- Email: [email protected]
Induction of hepatitis B virus-specific cytotoxic T lymphocytes response in vivo by filamentous phage display vaccine
Vaccine 19 (2001) 2918– 2923 www.elsevier.com/locate/vaccine
Induction of hepatitis B virus-specific cytotoxic T lymphocytes response in vivo by filamentous phage display vaccine Ying Wan *, Yuzhang Wu, Jiang Bian, XiangZhi Wang, Wei Zhou, ZhengCai Jia, Yang Tan, Liyun Zhou The Institute of Immunology, The Third Military Medicine Uni6ersity, 30 Gaotanyan Street, Shapingba District, Chongqing 400038, People’s Republic of China Received 16 May 2000; received in revised form 17 October 2000; accepted 28 November 2000
Abstract The ability of inducing MHC class I restricted cytotoxic T lymphocytes response in vivo via recombinant filamentous phage was investigated. The recombinant filamentous phage particles that displayed the Hepatitis B virus epitope S28 – 39 were injected into BALB/c (H-2d) mice without adjuvants. A MHC class I restricted HBs specific CTL response was found 8 days after injection. The potentiality of using the recombinant filamentous phage as anti-virus vaccine was discussed. © 2001 Elsevier Science Ltd. All rights reserved. Keywords: Cytotoxic T lymphocyte; Filamentous phage; MHC class I
1. Introduction Since it was discovered that the recombinant phage could express peptides on their surface, the system has been widely used in numerous studies [1,2]. It has been shown that the displayed peptides were physically accessible and could elicit immune responses in different animal systems. De la Cruz and Willis reported on antibodies that were specific to B-cell epitopes or mimotopes that could be detected after the phage particles were injected into mice [3,4]. Another report showed that mice immunized with the recombinant phage that displayed a protective B cell epitope of humna respiratory syncytial virus (RSV) acquired a complete resistance to RSV [5]. Also, when maternal mice were immunized with the phage particles displaying recombinant anti-idiotypic Ab fragments, the neonatal mice acquired protection against streptococcal infection [6]. Recently, Manoutcharian et al. reported that a T-cell Abbre6iations: IMDM, Iscove’s modified Dulbecco’s medium; LB, Luria– Bertani; X-gal, 5-bromo-4-chloro-3-indolyl-b-D-galactoside; tet, tetracycline. * Corresponding author. Tel.: +81-23-65421925; fax: +81-2365421925. E-mail address: [email protected] (Y. Wan).
epitope that was predicted by analyzing the Taenia crassiceps protective antigen KETc7 was displayed on the surface of the phage, and the CD4+ and CD8+ T cells isolated from mice immunized with the phage particles induced the production of IFN-g and the absence of IL-4 when specifically stimulated in vitro [7]. The results suggested that the exogenous phage particles may be efficiently processed and presented by MHC class I molecules and elicit CTL responses. For the important role of CTL in anti-virus and anti-cancer, many strategies have been pursued to enable antigen presentation on class I molecules and thereby elicit CTL immunity [8]. However until now, the presentation of soluble exogenous antigens on class I molecules has been shown to vary inefficiently. One way to overcome the obstacle is to attach exogenous antigens to small particles. It has been reported that the present efficiency could be 1000 –10 000-fold higher in the class I pathway if the exogenous antigens were attached to small particles [9]. Some protein complex that physically mimic viral particles had also been found to effectively elicit CTLs such as the hepatitis B surface antigen [10], which assembles into 20 nm particles, the yeast retrotransposon encoded protein Ty, which assembles into virus-like particles (VLP) [11].
0264-410X/01/$ - see front matter © 2001 Elsevier Science Ltd. All rights reserved. PII: S 0 2 6 4 - 4 1 0 X ( 0 0 ) 0 0 5 6 1 - 2
Y. Wan et al. / Vaccine 19 (2001) 2918–2923
Filamentous phage virion is a rod about 6 nm in diameter and 800 –2000 nm long [12]. Some evidence has demonstrated that phage particles could be efficiently internalized into mammalian cells [13]. To our knowledge, however, no study has reported that recombinant filamentous phage elicited CTL responses to specific antigen in vivo. In order to investigate whether a CTL epitope displayed on the surface of recombinant filamentous phage particles could induce a specific CTL response, an MHC class I molecule (H-2d) binding peptide HBs28 – 39, previously reported to be generated by exogeous processing of hepatitis B virus surface anigen [14], was inserted in the phage gVIIIp coat protein using a phagemid vector system. After injection of low doses of the hybrid virus particles into BALB/c (H-2d) mice without adjuvants, the specific CTL response for MHC class I-restricted epitope HBS28 – 39 has been analyzed.
2. Materials and methods
2.1. Stains, cell lines, mice and general techniques The phagmid pC89, which was propagated in Eschericha coli cells, is a gift from Dr F. Felici (Kenton Lab, Centro Ricerche Farmacologia, IRCCS S, Italy). A detailed outline of its construction is presented in F. Felici et al. [15]. E. coli. strains XL1-blue (supE44 hsdR17 recA1 endA1 gyrA46 thi relA1 lac − F%[proAB + lacIq lacZ ZM15 Tn10(tet r) ]) and helper phage VASM13 used in this work is from Stratagene. The H-2d mastocytoma cell line P815 (TIB64) was obtained from American Type Culture Collection (ATCC Rockville, MD). P815/S is a stable transfectant cell line that expressed the S-antigen by the plasmid pcDNA/ HBs in murine cell line P815 (kindly provided by Dr Shuanhu Liu, Xianyan Hospital, Hunan Medical University, China). Female BALB/c mice were obtained from a specific-pathogen-free animal facility of the Third Military Medicine University and were used between 6 and 8 weeks of age. Phage and recombinant DNA techniques were essentially as described by Sambrook et al. [16].
2.2. Construction of phage displaying HBs28 – 39 The phagemid for displaying HBs28 – 39 was constructed by hybridizing oligonucleotide AATTCATACCGCAGAGTCTAGACTCGTGGTGGACTTCTCTG and oligonucleotide GATCCAGAGAAGTCCACCACGAGTCTAGACTCTGCGGTATG and ligating them into phagemid pC89 digested with enzymes EcoRI and BamHI to fuse HBs28 – 39 in frame with the filamentous phage major coat protein pVIII. The com-
2919
petant E. coli. XL1-blue cells were transformed with the ligation mixure. The colonies formed by cells containing the phagemid with the correct insertion were recognized from the intensity of their blue color on X-gal indicator plates. In that configuration, the insert was located between the leader sequence and gene VIII and allowed the display of HBs28 – 39 on the N-terminus of the coat protein pVIII.
