- Email: [email protected]
Induction of cytochrome P4501A (CYP1A) in Trematomus bernacchii as an indicator of environmental pollution in Antarctica: assessment by quantitative RT-PCR
Aquatic Toxicology 44 (1999) 183 – 193
Induction of cytochrome P4501A (CYP1A) in Trematomus bernacchii as an indicator of environmental pollution in Antarctica: assessment by quantitative RT-PCR Hilary C. Miller a, Geoffrey N. Mills c, D.G. Bembo a, John A. Macdonald b, Clive W. Evans a,* a
De6elopmental Biology and Cancer Research Group, School of Biological Sciences, Uni6ersity of Auckland, Pri6ate Bag 92019, Auckland, New Zealand b Experimental Biology Research Group, School of Biological Sciences, Uni6ersity of Auckland, Pri6ate Bag 92019, Auckland, New Zealand c National Institute of Water and Atmospheric Research, P.O. Box 11 -115, Hamilton, New Zealand Received 26 November 1997; received in revised form 22 April 1998; accepted 4 May 1998
Abstract Although most of Antarctica is relatively pristine, high levels of pollutants have been recorded in localised areas such as in the vicinity of scientific bases like McMurdo Station. We have used the Antarctic fish Trematomus bernacchii as an indicator species to assess the level of impact of these pollutants on the local biota. Fish were collected from Winter Quarters Bay (adjacent to McMurdo Station) and Backdoor Bay (remote from human activities). Liver samples from individual fish were used in the preparation of total RNA from which the level of expression of the cytochrome P4501A gene (CYP1A), known to be responsive to polycyclic aromatic hydrocarbons (PAHs), was determined by quantitative competitive reverse-transcriptase polymerase chain reaction (RT-PCR). Samples of bile from the same fish were analysed for fluorescent aromatic compounds (FACs) at naphthalene and phenanthrene wavelengths to provide an indication of exposure to organic compounds such as the PAHs. The levels of biliary FACs in fish from Winter Quarters Bay were approximately 2-fold higher than those in fish from Backdoor Bay, whereas there was an average 37-fold increase in CYP1A expression between fish taken from the two sites. The extent of CYP1A induction correlated positively with biliary FACs levels, indicating the potential of quantitative competitive RT-PCR as a sensitive molecular approach to pollution impact assessment. Fish from Winter Quarters Bay also had significantly higher hepatosomatic and gonadosomatic indices indicative of altered organ function, although the extent to which this might be related to pollution is uncertain. © 1999 Elsevier Science B.V. All rights reserved. Keywords: Antarctica; CYP1A; Cytochrome P450; Pollution; RT-PCR; Trematomus bernacchii
* Corresponding author. Tel.: +64 9 3737599; fax: + 64 9 3737417; e-mail [email protected] 0166-445X/99/$ - see front matter © 1999 Elsevier Science B.V. All rights reserved. PII S0166-445X(98)00075-7
184
H.C. Miller et al. / Aquatic Toxicology 44 (1999) 183–193
1. Introduction High levels of localised pollution have been documented in certain parts of Antarctica, particularly around relatively populated areas such as the scientific research bases (Cripps and Priddle, 1991, Lenihan, 1992). Most contamination is petroleum-related and originates from improper waste disposal practices, ship discharges, accidental fuel leakage and run-off from the populated areas. The American base McMurdo Station is the largest human settlement in Antarctica, with a summer population of approximately 1000 people. Since the base was built approximately 40 years ago, waste discharge practices have resulted in severe but localised marine pollution. This is particularly noticeable in Winter Quarters Bay, a small mud-bottomed bay approximately 1 km2 in area adjacent to the station, where extensive dumping of waste and debris both along the shoreline and directly into the sea has taken place. In the Antarctic summer, Winter Quarters Bay is the site of an ice dock for cargo ships which increases the potential risk for contamination. Previous studies have detected an intense contamination gradient of polycyclic aromatic hydrocarbons (PAHs) and polychlorinated biphenyls (PCBs) in sediments from Winter Quarters Bay, with levels at the back of the bay as high as those seen in water sediments within industrialised areas of Europe and America. Only a relatively small area (approximately 0.5 km2) is heavily polluted, however, since contaminant levels decrease sharply outside the bay and are almost undetectable 1 km away at Cape Armitage (Lenihan et al., 1990, Riseborough et al., 1990). Given the reported high levels of organic contaminants in sediments from Winter Quarters Bay, the key question now focuses on how these impact on the local biota. In order to address this issue we have commenced a study using a local fish (Trematomus bernacchii ) as an indicator species. T. bernacchii is ideal as an indicator species for impact assessment because it is non-pelagic and it is ubiquitous along the Victoria Land coast (Gon and Heemstra, 1990). It is an opportunistic feeder (consuming a high proportion of benthic invertebrates) and, furthermore, diver and under-
water video observations suggest that individuals of this species have relatively restricted home ranges, spending large periods of time occupying small patches of substrate (Macdonald and Evans, personal observation). In this initial report we examine the level of expression of the gene for cytochrome P4501A (CYP1A) in T. bernacchii as a biomarker for exposure to organic pollutants. The cytochrome P450 family of monooxygenases metabolises both endogenous compounds, such as steroids and fatty acids, and foreign chemicals such as drugs and organic pollutants. CYP1A is induced by a number of organic contaminants including PAHs, PCBs and polychlorinated dibenzodioxins (Stegeman et al., 1981, Courtenay et al., 1993, Leaver et al., 1993, George et al., 1995). Induction of hepatic CYP1A in fish has been extensively used as an indicator of aquatic pollution (reviewed by Bucheli and Fent, 1995), and it is one of the most sensitive and well-characterised biomarkers in environmental impact assessment. The presence of an inducible cytochrome P450 monooxygenase system in T. bernacchii has been confirmed by other workers (Focardi et al., 1995). To date, the most commonly used method of assessing CYP1A induction in response to environmental contamination has involved measurement of CYP1A enzyme activity using the EROD assay which is based on the rate of O-de-ethylation of ethoxyresorufin (Pohl and Fouts, 1980). EROD-based measurements of CYP1A functional activity in the Antarctic fish Notothenia coriiceps have been used in studies of pollution around Palmer Station and the ‘Bahia Paraiso’ wreck (Kennicutt et al., 1995, McDonald et al., 1995). Direct measurements of CYP1A mRNA levels, however, have the potential to provide increased sensitivity and accuracy relative to assessments based on functional activity. The feasibility of using measurements of CYP1A mRNA as a biomarker has been demonstrated in several field studies (Courtenay et al., 1993, Haasch et al., 1993). In this study we have used competitive amplification by the reverse transcriptase–polymerase chain reaction (RT-PCR) to quantify CYP1A mRNA levels. The potential of this approach for measuring CYP1A mRNA has been demonstrated
H.C. Miller et al. / Aquatic Toxicology 44 (1999) 183–193
185
Fig. 1. Study sites. (a) Ross Island. (b) Backdoor Bay. (c) Winter Quarters Bay.
previously in mammals (Vanden Heuvel et al., 1993), and the technique has been shown to be up to 1000 times more sensitive than traditional RNA blotting (Wang et al., 1989). This makes it possible to detect and quantify rare mRNA transcripts which would be otherwise undetectable by methods such as Northern blotting, RNA dot blots and in situ hybridisation techniques. Furthermore, there is some indication that Antarctic fish have extremely low basal levels of CYP1A protein which may not always be detectable by methods based on functional activity (Focardi et al., 1989, 1992, 1995). In such cases, measurement of CYP1A mRNA by competitive RT-PCR may allow more accurate measurement of baseline data at pristine sites, and accurate quantitation of
responses to low levels of pollutants.
