytokines, such as tumor necrosis factor-␣ (TNF-␣), Fas ligand (FasL) and tumor necrosis factor-␣-related apoptosis-inducing ligand (TRAIL) (Ashkenazi and Herbst, 2008). Once the receptor is activated, for example by Fas ligand, receptors oligomerize, recruit intracellular adaptor proteins and form scaffolding complexes, while FADD is recruited for Fas signaling (Youle and Strasser, 2008). The complexes recruit one or more members of the caspase family of cell death protease, classically caspase-8. Cleavage of caspase-8 leads to the formation of an active enzyme comprising p20 and p10 heterotetramer. This activated initiator caspase cleaves downstream

effector caspases, in particular caspase-3. Caspase-3 then cleaves a large number of intracellular substrates, now numbering ∼400 which culminate in the morphological changes of apoptosis (Taylor and Nicot, 2008). The intrinsic pathway is initiated by anticancer drugs, growth factor withdrawal, hypoxia, or via induction of oncogenes. These stimuli induces permeabilization of the outer mitochondrial membrane and activates the mitochondrial pathway. The mitochondrial pathway is engaged by the release of apoptogenic factors like cytochrome c from the mitochondrial intermembrane space into the cytosol. This release of cytochrome c into the cytosol triggers caspase-3 activation through formation of the cytochrome c/Apaf1/caspase-9-containing apoptosome complex (Riedl and Salvesen, 2007). Other hallmarks of apoptosis include the fragmentation of DNA by the caspase activated DNase into ∼200 b.p. segments. Mitochondria-mediated apoptosis includes downstream of ROS production and upstream of caspase activation is regulated by Bcl-2 family proteins. The Bcl-2 family of proteins consists of antiapoptotic proteins (Bcl-2, Bcl-xL and Mcl-1), as well as a number of pro-apoptotic molecules (Bax, Bad and Bim), whereas overexpression of the anti-apoptotic protein Bcl-2, blocks mitochondrial outer membrane permeabilization and inhibits apoptosis (Gillings et al., 2009; Tait and Green, 2010) It has been proposed that an agent that could enhance the expression of pro-apoptotic proteins and/or inhibit the expression of anti-apoptotic proteins might induce the apoptosis in cancer cells. We hypothesized that nimbolide inhibits the proliferation and induces apoptosis of breast cancer cells. This hypothesis is supported by previous reports from our lab as it was stated that ethanolic neem leaf extract reduced proliferation and induced apoptosis in breast cancer (MCF-7 and MDA-MB-231) cell lines (Elumalai et al., 2012) and prostate cancer (PC-3) cell line (Gunadharini et al., 2011). Nimbolide is the predominant active principle constituent present in the neem leaf. In this study, we aimed to investigate the underlying mechanisms of nimbolide on the proliferation and its role on apoptosis of ER␣ positive (MCF-7) and ER␣-negative (MDA-MB-231) breast cancer cells. We further demonstrated the apoptosis via extrinsic and intrinsic apoptotic signaling pathway through anti-apoptotic and pro-apoptotic proteins.

2. Materials and methods 2.1. Chemicals Acridine orange (AO), ethidium bromide (EtBr) dimethyl sulfoxide (DMSO), 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), 4,6diamidino-2-phenylindole dihydrochloride (DAPI) and ␤-actin were purchased from Sigma Chemical Pvt Ltd, USA. Polyvinylidine difluoride (PVDF) membrane was purchased from Millipore, USA. Trypsin-EDTA, fetal bovine serum (FBS), antibiotics-antimycotics, Dulbecco’s modified Eagle’s medium (DMEM) and phosphate buffered saline (PBS) were purchased from Gibco, Canada. JC-1 (5,5 ,6,6 tetrachloro-1,1 ,3,3 -tetraethylbenzimidazolocarbocyanine iodide) and real time PCR kit (MESA Green) were purchased from Invitrogen, USA. Primary antibodies against Bax, Bcl-2, PARP, Mcl-1, XIAP-1, caspases-8, caspases-9, caspases-3 and cytochrome c were purchased from Cell Signaling, USA and Santa Cruz Biotechnology (Santa Cruz, CA, USA). The secondary antibodies, horse radishperoxidase (HRP) conjugated rabbit-anti mouse IgG and goat-anti rabbit IgG were obtained from Santa Cruz Biotechnology, USA. All the chemicals used were extra pure of analytical grade.

2.2. Cell line and culture Estrogen dependent (MCF-7) and estrogen independent (MDA-MB-231) breast cancer cell lines were obtained from the NCCS, Pune. The cells were grown in T25 culture flasks containing DMEM supplemented with 10% FBS and 1% antibiotics (100 U/ml penicillin and 100 ␮g/ml streptomycin). Cells were maintained at 37 ◦ C in a humidified atmosphere containing 5% CO2 . Upon reaching confluency, the cells were trypsinized and passaged.

P. Elumalai et al. / Toxicology Letters 215 (2012) 131–142 2.3. Cell viability assay Cell viability was assayed using a modified colorimetric technique that is based on the ability of live cells to convert MTT, a tetrazolium compound into purple formazan crystals by mitochondrial reductases (Mosmann, 1983). Briefly, the cells (1 × 104 /well) were exposed to different concentrations of nimbolide 1–6 ␮M for MCF-7 cells and 1–10 ␮M for MDA-MB-231 cells for 24 or 48 h. At the end of the treatment, 100 ␮l of 0.5 mg/ml MTT solution was added to each well and incubated at 37 ◦ C for an hour. Then the formazan crystals formed were dissolved in dimethyl sulfoxide (100 ␮l) and incubated in dark for an hour. Then the intensity of the color developed was assayed using a Micro ELISA plate reader at 570 nm. The number of viable cells was expressed as percentage of control cells cultured in serum-free medium. Cell viability in control medium without any treatment was represented as 100%. The cell viability is calculated using the formula: % cell viability = [A570 nm of treated cells/A570 nm of control cells] × 100. 2.4. Cytotoxicity assay Lactate dehydrogenase (LDH) is a stable cytosolic enzyme that is released in the culture medium upon cell lysis and the released LDH is measured colorimetrically with maximum absorbance read at 440 nm (King, 1965). LDH catalyzes the readily reversible reaction involving the oxidation of lactate to pyruvate, forming NAD+ from NADH and the determination of lactate dehydrogenase is based on the detection of NADH in the reaction. The treatment protocol was as mentioned for MTT assay and the conditioned medium alone was taken for LDH leakage assay. To 1 ml of buffered substrate, 0.1 ml of conditioned media was added and kept in water bath at 37 ◦ C. Then 0.2 ml of NAD+ solution was added, mixed gently and incubated at 37 ◦ C for 15 min. To this, 1 ml of DNPH reagent was added and incubated for further 15 min. Finally, 10 ml of sodium hydroxide (0.4 N) was added and after 1–5 min, the absorbance was read at 440 nm. Standards were also run simultaneously and treated as for assays with sodium pyruvate to prepare the standard graph. The amount of color formed is proportional to the number of lysed cells. LDH activity = OD of unknown/OD of known × standard concentration = ␮g of Lactate liberated/ml of conditioned media.