2.3. DNA sequencing The nucleotide sequence of the gene VIII inserts from selected clone was verified by single-stranded DNA dideoxy sequencing with the chain-termination method on ABI Prism™377. AmpliTaq DNA polymerase and Forward M13 –40 primer were used.
2.4. Large-scale production of a recombinant phage E. coli XL1-blue transformed by the phagemid with correct insertion was grown at 37°C overnight in 2 ml of LB medium containing 40 mg/ml of tetracycline (LB/tet). This bacterial suspension was added to 1 l of LB supplement (0.2 mg/ml of tet, 1 mM IPTG), and then superinfected with VASM13 helper phage for producing the hybrid phage particles. Following a 10 h incubation period at 24°C, the culture was centrifuged at 10 000×g for 10 min. The infectious phages contained in the supernatant were precipitated at 4°C for 4 h by the addition of 0.15 vol. of a solution containing 20% polyethylene glycol-8000 and 2.5 M NaCl and centrifuged at 15 000× g for 20 min. The phage pellet was resuspended in 3 ml of 100 mM phosphate-buffer saline (PBS), reprecipitated, and then resuspended in 1 ml of PBS.
2.5. Electrophoresis Phage proteins were analyzed on a discontinuous SDS/polyacrylamide gel eletrophoresis system according to Sha¨gger and von Jagow [17] using a concentration 16.5% T and 3% C as separating gels. This corresponds to 18% (w/v) acrylamide and 0.5% (w/v) bis-acrylamide. The major coat proteins were revealed by silver-staining and analyzed by the N-terminal amino acid sequence, as described by R. N. Perham [18].
2.6. Synthetic peptides The synthetic S28 – 39 12 mer peptide [PQSLDSWWTSL] was synthesized according to standard F-moc method [19] in an Applied Biosystems peptide synthesizer model 431A. Purification was carried out by POROS 50 R1 column (PerSeptive Biosystems) on the A8 KTA explorer 100 system. The purity of
2920
Y. Wan et al. / Vaccine 19 (2001) 2918–2923
the peptide was generally \ 90%, as determined by reverse-phase HPLC methods. Peptides were dissolved in a 50% ethnol/10 nM H3PO4 solution at concentrations of 0.2 mg/ml and diluted with culture medium for use.
2.7. Sensitized target cell Target cells P815/S or P815 were then pulsed with HBs28 – 39 12 mer peptide, labeled for 90 min at 37°C with 200 mCi sodium [51Cr] chromate (NEN. Dupont, Boston, MA) in IMDM with 2% FCS, washed three times, and resuspended at the appropriate concentration.
2.8. Immunization of mice On days 0 and 10, Female BALB/c (H-2d) mice (five mice per group) were immunized by intradermal (i.d.) and then boosted once intraperitoneally (i.p.) by hybrid virus particle pC89S4 (10 mg), wild-type phage particle from VASM13 (10 mg), synthetic S28 – 39 12 mer peptide (10 mg) suspended in 0.5 ml of PBS.
2.9. Cytotoxic assay Lymphoid cells from the spleen were aseptically prepared from immunized mice 8 days post-immunization. Cells were suspended in IMEM tissue culture medium (HyClone) supplemented with 25 mM HEPES buffer, 4.0 mM L-glutamine, antibiotics, and 10% (v/v) FCS (HyClone). Responder cells (3×107) were co-cultured with 40 ng of synthetic S28 – 39 12 mer peptide in 10 ml of medium in upright 25 cm2 culture flasks in 5% CO2 at 37°C. Cytotoxic effector populations were harvested after 7 days of in-vitro
culture and washed twice. Serial dilutions of the effector cells were cultured with 1× 104 Cr51-labeled targets in 200 ml V-bottom wells. After 4 h of incubation at 37°C, 100 ml of supernatant were collected for gamma radiation counting. The percentage specific release was calculated as [(experimental release−spontaneous release)/(total release− spontaneous release] × 100. Total counts were measured by incubating target cells with 100 ml of HCl (2 M). Spontaneous released counts were measured always less than 20% of the total counts. Data shown are the mean of triplicate cultures. The S.D. of the triplicate data was always less than 20% of the mean.
3. Results
3.1. Construction of phagemid for displaying HBs28 – 39 The general strategy of imunogen construction is summarized in Fig. 1. After hybridizing two synthetic complementary oligonuleotides, the DNA fragment encoding HBs28 – 39 oligopeptide with the compatible cohesive end was cloned into the EcoRI and BamHI sites of phagemid vector pC89 [15]. Since the EcoRI and BamHI restriction sites of pC89 flank in-frame an amber codon and the cloned DNA fragment substitute the amber codon, the colonies formed by cells containing the plasmid with the correct insertion were recognized from the intensity of their blue color on X-gal indicator plates [15]. The correct clone (pC89S4) was verified by DNA sequencing. The nucleotide sequence of recombinant vector pC89S4 that contained the foreign DNA fragment encoding HBs28 – 39 is shown in Fig. 1.
Fig. 1. Engineering of recombinant filamentous phages displaying the HBs28 – 39. After hybridizing two synthetic complementary oligonuleotides, the DNA fragment encoded HBs28 – 39 oligopeptide with the compatible cohesive end was cloned into the EcoRI and BamHI sites of phagemid vector pC89.
Y. Wan et al. / Vaccine 19 (2001) 2918–2923
2921
one with the same mobility as the wild-type and the other lagging the wild-type (Fig. 2), which was verified by N-terminal amino acid sequence.
3.3. Exogenous hybrid filamentous phage particle induce an effecti6e, MHC class I-restricted CTL response
Fig. 2. SDS– polyacrylamide gel electrophoresis of recombinant filamentous phage particles. Lane 1, recombinant filamentous phage particles whose gene VIII contained the DNA insert encoding the HBs28 – 39 epitope, lane 2, wild-type filamentous phage particles, lane 3 protein markers, with apparent Mr values ×103.
