- Email: [email protected]
Induction of oxidative stress and apoptosis by silver nanoparticles in the liver of adult zebrafish
Aquatic Toxicology 100 (2010) 151–159
Contents lists available at ScienceDirect
Aquatic Toxicology journal homepage: www.elsevier.com/locate/aquatox
Induction of oxidative stress and apoptosis by silver nanoparticles in the liver of adult zebrafish Ji Eun Choi a , Soohee Kim a , Jin Hee Ahn a , Pilju Youn a , Jin Seok Kang b , Kwangsik Park c , Jongheop Yi d , Doug-Young Ryu a,∗ a
College of Veterinary Medicine, Seoul National University, 599 Gwanak, Gwanak, Seoul, 151-742, Republic of Korea Department of Biomedical Laboratory Science, Namseoul University, Cheonan, 330-707, Republic of Korea College of Pharmacy, Dongduk Women’s University, Seoul, 136-714, Republic of Korea d College of Engineering, Seoul National University, Seoul, 151-742, Republic of Korea b c
a r t i c l e
i n f o
Article history: Received 19 August 2009 Received in revised form 2 December 2009 Accepted 12 December 2009 Keywords: Ag Nanoparticle Zebrafish Liver Oxidative stress Apoptosis
a b s t r a c t Silver nanoparticles (AgNPs) may induce deleterious effects in aquatic life on environmental release. The hepatotoxicity of AgNPs was assessed in the liver of adult zebrafish, with the aim of studying the roles of oxidative damage and apoptosis. Zebrafish were exposed to an AgNP solution in which free Ag+ ions were absent at the time of treatment. However, the metal-sensitive metallothionein 2 (MT2) mRNA was induced in the liver tissues of AgNP-treated zebrafish, suggesting that Ag+ ions were released from AgNPs after treatment. It is also possible that MT2 mRNA was induced in the liver tissues by AgNP-generated free radicals. A number of cellular alterations including disruption of hepatic cell cords and apoptotic changes were observed in histological analysis of the liver tissues. The levels of malondialdehyde, a byproduct of cellular lipid peroxidation, and total glutathione were increased in the tissues after treatment with AgNPs. The mRNA levels of the oxyradical-scavenging enzymes catalase and glutathione peroxidase 1a were reduced in the tissues. AgNP treatment induced DNA damage, as demonstrated by analysis with the double-strand break marker ␥-H2AX and the expression of p53 protein in liver tissues. In addition, the p53-related pro-apoptotic genes Bax, Noxa, and p21 were upregulated after treatment with AgNPs. These data suggest that oxidative stress and apoptosis are associated with AgNP toxicity in the liver of adult zebrafish. © 2009 Elsevier B.V. All rights reserved.
1. Introduction Nanoparticles (NPs) have at least one dimension of 100 nm or less and represent an intermediate supramolecular state of matter between bulk and molecular material (Maynard and Kuempel, 2005). NPs are used to produce novel materials with unique physicochemical properties, which become an environmental concern in the event of unintended release into the environment. NPs may induce deleterious effects in aquatic systems as well as in aquatic life. The small size, chemical composition, surface structure, solubility, shape, agglomeration, and aggregation of these particles may be associated with NP-induced toxicity (Nel et al., 2006; Skebo et al., 2007; Wallace et al., 2007). Nonspecific oxidative stress has been suggested as one of the greatest concerns in NP-induced toxicity (Nel et al., 2006). A variety of toxic changes has been observed in NP-exposed fish and embryos, including oxidative stress-related
∗ Corresponding author. Tel.: +82 2 880 1253; fax: +82 2 878 2360. E-mail address: [email protected] (D.-Y. Ryu). 0166-445X/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.aquatox.2009.12.012