133

reverse transcribed using a commercial Superscript III first strand cDNA synthesis kit (Invitrogen, USA) according to the manufacturer’s protocol. The list of primers and the internal control sequence are given in Table 1. Real time-PCR was carried out in a MX3000p PCR system (Stratagene, Europe). Reaction was performed using MESA Green PCR master mix (It contains all the PCR components along with SYBR green dye.) Eurogentec, USA. The specificity of the amplification product was determined by melting curve analysis for each primer pairs. The data were analyzed by comparative CT method and the fold change is calculated by 2−CT method described by Schmittgen and Livak (2008) using CFX Manager Version 2.1 (Bio Rad, USA). 2.9. Western blot analysis After the 24 h treatment period the cells were lysed in RIPA buffer containing 1X protease inhibitor cocktail, and protein concentrations were determined by Lowry’s method (Lowry et al., 1951). Cell lysate (50 ␮g) were electrophoresed in 12% SDS polyacrylamide gel and then transferred into PVDF membranes. The membranes were incubated with primary antibodies against Bax, Bcl-2, caspase-9, caspase-8, caspase-3, cytochrome c, Mcl-1, XIAP-1, PARP and ␤-actin (1:2000) in Tris-buffered saline. After washing, the membranes were incubated with HRP conjugated antimouse IgG (1:5000) and Goat-anti rabbit IgG (1:5000). Protein bands were detected using chemiluminescence system (ECL Kit) and quantified in Chemi Doc XRS Imaging System, Bio-Rad (USA). 2.10. Statistical analysis Data were expressed as mean ± SEM. Statistical analyses were performed using one-way ANOVA followed by Student–Newman–Keul’s (SNK) tests for comparison between treatment values and control values using Statistical Package for Student version 7.5 (SPSS) software. p < 0.05 was considered to be statistically significant.

3. Results 3.1. Effect of nimbolide on cell viability of MCF-7 and MDA-MB-231 cell line

2.5. Determination of cell and nuclear morphological changes of cells Analysis of cell morphology changes by a phase contrast microscope. 3 × 104 cells were seeded in 6 well plates and treated with nimbolide (2 ␮M & 4 ␮M for MCF-7 cells and 4 ␮M & 6 ␮M for MDA-MB-231 cells) for 24 h. At the end of the incubation period, the medium was removed and cells were washed once with a phosphate buffer saline (PBS pH 7.4). The plates were observed under a phase contrast microscope (Nikon Eclipse-80i, Japan). For the nuclear analysis, the monolayer of cells was washed with PBS and fixed with 3% paraformaldehyde for 10 min at room temperature. The fixed cells were permeabilized with 0.2% Triton X-100 in PBS for 10 min at room temperature and incubated with 0.5 ␮g/ml of DAPI for 5 min. The apoptotic nuclei (intensely stained, fragmented nuclei, and condensed chromatin) were viewed under a fluorescent microscope (Nikon Eclipse-80i, Japan) with an excitation at 359 nm and emission at 461 nm wavelengths, respectively. 2.6. Determination of mode of cell death by acridine orange (AO)/ethidium bromide (EtBr) dual staining The effects of nimbolide in MCF-7 and MDA-MB-231 cell death were also determined by AO/EtBr dual staining as described previously (Cury-Boaventura et al., 2004). The cells were treated with nimbolide for 24 h and then the cells were harvested, washed with ice-cold PBS. The pellets were resuspended in 5 ␮L of acridine orange (1 mg/mL) and 5 ␮L of EtBr (1 mg/mL). The apoptotic changes of the stained cells were then observed by using a fluorescence microscope (Nikon Eclipse-80i, Japan). 2.7. Measurement of mitochondrial membrane potential ( m) Mitochondrial stability was assessed by fluorescence microscopy after incubation with 5,59,6,69-tetrachloro-1,19,3,39-tetraethylbenzimidoazolylcarbocyanino iodide (JC-1; Molecular Probes, Eugene, OR). MCF-7 and MDA-MB-231 cells were grown on 35 mm Petri dish and treated with 2 and 4 ␮M for MCF-7 cells and 4 and 6 ␮M concentrations of nimbolide for MDA-MB-231 cells. After the 24 h treatment the cells were incubated with 5 ␮M JC-1 fluorescence dye for 30 min in the CO2 incubator and washed slowly for several times with PBS. Mitochondrial membrane potential was evaluated qualitatively under a fluorescence microscope using 568 nm filter (Nikon Eclipse-80i, Japan). The green JC-1 signals were measured at Ex 485 nm (20 nm BW)/Em 535 nm (25 nm BW), the red signals at Ex 535 nm (25 nm BW)/Em 590 nm (20 nm BW). 2.8. Quantitative RT-PCR mRNA expression levels of Bax, Bad, Bcl-2, Bcl-xL, TRAIL, FasL and FADDR were examined using real-time PCR. The total RNA was isolated by using Tri Reagent (Sigma) (Chomczynski and Sacchi, 1987). Total RNA (2 ␮g) from each sample was