2. Materials and methods
2.1. Sampling Sampling was carried out in November 1996 at two sites: (1) Backdoor Bay (Cape Royds), approximately 35 km from McMurdo Station, and (2) Winter Quarters Bay, adjacent to McMurdo Station (Fig. 1). The site at Winter Quarters Bay was located between the former dump site and the ice dock, which was under construction at the time. T. bernacchii were caught from ice holes and immediately placed in an insulated bin containing
186
H.C. Miller et al. / Aquatic Toxicology 44 (1999) 183–193
seawater at −1.5°C. Winter Quarters Bay fish were transported back to a field hut at Cape Armitage for processing, while fish from Backdoor Bay were processed on site at a small hut adjacent to the fishing area. Fish were killed by cervical section, then weighed and their total length measured. A bile sample was taken and stored at −20°C. The liver was removed and weighed, and a 50– 100-mg sample was immediately homogenised in 1 ml Trizol (Gibco-BRL) and stored at −20°C for subsequent RNA isolation. The gonads were removed and weighed, and the sex of the fish was determined. The weight data obtained from the body, liver and gonad measurements were used to determine the hepatosomatic (liver/body weight per cent) and gonadosomatic (gonad/body weight per cent) indices (HSI and GSI, respectively).
2.2. Total rna isolation Liver samples which had been stored at −20°C in Trizol were thawed and total RNA was then extracted according to the manufacturer’s instructions. Total RNA was resuspended in 100 ml diethylpyrocarbonate-treated water (DEPC-H2O) containing 10 U RNAsin (Promega) and 2 mM dithiothreitol (DTT), and quantified using a GeneQuant spectrophotometer (Pharmacia). The integrity of the RNA was checked by electrophoresis in a 1% TAE (tris – acetate – EDTA) agarose gel.
2.3. T. bernacchii CYP1A sequence analysis A partial sequence of the T. bernacchii CYP1A gene was obtained by PCR using degenerate primers (forward primer GACTCCCTBATTGAYCACTG; reverse primer TGCCACTGRTTGATGAAGAC), designed to a consensus CYP1A sequence from the rainbow trout (Oncorhynchus mykiss), plaice (Pleuronectes platessa) and Atlantic tomcod (Microgadus tomcod). The resulting product was purified from a 0.4% TAE agarose gel, reamplified and sequenced following another round of electrophoresis and extraction (Fig. 2). When the sequence obtained was compared with others in the GenBank DNA database, the top
seven matches were to CYP1A from other teleosts.
2.4. Production of RNA competitor Primers bern450F1 (ACTCAGACATCCAGATGTCAGACG) and bern450R2 (CGGAAAATCTCCAGGATGAAAGCC) were designed to the partial T. bernacchii CYP1A sequence in order to amplify a 241 base pair (bp) target fragment. A 216-bp DNA competitor containing these primer sites and an internally nested sequence of T. bernacchii CYP1A was produced by the extended primer method of Celi et al. (1993) and cloned into pGEM-T (Promega). The DNA competitor was then linearised with Sal1 and transcribed in vitro using Ampliscribe (Epicentre Technologies) to produce an RNA competitor template. DNA in the in vitro transcription reaction was removed by treatment with DNAse and the RNA competitor was then isolated by phenol–chloroform extraction and resuspended in 20 ml DEPC-H20 containing 10 U RNAsin and 2 mM DTT. In order to produce a stock of RNA competitor, several transcription reactions were set up and the products were pooled. The size and integrity of the RNA competitor were checked by electrophoresis (1% TAE agarose gel) and its final concentration was measured using a GeneQuant spectrophotometer (Pharmacia).
2.5. Competiti6e RT-PCR A standard curve was produced by co-reverse transcription and co-amplification of a constant amount of competitor RNA with a dilution series of total RNA. Competitor RNA (1 fmol per tube) was added to an RT cocktail containing 10 pmol each of bern450F1 and bern450R2 primers, 10 U RNAsin and 10 mM DTT, and dispensed into individual PCR tubes. Total RNA was diluted to 0.2–20 ng ml − 1 and 5 ml were added to individual tubes (each containing 1 fmol of competitor RNA) to give a final range of 1–100 ng total RNA. This mixture was heated to 95°C for 1 min and then cooled to 60°C for 5 min to allow primer annealing. Tubes were then placed on ice and a
H.C. Miller et al. / Aquatic Toxicology 44 (1999) 183–193
187
Fig. 2. T. bernacchii CYP1A sequence analysis. The partial T. bernacchii CYP1A sequence obtained (Tbern, upper) is shown aligned against that from the Atlantic tomcod (Mtomcod, lower). Degenerate PCR primers designed to the consensus CYP1A sequences from rainbow trout, plaice and Atlantic tomcod are underlined (forward primer GACTCCCTBATGAYCACTG; reverse primer TGCCACTGRTTGATGAAGAC). The locations of the primers bern450F1 (ACTCAGACATCCAGATGTCAGACG) and bern450R2 (CGGAAAATCTCCAGGATGAAAGCC) are italicised. Base numbering for Mtomcod refers to the Atlantic tomcod cDNA sequence (GenBank Accession No. L42886).
cocktail containing first strand buffer (50 mM Tris –HCl, 75 mM KCl, 3 mM MgCl2), 0.5 mM each dNTP, and 200 U of Moloney murine leukaemia virus (M-MLV) reverse transcriptase was added to give a total volume of 20 ml. This mixture was incubated at 42°C for 1 h, then heated to 95°C for 2 min and placed on ice. The reverse transcription product was diluted 10-fold and 10 ml was then used as a template for amplification by PCR which was carried out in a 25-ml total reaction volume consisting of 10 mM Tris – HCl (pH 8.3), 1.5–2 mM MgCl2, 50 mM KCl, 0.2 mM dNTPs, 0.4 mM primers and 0.5 U Taq DNA polymerase (Boehringer Mannheim). The reaction was set up on ice and overlaid with mineral oil (Sigma) to prevent evaporation. Samples were amplified in an Omn-E thermal cycler (Hybaid)
with an initial denaturing step of 94°C for 2 min, followed by 30 cycles of 30 s at 94°C, 30 s at 60°C and 30 s at 72°C. PCR products were separated on a 10% polyacrylamide gel and stained with 0.3 mg ml − 1 ethidium bromide. Products were visualised over UV light (Fig. 3a) and relative band intensities were measured using an image analysis program (NIH Image 1.54). The logarithmic ratio of target to competitor band intensities was then plotted against the logarithm of the initial amount of total RNA added to the RT-PCR. The amount of CYP1A mRNA present in the total RNA sample used to make the standard curve was quantified by determining the equivalence point on the standard curve (log (t/c)=0), where the initial amount of target mRNA is equal to the initial amount of competitor. This allowed the
188
H.C. Miller et al. / Aquatic Toxicology 44 (1999) 183–193
Fig. 3. Standard curve for CYP1A competitive RT-PCR. (a) PCR products separated on a 10% polyacrylamide gel. Numbers indicate ng total RNA co-amplified with 1 fmol competitor. The gel shows decreasing target product (241 bp) formed relative to the competitor (216 bp) with an equivalence point between 25 and 50 ng total RNA. The band at approximately 460 bp is a heteroduplex formed from the competitor and target fragments. (b) Plot of standard curve. The line of best fit was derived from three independent experiments.
results to be expressed as fmol CYP1A mRNA rather than ng total RNA. The standard curve (Fig. 3b) was repeated three times and found to be highly repeatable (R 2 =0.967). CYP1A mRNA from unknown samples was quantified by co-reverse transcription and co-amplification of total RNA with 1 fmol of competitor RNA under the same conditions as used to construct the standard curve. For samples from Winter Quarters Bay, 50 ng of total RNA was added to the reaction, whereas for samples from Backdoor Bay 500 ng of total RNA was added in order to obtain a measurable response. The ratio
of target to competitor was determined as above, and the logarithm of the initial amount of CYP1A mRNA was interpolated from the standard curve.
2.6. Measurement of biliary FACs Biliary FACs were determined by fixed wavelength fluorescence (Lin et al., 1996) at excitation/ emission wavelengths of 290/335 nm and 256/380 nm for naphthalene-type and phenanthrene-type polyaromatics respectively (Krahn et al., 1984). Bile was diluted 1:1000 in 50/50 (v/v) ethanol–water (Ariese et al., 1993) before measuring fluores-
H.C. Miller et al. / Aquatic Toxicology 44 (1999) 183–193
189
Table 1 Physical data for T. bernacchii Sample site
n
Length (mm)
Weight (g)
HSI (%)
GSI a (%)
Backdoor Bay Winter Quarters Bay
8 8
200 9 18.1 199.99 22.6
110.4 9 36.9 112.53 9 38.7
1.54 90.15 2.10 9 0.22 **
1.03 90.71 1.97 90.56 *
Data are expressed as mean 9S.D. Excluding a single male at each site. * PB0.01, ** PB0.001 (Students t-test). a
cence using a Perkin-Elmer model LS50B luminescence spectrometer fitted with 1-cm quartz cells. Concentrations were calculated from linear calibration curves constructed from six standard solutions of naphthalene or phenanthrene dissolved in ethanol–water (50:50, v/v).