3.2. Displaying the HBs28 – 39 oligopeptide on filamentous phage particles The recombinant phagemid vector pC89S4 was transformed in the host cell XL1-Blue, which directed the synthesis of the modified major coat proteins containing an insertion of the oligopeptide HBs28 – 39 after the third amino acid of the mature wild-type protein and two extra amino acid (EF) encoded by EcoRI site (Fig. 1). Hybrid phage particles were produced by superinfecting the cells with helper phage VASM13, which provided wild-type coat proteins (pVIII) for correct packaging of phage particles. These provide wild-type pVIII that allow packaging of single-stranded phagemid DNA into viable phage particles bearing both wild-type and fusion pVIII. Expression of the fusion protein in hybrid phage particle was examined by SDS –PAGE. There were two coat protein bands,
The recombinant phage particles were precipitated twice with polyethylene glycol, and the 10 mg of hybrid filamentous phage particles (without adjuvants) were immunized H-2d BALB/c twice. The HBs28 – 39-specific CTL response in mice immunized with the hybrid filamentous phage particles was determined by release of 51Cr from target cell P815 pulsed with the synthetic S28 – 39 peptide or P815/S and compared with mice injected synthetic peptide without adjuvants. The specificity of CTL-mediated lysis was determined by using P815 without the synthetic S28 – 39 peptide. Only splenocytes from mice injected the recombinant phages had a measurable Ld-restricted, HBs28 – 39-specific response of CTL (Fig. 3). Immunization of H-2d mice with 10 mg of antigenic HBs28 – 39 peptide and wild-type filamentous phage particles without adjuvants did not trigger a specific CTL response.
4. Discussion Since the first report presented by George P. Smith in 1985 [20], the system has been used extensively to generate and screen large diverse peptide or antibody libraries. It was also found that the filamentous phage was an effective system to present peptides antigen. This was first demonstrated while rabbits and mice were immunized against repeat regions of the Plasmodium falciparum malaria circumsporozoite protein cloned into gIII [19]. Further studies showed that the mice
Fig. 3. In vivo CTL priming by phage particles. Spleen cells from BALB/c mice that had been immunized with (a) the hybrid filamentous phage particles (without adjuvants), (b) wild-type filamentous phage particles, (c) synthesis HBs28 – 39 oligopeptide. The resulting effectors were then tested for lysis of 51Cr-labeled P815 pulsed the HBs28 – 39 oligopeptide ( ), P815/S ( ) or P815 ().
2922
Y. Wan et al. / Vaccine 19 (2001) 2918–2923
immunized with the recombinant phage could acquire protection responses to pathogens [5,6]. In addition, the response was T-cell-dependent and underwent class switching from IgM to IgG [4]. Recently, a predicted T-cell epitope from the T. crassiceps proline-rich protective antigen KETc7 was grafted into immunoglobulin heavy-chain complementarity-determining regions and displayed on the surface of filamentous phage particles. The mice immunized with the phage display vaccine developed a strong cellular immune response and resistance to infection challenging [7]. Since the specific cellular immune response plays a key role in generating effective antitumor or antivirus immune response, it is interesting to investigate whether the CTL epitope displayed on the surface of filamentous phage particles can induce specific CTL responses. To achieve this aim, the DNA fragment encoded HBs28 – 39 oligopeptide was insert into phagemid vector pC89. The correct transformant (pC89S4) was superinfected with VASM13 helper phage and constructed the hybrid filamentous phage particle containing a mutant gpVIII in which the HBs28 – 39 CTL epitope was inserted after the third amino acid of the mature wild-type protein and two extra amino acid (Fig. 1). A number of groups have observed that only relatively short (six to 10 amino acids) inserts can be tolerated on every copy of gpVIII. However, on the phagemid rescue system, the display of the entire single-chain antibodies on gpVIII is good evidence that the length of foreign peptide is not the limitation of the phage display based on gpVIII [21]. In our experiments, the foreign 12-mer oligopeptide does not seem to affect the assembly and stability of filamentous phage particles, although there are one proline and five hydrophobic amino acid in HBs28 – 39. The HBs28 – 39 is a well-characterized epitope with which to study the precession of the exogenous antigen in mice for MHC class I-restricted presentation. It was shown previously that the MHC class I-restricted presentation of the epitope could be elicited by exogenous HBsAg particles in a novel endosomal pathway in vitro or in vivo [10]. The data in this paper also indicated the injection of low doses of the hybrid filamentous phage particle with HBs28 – 39 as a kind of exogenous antigen that could be processed for MHC class I restricted presentation to the CD8+ T cell, and primed a Ld-restricted HBS28 – 39-specific T-cell response in H-2d mice without adjuvants. The ability of phage display vaccine to prime MHC class I restricted immune responses provided an easily manipulatable model to describe the details of procession of exogenous antigen, such as the characters of the amino acid flanking CTL epitope. Although exogenous antigens are generally presented by class II MHC molecules, in some cases, professional antigen processing cells, such as macrophages, dendritic cells [22], mast cells [23] and B cells [24], can process
exogenous antigens through alternative pathways for MHC class I restricted presentation to T cells. This may occur with invasive bacteria (e.g. Listeria monocytogenes) [25], Ags encapsulated in acid-sensitive liposomes [26], Ags expressed in Salmonella and Escherichia coli [27,28], and some antigen particles [29,30]. It has been reported that exogenous multimeric protein particles, 20–80 nm in diameter, like yeast-derived HIV-1 V3:Ty virus like particles [11] or chimeric HIV-1 V3:gag fusion particles [30] could elicit MHC-I-restricted T cell responses more efficiently in different animal species when injected in low doses without adjuvants. The Hybrid filamentous phage particle is a flexible rod about 6 nm in diameter and 800 –2000 nm long (depending on the strain and the length of the phagemid), comprising a sheath of several thousand wild-type gpVIII and several hundred mutations gpVIII around a single-stranded circular DNA molecule at the core [12]. Evidence that some organs, such as the liver and lung, could capture many phages suggested that the asymmetric phage particle could be internalized from the extracellular space by macrophage phagocytosis [31]. Thus, it is possible that filamentous phage particles can be processed by macrophages for presentation by MHC-I molecules. There were various approaches to develop CTL vaccine, such as lipopeptide, recombinant protein expressing T-cell epitope either alone or emulsified in adjuvant, chimeric viruses or bacteria, naked DNA or RNA [8,9]. Comparing with these immunization methods, the recombinant filamentous phage particles have some advantages. First, the production and purification of phage particles is simple and less expansive. Second, no adjuvant is required for its application. Third, the ability to recruit helper T cells [10] and the asymmetry of phage particles are propitious for priming the CTL responses. In conclusion, our results suggest that the filamentous phage-displayed vaccine could be potentially suitable for developing the anti-virus or anti-cancer vaccine.