changes such as lipid oxidation, apoptosis, and changes in gene expression (Oberdörster, 2004; Oberdörster et al., 2006; Smith et al., 2007; Usenko et al., 2007; Zhu et al., 2006). Silver (Ag) has received much attention because of its toxicity at low ionic concentrations. The most common oxidation state of Ag is +1; in addition, +2 compounds and the less-common +3 compounds are also known. The antibacterial activity exhibited by Ag has led to the widespread use of AgNPs in many commercial products, such as shampoo, food packaging, odor resistant textiles, kitchen utensils, water filters, household appliances, and medical devices (Cohen et al., 2007; Sondi and Salopek-Sondi, 2004; Yon and Lead, 2008). AgNP-induced toxicity has been frequently studied in fish embryos. A concentration-dependent increase in mortality and delayed hatching has been observed in embryos treated with AgNP. The 72-h and 120-h LC50 s of AgNPs in zebrafish embryos range from 25–50 mg Ag/L (Asharani et al., 2008) to 10–15 mg Ag/L (Bar-Ilan et al., 2009), respectively. AgNPs have been observed in the brain, testis, liver, and blood of medaka embryos (Kashiwada, 2006). In zebrafish embryos, AgNP treatment induces circulatory and morphological abnormalities (Asharani et al., 2008; Bar-Ilan et al., 2009; Lee et al., 2007). Apoptotic changes have
152
J.E. Choi et al. / Aquatic Toxicology 100 (2010) 151–159
been detected in AgNP-treated zebrafish embryos (Asharani et al., 2008). AgNPs are also acutely lethal to adult zebrafish, with an LC50 of 7.07 mg Ag/L (Griffitt et al., 2008). However, few studies have examined organ-specific AgNP-induced toxicity in adult fish. AgNPs release Ag+ ions in the presence of water (Santoro et al., 2007). Thus, it is necessary to distinguish between the toxic effects of AgNPs and those of dissolved Ag+ ions. For this purpose, AgNPs were rinsed in pure water to remove Ag+ ions (Sondi and Salopek-Sondi, 2004). In another study, the amino acid cysteine was added to the AgNP solution to bind free Ag+ ions (Navarro et al., 2008). In addition, Ag concentrations in AgNP solutions have been analyzed after treatment with ion exchange resin to ensure that the AgNP solution is free of Ag+ ions (Kim et al., 2009). In this study, we assessed the toxicity of AgNPs in zebrafish liver tissues, with the specific aim of studying the role of oxidative damage and apoptosis in hepatotoxicity. To ensure that the AgNP solution lacked Ag+ ions, we analyzed Ag concentrations in the AgNP solutions after treatment with ion exchange resin. We examined the intracellular distribution of AgNPs using transmission electron microscopy (TEM) and analyzed histological changes, markers of oxidative and genetic damage, and gene expression in the liver tissues of AgNP-treated zebrafish. 2. Materials and methods 2.1. Chemicals All chemicals were reagent grade or higher and were obtained from Sigma–Aldrich (St. Louis, MO) unless otherwise specified. 2.2. AgNP solution A water-based solution of AgNPs containing approximately 1.0 g/L Ag was purchased from Nanopoly (Seoul, Korea; Hwang et al., 2008). To ensure that the AgNP solution was free of Ag+ ions, the AgNP solution was incubated for 24 h at room temperature and then deionized by treatment with 4 mg/ml Dowex Marathon C ion exchange resin for 1 h on a shaker set to 200 rpm (Lin et al., 2000; Simeonova et al., 2006; Kim et al., 2009). Ag concentrations in the deionized and untreated AgNP solutions were determined using inductively coupled plasma-mass spectrometry (ICP-MS, PerkinElmer SCIEX, Ontario, Canada). A drop of AgNP solution was placed onto a carbon-coated copper grid, air-dried, and observed using TEM (JEOL, Tokyo, Japan). 2.3. Zebrafish Adult zebrafish of both sexes (Danio rerio) were purchased from a local pet shop and acclimated in aerated recirculating tanks containing commercially available bottled water. Zebrafish were fed with a commercial fish food twice a day and kept at approximately 28 ◦ C with a 14 h:10 h light–dark cycle. Zebrafish were removed from the recirculating tanks, placed in static tanks, and fasted for 24 h both prior to and during experimentation (Li et al., 2008; Federici et al., 2007). Each zebrafish weighed 0.2–0.3 g, and each five zebrafish were treated in static tanks containing 2.0 L water. For treatment, AgNP solutions of various concentrations were sonicated for 30 s and added to the static tanks. After treatment for 24 h, zebrafish were quickly euthanized in melting ice. The liver tissues were separated and used immediately for analysis. The Institute of Laboratory Animal Resources of Seoul National University approved all procedures for handling of the animals described in this study.