3. Results Table 1 shows the physical characteristics of the fish caught from Backdoor Bay and Winter Quarters Bay. Seven females and one male fish were analysed from each site. No significant differences (Student’s t-test) were seen in the length or weight of the two groups of fish although those from Winter Quarters Bay had significantly higher HSI and GSI. CYP1A mRNA was measured by competitive RT-PCR as described and standardised to 100 ng total RNA. The PCR results (Fig. 3a) used in generating the standard curve (Fig. 3b) included a band at approximately 460 bp which proved to be a heteroduplex formed from competitor and target DNA. Control experiments (not shown) indicated that the heteroduplex:competitor density in the unknown sample gels was consistent with that used in preparing the standard curve, and thus heteroduplex formation was not expected to significantly affect quantitation. A 37-fold increase in CYP1A mRNA was seen in fish from Winter Quarters Bay when compared with that of fish from Backdoor Bay (Table 2). The concentrations of biliary naphthalene-
and phenanthrene-like PAH metabolites in fish from Winter Quarters Bay were 2-fold higher than those in fish from Backdoor Bay (Table 3). One fish from Backdoor Bay gave inadequate bile for PAH analysis, thus only seven fish from this site were analysed. Levels of both naphthalene- and phenanthrene-type metabolites in fish from Winter Quarters Bay correlated strongly with CYP1A mRNA levels (Fig. 4a). In fish from Backdoor Bay the correlation between levels of phenanthrene-type metabolites and CYP1A mRNA was much greater than that between naphthalene-type metabolites and CYP1A mRNA (Fig. 4b). One CYP1A mRNA sample from Backdoor Bay (0.452 fmol 100 ng − 1 total RNA) was determined to be an outlier in the correlation with biliary PAH levels (94.40 and 7.908 mg g − 1 for naphthalene and phenanthrene derivatives respectively) and was not included in the linear regression analysis. Even though the CYP1A mRNA value was relatively high, it was still significantly different (over 10-fold lower) than the mean value recorded from Winter Quarters Bay and is thus included in Table 2. Table 2 CYP1A mRNA levels in T. bernacchii Sample site
n
Backdoor Bay 8 Winter Quarters 8 Bay
CYP1A mRNA (fmol CYP1A 100 ng-1 total RNA) 0.149 90.126 5.594 91.478 **
Data are expressed as mean 9 S.D. ** PB0.001 (Students t-test).
H.C. Miller et al. / Aquatic Toxicology 44 (1999) 183–193
190 Table 3 Biliary FACs levels Sample site
n
Naphthalene derivatives (mg g−1)
Phenanthrene derivatives (mg g−1)
Backdoor Bay Winter Quarters Bay
7a 8
114.349 30.55 216.189 43.83 **
12.13 9 4.37 24.17 9 5.04 **
Data are expressed as mean 9S.D. a One fish provided a bile sample too small for analysis. ** PB0.001 (Students t-test).
4. Discussion In the majority of studies to date, competitive RT-PCR has been performed as a titration assay in which constant amounts of total RNA are co-reverse transcribed and co-amplified with a dilution series of an RNA competitor for each sample (Becker-Andre and Hahlbrock, 1989, Vanden Heuvel et al., 1993). The approach used in the current study differs from that used in most earlier reports in that samples are co-reversed transcribed with a single competitor concentration and the ratio of products is then compared to a standard curve. Results using standard curve methodology have been shown to correlate closely with those obtained using the original procedures (Tsai and Wiltbank, 1996). Additionally, the standard curve approach has a number of practical advantages in that it requires less RNA per sample, fewer gels to be run, and less time for analysis. The results of the present study using standard curve methodology show highly elevated levels of CYP1A mRNA in T. bernacchii from Winter Quarters Bay when compared to fish from a reference site (Backdoor Bay). This indicates that Winter Quarters Bay fish have been exposed to compounds known to induce CYP1A such as PAHs, PCBs and polychlorinated benzodioxins. The large relative increase in expression (37-fold) seen in fish from Winter Quarters Bay reflects previous work indicating a high level of sediment contamination with such compounds (Lenihan et al., 1990, Riseborough et al., 1990). Significantly higher levels of PAH metabolites were measured in fish from Winter Quarters Bay when compared to that in fish from Backdoor
Bay. The relatively high levels of FACs in Winter Quarters Bay fish is in broad agreement with the results of McDonald et al. (1995), who found that biliary levels of naphthalene-type and phenanthrene-type PAH metabolites in T. bernacchii from Winter Quarters Bay were three times higher than levels in fish from Cinder Cones (a clean site approximately 10 km from McMurdo Station). The amounts of phenanthrene metabolites found in T. bernacchii from Winter Quarters Bay were similar to those seen in this study (25 mg g − 1), while those for naphthalene-type compounds were slightly lower (140 mg g − 1). Strong correlations were found in the present study between biliary PAH metabolites and CYP1A mRNA levels in T. bernacchii collected from the relatively more impacted site indicating the informative potential of the RT-PCR approach. Correlations between biliary metabolites and CYP1A mRNA levels in fish collected from the pristine site were also apparent, particularly with respect to phenanthrene derivatives even though this type of contaminant was present at extremely low levels in reference site fish. Fish from Winter Quarters Bay have enlarged livers and gonads relative to fish from Backdoor Bay as indicated by HSI and GSI. Enlarged livers have been reported previously in fish from other polluted sites, particularly where high levels of chlorinated compounds have been detected (Elskus and Stegeman, 1989), and this may be indicative of altered liver function. Likewise, the enlarged gonads seen in Winter Quarters Bay may be a reflection on their general health. Although T. bernacchii mostly spawn between mid-December and mid-January in McMurdo Sound (Dearborn, 1965), all the fish sampled in this study were reproductively immature and would not have
H.C. Miller et al. / Aquatic Toxicology 44 (1999) 183–193
191
Fig. 4. Correlation between CYP1A induction and biliary FACs. (a) Winter Quarters Bay. (b) Backdoor Bay.
spawned in the season of sampling. This conclusion is supported by the low recorded GSI values (approximately 1–2%) which normally peak at 18 – 19% immediately prior to spawning (Hureau, 1964). The absence of reproductively mature fish possibly reflects the shallow water habitat from which fish were collected. Thus differences in
spawning state between the two populations are unlikely to explain the significant difference in GSI between them. Although the sex steroid estradiol is an inhibitor of CYP1A (Elskus et al., 1992, Larsen et al., 1992), significantly no decrease in CYP1A mRNA was seen in fish with elevated GSI in this study.
192
H.C. Miller et al. / Aquatic Toxicology 44 (1999) 183–193
Previous studies have shown that severe pollution does exist in Winter Quarters Bay. The United States Antarctic Research Program undertook an extensive study of marine pollution in Winter Quarters Bay in response to criticism for contaminating the environment and endangering wildlife, and not applying US environmental laws to waste disposal (Lenihan, 1992). This survey found that an intense contamination gradient of PAHs and PCBs existed in Winter Quarters Bay. In the back of the bay levels of hydrocarbons in sediments were as high as 4500 ppm. This is higher than levels seen in the most polluted harbours in other parts of the world. However, only a relatively small area (approximately 0.5 km2) is heavily polluted since hydrocarbon levels sharply decrease outside the bay and are almost undetectable 1 km away at Cape Armitage (Lenihan et al., 1990). A similar pattern was seen for PCBs, with levels as high as 1400 ppb at the back of the bay, but two orders of magnitude lower 1 km away (Riseborough et al., 1990). It was found that a large amount of anthropogenic debris, such as used machinery, 44-gallon drums and scrap metal littered the sea floor, and a marked change in marine benthic communities was seen along the contamination gradient (Lenihan, 1992). An extensive McMurdo Station clean up program was begun in 1988. Major rubbish dumps were removed and returned to the USA, and dumping along the shoreline no longer occurs. Sewerage and grey water are now discharged at a submerged outfall. The results of the present study show that a significant level of contamination still exists, however, and that it has the potential to cause significantly increased transcription of a prominent toxic response indicator gene. Since hydrocarbon breakdown is slow in Antarctica due to the cold temperatures, the effects of earlier contamination episodes are likely to remain for a considerable period of time.