Acknowledgements We thank Dr Jianping Zhao, Dr. Jianxun Shun and Dr Xing Liu for help in the manuscript preparation. This work has been funded by a National Science Foundation of China Grant (No. 39789010).
References [1] Rodi DJ, Makowski L. Phage-display technology — finding a needle in a vast molecular haystack. Curr Opin Biotechnol 1999;10:87– 93.
Y. Wan et al. / Vaccine 19 (2001) 2918–2923 [2] Zwick MB, Shen J, Scott JK. Phage-displayed peptide libraries. Curr Opin Biotechnol 1998;9:427–36. [3] de la Cruz VF, Lai AA, McCutchan TF. Immunogenicity and epitope mapping of foreign sequences via genetically engineered filamentous phage. J Biol Chem 1988;263:4318–22. [4] Willis AE, Perham RN, Wraith D. Immunological properties of foreign peptides in multiple display on a filamentous bacteriophage. Gene 1993;128:79–83. [5] Bastien N, Trudel M, Simard C. Protective immune responses induced by the immunization of mice with a recombinant bacteriophage displaying an epitope of the human respiratory syncytial virus. Virology 1997;234:118–22. [6] Magliani W, Polonelli L, Conti S, et al. Neonatal mouse immunity against B streptococcal infection by maternal vaccination with recombinant anti-idiotypes. Nat Med 1998;4:705–9. [7] Manoutcharian K, Terrazas LI, Gevorkian G, et al. Phage-displayed T-cell epitope grafted into immunoglobulin heavy-chain complementarity-determining regions: an effective vaccine design tested in murine cysticercosis. Infect Immun 1999;67:4764– 70. [8] Bona CA, Casares S, Brumeanu TD. Towards development of T-cell vaccines. Immunol Today 1998;19:126–32. [9] Raychaudhuri S, Rock KL. Fully mobilizing host defense: building better vaccines. Nat Biotechnol 1998;16:1025–31. [10] Reimann J, Schirmbech R. Alternative pathways for processing exogenous and endogenous anitgens that can generate peptides for MHC class I restricted presentation. Immunol Rev 1999;172:131– 52. [11] Kingsman AJ, Burns NR, Layton GT, Adams SE. Yeast retrotransposon particles as antigen delivery systems. Ann NY Acad Sci 1995;754:202– 13. [12] Marvin DA. Filamentous phage structure, infection and assembly. Curr Opin Struct Biol 1998;8:150–8. [13] Brown KC. New approaches for cell-specific targeting: identification of cell selective peptides from combinatiorial libraries. Curr Opin Chem Biol 2000;4:16–21. [14] Schirmbeck R, Wild J, Reiman J. Similar as well as distinct MHC class I-binding peptides are generated by exogenous and endogenous processing of hepatitis B virus surface antigen. Eur J Immunol 1998;28:4149–61. [15] Felici F, Castagnoli L, Musacchio A, Jappelli R, Cesareni G. Selection of antibody ligands from a large library of oligopeptides expressed on a multivalent exposition vector. J Mol Biol 1991;222:301– 10. [16] Sambrook J, Fritsch EF, Maniatis T, editors. Molecular cloning: a laboratory manual, second ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 1989. [17] Scha¨gger H, von Jagow G. Tricine–sodium dodecyl sulfate– polyacrylamide gel electrophoresis for the separationof proteins in the range from 1 to 100 kDa. Anal Biochem 1987;166:368– 79. [18] Greenwood J, Willis AE, Perham RN. Multiple display of forgein peptides on a filamentous bacteriophage. Peptides from
.
[19]
[20]
[21]
[22]
[23]
[24]
[25]
[26]
[27]
[28]
[29]
[30]
[31]
2923
Plasmodium falciparum circumsporozoite protein as antigens. J Mol Biol 1991;220:821– 7. Ruppert J, Sidney J, Celis E, Kubo RT, Grey HM, Sette A. Prominent role of secondary anchor residues in peptide binding to HLA-A2.1 molecules. Cell 1993;74:929– 37. Smith GP. Filamentous fusion phage: novel expression vectors that display cloned antigens on the virion surface. Science 1985;228:1315– 7. Nakayama GR, Valkirs G, McGrath D, Huse WD. Improving the copy numbers of antibody fragments expressed on the major coat protein of bacteriophage M13. Immunotechnology 1996;2:197– 207. Bachmann MF, Lutz MB, Layton GT, Harris SJ, Fehr T, Rescigno M, Ricciardi-Castagnoli P. Dendritic cells process exogenous viral proteins and virus-like particles for class I presentation to CD8 + cytotoxic T lymphocytes. Eur J Immunol 1996;26:2595– 600. Malaviya R, Twesten NJ, Ross EA, Abraham SN, Pfeifer JD. Mast cells process bacterial Ags through a phagocytic route for class I MHC presentation to T cells. J Immunol 1996;156:1490– 6. Ke Y, Kapp JA. Exogenous antigens gain access to the major histocompatibility complex class I processing pathway in B cells by receptor-mediated uptake. J Exp Med 1996;184:1179–84. Darji A, Chakraborty T, Wehland J, Weiss S. Listeriolysin generates a route for the presentation of exogenous antigens by major histocompatibility complex class I. Eur J Immunol 1995;25:2967– 71. Zhou F, Huang L. Delivery of protein antigen to the major histocompatibility complex class I-restricted antigen presentation pathway. J Drug Target 1995;3:91– 109. Lo WF, Ong H, Metcalf ES, Soloski MJ. T cell responses to Gram-negative intracellular bacterial pathogens: a role for CD8+ T cells in immunity to Salmonella infection and the involvement of MHC class Ib molecules. J Immunol 1999;162:5398– 406. Pfeifer JD, Wick MJ, Roberts RL, Findlay K, Normark SJ, Harding CV. Phagocytic processing of bacterial antigens for class I MHC presentation to T cells. Nature 1993;361:359–62. Lo Man R, Rueda P, Sedlik C, Deriaud E, Casal I, Leclerc C. A recombinant virus-like particle system derived from parvovirus as an efficient antigen carrier to elicit a polarized Th1 immune response without adjuvant. Eur J Immunol 1998;28:1401–7. Grifliths JC, Harris SJ, Layton GT, Berrie EL, French NRB, Adams SE, Kingsman AJ. Hybrid human immunodeficiency virus Gag particles as an antigen carrier system: induction of cytotoxic T-cell and humoral responses by a Gag:V3 fusion. J Virol 1993;67:3191– 8. Pasqualini R, Ruoslahti E. Organ targeting in vivo using phage display peptide libraries. Nature 1996;380:364– 6.