Nimbolide significantly decreased the viability of MCF-7 (Fig. 1A) and MDA-MB-231cells (Fig. 1B) at 24 h with IC50 values of 4 ␮M/ml and 6 ␮M/ml, respectively. Hence, for further studies of 2 and 4 ␮M/ml concentrations for MCF-7 cells and 4 and 6 ␮M/ml concentrations for MDA-MB-231 cells were considered. To evaluate cell membrane permeability and integrity, the LDH activity was assayed. As shown in (Fig. 1C and D), the group exposed to nimbolide alone presented a significant increase in LDH release when compared to the control. 3.2. Cell and nuclear morphology The morphological examinations of the MCF-7 and MDA-MB231 cells were observed and photographed using phase contrast microscope. The MCF-7 and MDA-MB-231 cells were treated with nimbolide (2 ␮M & 4 ␮M for MCF-7 cells and 4 ␮M & 6 ␮M for MDA-MB-231 cells) for 24 h, compared with the untreated cells, treated cells showed significant morphological changes, which are characteristic of apoptotic cells, such as cell shrinkage and reduced cell density were observed in the nimbolide treated cells (Figs. 2A and 3A). Cells undergoing apoptosis also displayed other types of morphological changes such as rounded up cells that shrink and lose contact with neighboring cells. Some sensitive cells were even detached from the surface of the plates. To assess cellular apoptosis by nimbolide, MCF-7 and MDA-MB-231 cells were treated with nimbolide for 24 h. After 24 h, the cells were stained with DAPI and examined by fluorescence microscopy. The treated cells clearly showed condensed chromatin and nuclear fragmentation, which are characteristics of apoptosis than compared to the control which showed clear round nuclei (Figs. 2B and 3B). Further the breast cancer cell death induced by nimbolide was also investigated by using the acridine orange/ethidium bromide (AO/EtBr) dual staining. AO/EtBr is used in evaluating the nuclear morphology of apoptotic cells. Acridine orange is a vital dye that will stain both live and dead cells, whereas ethidium bromide will stain only those cells that have lost their membrane

134

P. Elumalai et al. / Toxicology Letters 215 (2012) 131–142

Table 1 Primer sequences. S. No.

Primers

Forward

Reverse

Accession number

Tm

bp

1 2 3 4 5 6 7 8

TRAIL FasL FADDR Bcl-xL BCL-2 BAX BAD GAPDH

ttcacagtgctcctgcagtc ccatgtgaagagggagaagc agatgaacctggtggctgac ggctgggatacttttgtgga attgggaagtttcaaatcagc gctggacattggacttcctc cctcaggcctatgcaaaaag cgaccactttgtcaagctca

ttggggtcccaataactgtc aagacagtcccccttgaggt aggacgcttcggaggtagat aagagtgagcccagcagaac tgcattcttggacgaggg ctcagcccatcttcttccag aaacccaaaacttccgatgg cccctcttcaaggggtctac

NM 003810.2 NM 000639.1 NM 003824.3 Z23115 L20121 NM 000657 NM 138764 NM 032989 M33197

58 58 58 58 58 58 58 58

140 146 120 131 331 168 120 238

integrity. Cells stained green represent viable cells, whereas yellow staining represented early apoptotic cells, and reddish or orange staining represents late apoptotic cells. In the control, uniformly green live cells with normal and large nucleus were observed, whereas in nimbolide treated cells yellow, orange and red staining were observed (Figs. 2C and 3C). These results confirm that nimbolide significantly induced the apoptosis in breast cancer cells. 3.3. Effect of nimbolide on the expression of Bcl-2 family members To examine the status of the intracellular signaling molecules responsible for the growth-inhibiting activity of nimbolide in MCF-7 and MDA-MB-231 cells, we seeded the cells at a density of 1 × 106 cells in 100 mm dishes and treated the cells with DMSO (vehicle), 2 ␮M & 4 ␮M of nimbolide for MCF-7 cells, 4 ␮M & 6 ␮M of nimbolide for MDA-MB-231 cells. After 24 h of treatment, we prepared protein extracts from the cells and then performed western blot analysis and mRNA expression by

3.4. Nimbolide regulates mRNA expression of extrinsic signaling molecules (FasL, TRAIL, FADDR and caspase-8) Extrinsic pathway is mediated by FasL and TRAIL. These ligands activate the death receptor and further activate the downstream

(B) 110 100 90 80 70 60 50 40 30 20 10 0

MCF-7

* * *

* *

*

*

* * Control

1

2

3

24hr

4

* * 5

48hr

% of cell viability

% of cell viability

(A)

real-time PCR. The Bcl-2 protein family consists of both proapoptotic (Bax and Bad) and anti-apoptotic (Bcl-2, Bcl-xL and Mcl-1) proteins that regulate mitochondrial outer membrane integrity, cytochrome c release, caspase activation. Therefore, we measured the protein expression and mRNA expression of Bcl-2 family proteins by western blot analysis and real time PCR. Nimbolide significantly increased the expression of proapoptotic proteins Bax and Bad in both the cell lines (Fig. 4A and B) and down regulates expression of anti-apoptotic protein Bcl-2, Bcl-xL and Mcl-1 in both the cell lines (Fig. 4A and B). These results suggest that Bcl-2 family members play a major role in nimbolide induced apoptosis in breast cancer cells.

*

110 100 90 80 70 60 50 40 30 20 10 0

* *

* * *

1

2

4

*

6

* 8

*

24hr 48hr

* 10

Nimbolide (µM)

Nimbolide µM

(C)

(D) MCF-7

70

*

60

80

*

*

50 40 *

30 20

*

10

* *

* *

*

* 24hr

*

48hr

*

60

*

*

50

*

*

40 *

30 20

*

*

*

24hr 48hr

*

10

0

*

MDA MB-231

70 LDH leakage %

80

LDH leakage %

*

*

Control

6

MDA MB-231

*

*

0 Control

1

2

3

4

Nimbolide (µM)

5

6

Control

1

2

4

6

8

10

Nimbolide (µM)

Fig. 1. Effect of nimbolide on the viability of breast cancer cells. MCF-7 and MDA-MB-231 cells cultured in DMEM supplemented with 10% FBS were incubated with indicated concentrations of nimbolide for 24 h, 48 h. For cell viability assay, cells were exposed to different doses (0–10 ␮M) of nimbolide for 24 h and 48 h. Nimbolide inhibits growth (as determined by MTT assay) of human breast cancer cells (A) MCF-7 cells, (B) MDA-MB-231cells. The cytotoxic effect was determined by LDH assay (C) MCF-7 cells, (D) MDA-MB-231 cells. Each bar represents the mean ± SEM of six independent observations. ‘*’ represents statistical significance between control versus nimbolide treatment groups at p < 0.05 level using Student’s–Newman–Keul’s test.