Acknowledgements We thank the University of Auckland Research Committee for financial support, Kelly Tarlton’s Underwater World (Auckland) for the use of
facilities and equipment, Dr Leon Huynen (University of Auckland) and staff of Antarctica New Zealand for their operational assistance, Bridget Kerr (NIWA) for FACs determinations, James Dickson (University of Auckland) for help with the manuscript, and Jenny Rains (University of Auckland) for technical support. HCM was a Freemasons Scholar and the recipient of an Antarctica New Zealand Science Award.
References Ariese, F., Kok, S.J., Verkaik, M., Gooijer, C., Velthorst, N.H., Hofstraat, J.W., 1993. Synchronous fluorescence spectrometry of fish bile: a rapid screening method for the biomonitoring of PAH exposure. Aquat. Toxicol. 26, 273 – 286. Becker-Andre, M., Hahlbrock, K., 1989. Absolute messenger RNA quantification using the polymerase chain reaction (PCR): a novel approach by PCR aided transcript titration assay (PATTY). Nucleic Acids Res. 17, 9437 – 9446. Bucheli, T.D., Fent, K., 1995. Induction of cytochrome p450 as a biomarker for environmental contamination in aquatic systems. Crit. Rev. Environ. Sci. Technol. 25, 201 – 268. Celi, F.S., Zenilman, M.E., Shuldiner, A.R., 1993. A rapid and versatile method to synthesise internal standards for competitive PCR. Nucleic Acids Res. 21, 1047. Courtenay, S., Grunwald, C., Kreamer, G.-L., Alexander, R., Wirgin, I., 1993. Induction and clearance of cytochrome p4501A1 mRNA in Atlantic tomcod caged in bleached kraft mill effluent in the Miramichi River. Aquat. Toxicol. 27, 225 – 244. Cripps, G.C., Priddle, J., 1991. Hydrocarbons in the Antarctic marine environment. Antarctic Sci. 3, 233 – 250. Dearborn, J.H., 1965. Reproduction in the nototheniid fish Trematomus bernacchii Boulenger at McMurdo Sound, Antarctica. Copeia 1965, 302 – 308. Elskus, A.A., Stegeman, J.J., 1989. Induced cytochrome p450 in Fundulus heteroclitus associated with environmental contamination by polychlorinated biphenyls and polynuclear aromatic hydrocarbons. Mar. Environ. Res. 27, 31 – 50. Elskus, A.A., Pruell, R., Stegeman, J.J., 1992. Endogenouslymediated, pretranslational suppression of cytochrome P4501A in PCB-contaminated flounder. Mar. Environ. Res. 34, 97 – 101. Focardi, S., Fossi, C., Leonzio, C., Di Simplicio, P., 1989. Mixed-function oxidase activity and conjugating enzymes in two species of Antarctic fish. Mar. Environ. Res. 28, 31 – 33. Focardi, S., Fossi, C., Lari, L., Marsili, L., Leonzio, C., Casini, S., 1992. Induction of mixed function oxidase (MFO) system in two species of Antarctic fish from Terra Nova Bay (Ross Sea). Polar Biol. 12, 721 – 725.
H.C. Miller et al. / Aquatic Toxicology 44 (1999) 183–193 Focardi, S., Fossi, M.C., Lari, L., Casini, S., Leonzio, C., Meidel, S.K., Nigro, M., 1995. Induction of MFO activity in the Antarctic fish Pagothenia bernacchii: preliminary results. Mar. Environ. Res. 39, 97–100. George, S.G., Christiansen, J.S., Killie, B., Wright, J., 1995. Dietary crude oil exposure during sexual maturation induces hepatic mixed function oxygenase (CYP1A) activity at very low environmental temperatures in the Polar cod Boreogadus saida. Mar. Ecol. Prog. Ser. 122, 307–312. Gon, O., Heemstra, P.C., 1990. Fishes of the Southern Ocean. JLB Smith Institute of Ichthyology, Grahamstown, Sth. Africa. Haasch, M.L., Prince, R., Wejksnora, P.J., Cooper, K.R., Lech, J.J., 1993. caged and wild fish induction of hepatic cytochrome P-450 CYP1A1 as an environmental biomarker. Environ. Toxicol. Chem. 12, 885–895. Hureau, J.C., 1964. Contribution a` la connaissance de Trematomus bernacchii Boulenger. Biol. Antarct. Actual. Sci. Ind. 1312, 481 – 487. Kennicutt, M.C., McDonald, S.J., Sericano, J.L., Boothe, P., Oliver, J., Safe, S., Presley, B.J., Liu, H., Wolfe, D., Wade, T.L., Crockett, A., Bockus, D., 1995. Human contamination of the marine environment—Arthur Harbour and McMurdo Sound, Antarctica. Environ. Sci. Technol. 29, 1279 – 1287. Krahn, M.M., Myers, M.S., Burrows, D.G., Malins, D.C., 1984. Determination of metabolites of xenobiotics in the bile of fish from polluted waterways. Xenobiotica 14, 633 – 646. Larsen, H.E., Celander, M., Goksoyr, A., 1992. The cytochrome p450 system of Atlantic Salmon (Salmo salar): II. Variations in hepatic catalytic activities and isozyme patterns during an annual reproductive cycle. Fish Physiol. Biochem. 10, 291 – 301. Leaver, M.J., Pirrit, L., George, S.G., 1993. Cytochrome p4501A1 cDNA from plaice (Pleuronectes platessa) and induction of p4501A1 mRNA in various tissues by 3-
methycholanthrene and isosafrole. Mol. Mar. Biol. Biotech. 2, 338 – 345. Lenihan, H.S., 1992. Benthic marine pollution around McMurdo Station, Antarctica: a summary of findings. Mar. Pollut. Bull. 25, 318 – 323. Lenihan, H.S., Oliver, J.S., Oakden, J.M., Stephenson, M.D., 1990. Intense and localised benthic marine pollution around McMurdo Station, Antarctica. Mar. Pollut. Bull. 21, 422 – 430. Lin, E.L.C., Cormier, S.M., Torsella, J.A., 1996. Fish biliary polycyclic aromatic hydrocarbon metabolites estimated by fixed-wavelength fluorescence: comparison with HPLC – fluorescent detection. Ecotoxicol. Environ. Saf. 35, 16 – 23. McDonald, S.J., Kennicutt, M.C., Liu, H., Safe, S.H., 1995. Assessing aromatic hydrocarbon exposure in Antarctic fish captured near Palmer and McMurdo Stations, Antarctica. Arch. Environ. Contam. Toxicol. 29, 232 – 240. Pohl, R.J., Fouts, J.R., 1980. A rapid method for asssaying the metabolism of 7-ethoxyresorufin by microsomal subcellular fractions. Anal. Biochem. 107, 150 – 155. Riseborough, R.W., De Lappe, B.W., Younghans-Haug, C., 1990. PCB and PCT contamination in Winter Quarters Bay, Antarctica. Mar. Pollut. Bull. 21, 523 – 529. Stegeman, J.J., Klotz, A.V., Woodin, B.R., Pajor, A.M., 1981. Induction of hepatic cytochrome p450 in fish and the indication of environmental induction in scup (Stenotomus chrysops). Aquat. Toxicol. 1, 197 – 212. Tsai, S.-J., Wiltbank, M.C., 1996. Quantification of mRNA using competitive RT-PCR with standard-curve methodology. BioTechniques 21, 862 – 866. Vanden Heuvel, J.P., Clark, G.C., Thompson, C.L., McCoy, Z., Miller, C.R., Lucier, G.W., Bell, D.A., 1993. CYP1A1 mRNA levels as a human exposure biomarker: use of quantitative polymerase chain reaction to measure CYP1A1 expression in human peripheral blood lymphocytes. Carcinogenesis 14, 2003 – 2006. Wang, A.M., Doyle, M.V., Mark, D.F., 1989. Quantitation of mRNA by the polymerase chain reaction. Proc. Natl. Acad. Sci. USA 86, 9717 – 9721.