Induction of hepatitis B virus-specific cytotoxic T lymphocytes response in vivo by filamentous phage display vaccine Ying Wan *, Yuzhang Wu, Jiang Bian, XiangZhi Wang, Wei Zhou, ZhengCai Jia, Yang Tan, Liyun Zhou The Institute of Immunology, The Third Military Medicine Uni6ersity, 30 Gaotanyan Street, Shapingba District, Chongqing 400038, People’s Republic of China Received 16 May 2000; received in revised form 17 October 2000; accepted 28 November 2000
Abstract The ability of inducing MHC class I restricted cytotoxic T lymphocytes response in vivo via recombinant filamentous phage was investigated. The recombinant filamentous phage particles that displayed the Hepatitis B virus epitope S28 – 39 were injected into BALB/c (H-2d) mice without adjuvants. A MHC class I restricted HBs specific CTL response was found 8 days after injection. The potentiality of using the recombinant filamentous phage as anti-virus vaccine was discussed. © 2001 Elsevier Science Ltd. All rights reserved. Keywords: Cytotoxic T lymphocyte; Filamentous phage; MHC class I
1. Introduction Since it was discovered that the recombinant phage could express peptides on their surface, the system has been widely used in numerous studies [1,2]. It has been shown that the displayed peptides were physically accessible and could elicit immune responses in different animal systems. De la Cruz and Willis reported on antibodies that were specific to B-cell epitopes or mimotopes that could be detected after the phage particles were injected into mice [3,4]. Another report showed that mice immunized with the recombinant phage that displayed a protective B cell epitope of humna respiratory syncytial virus (RSV) acquired a complete resistance to RSV [5]. Also, when maternal mice were immunized with the phage particles displaying recombinant anti-idiotypic Ab fragments, the neonatal mice acquired protection against streptococcal infection [6]. Recently, Manoutcharian et al. reported that a T-cell Abbre6iations: IMDM, Iscove’s modified Dulbecco’s medium; LB, Luria– Bertani; X-gal, 5-bromo-4-chloro-3-indolyl-b-D-galactoside; tet, tetracycline. * Corresponding author. Tel.: +81-23-65421925; fax: +81-2365421925. E-mail address: [email protected] (Y. Wan).
epitope that was predicted by analyzing the Taenia crassiceps protective antigen KETc7 was displayed on the surface of the phage, and the CD4+ and CD8+ T cells isolated from mice immunized with the phage particles induced the production of IFN-g and the absence of IL-4 when specifically stimulated in vitro [7]. The results suggested that the exogenous phage particles may be efficiently processed and presented by MHC class I molecules and elicit CTL responses. For the important role of CTL in anti-virus and anti-cancer, many strategies have been pursued to enable antigen presentation on class I molecules and thereby elicit CTL immunity [8]. However until now, the presentation of soluble exogenous antigens on class I molecules has been shown to vary inefficiently. One way to overcome the obstacle is to attach exogenous antigens to small particles. It has been reported that the present efficiency could be 1000 –10 000-fold higher in the class I pathway if the exogenous antigens were attached to small particles [9]. Some protein complex that physically mimic viral particles had also been found to effectively elicit CTLs such as the hepatitis B surface antigen [10], which assembles into 20 nm particles, the yeast retrotransposon encoded protein Ty, which assembles into virus-like particles (VLP) [11].
0264-410X/01/$ - see front matter © 2001 Elsevier Science Ltd. All rights reserved. PII: S 0 2 6 4 - 4 1 0 X ( 0 0 ) 0 0 5 6 1 - 2
Y. Wan et al. / Vaccine 19 (2001) 2918–2923
Filamentous phage virion is a rod about 6 nm in diameter and 800 –2000 nm long [12]. Some evidence has demonstrated that phage particles could be efficiently internalized into mammalian cells [13]. To our knowledge, however, no study has reported that recombinant filamentous phage elicited CTL responses to specific antigen in vivo. In order to investigate whether a CTL epitope displayed on the surface of recombinant filamentous phage particles could induce a specific CTL response, an MHC class I molecule (H-2d) binding peptide HBs28 – 39, previously reported to be generated by exogeous processing of hepatitis B virus surface anigen [14], was inserted in the phage gVIIIp coat protein using a phagemid vector system. After injection of low doses of the hybrid virus particles into BALB/c (H-2d) mice without adjuvants, the specific CTL response for MHC class I-restricted epitope HBS28 – 39 has been analyzed.
2. Materials and methods
2.1. Stains, cell lines, mice and general techniques The phagmid pC89, which was propagated in Eschericha coli cells, is a gift from Dr F. Felici (Kenton Lab, Centro Ricerche Farmacologia, IRCCS S, Italy). A detailed outline of its construction is presented in F. Felici et al. [15]. E. coli. strains XL1-blue (supE44 hsdR17 recA1 endA1 gyrA46 thi relA1 lac − F%[proAB + lacIq lacZ ZM15 Tn10(tet r) ]) and helper phage VASM13 used in this work is from Stratagene. The H-2d mastocytoma cell line P815 (TIB64) was obtained from American Type Culture Collection (ATCC Rockville, MD). P815/S is a stable transfectant cell line that expressed the S-antigen by the plasmid pcDNA/ HBs in murine cell line P815 (kindly provided by Dr Shuanhu Liu, Xianyan Hospital, Hunan Medical University, China). Female BALB/c mice were obtained from a specific-pathogen-free animal facility of the Third Military Medicine University and were used between 6 and 8 weeks of age. Phage and recombinant DNA techniques were essentially as described by Sambrook et al. [16].
2.2. Construction of phage displaying HBs28 – 39 The phagemid for displaying HBs28 – 39 was constructed by hybridizing oligonucleotide AATTCATACCGCAGAGTCTAGACTCGTGGTGGACTTCTCTG and oligonucleotide GATCCAGAGAAGTCCACCACGAGTCTAGACTCTGCGGTATG and ligating them into phagemid pC89 digested with enzymes EcoRI and BamHI to fuse HBs28 – 39 in frame with the filamentous phage major coat protein pVIII. The com-
2919
petant E. coli. XL1-blue cells were transformed with the ligation mixure. The colonies formed by cells containing the phagemid with the correct insertion were recognized from the intensity of their blue color on X-gal indicator plates. In that configuration, the insert was located between the leader sequence and gene VIII and allowed the display of HBs28 – 39 on the N-terminus of the coat protein pVIII.