P. Elumalai et al. / Toxicology Letters 215 (2012) 131–142

135

Fig. 2. Effect of nimbolide on cell and nuclear morphology in MCF-7 cells. (A) Cells were treated with 2 ␮M and 4 ␮M of nimbolide for 24 h and cells were observed under phase contrast microscope (200×). The number of cells decreased after nimbolide treatment and the cells exhibited cell shrinkage and cytoplasmic membrane blebbing. (B) Chromatin condensation and nuclear fragmentation of MCF-7 cells induced by nimbolide. The nuclei were stained with DAPI staining and observed under a fluorescence microscope (200×). (C) AO/EtBr staining of MCF-7 cells, viewed under a fluorescence microscope (200×) as described in materials and methods. The viable cell will possess uniform bright green nucleus (a – Viable cells), early apoptotic cells will have bright orange areas of condensed or fragmented chromatin in the nucleus (b – Early apoptotic cells), and late apoptotic cells will have uniform bright red nucleus (c –Late apoptotic cells); such were obtained from at least three independent experiments with similar parameter.

signaling molecules such as FADDR and caspase-8 which leads to induction of apoptosis. We examined the increased levels of FasL, TRAIL, FADDR mRNA and caspase-8 protein expression in nimbolide treated MCF-7 and MDA-MB-231cells (Fig. 5).

that nimbolide-induced apoptosis in breast cancer cells involves signaling at the mitochondrial level.

3.5. Nimbolide induces mitochondrial membrane depolarization and cytochrome c release from the mitochondria

To analyze the involvement of mitochondrial release of cytochrome c in breast cancer cells, Treatment of breast cancer cells with nimbolide for 24 h resulted in increase of cytochrome c levels in a dose dependent manner. These results indicate that nimbolide can provoke cytochrome c release from mitochondria into cytosol after nimbolide treatment (Fig. 7), supporting the notion that nimbolide-induced apoptosis in breast cancer cells involves signaling at the mitochondrial level. Protein levels were quantified using densitometry analysis and are expressed in relative intensity arbitrary unit. To determine whether caspases are involved in nimbolide-induced apoptosis, we examined the protein expression of caspases by western blot. MCF-7 and MDA-MB-231 cells were treated with nimbolide (2 ␮M & 4 ␮M for MCF-7 cells and 4 ␮M & 6 ␮M for MDA-MB-231 cells) for 24 h to analyze caspases

JC-1 is a cationic dye that exhibits membrane potentialdependent accumulation in mitochondria, indicated by a fluorescence emission shift from red to green. JC-1 can be used as an indicator of mitochondrial potential in a variety of cell types. JC-1 is a voltage sensitive fluorescent dye that detects normal polarized mitochondria as red color, and depolarized mitochondrial membranes as green color. The exposure of nimbolide to MCF-7 and MDA-MB-231 cells caused loss of mitochondrial membrane potential (Fig. 6). These results indicate that nimbolide can provoke cytochrome c release from mitochondria into cytosol after nimbolide treatment (Fig. 6), supporting the notion

3.6. Effect of nimbolide on the expression of cytochrome c and caspases

136

P. Elumalai et al. / Toxicology Letters 215 (2012) 131–142

Fig. 3. Effect of nimbolide on cell and nuclear morphology in MDA-MB-231 cells. (A) Cells were treated with 4 ␮M and 6 ␮M of nimbolide for 24 h and cells were observed under phase contrast microscope (200×). The number of cells decreased after nimbolide treatment and the cells exhibited cell shrinkage and cytoplasmic membrane blebbing. (B) Chromatin condensation and nuclear fragmentation of MDA-MB-231 cells induced by nimbolide. The nuclei were stained with DAPI staining and observed under a fluorescence microscope (200×). (C) AO/EtBr staining of MCF-7 and MDA-MB-231 cells, viewed under a fluorescence microscope (200×) as described in materials and methods. The viable cell will possess uniform bright green nucleus (a – Viable cells), early apoptotic cells will have bright orange areas of condensed or fragmented chromatin in the nucleus (b – Early apoptotic cell), and late apoptotic cells will have uniform bright red nucleus (c – Late apoptotic cell); such were obtained from at least three independent experiments with similar parameter. a – Viable cells; b – Early apoptotic cells; c – Late apoptotic cells.

protein expression because the activation of caspases is crucial for mitochondrial-dependent and independent apoptotic pathways. Nimbolide increased caspase-9 and caspase-3 expressions in breast cancer cells in a dose-dependent manner (Fig. 7), Protein levels were quantified using densitometry analysis and are expressed in relative intensity arbitrary unit. 3.7. Effect of nimbolide on the expression of XIAP and PARP The enzymatic activity of caspases is inhibited by the conserved IAP (inhibitor of apoptosis) family of proteins. X-linked inhibitor of apoptosis protein (XIAP) is a member of the IAP family that selectively binds and inhibits caspase-3, -7 and -9. Thus, XIAP may represent a novel and tumor selective therapeutic target for anticancer drug design. As shown in Fig. 8, nimbolide-treated breast cancer cells significantly decreased the XIAP protein level in a dosedependent manner. These results confirm the involvement of the caspase pathway in nimbolide-induced apoptosis in breast cancer cells. Activation of caspase-3 leads to cleavage of several substrates including PARP. Therefore, cleavage of PARP was determined by

western blot analysis. Nimbolide treatment induces cleavage of PARP in MCF-7 and MDA-MB-231 cells (Fig. 8). 4. Discussion Apoptosis or programmed cell death is essential for maintenance of development and homeostasis of multicellular organisms by eliminating superfluous or unwanted cells (Danial and Korsmeyer, 2004). Inefficient apoptosis is considered as one of the hallmarks of tumorigenicity (Dowsett et al., 2006; Yang et al., 2003). Moreover, induction of apoptosis is an important target for cancer therapy (Fesik, 2005). In the present study we investigated the intrinsic pathway of apoptosis induced by nimbolide and its interaction with the extrinsic pathway in human breast cancer cell lines (MCF-7 and MDA-MB-231). Nimbolide and 28-deoxonimbolide have been identified as cytotoxic constituents of neem leaves (Kigodi et al., 1989). Cohen et al. (1996) found that nimbolide was the most potent neem limonoids examined for cytotoxicity against N1E-155 murine neuroblastoma and 143B TK-human osteosarcoma cell lines with IC50 values

P. Elumalai et al. / Toxicology Letters 215 (2012) 131–142

137

Fig. 4. Effect of nimbolide on the mRNA and protein expression of intrinsic apoptotic signaling molecules in MCF-7 and MDA-MB-231 cells. Cells were treated with 2 ␮M & 4 ␮M (MCF-7) and 4 ␮M & 6 ␮M (MDA-MB-231) of nimbolide for 24 h, and total RNA was immediately extracted and converted to cDNA. The mRNA expression of proapoptotic genes were analyzed by real-time PCR using SYBR Green dye and protein expression by western blot. Protein levels were quantified using densitometry analysis and are expressed in relative intensity arbitrary unit (A). ␤-Actin was used as an internal control. Target gene expression is normalized to GAPDH mRNA expression and the results are expressed as fold change from control (B). ‘*’ Represents statistical significance between control versus nimbolide treatment groups at p < 0.05 level using Student’s–Newman–Keul’s test.