. .
193
Induction of cytochrome P4501A (CYP1A) in Trematomus bernacchii as an indicator of environmental pollution in Antarctica: assessment by quantitative RT-PCR Hilary C. Miller a, Geoffrey N. Mills c, D.G. Bembo a, John A. Macdonald b, Clive W. Evans a,* a
De6elopmental Biology and Cancer Research Group, School of Biological Sciences, Uni6ersity of Auckland, Pri6ate Bag 92019, Auckland, New Zealand b Experimental Biology Research Group, School of Biological Sciences, Uni6ersity of Auckland, Pri6ate Bag 92019, Auckland, New Zealand c National Institute of Water and Atmospheric Research, P.O. Box 11 -115, Hamilton, New Zealand Received 26 November 1997; received in revised form 22 April 1998; accepted 4 May 1998
Abstract Although most of Antarctica is relatively pristine, high levels of pollutants have been recorded in localised areas such as in the vicinity of scientific bases like McMurdo Station. We have used the Antarctic fish Trematomus bernacchii as an indicator species to assess the level of impact of these pollutants on the local biota. Fish were collected from Winter Quarters Bay (adjacent to McMurdo Station) and Backdoor Bay (remote from human activities). Liver samples from individual fish were used in the preparation of total RNA from which the level of expression of the cytochrome P4501A gene (CYP1A), known to be responsive to polycyclic aromatic hydrocarbons (PAHs), was determined by quantitative competitive reverse-transcriptase polymerase chain reaction (RT-PCR). Samples of bile from the same fish were analysed for fluorescent aromatic compounds (FACs) at naphthalene and phenanthrene wavelengths to provide an indication of exposure to organic compounds such as the PAHs. The levels of biliary FACs in fish from Winter Quarters Bay were approximately 2-fold higher than those in fish from Backdoor Bay, whereas there was an average 37-fold increase in CYP1A expression between fish taken from the two sites. The extent of CYP1A induction correlated positively with biliary FACs levels, indicating the potential of quantitative competitive RT-PCR as a sensitive molecular approach to pollution impact assessment. Fish from Winter Quarters Bay also had significantly higher hepatosomatic and gonadosomatic indices indicative of altered organ function, although the extent to which this might be related to pollution is uncertain. © 1999 Elsevier Science B.V. All rights reserved. Keywords: Antarctica; CYP1A; Cytochrome P450; Pollution; RT-PCR; Trematomus bernacchii
* Corresponding author. Tel.: +64 9 3737599; fax: + 64 9 3737417; e-mail [email protected] 0166-445X/99/$ - see front matter © 1999 Elsevier Science B.V. All rights reserved. PII S0166-445X(98)00075-7
184
H.C. Miller et al. / Aquatic Toxicology 44 (1999) 183–193
1. Introduction High levels of localised pollution have been documented in certain parts of Antarctica, particularly around relatively populated areas such as the scientific research bases (Cripps and Priddle, 1991, Lenihan, 1992). Most contamination is petroleum-related and originates from improper waste disposal practices, ship discharges, accidental fuel leakage and run-off from the populated areas. The American base McMurdo Station is the largest human settlement in Antarctica, with a summer population of approximately 1000 people. Since the base was built approximately 40 years ago, waste discharge practices have resulted in severe but localised marine pollution. This is particularly noticeable in Winter Quarters Bay, a small mud-bottomed bay approximately 1 km2 in area adjacent to the station, where extensive dumping of waste and debris both along the shoreline and directly into the sea has taken place. In the Antarctic summer, Winter Quarters Bay is the site of an ice dock for cargo ships which increases the potential risk for contamination. Previous studies have detected an intense contamination gradient of polycyclic aromatic hydrocarbons (PAHs) and polychlorinated biphenyls (PCBs) in sediments from Winter Quarters Bay, with levels at the back of the bay as high as those seen in water sediments within industrialised areas of Europe and America. Only a relatively small area (approximately 0.5 km2) is heavily polluted, however, since contaminant levels decrease sharply outside the bay and are almost undetectable 1 km away at Cape Armitage (Lenihan et al., 1990, Riseborough et al., 1990). Given the reported high levels of organic contaminants in sediments from Winter Quarters Bay, the key question now focuses on how these impact on the local biota. In order to address this issue we have commenced a study using a local fish (Trematomus bernacchii ) as an indicator species. T. bernacchii is ideal as an indicator species for impact assessment because it is non-pelagic and it is ubiquitous along the Victoria Land coast (Gon and Heemstra, 1990). It is an opportunistic feeder (consuming a high proportion of benthic invertebrates) and, furthermore, diver and under-
water video observations suggest that individuals of this species have relatively restricted home ranges, spending large periods of time occupying small patches of substrate (Macdonald and Evans, personal observation). In this initial report we examine the level of expression of the gene for cytochrome P4501A (CYP1A) in T. bernacchii as a biomarker for exposure to organic pollutants. The cytochrome P450 family of monooxygenases metabolises both endogenous compounds, such as steroids and fatty acids, and foreign chemicals such as drugs and organic pollutants. CYP1A is induced by a number of organic contaminants including PAHs, PCBs and polychlorinated dibenzodioxins (Stegeman et al., 1981, Courtenay et al., 1993, Leaver et al., 1993, George et al., 1995). Induction of hepatic CYP1A in fish has been extensively used as an indicator of aquatic pollution (reviewed by Bucheli and Fent, 1995), and it is one of the most sensitive and well-characterised biomarkers in environmental impact assessment. The presence of an inducible cytochrome P450 monooxygenase system in T. bernacchii has been confirmed by other workers (Focardi et al., 1995). To date, the most commonly used method of assessing CYP1A induction in response to environmental contamination has involved measurement of CYP1A enzyme activity using the EROD assay which is based on the rate of O-de-ethylation of ethoxyresorufin (Pohl and Fouts, 1980). EROD-based measurements of CYP1A functional activity in the Antarctic fish Notothenia coriiceps have been used in studies of pollution around Palmer Station and the ‘Bahia Paraiso’ wreck (Kennicutt et al., 1995, McDonald et al., 1995). Direct measurements of CYP1A mRNA levels, however, have the potential to provide increased sensitivity and accuracy relative to assessments based on functional activity. The feasibility of using measurements of CYP1A mRNA as a biomarker has been demonstrated in several field studies (Courtenay et al., 1993, Haasch et al., 1993). In this study we have used competitive amplification by the reverse transcriptase–polymerase chain reaction (RT-PCR) to quantify CYP1A mRNA levels. The potential of this approach for measuring CYP1A mRNA has been demonstrated
H.C. Miller et al. / Aquatic Toxicology 44 (1999) 183–193
185
Fig. 1. Study sites. (a) Ross Island. (b) Backdoor Bay. (c) Winter Quarters Bay.
previously in mammals (Vanden Heuvel et al., 1993), and the technique has been shown to be up to 1000 times more sensitive than traditional RNA blotting (Wang et al., 1989). This makes it possible to detect and quantify rare mRNA transcripts which would be otherwise undetectable by methods such as Northern blotting, RNA dot blots and in situ hybridisation techniques. Furthermore, there is some indication that Antarctic fish have extremely low basal levels of CYP1A protein which may not always be detectable by methods based on functional activity (Focardi et al., 1989, 1992, 1995). In such cases, measurement of CYP1A mRNA by competitive RT-PCR may allow more accurate measurement of baseline data at pristine sites, and accurate quantitation of
responses to low levels of pollutants.
2. Materials and methods
2.1. Sampling Sampling was carried out in November 1996 at two sites: (1) Backdoor Bay (Cape Royds), approximately 35 km from McMurdo Station, and (2) Winter Quarters Bay, adjacent to McMurdo Station (Fig. 1). The site at Winter Quarters Bay was located between the former dump site and the ice dock, which was under construction at the time. T. bernacchii were caught from ice holes and immediately placed in an insulated bin containing
186
H.C. Miller et al. / Aquatic Toxicology 44 (1999) 183–193
seawater at −1.5°C. Winter Quarters Bay fish were transported back to a field hut at Cape Armitage for processing, while fish from Backdoor Bay were processed on site at a small hut adjacent to the fishing area. Fish were killed by cervical section, then weighed and their total length measured. A bile sample was taken and stored at −20°C. The liver was removed and weighed, and a 50– 100-mg sample was immediately homogenised in 1 ml Trizol (Gibco-BRL) and stored at −20°C for subsequent RNA isolation. The gonads were removed and weighed, and the sex of the fish was determined. The weight data obtained from the body, liver and gonad measurements were used to determine the hepatosomatic (liver/body weight per cent) and gonadosomatic (gonad/body weight per cent) indices (HSI and GSI, respectively).