2.3. DNA sequencing The nucleotide sequence of the gene VIII inserts from selected clone was verified by single-stranded DNA dideoxy sequencing with the chain-termination method on ABI Prism™377. AmpliTaq DNA polymerase and Forward M13 –40 primer were used.
2.4. Large-scale production of a recombinant phage E. coli XL1-blue transformed by the phagemid with correct insertion was grown at 37°C overnight in 2 ml of LB medium containing 40 mg/ml of tetracycline (LB/tet). This bacterial suspension was added to 1 l of LB supplement (0.2 mg/ml of tet, 1 mM IPTG), and then superinfected with VASM13 helper phage for producing the hybrid phage particles. Following a 10 h incubation period at 24°C, the culture was centrifuged at 10 000×g for 10 min. The infectious phages contained in the supernatant were precipitated at 4°C for 4 h by the addition of 0.15 vol. of a solution containing 20% polyethylene glycol-8000 and 2.5 M NaCl and centrifuged at 15 000× g for 20 min. The phage pellet was resuspended in 3 ml of 100 mM phosphate-buffer saline (PBS), reprecipitated, and then resuspended in 1 ml of PBS.
2.5. Electrophoresis Phage proteins were analyzed on a discontinuous SDS/polyacrylamide gel eletrophoresis system according to Sha¨gger and von Jagow [17] using a concentration 16.5% T and 3% C as separating gels. This corresponds to 18% (w/v) acrylamide and 0.5% (w/v) bis-acrylamide. The major coat proteins were revealed by silver-staining and analyzed by the N-terminal amino acid sequence, as described by R. N. Perham [18].
2.6. Synthetic peptides The synthetic S28 – 39 12 mer peptide [PQSLDSWWTSL] was synthesized according to standard F-moc method [19] in an Applied Biosystems peptide synthesizer model 431A. Purification was carried out by POROS 50 R1 column (PerSeptive Biosystems) on the A8 KTA explorer 100 system. The purity of
2920
Y. Wan et al. / Vaccine 19 (2001) 2918–2923
the peptide was generally \ 90%, as determined by reverse-phase HPLC methods. Peptides were dissolved in a 50% ethnol/10 nM H3PO4 solution at concentrations of 0.2 mg/ml and diluted with culture medium for use.
2.7. Sensitized target cell Target cells P815/S or P815 were then pulsed with HBs28 – 39 12 mer peptide, labeled for 90 min at 37°C with 200 mCi sodium [51Cr] chromate (NEN. Dupont, Boston, MA) in IMDM with 2% FCS, washed three times, and resuspended at the appropriate concentration.
2.8. Immunization of mice On days 0 and 10, Female BALB/c (H-2d) mice (five mice per group) were immunized by intradermal (i.d.) and then boosted once intraperitoneally (i.p.) by hybrid virus particle pC89S4 (10 mg), wild-type phage particle from VASM13 (10 mg), synthetic S28 – 39 12 mer peptide (10 mg) suspended in 0.5 ml of PBS.
2.9. Cytotoxic assay Lymphoid cells from the spleen were aseptically prepared from immunized mice 8 days post-immunization. Cells were suspended in IMEM tissue culture medium (HyClone) supplemented with 25 mM HEPES buffer, 4.0 mM L-glutamine, antibiotics, and 10% (v/v) FCS (HyClone). Responder cells (3×107) were co-cultured with 40 ng of synthetic S28 – 39 12 mer peptide in 10 ml of medium in upright 25 cm2 culture flasks in 5% CO2 at 37°C. Cytotoxic effector populations were harvested after 7 days of in-vitro
culture and washed twice. Serial dilutions of the effector cells were cultured with 1× 104 Cr51-labeled targets in 200 ml V-bottom wells. After 4 h of incubation at 37°C, 100 ml of supernatant were collected for gamma radiation counting. The percentage specific release was calculated as [(experimental release−spontaneous release)/(total release− spontaneous release] × 100. Total counts were measured by incubating target cells with 100 ml of HCl (2 M). Spontaneous released counts were measured always less than 20% of the total counts. Data shown are the mean of triplicate cultures. The S.D. of the triplicate data was always less than 20% of the mean.
3. Results
3.1. Construction of phagemid for displaying HBs28 – 39 The general strategy of imunogen construction is summarized in Fig. 1. After hybridizing two synthetic complementary oligonuleotides, the DNA fragment encoding HBs28 – 39 oligopeptide with the compatible cohesive end was cloned into the EcoRI and BamHI sites of phagemid vector pC89 [15]. Since the EcoRI and BamHI restriction sites of pC89 flank in-frame an amber codon and the cloned DNA fragment substitute the amber codon, the colonies formed by cells containing the plasmid with the correct insertion were recognized from the intensity of their blue color on X-gal indicator plates [15]. The correct clone (pC89S4) was verified by DNA sequencing. The nucleotide sequence of recombinant vector pC89S4 that contained the foreign DNA fragment encoding HBs28 – 39 is shown in Fig. 1.
Fig. 1. Engineering of recombinant filamentous phages displaying the HBs28 – 39. After hybridizing two synthetic complementary oligonuleotides, the DNA fragment encoded HBs28 – 39 oligopeptide with the compatible cohesive end was cloned into the EcoRI and BamHI sites of phagemid vector pC89.
Y. Wan et al. / Vaccine 19 (2001) 2918–2923
2921
one with the same mobility as the wild-type and the other lagging the wild-type (Fig. 2), which was verified by N-terminal amino acid sequence.
3.3. Exogenous hybrid filamentous phage particle induce an effecti6e, MHC class I-restricted CTL response
Fig. 2. SDS– polyacrylamide gel electrophoresis of recombinant filamentous phage particles. Lane 1, recombinant filamentous phage particles whose gene VIII contained the DNA insert encoding the HBs28 – 39 epitope, lane 2, wild-type filamentous phage particles, lane 3 protein markers, with apparent Mr values ×103.