138

P. Elumalai et al. / Toxicology Letters 215 (2012) 131–142

Fig. 5. Effect of nimbolide on the mRNA and protein expression of extrinsic apoptotic signaling molecules in MCF-7 and MDA-MB-231 cells. Cells were treated with 2 ␮M & 4 ␮M (MCF-7) and 4 ␮M & 6 ␮M (MDA MB-231) of nimbolide for 24 h. The mRNA expression of anti-apoptotic genes were analyzed by real-time PCR using SYBR Green dye and protein expression by western blot. Target gene expression is normalized to GAPDH mRNA expression and the results are expressed as fold change from control. Protein levels were quantified using densitometry analysis and are expressed in relative intensity arbitrary unit. ␤-Actin was used as an internal control. ‘*’ represents statistical significance between control versus nimbolide treatment groups at p < 0.05 level using Student’s–Newman–Keul’s test.

averaging 4.75 ␮M. Sastry et al. (2006) tested the in vitro cytotoxicity of nimbolide against a panel of human cancer cell lines and reported IC50 values that ranged from 4.17 ␮M to 15.56 ␮M with an average of 8.31 ␮M. Roy et al. (2007) investigated the inhibitory effect of nimbolide on the growth of leukemic (HL-60, U937 and THP-1) and melanoma (B16) cell lines. Harish Kumar et al. (2009) demonstrated that nimbolide exerts antiproliferative effects against BeWo cells by inducing apoptosis. Recent study demonstrated that nimbolide concurrently abrogates canonical NF␬B and Wnt signaling and induces intrinsic apoptosis in HepG2 cells (Kavitha et al., 2012). However, so far no study has reported the cytotoxic effect of nimbolide on breast cancer cells. Therefore, we investigated the cytotoxic effects of nimbolide on breast cancer cells in a dose and time-dependent manner. In the present study, nimbolide exerted cytotoxic effects on MCF-7 cells with IC50 values of 4.0 ␮M and 2.7 ␮M for 24 and 48 h, respectively. Nimbolide could induce cytotoxicity not only in MCF-7 cells but also in MDAMB-231 cells with IC50 values of 6.0 ␮M and 3.2 ␮M for 24 and 48 h, respectively. MCF-7 and MDA-MB-231 cell lines were sensitive to the cytotoxic effect of nimbolide at micro molar concentrations. However, MCF-7 cells were more sensitive than the MDA-MB-231 cells. Then, we investigated morphological changes in the nuclear chromatin of the breast cancer cell lines MCF-7 and MDA-MB231 by DAPI staining, Apoptotic features including chromatin condensation was observed in both human breast cancer

cell lines. Further the nimbolide induced apoptotic cells were detected using AO/EtBr dual staining. After 24 h treatment of human breast cancer cell lines with nimbolide, the nuclear structure was examined using AO/EtBr staining and visualized under fluorescent microscopy. Nimbolide treated cells exhibited condensed and fragmented nuclei. Live cells appeared uniformly green. Early apoptotic cells stained yellow and late apoptotic cells showed condensed and often fragmented nuclei and the incorporated ethidium bromide stained red. The Extrinsic or death receptor mediated pathway is triggered by the activation of death receptors such as those activated by FasL and TRAIL. Activation of DR4 and DR5 leads primarily to the formation of the death-inducing signaling complex (DISC) formed by the recruitment of the FADD through homotypic death domain interaction. FADD then recruits caspase-8 through homotypic interactions of death effector domains (DEDs), leading to caspase-8 activation and further amplifies the apoptotic cascade by activation of executioner caspases (Khosravi-Far and Esposti, 2004). Gupta et al. (2011) reported that nimbolide sensitizes tumor cells to TRAIL-induced apoptosis. In the present study nimbolide increased the extrinsic signaling molecules mRNA expression (FasL, FADDR and TRAIL) and caspase-8 protein expression. Nimbolide transduces apoptosis by both the intrinsic and extrinsic pathways in DMBA induced hamster buccal pouch carcinogenesis (Harish Kumar et al., 2010). Activation of caspase-3, caspase-8, and caspase-9 suggests that nimbolide

P. Elumalai et al. / Toxicology Letters 215 (2012) 131–142

139

Fig. 6. Dose-dependent effect of nimbolide upon changes of mitochondrial membrane potential and cytochrome c release. Breast cancer cells were treated with 2 ␮M & 4 ␮M (MCF-7) and 4 ␮M & 6 ␮M (MDA MB-231) of nimbolide for 24 h and then subjected to JC-1 staining to evaluate the changes in mitochondrial membrane potential viewed under a fluorescence microscope (400×). In JC-1 stained cells, red fluorescence is visible in cell areas with high mitochondrial membrane potential, while green fluorescence of JC-1 monomer is present in cell areas with low mitochondrial potential.

potentiated both extrinsic and intrinsic pathways of apoptosis in human colon cancer cells (Gupta et al., 2011). Bcl-2 family proteins are structurally related molecules, which positively or negatively regulate apoptosis. The relative equilibrium of various pro-apoptotic (Bax, Bad) anti-apoptotic (Bcl-2, Bcl-xL, Mcl-1) Bcl-2 family members is a critical determinant of cellular homeostasis (Kim, 2005; Mayorga et al., 2004). Nimbolide raised the levels of Bax, Bad and translocation of Bax from the cytosol into mitochondria. In the presence of death stimuli, the pro-apoptotic monomeric Bax in the cytoplasm undergoes a conformational change and contributes to the formation of the mitochondrial permeability transition (Precht et al., 2005; Yamaguchi et al., 2003). Anti-apoptotic Bcl-2 proteins (Bcl-2, Bcl-xL, Mcl-1) interfere with engagement of mitochondrial apoptotic machinery by inhibiting oligomerization of Bax and Bak. Defective apoptotic signaling pathways have an important role in the initiation and progression of cancer (Reed, 1999). One of the mechanisms through which tumor cells are believed to acquire resistance to apoptosis is overexpression of XIAP, which prevent apoptosis by specifically inhibiting caspases 3, 7, and 9 (Nachmias et al., 2004). Bcl-xL is an anti-apoptotic protein and a member of the Bcl-2 family, which includes Bcl-2, Bcl-w, Bcl-xs, and Mcl-1. It was reported that a hepatocyte-specific knockout of Bcl-xL induced spontaneous apoptosis in hepatocytes (Hikita et al., 2009). Mcl-1 is an anti-apoptotic Bcl-2 family protein that binds to pro-apoptotic Bcl-2 proteins, including Bax and Bik, and neutralizes their pro-apoptotic functions in cancer cells (Adams and Cory, 2007). Cumulative data suggest that Mcl-1 is a critical mediator of