2.2. Total rna isolation Liver samples which had been stored at −20°C in Trizol were thawed and total RNA was then extracted according to the manufacturer’s instructions. Total RNA was resuspended in 100 ml diethylpyrocarbonate-treated water (DEPC-H2O) containing 10 U RNAsin (Promega) and 2 mM dithiothreitol (DTT), and quantified using a GeneQuant spectrophotometer (Pharmacia). The integrity of the RNA was checked by electrophoresis in a 1% TAE (tris – acetate – EDTA) agarose gel.
2.3. T. bernacchii CYP1A sequence analysis A partial sequence of the T. bernacchii CYP1A gene was obtained by PCR using degenerate primers (forward primer GACTCCCTBATTGAYCACTG; reverse primer TGCCACTGRTTGATGAAGAC), designed to a consensus CYP1A sequence from the rainbow trout (Oncorhynchus mykiss), plaice (Pleuronectes platessa) and Atlantic tomcod (Microgadus tomcod). The resulting product was purified from a 0.4% TAE agarose gel, reamplified and sequenced following another round of electrophoresis and extraction (Fig. 2). When the sequence obtained was compared with others in the GenBank DNA database, the top
seven matches were to CYP1A from other teleosts.
2.4. Production of RNA competitor Primers bern450F1 (ACTCAGACATCCAGATGTCAGACG) and bern450R2 (CGGAAAATCTCCAGGATGAAAGCC) were designed to the partial T. bernacchii CYP1A sequence in order to amplify a 241 base pair (bp) target fragment. A 216-bp DNA competitor containing these primer sites and an internally nested sequence of T. bernacchii CYP1A was produced by the extended primer method of Celi et al. (1993) and cloned into pGEM-T (Promega). The DNA competitor was then linearised with Sal1 and transcribed in vitro using Ampliscribe (Epicentre Technologies) to produce an RNA competitor template. DNA in the in vitro transcription reaction was removed by treatment with DNAse and the RNA competitor was then isolated by phenol–chloroform extraction and resuspended in 20 ml DEPC-H20 containing 10 U RNAsin and 2 mM DTT. In order to produce a stock of RNA competitor, several transcription reactions were set up and the products were pooled. The size and integrity of the RNA competitor were checked by electrophoresis (1% TAE agarose gel) and its final concentration was measured using a GeneQuant spectrophotometer (Pharmacia).
2.5. Competiti6e RT-PCR A standard curve was produced by co-reverse transcription and co-amplification of a constant amount of competitor RNA with a dilution series of total RNA. Competitor RNA (1 fmol per tube) was added to an RT cocktail containing 10 pmol each of bern450F1 and bern450R2 primers, 10 U RNAsin and 10 mM DTT, and dispensed into individual PCR tubes. Total RNA was diluted to 0.2–20 ng ml − 1 and 5 ml were added to individual tubes (each containing 1 fmol of competitor RNA) to give a final range of 1–100 ng total RNA. This mixture was heated to 95°C for 1 min and then cooled to 60°C for 5 min to allow primer annealing. Tubes were then placed on ice and a
H.C. Miller et al. / Aquatic Toxicology 44 (1999) 183–193
187
Fig. 2. T. bernacchii CYP1A sequence analysis. The partial T. bernacchii CYP1A sequence obtained (Tbern, upper) is shown aligned against that from the Atlantic tomcod (Mtomcod, lower). Degenerate PCR primers designed to the consensus CYP1A sequences from rainbow trout, plaice and Atlantic tomcod are underlined (forward primer GACTCCCTBATGAYCACTG; reverse primer TGCCACTGRTTGATGAAGAC). The locations of the primers bern450F1 (ACTCAGACATCCAGATGTCAGACG) and bern450R2 (CGGAAAATCTCCAGGATGAAAGCC) are italicised. Base numbering for Mtomcod refers to the Atlantic tomcod cDNA sequence (GenBank Accession No. L42886).
cocktail containing first strand buffer (50 mM Tris –HCl, 75 mM KCl, 3 mM MgCl2), 0.5 mM each dNTP, and 200 U of Moloney murine leukaemia virus (M-MLV) reverse transcriptase was added to give a total volume of 20 ml. This mixture was incubated at 42°C for 1 h, then heated to 95°C for 2 min and placed on ice. The reverse transcription product was diluted 10-fold and 10 ml was then used as a template for amplification by PCR which was carried out in a 25-ml total reaction volume consisting of 10 mM Tris – HCl (pH 8.3), 1.5–2 mM MgCl2, 50 mM KCl, 0.2 mM dNTPs, 0.4 mM primers and 0.5 U Taq DNA polymerase (Boehringer Mannheim). The reaction was set up on ice and overlaid with mineral oil (Sigma) to prevent evaporation. Samples were amplified in an Omn-E thermal cycler (Hybaid)
with an initial denaturing step of 94°C for 2 min, followed by 30 cycles of 30 s at 94°C, 30 s at 60°C and 30 s at 72°C. PCR products were separated on a 10% polyacrylamide gel and stained with 0.3 mg ml − 1 ethidium bromide. Products were visualised over UV light (Fig. 3a) and relative band intensities were measured using an image analysis program (NIH Image 1.54). The logarithmic ratio of target to competitor band intensities was then plotted against the logarithm of the initial amount of total RNA added to the RT-PCR. The amount of CYP1A mRNA present in the total RNA sample used to make the standard curve was quantified by determining the equivalence point on the standard curve (log (t/c)=0), where the initial amount of target mRNA is equal to the initial amount of competitor. This allowed the
188
H.C. Miller et al. / Aquatic Toxicology 44 (1999) 183–193
Fig. 3. Standard curve for CYP1A competitive RT-PCR. (a) PCR products separated on a 10% polyacrylamide gel. Numbers indicate ng total RNA co-amplified with 1 fmol competitor. The gel shows decreasing target product (241 bp) formed relative to the competitor (216 bp) with an equivalence point between 25 and 50 ng total RNA. The band at approximately 460 bp is a heteroduplex formed from the competitor and target fragments. (b) Plot of standard curve. The line of best fit was derived from three independent experiments.
results to be expressed as fmol CYP1A mRNA rather than ng total RNA. The standard curve (Fig. 3b) was repeated three times and found to be highly repeatable (R 2 =0.967). CYP1A mRNA from unknown samples was quantified by co-reverse transcription and co-amplification of total RNA with 1 fmol of competitor RNA under the same conditions as used to construct the standard curve. For samples from Winter Quarters Bay, 50 ng of total RNA was added to the reaction, whereas for samples from Backdoor Bay 500 ng of total RNA was added in order to obtain a measurable response. The ratio
of target to competitor was determined as above, and the logarithm of the initial amount of CYP1A mRNA was interpolated from the standard curve.
2.6. Measurement of biliary FACs Biliary FACs were determined by fixed wavelength fluorescence (Lin et al., 1996) at excitation/ emission wavelengths of 290/335 nm and 256/380 nm for naphthalene-type and phenanthrene-type polyaromatics respectively (Krahn et al., 1984). Bile was diluted 1:1000 in 50/50 (v/v) ethanol–water (Ariese et al., 1993) before measuring fluores-
H.C. Miller et al. / Aquatic Toxicology 44 (1999) 183–193
189
Table 1 Physical data for T. bernacchii Sample site
n
Length (mm)
Weight (g)
HSI (%)
GSI a (%)
Backdoor Bay Winter Quarters Bay
8 8
200 9 18.1 199.99 22.6
110.4 9 36.9 112.53 9 38.7
1.54 90.15 2.10 9 0.22 **
1.03 90.71 1.97 90.56 *
Data are expressed as mean 9S.D. Excluding a single male at each site. * PB0.01, ** PB0.001 (Students t-test). a
cence using a Perkin-Elmer model LS50B luminescence spectrometer fitted with 1-cm quartz cells. Concentrations were calculated from linear calibration curves constructed from six standard solutions of naphthalene or phenanthrene dissolved in ethanol–water (50:50, v/v).