3.2. Displaying the HBs28 – 39 oligopeptide on filamentous phage particles The recombinant phagemid vector pC89S4 was transformed in the host cell XL1-Blue, which directed the synthesis of the modified major coat proteins containing an insertion of the oligopeptide HBs28 – 39 after the third amino acid of the mature wild-type protein and two extra amino acid (EF) encoded by EcoRI site (Fig. 1). Hybrid phage particles were produced by superinfecting the cells with helper phage VASM13, which provided wild-type coat proteins (pVIII) for correct packaging of phage particles. These provide wild-type pVIII that allow packaging of single-stranded phagemid DNA into viable phage particles bearing both wild-type and fusion pVIII. Expression of the fusion protein in hybrid phage particle was examined by SDS –PAGE. There were two coat protein bands,
The recombinant phage particles were precipitated twice with polyethylene glycol, and the 10 mg of hybrid filamentous phage particles (without adjuvants) were immunized H-2d BALB/c twice. The HBs28 – 39-specific CTL response in mice immunized with the hybrid filamentous phage particles was determined by release of 51Cr from target cell P815 pulsed with the synthetic S28 – 39 peptide or P815/S and compared with mice injected synthetic peptide without adjuvants. The specificity of CTL-mediated lysis was determined by using P815 without the synthetic S28 – 39 peptide. Only splenocytes from mice injected the recombinant phages had a measurable Ld-restricted, HBs28 – 39-specific response of CTL (Fig. 3). Immunization of H-2d mice with 10 mg of antigenic HBs28 – 39 peptide and wild-type filamentous phage particles without adjuvants did not trigger a specific CTL response.
4. Discussion Since the first report presented by George P. Smith in 1985 [20], the system has been used extensively to generate and screen large diverse peptide or antibody libraries. It was also found that the filamentous phage was an effective system to present peptides antigen. This was first demonstrated while rabbits and mice were immunized against repeat regions of the Plasmodium falciparum malaria circumsporozoite protein cloned into gIII [19]. Further studies showed that the mice
Fig. 3. In vivo CTL priming by phage particles. Spleen cells from BALB/c mice that had been immunized with (a) the hybrid filamentous phage particles (without adjuvants), (b) wild-type filamentous phage particles, (c) synthesis HBs28 – 39 oligopeptide. The resulting effectors were then tested for lysis of 51Cr-labeled P815 pulsed the HBs28 – 39 oligopeptide ( ), P815/S ( ) or P815 ().
2922
Y. Wan et al. / Vaccine 19 (2001) 2918–2923
immunized with the recombinant phage could acquire protection responses to pathogens [5,6]. In addition, the response was T-cell-dependent and underwent class switching from IgM to IgG [4]. Recently, a predicted T-cell epitope from the T. crassiceps proline-rich protective antigen KETc7 was grafted into immunoglobulin heavy-chain complementarity-determining regions and displayed on the surface of filamentous phage particles. The mice immunized with the phage display vaccine developed a strong cellular immune response and resistance to infection challenging [7]. Since the specific cellular immune response plays a key role in generating effective antitumor or antivirus immune response, it is interesting to investigate whether the CTL epitope displayed on the surface of filamentous phage particles can induce specific CTL responses. To achieve this aim, the DNA fragment encoded HBs28 – 39 oligopeptide was insert into phagemid vector pC89. The correct transformant (pC89S4) was superinfected with VASM13 helper phage and constructed the hybrid filamentous phage particle containing a mutant gpVIII in which the HBs28 – 39 CTL epitope was inserted after the third amino acid of the mature wild-type protein and two extra amino acid (Fig. 1). A number of groups have observed that only relatively short (six to 10 amino acids) inserts can be tolerated on every copy of gpVIII. However, on the phagemid rescue system, the display of the entire single-chain antibodies on gpVIII is good evidence that the length of foreign peptide is not the limitation of the phage display based on gpVIII [21]. In our experiments, the foreign 12-mer oligopeptide does not seem to affect the assembly and stability of filamentous phage particles, although there are one proline and five hydrophobic amino acid in HBs28 – 39. The HBs28 – 39 is a well-characterized epitope with which to study the precession of the exogenous antigen in mice for MHC class I-restricted presentation. It was shown previously that the MHC class I-restricted presentation of the epitope could be elicited by exogenous HBsAg particles in a novel endosomal pathway in vitro or in vivo [10]. The data in this paper also indicated the injection of low doses of the hybrid filamentous phage particle with HBs28 – 39 as a kind of exogenous antigen that could be processed for MHC class I restricted presentation to the CD8+ T cell, and primed a Ld-restricted HBS28 – 39-specific T-cell response in H-2d mice without adjuvants. The ability of phage display vaccine to prime MHC class I restricted immune responses provided an easily manipulatable model to describe the details of procession of exogenous antigen, such as the characters of the amino acid flanking CTL epitope. Although exogenous antigens are generally presented by class II MHC molecules, in some cases, professional antigen processing cells, such as macrophages, dendritic cells [22], mast cells [23] and B cells [24], can process
exogenous antigens through alternative pathways for MHC class I restricted presentation to T cells. This may occur with invasive bacteria (e.g. Listeria monocytogenes) [25], Ags encapsulated in acid-sensitive liposomes [26], Ags expressed in Salmonella and Escherichia coli [27,28], and some antigen particles [29,30]. It has been reported that exogenous multimeric protein particles, 20–80 nm in diameter, like yeast-derived HIV-1 V3:Ty virus like particles [11] or chimeric HIV-1 V3:gag fusion particles [30] could elicit MHC-I-restricted T cell responses more efficiently in different animal species when injected in low doses without adjuvants. The Hybrid filamentous phage particle is a flexible rod about 6 nm in diameter and 800 –2000 nm long (depending on the strain and the length of the phagemid), comprising a sheath of several thousand wild-type gpVIII and several hundred mutations gpVIII around a single-stranded circular DNA molecule at the core [12]. Evidence that some organs, such as the liver and lung, could capture many phages suggested that the asymmetric phage particle could be internalized from the extracellular space by macrophage phagocytosis [31]. Thus, it is possible that filamentous phage particles can be processed by macrophages for presentation by MHC-I molecules. There were various approaches to develop CTL vaccine, such as lipopeptide, recombinant protein expressing T-cell epitope either alone or emulsified in adjuvant, chimeric viruses or bacteria, naked DNA or RNA [8,9]. Comparing with these immunization methods, the recombinant filamentous phage particles have some advantages. First, the production and purification of phage particles is simple and less expansive. Second, no adjuvant is required for its application. Third, the ability to recruit helper T cells [10] and the asymmetry of phage particles are propitious for priming the CTL responses. In conclusion, our results suggest that the filamentous phage-displayed vaccine could be potentially suitable for developing the anti-virus or anti-cancer vaccine.
Acknowledgements We thank Dr Jianping Zhao, Dr. Jianxun Shun and Dr Xing Liu for help in the manuscript preparation. This work has been funded by a National Science Foundation of China Grant (No. 39789010).