cellular resistance to various anti-cancer therapies. The importance of Mcl-1 in suppressing TRAIL-induced cell death was identified in previous reports showing that reduced expression of Mcl-1 using RNA interference or microRNA-29b enhanced TRAIL-induced cell death in cancer cells (Han et al., 2006; Wirth et al., 2005). Inhibition of Bcl-xL, bcl-2, Mcl-1 and XIAP expression and function could help improve the efficiency of chemotherapeutic agents. A recent publication indicates that, interestingly, nimbolide down regulates Bcl-2, Bcl-xL, Mcl-1 and XIAP, and up regulates the proapoptotic protein Bad and Bax and enhanced cytochrome c release in colon cancer cells (Gupta et al., 2011). In our study, we found that nimbolide treatment significantly increased the expression of Bax, Bad and decreased Bcl-2, Bcl-xL, Mcl-1 and XIAP in both MCF7 and MDA-MB-231 cells. Thus it is clear that nimbolide induces the apoptosis in MCF-7 and MDA-MB-231 cells through intrinsic pathway. Mitochondria are increasingly recognized as the bioenergetics and metabolic centers essential to both life and death (Brenner and Kroemer, 2000; Degli Esposti, 2004). Our study revealed a dose-dependent depolarization of the mitochondrial membrane potential as evidenced by a shift in the fluorescence from red to green in nimbolide treated cells confirmed that nimbolide induces a disturbance in the mitochondrial transmembrane potential thereby transducing the apoptotic signal through the mitochondrial pathway. Consequently, formation of the mitochondrial permeability transition brought about a leakage of apoptogenic proteins such as cytochrome c and AIF from mitochondria, culminating in caspase-dependent cell death. Nimbolide treatment

140

P. Elumalai et al. / Toxicology Letters 215 (2012) 131–142

Fig. 7. Effect of nimbolide on the protein expression of cytochrome c and caspase in breast cancer cells. Cells were treated with 2 ␮M & 4 ␮M (MCF-7) and 4 ␮M & 6 ␮M (MDA-MB-231) of nimbolide for 24 h. Whole cell protein lysates were analyzed by western blotting using antibodies against cytochrome c and caspase. Protein levels were quantified using densitometry analysis and are expressed in relative intensity arbitrary unit. ‘*’ represents statistical significance between control versus nimbolide treatment groups at p < 0.05 level using Student’s–Newman–Keul’s test.

thus resulted in the activation of caspase-9, most likely by the formation of the apoptosome complex with cytoplasmic cytochrome c and Apaf-1 followed by the cleavage of pro-caspase-3 into the active form and a cascade of subsequent changes responsible for the execution of apoptosis, exemplified by the fragmentation of PARP. Exactly how nimbolide disrupts mitochondrial integrity by targeting the Bcl-2 family proteins is not well characterized. This may be explained, at least in part, by the notion that nimbolide triggers apoptosis via the production of reactive oxygen species that could result in Bax- and Bak-dependent formation of the mitochondrial outer membrane pore. Nimbolide induced apoptosis and mitochondrial permeability transition in a concentration dependent manner. The current study provides evidence that mitochondria are critically involved in nimbolide induced apoptosis, as nimbolide causes mitochondrial permeability transition. These findings shed insights into the diverse caveats of the molecular mechanism of nimbolide induced apoptosis. Caspase-8/10 are initiator caspase in extrinsic pathway and they share a same homology with death effectors domains (Ashkenazi and Dixit, 1998) and intrinsic pathway involving key mitochondrial events such as anti-apoptotic proteins Bcl-2, Bcl-xL and proapoptotic protein Bax, Bad and Bid regulating the release of cytochrome c from mitochondria to cytosol and activating the initiator caspases9 and effector caspase-3 (Tait and Green, 2010). Caspase-3 is a key member of the caspase family, a group of cysteine proteases that mediate apoptotic execution (Riedl and Shi, 2004).

It can be activated by apoptotic signals from both death receptor and intracellular/mitochondrial pathways. Caspase-3 functions as a major effector caspase by cleavage of numerous cell death substrates, to cellular dysfunction and destruction (Riedl and Shi, 2004). Recently, caspase-3 deficiency and down regulation have been associated with breast carcinogenesis (Devarajan et al., 2002), suggesting caspase-3 could be a biomarker in cancer prevention and treatment. In the present study nimbolide treatment significantly increased the protein expression of cytochrome c, caspase-8, -9, -3 and cleaved PARP. The present study proved that nimbolide induced activation of caspase-3 is merely mediated by initiation of both the extrinsic and intrinsic apoptotic signaling pathways, thus nimbolide induces extrinsic and intrinsic pathway mediated apoptosis. The results demonstrate that: (i) Nimbolide inhibits the proliferation of MCF-7 and MDA-MB-231 cells in a time and dose dependent manner; (ii) Nimbolide up regulates the pro-apoptotic proteins and down regulates anti-apoptotic proteins; (iii) Nimbolide induced mitochondrial permeability transition as an early event of apoptosis; (iv) cytochrome c was translocated from mitochondria to the cytosol and nucleus, respectively, caspase-9 and caspase-3 were activated and PARP was cleaved as a consequence of mitochondrial permeability transition in response to nimbolide exposure. Nimbolide suppressed the proliferation of ER negative (MDA-MB231) and ER positive (MCF-7) breast cancer cells. Our results