3. Results Table 1 shows the physical characteristics of the fish caught from Backdoor Bay and Winter Quarters Bay. Seven females and one male fish were analysed from each site. No significant differences (Student’s t-test) were seen in the length or weight of the two groups of fish although those from Winter Quarters Bay had significantly higher HSI and GSI. CYP1A mRNA was measured by competitive RT-PCR as described and standardised to 100 ng total RNA. The PCR results (Fig. 3a) used in generating the standard curve (Fig. 3b) included a band at approximately 460 bp which proved to be a heteroduplex formed from competitor and target DNA. Control experiments (not shown) indicated that the heteroduplex:competitor density in the unknown sample gels was consistent with that used in preparing the standard curve, and thus heteroduplex formation was not expected to significantly affect quantitation. A 37-fold increase in CYP1A mRNA was seen in fish from Winter Quarters Bay when compared with that of fish from Backdoor Bay (Table 2). The concentrations of biliary naphthalene-
and phenanthrene-like PAH metabolites in fish from Winter Quarters Bay were 2-fold higher than those in fish from Backdoor Bay (Table 3). One fish from Backdoor Bay gave inadequate bile for PAH analysis, thus only seven fish from this site were analysed. Levels of both naphthalene- and phenanthrene-type metabolites in fish from Winter Quarters Bay correlated strongly with CYP1A mRNA levels (Fig. 4a). In fish from Backdoor Bay the correlation between levels of phenanthrene-type metabolites and CYP1A mRNA was much greater than that between naphthalene-type metabolites and CYP1A mRNA (Fig. 4b). One CYP1A mRNA sample from Backdoor Bay (0.452 fmol 100 ng − 1 total RNA) was determined to be an outlier in the correlation with biliary PAH levels (94.40 and 7.908 mg g − 1 for naphthalene and phenanthrene derivatives respectively) and was not included in the linear regression analysis. Even though the CYP1A mRNA value was relatively high, it was still significantly different (over 10-fold lower) than the mean value recorded from Winter Quarters Bay and is thus included in Table 2. Table 2 CYP1A mRNA levels in T. bernacchii Sample site
n
Backdoor Bay 8 Winter Quarters 8 Bay
CYP1A mRNA (fmol CYP1A 100 ng-1 total RNA) 0.149 90.126 5.594 91.478 **
Data are expressed as mean 9 S.D. ** PB0.001 (Students t-test).
H.C. Miller et al. / Aquatic Toxicology 44 (1999) 183–193
190 Table 3 Biliary FACs levels Sample site
n
Naphthalene derivatives (mg g−1)
Phenanthrene derivatives (mg g−1)
Backdoor Bay Winter Quarters Bay
7a 8
114.349 30.55 216.189 43.83 **
12.13 9 4.37 24.17 9 5.04 **
Data are expressed as mean 9S.D. a One fish provided a bile sample too small for analysis. ** PB0.001 (Students t-test).
4. Discussion In the majority of studies to date, competitive RT-PCR has been performed as a titration assay in which constant amounts of total RNA are co-reverse transcribed and co-amplified with a dilution series of an RNA competitor for each sample (Becker-Andre and Hahlbrock, 1989, Vanden Heuvel et al., 1993). The approach used in the current study differs from that used in most earlier reports in that samples are co-reversed transcribed with a single competitor concentration and the ratio of products is then compared to a standard curve. Results using standard curve methodology have been shown to correlate closely with those obtained using the original procedures (Tsai and Wiltbank, 1996). Additionally, the standard curve approach has a number of practical advantages in that it requires less RNA per sample, fewer gels to be run, and less time for analysis. The results of the present study using standard curve methodology show highly elevated levels of CYP1A mRNA in T. bernacchii from Winter Quarters Bay when compared to fish from a reference site (Backdoor Bay). This indicates that Winter Quarters Bay fish have been exposed to compounds known to induce CYP1A such as PAHs, PCBs and polychlorinated benzodioxins. The large relative increase in expression (37-fold) seen in fish from Winter Quarters Bay reflects previous work indicating a high level of sediment contamination with such compounds (Lenihan et al., 1990, Riseborough et al., 1990). Significantly higher levels of PAH metabolites were measured in fish from Winter Quarters Bay when compared to that in fish from Backdoor
Bay. The relatively high levels of FACs in Winter Quarters Bay fish is in broad agreement with the results of McDonald et al. (1995), who found that biliary levels of naphthalene-type and phenanthrene-type PAH metabolites in T. bernacchii from Winter Quarters Bay were three times higher than levels in fish from Cinder Cones (a clean site approximately 10 km from McMurdo Station). The amounts of phenanthrene metabolites found in T. bernacchii from Winter Quarters Bay were similar to those seen in this study (25 mg g − 1), while those for naphthalene-type compounds were slightly lower (140 mg g − 1). Strong correlations were found in the present study between biliary PAH metabolites and CYP1A mRNA levels in T. bernacchii collected from the relatively more impacted site indicating the informative potential of the RT-PCR approach. Correlations between biliary metabolites and CYP1A mRNA levels in fish collected from the pristine site were also apparent, particularly with respect to phenanthrene derivatives even though this type of contaminant was present at extremely low levels in reference site fish. Fish from Winter Quarters Bay have enlarged livers and gonads relative to fish from Backdoor Bay as indicated by HSI and GSI. Enlarged livers have been reported previously in fish from other polluted sites, particularly where high levels of chlorinated compounds have been detected (Elskus and Stegeman, 1989), and this may be indicative of altered liver function. Likewise, the enlarged gonads seen in Winter Quarters Bay may be a reflection on their general health. Although T. bernacchii mostly spawn between mid-December and mid-January in McMurdo Sound (Dearborn, 1965), all the fish sampled in this study were reproductively immature and would not have
H.C. Miller et al. / Aquatic Toxicology 44 (1999) 183–193
191
Fig. 4. Correlation between CYP1A induction and biliary FACs. (a) Winter Quarters Bay. (b) Backdoor Bay.
spawned in the season of sampling. This conclusion is supported by the low recorded GSI values (approximately 1–2%) which normally peak at 18 – 19% immediately prior to spawning (Hureau, 1964). The absence of reproductively mature fish possibly reflects the shallow water habitat from which fish were collected. Thus differences in
spawning state between the two populations are unlikely to explain the significant difference in GSI between them. Although the sex steroid estradiol is an inhibitor of CYP1A (Elskus et al., 1992, Larsen et al., 1992), significantly no decrease in CYP1A mRNA was seen in fish with elevated GSI in this study.
192
H.C. Miller et al. / Aquatic Toxicology 44 (1999) 183–193
Previous studies have shown that severe pollution does exist in Winter Quarters Bay. The United States Antarctic Research Program undertook an extensive study of marine pollution in Winter Quarters Bay in response to criticism for contaminating the environment and endangering wildlife, and not applying US environmental laws to waste disposal (Lenihan, 1992). This survey found that an intense contamination gradient of PAHs and PCBs existed in Winter Quarters Bay. In the back of the bay levels of hydrocarbons in sediments were as high as 4500 ppm. This is higher than levels seen in the most polluted harbours in other parts of the world. However, only a relatively small area (approximately 0.5 km2) is heavily polluted since hydrocarbon levels sharply decrease outside the bay and are almost undetectable 1 km away at Cape Armitage (Lenihan et al., 1990). A similar pattern was seen for PCBs, with levels as high as 1400 ppb at the back of the bay, but two orders of magnitude lower 1 km away (Riseborough et al., 1990). It was found that a large amount of anthropogenic debris, such as used machinery, 44-gallon drums and scrap metal littered the sea floor, and a marked change in marine benthic communities was seen along the contamination gradient (Lenihan, 1992). An extensive McMurdo Station clean up program was begun in 1988. Major rubbish dumps were removed and returned to the USA, and dumping along the shoreline no longer occurs. Sewerage and grey water are now discharged at a submerged outfall. The results of the present study show that a significant level of contamination still exists, however, and that it has the potential to cause significantly increased transcription of a prominent toxic response indicator gene. Since hydrocarbon breakdown is slow in Antarctica due to the cold temperatures, the effects of earlier contamination episodes are likely to remain for a considerable period of time.