References [1] Rodi DJ, Makowski L. Phage-display technology — finding a needle in a vast molecular haystack. Curr Opin Biotechnol 1999;10:87– 93.
Y. Wan et al. / Vaccine 19 (2001) 2918–2923 [2] Zwick MB, Shen J, Scott JK. Phage-displayed peptide libraries. Curr Opin Biotechnol 1998;9:427–36. [3] de la Cruz VF, Lai AA, McCutchan TF. Immunogenicity and epitope mapping of foreign sequences via genetically engineered filamentous phage. J Biol Chem 1988;263:4318–22. [4] Willis AE, Perham RN, Wraith D. Immunological properties of foreign peptides in multiple display on a filamentous bacteriophage. Gene 1993;128:79–83. [5] Bastien N, Trudel M, Simard C. Protective immune responses induced by the immunization of mice with a recombinant bacteriophage displaying an epitope of the human respiratory syncytial virus. Virology 1997;234:118–22. [6] Magliani W, Polonelli L, Conti S, et al. Neonatal mouse immunity against B streptococcal infection by maternal vaccination with recombinant anti-idiotypes. Nat Med 1998;4:705–9. [7] Manoutcharian K, Terrazas LI, Gevorkian G, et al. Phage-displayed T-cell epitope grafted into immunoglobulin heavy-chain complementarity-determining regions: an effective vaccine design tested in murine cysticercosis. Infect Immun 1999;67:4764– 70. [8] Bona CA, Casares S, Brumeanu TD. Towards development of T-cell vaccines. Immunol Today 1998;19:126–32. [9] Raychaudhuri S, Rock KL. Fully mobilizing host defense: building better vaccines. Nat Biotechnol 1998;16:1025–31. [10] Reimann J, Schirmbech R. Alternative pathways for processing exogenous and endogenous anitgens that can generate peptides for MHC class I restricted presentation. Immunol Rev 1999;172:131– 52. [11] Kingsman AJ, Burns NR, Layton GT, Adams SE. Yeast retrotransposon particles as antigen delivery systems. Ann NY Acad Sci 1995;754:202– 13. [12] Marvin DA. Filamentous phage structure, infection and assembly. Curr Opin Struct Biol 1998;8:150–8. [13] Brown KC. New approaches for cell-specific targeting: identification of cell selective peptides from combinatiorial libraries. Curr Opin Chem Biol 2000;4:16–21. [14] Schirmbeck R, Wild J, Reiman J. Similar as well as distinct MHC class I-binding peptides are generated by exogenous and endogenous processing of hepatitis B virus surface antigen. Eur J Immunol 1998;28:4149–61. [15] Felici F, Castagnoli L, Musacchio A, Jappelli R, Cesareni G. Selection of antibody ligands from a large library of oligopeptides expressed on a multivalent exposition vector. J Mol Biol 1991;222:301– 10. [16] Sambrook J, Fritsch EF, Maniatis T, editors. Molecular cloning: a laboratory manual, second ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 1989. [17] Scha¨gger H, von Jagow G. Tricine–sodium dodecyl sulfate– polyacrylamide gel electrophoresis for the separationof proteins in the range from 1 to 100 kDa. Anal Biochem 1987;166:368– 79. [18] Greenwood J, Willis AE, Perham RN. Multiple display of forgein peptides on a filamentous bacteriophage. Peptides from
.
[19]
[20]
[21]
[22]
[23]
[24]
[25]
[26]
[27]
[28]
[29]
[30]
[31]
2923
Plasmodium falciparum circumsporozoite protein as antigens. J Mol Biol 1991;220:821– 7. Ruppert J, Sidney J, Celis E, Kubo RT, Grey HM, Sette A. Prominent role of secondary anchor residues in peptide binding to HLA-A2.1 molecules. Cell 1993;74:929– 37. Smith GP. Filamentous fusion phage: novel expression vectors that display cloned antigens on the virion surface. Science 1985;228:1315– 7. Nakayama GR, Valkirs G, McGrath D, Huse WD. Improving the copy numbers of antibody fragments expressed on the major coat protein of bacteriophage M13. Immunotechnology 1996;2:197– 207. Bachmann MF, Lutz MB, Layton GT, Harris SJ, Fehr T, Rescigno M, Ricciardi-Castagnoli P. Dendritic cells process exogenous viral proteins and virus-like particles for class I presentation to CD8 + cytotoxic T lymphocytes. Eur J Immunol 1996;26:2595– 600. Malaviya R, Twesten NJ, Ross EA, Abraham SN, Pfeifer JD. Mast cells process bacterial Ags through a phagocytic route for class I MHC presentation to T cells. J Immunol 1996;156:1490– 6. Ke Y, Kapp JA. Exogenous antigens gain access to the major histocompatibility complex class I processing pathway in B cells by receptor-mediated uptake. J Exp Med 1996;184:1179–84. Darji A, Chakraborty T, Wehland J, Weiss S. Listeriolysin generates a route for the presentation of exogenous antigens by major histocompatibility complex class I. Eur J Immunol 1995;25:2967– 71. Zhou F, Huang L. Delivery of protein antigen to the major histocompatibility complex class I-restricted antigen presentation pathway. J Drug Target 1995;3:91– 109. Lo WF, Ong H, Metcalf ES, Soloski MJ. T cell responses to Gram-negative intracellular bacterial pathogens: a role for CD8+ T cells in immunity to Salmonella infection and the involvement of MHC class Ib molecules. J Immunol 1999;162:5398– 406. Pfeifer JD, Wick MJ, Roberts RL, Findlay K, Normark SJ, Harding CV. Phagocytic processing of bacterial antigens for class I MHC presentation to T cells. Nature 1993;361:359–62. Lo Man R, Rueda P, Sedlik C, Deriaud E, Casal I, Leclerc C. A recombinant virus-like particle system derived from parvovirus as an efficient antigen carrier to elicit a polarized Th1 immune response without adjuvant. Eur J Immunol 1998;28:1401–7. Grifliths JC, Harris SJ, Layton GT, Berrie EL, French NRB, Adams SE, Kingsman AJ. Hybrid human immunodeficiency virus Gag particles as an antigen carrier system: induction of cytotoxic T-cell and humoral responses by a Gag:V3 fusion. J Virol 1993;67:3191– 8. Pasqualini R, Ruoslahti E. Organ targeting in vivo using phage display peptide libraries. Nature 1996;380:364– 6.