P. Elumalai et al. / Toxicology Letters 215 (2012) 131–142

141

Fig. 8. Effect of nimbolide on XIAP and cleavage of PARP protein expression in breast cancer cells. Cells were treated with 2 ␮M & 4 ␮M (MCF-7) and 4 ␮M & 6 ␮M (MDA-MB231) of nimbolide for 24 h. Whole cell protein lysates were analyzed by western blotting using antibodies against PARP. Protein levels were quantified using densitometry analysis and are expressed in relative intensity arbitrary unit. ‘*’ represents statistical significance between control versus nimbolide treatment groups at p < 0.05 level using Student’s–Newman–Keul’s test.

suggest that nimbolide may be a potential therapeutic agent for breast cancer in future. Further study on the molecular mechanism is warranted. Thus, the present study proves that nimbolide induces apoptosis in breast cancer cells. Conflict of interest statement The authors declare that there are no conflicts of interest. Acknowledgement The financial support from Council for Scientific and Industrial research in the form of senior research fellowship (CSIR-SRF) to P. Elumalai is greatly acknowledged. References Adams, J.M., Cory, S., 2007. The Bcl-2 apoptotic switch in cancer development and therapy. Oncogene 26, 1324–1337. Anitha, G., Josepha Lourdu Raj, J., Narasimhan, S., Anand Solomon, K., Rajan, S.S., 2006. Nimbolide and isonimbolide. Journal of Asian Natural Products Research 8, 445–449. Ashkenazi, A., Dixit, V.M., 1998. Death receptors: signaling and modulation. Science 281, 1305–1308. Ashkenazi, A., Herbst, R.S., 2008. To kill a tumor cell: the potential of proapoptotic receptor agonists. Journal of Clinical Investigation 118, 1979–1990.

Babykutty, S., S., P.P., J, N.R., Kumar, M.A., Nair, M.S., Srinivas, P., Gopala, S., 2012. Nimbolide retards tumor cell migration, invasion, and angiogenesis by downregulating MMP-2/9 expression via inhibiting ERK1/2 and reducing DNA-binding activity of NF-kappaB in colon cancer cells. Molecular Carcinogenesis 51, 475–490. Bold, R.J., Termuhlen, P.M., McConkey, D.J., 1997. Apoptosis, cancer and cancer therapy. Surgical Oncology 6, 133–142. Brenner, C., Kroemer, G., 2000. Apoptosis. Mitochondria—the death signal integrators. Science 289, 1150–1151. Chomczynski, P., Sacchi, N., 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction. Analytical Biochemistry 162, 156–159. Cohen, E., Quistad, G.B., Casida, J.E., 1996. Cytotoxicity of nimbolide, epoxyazadiradione and other limonoids from neem insecticide. Life Sciences 58, 1075–1081. Cury-Boaventura, M.F., Pompeia, C., Curi, R., 2004. Comparative toxicity of oleic acid and linoleic acid on Jurkat cells. Clinical Nutrition 23, 721–732. Danial, N.N., Korsmeyer, S.J., 2004. Cell death: critical control points. Cell 116, 205–219. Degli Esposti, M., 2004. Mitochondria in apoptosis: past, present and future. Biochemical Society Transactions 32, 493–495. Devarajan, E., Sahin, A.A., Chen, J.S., Krishnamurthy, R.R., Aggarwal, N., Brun, A.M., Sapino, A., Zhang, F., Sharma, D., Yang, X.H., Tora, A.D., Mehta, K., 2002. Down-regulation of caspase 3 in breast cancer: a possible mechanism for chemoresistance. Oncogene 21, 8843–8851. Dowsett, M., Smith, I.E., Ebbs, S.R., Dixon, J.M., Skene, A., Griffith, C., Boeddinghaus, I., Salter, J., Detre, S., Hills, M., Ashley, S., Francis, S., Walsh, G., A’Hern, R., 2006. Proliferation and apoptosis as markers of benefit in neoadjuvant endocrine therapy of breast cancer. Clinical Cancer Research 12, 1024s–1030s. Elumalai, P., Gunadharini, D.N., Senthilkumar, K., Banudevi, S., Arunkumar, R., Benson, C.S., Sharmila, G., J, A., 2012. Ethanolic neem (Azadirachta indica A. Juss)

142

P. Elumalai et al. / Toxicology Letters 215 (2012) 131–142

leaf extract induces apoptosis and inhibits the IGF signaling pathway in breast cancer cell lines. Biomedicine & Preventive Nutrition 2, 59–68. Fesik, S.W., 2005. Promoting apoptosis as a strategy for cancer drug discovery. Nature Reviews Cancer 5, 876–885. Gillings, A.S., Balmanno, K., Wiggins, C.M., Johnson, M., Cook, S.J., 2009. Apoptosis and autophagy: BIM as a mediator of tumour cell death in response to oncogenetargeted therapeutics. The FEBS Journal 276, 6050–6062. Gunadharini, D.N., Elumalai, P., Arunkumar, R., Senthilkumar, K., Arunakaran, J., 2011. Induction of apoptosis and inhibition of PI3K/Akt pathway in PC-3 and LNCaP prostate cancer cells by ethanolic neem leaf extract. Journal of Ethnopharmacology 134, 644–650. Gupta, S.C., Reuter, S., Phromnoi, K., Park, B., Hema, P.S., Nair, M., Aggarwal, B.B., 2011. Nimbolide sensitizes human colon cancer cells to TRAIL through reactive oxygen species- and ERK-dependent up-regulation of death receptors, p53, and Bax. Journal of Biological Chemistry 286, 1134–1146. Han, J., Goldstein, L.A., Gastman, B.R., Rabinowich, H., 2006. Interrelated roles for Mcl-1 and BIM in regulation of TRAIL-mediated mitochondrial apoptosis. Journal of Biological Chemistry 281, 10153–10163. Harish Kumar, G., Chandra Mohan, K.V., Jagannadha Rao, A., Nagini, S., 2009. Nimbolide a limonoid from Azadirachta indica inhibits proliferation and induces apoptosis of human choriocarcinoma (BeWo) cells. Investigational New Drugs 27, 246–252. Harish Kumar, G., Vidya Priyadarsini, R., Vinothini, G., Vidjaya Letchoumy, P., Nagini, S., 2010. The neem limonoids azadirachtin and nimbolide inhibit cell proliferation and induce apoptosis in an animal model of oral oncogenesis. Investigational New Drugs 28, 392–401. Hikita, H., Takehara, T., Shimizu, S., Kodama, T., Li, W., Miyagi, T., Hosui, A., Ishida, H., Ohkawa, K., Kanto, T., Hiramatsu, N., Yin, X.M., Hennighausen, L., Tatsumi, T., Hayashi, N., 2009. Mcl-1 and Bcl-xL cooperatively maintain integrity of hepatocytes in developing and adult murine liver. Hepatology 50, 1217– 1226. Kavitha, K., Vidya Priyadarsini, R., Anitha, P., Ramalingam, K., Sakthivel, R., Purushothaman, G., Singh, A.K., Karunagaran, D., Nagini, S., 2012. Nimbolide, a neem limonoid abrogates canonical NF-kappaB and Wnt signaling to induce caspase-dependent apoptosis in human hepatocarcinoma (HepG2) cells. European Journal of Pharmacology 681, 6–14. Khosravi-Far, R., Esposti, M.D., 2004. Death receptor signals to mitochondria. Cancer Biology and Therapy 3, 1051–1057. Kigodi, P.G., Blasko, G., Thebtaranonth, Y., Pezzuto, J.M., Cordell, G.A., 1989. Spectroscopic and biological investigation of nimbolide and 28-deoxonimbolide from Azadirachta indica. Journal of Natural Products 52, 1246–1251. Kim, R., 2005. Unknotting the roles of Bcl-2 and Bcl-xL in cell death. Biochemical and Biophysical Research Communications 333, 336–343. King, J., 1965. The dehydrogenase or oxidoreductase-N lactate dehydrogenase. In: Practical Clinical Enzymology. Van D nor Stand Company Limited, pp. 83–93. Lowry, O.H., Rosebrough, N.J., Farr, A.L., Randall, R.J., 1951. Protein measurement with the Folin phenol reagent. Journal of Biological Chemistry 193, 265– 275. Mayorga, M., Bahi, N., Ballester, M., Comella, J.X., Sanchis, D., 2004. Bcl-2 is a key factor for cardiac fibroblast resistance to programmed cell death. Journal of Biological Chemistry 279, 34882–34889. Mosmann, T., 1983. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. Journal of Immunological Methods 65, 55–63. Nachmias, B., Ashhab, Y., Ben-Yehuda, D., 2004. The inhibitor of apoptosis protein family (IAPs): an emerging therapeutic target in cancer. Seminars in Cancer Biology 14, 231–243.