Acknowledgements We thank the University of Auckland Research Committee for financial support, Kelly Tarlton’s Underwater World (Auckland) for the use of
facilities and equipment, Dr Leon Huynen (University of Auckland) and staff of Antarctica New Zealand for their operational assistance, Bridget Kerr (NIWA) for FACs determinations, James Dickson (University of Auckland) for help with the manuscript, and Jenny Rains (University of Auckland) for technical support. HCM was a Freemasons Scholar and the recipient of an Antarctica New Zealand Science Award.
References Ariese, F., Kok, S.J., Verkaik, M., Gooijer, C., Velthorst, N.H., Hofstraat, J.W., 1993. Synchronous fluorescence spectrometry of fish bile: a rapid screening method for the biomonitoring of PAH exposure. Aquat. Toxicol. 26, 273 – 286. Becker-Andre, M., Hahlbrock, K., 1989. Absolute messenger RNA quantification using the polymerase chain reaction (PCR): a novel approach by PCR aided transcript titration assay (PATTY). Nucleic Acids Res. 17, 9437 – 9446. Bucheli, T.D., Fent, K., 1995. Induction of cytochrome p450 as a biomarker for environmental contamination in aquatic systems. Crit. Rev. Environ. Sci. Technol. 25, 201 – 268. Celi, F.S., Zenilman, M.E., Shuldiner, A.R., 1993. A rapid and versatile method to synthesise internal standards for competitive PCR. Nucleic Acids Res. 21, 1047. Courtenay, S., Grunwald, C., Kreamer, G.-L., Alexander, R., Wirgin, I., 1993. Induction and clearance of cytochrome p4501A1 mRNA in Atlantic tomcod caged in bleached kraft mill effluent in the Miramichi River. Aquat. Toxicol. 27, 225 – 244. Cripps, G.C., Priddle, J., 1991. Hydrocarbons in the Antarctic marine environment. Antarctic Sci. 3, 233 – 250. Dearborn, J.H., 1965. Reproduction in the nototheniid fish Trematomus bernacchii Boulenger at McMurdo Sound, Antarctica. Copeia 1965, 302 – 308. Elskus, A.A., Stegeman, J.J., 1989. Induced cytochrome p450 in Fundulus heteroclitus associated with environmental contamination by polychlorinated biphenyls and polynuclear aromatic hydrocarbons. Mar. Environ. Res. 27, 31 – 50. Elskus, A.A., Pruell, R., Stegeman, J.J., 1992. Endogenouslymediated, pretranslational suppression of cytochrome P4501A in PCB-contaminated flounder. Mar. Environ. Res. 34, 97 – 101. Focardi, S., Fossi, C., Leonzio, C., Di Simplicio, P., 1989. Mixed-function oxidase activity and conjugating enzymes in two species of Antarctic fish. Mar. Environ. Res. 28, 31 – 33. Focardi, S., Fossi, C., Lari, L., Marsili, L., Leonzio, C., Casini, S., 1992. Induction of mixed function oxidase (MFO) system in two species of Antarctic fish from Terra Nova Bay (Ross Sea). Polar Biol. 12, 721 – 725.
H.C. Miller et al. / Aquatic Toxicology 44 (1999) 183–193 Focardi, S., Fossi, M.C., Lari, L., Casini, S., Leonzio, C., Meidel, S.K., Nigro, M., 1995. Induction of MFO activity in the Antarctic fish Pagothenia bernacchii: preliminary results. Mar. Environ. Res. 39, 97–100. George, S.G., Christiansen, J.S., Killie, B., Wright, J., 1995. Dietary crude oil exposure during sexual maturation induces hepatic mixed function oxygenase (CYP1A) activity at very low environmental temperatures in the Polar cod Boreogadus saida. Mar. Ecol. Prog. Ser. 122, 307–312. Gon, O., Heemstra, P.C., 1990. Fishes of the Southern Ocean. JLB Smith Institute of Ichthyology, Grahamstown, Sth. Africa. Haasch, M.L., Prince, R., Wejksnora, P.J., Cooper, K.R., Lech, J.J., 1993. caged and wild fish induction of hepatic cytochrome P-450 CYP1A1 as an environmental biomarker. Environ. Toxicol. Chem. 12, 885–895. Hureau, J.C., 1964. Contribution a` la connaissance de Trematomus bernacchii Boulenger. Biol. Antarct. Actual. Sci. Ind. 1312, 481 – 487. Kennicutt, M.C., McDonald, S.J., Sericano, J.L., Boothe, P., Oliver, J., Safe, S., Presley, B.J., Liu, H., Wolfe, D., Wade, T.L., Crockett, A., Bockus, D., 1995. Human contamination of the marine environment—Arthur Harbour and McMurdo Sound, Antarctica. Environ. Sci. Technol. 29, 1279 – 1287. Krahn, M.M., Myers, M.S., Burrows, D.G., Malins, D.C., 1984. Determination of metabolites of xenobiotics in the bile of fish from polluted waterways. Xenobiotica 14, 633 – 646. Larsen, H.E., Celander, M., Goksoyr, A., 1992. The cytochrome p450 system of Atlantic Salmon (Salmo salar): II. Variations in hepatic catalytic activities and isozyme patterns during an annual reproductive cycle. Fish Physiol. Biochem. 10, 291 – 301. Leaver, M.J., Pirrit, L., George, S.G., 1993. Cytochrome p4501A1 cDNA from plaice (Pleuronectes platessa) and induction of p4501A1 mRNA in various tissues by 3-
methycholanthrene and isosafrole. Mol. Mar. Biol. Biotech. 2, 338 – 345. Lenihan, H.S., 1992. Benthic marine pollution around McMurdo Station, Antarctica: a summary of findings. Mar. Pollut. Bull. 25, 318 – 323. Lenihan, H.S., Oliver, J.S., Oakden, J.M., Stephenson, M.D., 1990. Intense and localised benthic marine pollution around McMurdo Station, Antarctica. Mar. Pollut. Bull. 21, 422 – 430. Lin, E.L.C., Cormier, S.M., Torsella, J.A., 1996. Fish biliary polycyclic aromatic hydrocarbon metabolites estimated by fixed-wavelength fluorescence: comparison with HPLC – fluorescent detection. Ecotoxicol. Environ. Saf. 35, 16 – 23. McDonald, S.J., Kennicutt, M.C., Liu, H., Safe, S.H., 1995. Assessing aromatic hydrocarbon exposure in Antarctic fish captured near Palmer and McMurdo Stations, Antarctica. Arch. Environ. Contam. Toxicol. 29, 232 – 240. Pohl, R.J., Fouts, J.R., 1980. A rapid method for asssaying the metabolism of 7-ethoxyresorufin by microsomal subcellular fractions. Anal. Biochem. 107, 150 – 155. Riseborough, R.W., De Lappe, B.W., Younghans-Haug, C., 1990. PCB and PCT contamination in Winter Quarters Bay, Antarctica. Mar. Pollut. Bull. 21, 523 – 529. Stegeman, J.J., Klotz, A.V., Woodin, B.R., Pajor, A.M., 1981. Induction of hepatic cytochrome p450 in fish and the indication of environmental induction in scup (Stenotomus chrysops). Aquat. Toxicol. 1, 197 – 212. Tsai, S.-J., Wiltbank, M.C., 1996. Quantification of mRNA using competitive RT-PCR with standard-curve methodology. BioTechniques 21, 862 – 866. Vanden Heuvel, J.P., Clark, G.C., Thompson, C.L., McCoy, Z., Miller, C.R., Lucier, G.W., Bell, D.A., 1993. CYP1A1 mRNA levels as a human exposure biomarker: use of quantitative polymerase chain reaction to measure CYP1A1 expression in human peripheral blood lymphocytes. Carcinogenesis 14, 2003 – 2006. Wang, A.M., Doyle, M.V., Mark, D.F., 1989. Quantitation of mRNA by the polymerase chain reaction. Proc. Natl. Acad. Sci. USA 86, 9717 – 9721.
. .
193