Precht, T.A., Phelps, R.A., Linseman, D.A., Butts, B.D., Le, S.S., Laessig, T.A., Bouchard, R.J., Heidenreich, K.A., 2005. The permeability transition pore triggers Bax translocation to mitochondria during neuronal apoptosis. Cell Death & Differentiation 12, 255–265. Reed, J.C., 1999. Dysregulation of apoptosis in cancer. Journal of Clinical Oncology 17, 2941–2953. Riedl, S.J., Salvesen, G.S., 2007. The apoptosome: signalling platform of cell death. Nature Reviews Molecular Cell Biology 8, 405–413. Riedl, S.J., Shi, Y., 2004. Molecular mechanisms of caspase regulation during apoptosis. Nature Reviews Molecular Cell Biology 5, 897–907. Rochanakij, S., Thebtaranonth, Y., Yenjai, C., Yuthavong, Y., 1985. Nimbolide, a constituent of Azadirachta indica, inhibits Plasmodium falciparum in culture. The Southeast Asian Journal of Tropical Medicine and Public Health 16, 66–72. Roy, M.K., Kobori, M., Takenaka, M., Nakahara, K., Shinmoto, H., Isobe, S., Tsushida, T., 2007. Antiproliferative effect on human cancer cell lines after treatment with nimbolide extracted from an edible part of the neem tree (Azadirachta indica). Phytotherapy Research 21, 245–250. Sastry, B.S., Suresh Babu, K., Hari Babu, T., Chandrasekhar, S., Srinivas, P.V., Saxena, A.K., Madhusudana Rao, J., 2006. Synthesis and biological activity of amide derivatives of nimbolide. Bioorganic and Medicinal Chemistry Letters 16, 4391–4394. Schmittgen, T.D., Livak, K.J., 2008. Analyzing real-time PCR data by the comparative C(T) method. Nature Protocols 3, 1101–1108. Subapriya, R., Nagini, S., 2005. Medicinal properties of neem leaves: a review. Current Medicinal Chemistry Anticancer Agents 5, 149-146. Suresh, G., Gopalakrishnan, G., Wesley, S.D., Pradeep Singh, N.D., Malathi, R., Rajan, S.S., 2002. Insect antifeedant activity of tetranortriterpenoids from the Rutales. A perusal of structural relations. Journal of Agricultural and Food Chemistry 50, 4484–4490. Tait, S.W., Green, D.R., 2010. Mitochondria and cell death: outer membrane permeabilization and beyond. Nature Reviews Molecular Cell Biology 11, 621–632. Taylor, J.M., Nicot, C., 2008. HTLV-1 and apoptosis: role in cellular transformation and recent advances in therapeutic approaches. Apoptosis 13, 733–747. Thomas, R.J., Guise, T.A., Yin, J.J., Elliott, J., Horwood, N.J., Martin, T.J., Gillespie, M.T., 1999. Breast cancer cells interact with osteoblasts to support osteoclast formation. Endocrinology 140, 4451–4458. Wirth, T., Kuhnel, F., Fleischmann-Mundt, B., Woller, N., Djojosubroto, M., Rudolph, K.L., Manns, M., Zender, L., Kubicka, S., 2005. Telomerase-dependent virotherapy overcomes resistance of hepatocellular carcinomas against chemotherapy and tumor necrosis factor-related apoptosis-inducing ligand by elimination of Mcl1. Cancer Research 65, 7393–7402. Yamaguchi, H., Bhalla, K., Wang, H.G., 2003. Bax plays a pivotal role in thapsigargininduced apoptosis of human colon cancer HCT116 cells by controlling Smac/Diablo and Omi/HtrA2 release from mitochondria. Cancer Research 63, 1483–1489. Yang, L., Cao, Z., Yan, H., Wood, W.C., 2003. Coexistence of high levels of apoptotic signaling and inhibitor of apoptosis proteins in human tumor cells: implication for cancer specific therapy. Cancer Research 63, 6815–6824. Youle, R.J., Strasser, A., 2008. The BCL-2 protein family: opposing activities that mediate cell death. Nature Reviews Molecular Cell Biology 9, 47–59. Zhang, Q., Fan, H., Shen, J., Hoffman, R.M., Xing, H.R., 2010. Human breast cancer cell lines co-express neuronal, epithelial, and melanocytic differentiation markers in vitro and in vivo. PLoS ONE 5, e9712.