2.4. Tissue Ag content Ag concentrations were analyzed in liver tissues. Liver samples of approximately 300 mg were dried at 150 ◦ C and cooled. To each sample, 6 ml HNO3 was added and samples were heated to 150 ◦ C. Samples were re-weighed for measurement of dry weight and resuspended in deionized distilled water to a mass of approximately 12 g. Subsequently, Ag content was analyzed using ICP-MS. 2.5. Intrahepatic localization of AgNPs After zebrafish were treated with AgNPs for 24 h, the liver tissues were harvested and fixed in 2% glutaraldehyde in cacodylate buffer, pH 7.2, and post-fixed in 1% osmium tetroxide. The tissues were dehydrated in a graded ethanol series and embedded in London resin white (Electron Microscopy Science, Hatfield, PA). Sections with a thickness of 80 nm were prepared from the embedded tissues and examined using TEM. 2.6. Protein assay The protein content of each sample was determined as described by Bradford (1976) using bovine serum albumin as a standard. 2.7. Malondialdehyde (MDA) levels The extent of lipid peroxidation in the tissues was determined by measuring the quantity of MDA (Gerard-Monnier et al., 1998). Briefly, liver tissues were homogenized in ice-cold 20 mM Tris buffer (pH 7.4), and 200 l sample was added to 650 l of a solution of 10.3 mM 1-methyl-2-phenylindole in a 3:1 mixture of acetonitrile/methanol. The reaction was initiated by adding 150 l of 37% hydrochloric acid. After incubation at 45 ◦ C for 60 min, the sample was cooled on ice and then centrifuged at 15,000 × g for 15 min. The absorbance of the supernatant at 586 nm was measured and compared to that of a control. A standard curve was prepared with solutions of 1,1,3,3-tetramethoxypropane, an MDA precursor. 2.8. Total glutathione (GSH) levels The total GSH levels were assayed as described by Tietze (1969). The liver tissues were homogenized in ice-cold 5% sulfosalicylic acid and centrifuged for 10 min at 4 ◦ C, after which the supernatant was incubated with 6.3 mM Na-EDTA, 6 mM dithionitrobenzoic acid, 0.25 mg/L NADPH, and 1 unit/ml GSH reductase in 143 mM sodium phosphate (pH 7.5) at room temperature for 6 min. The absorbance was then measured at 405 nm. A standard curve was prepared using known amounts of GSH. 2.9. Real time reverse transcription-polymerase chain reaction (RT-PCR) Liver tissues were homogenized in TRIzol reagent (Invitrogen, Carlsbad, CA), and total RNA was extracted according to the manufacturer’s instructions. The RNA samples were quantitated using a NanoDrop spectrophotometer (NanoDrop Technologies, Wilmington, DE). One microgram total RNA was reverse transcribed using reverse transcriptase and random primers (Promega, Madison, WI), after which real-time PCR was performed with cDNAs and genespecific primer pairs (Table 1) mixed with ABI SYBR Green PCR master mix (Applied Biosystems, Foster City, CA) in an ABI Prism 7000 Sequence Detection System (Applied Biosystems). The samples were first denatured for 10 min at 95 ◦ C and then amplified using 40 cycles of 15 s at 95 ◦ C and 1 min at 60 ◦ C followed by quan-
J.E. Choi et al. / Aquatic Toxicology 100 (2010) 151–159 Table 1 Primer sets employed in real-time RT-PCR analysis.
153
antibody for 1 h and developed with chemiluminescence detection reagents.
mRNA
Accession no.a
Primer sequence (5 to 3 )
Bax1
NM 131562.2
Forward: ACAGGGATGCTGAAGTGACC Reverse: GAAAAGCGCCACAACTCTTC
Blp1
NM 131807.1
Forward: TCCTCACAGCTCCACATCAC Reverse: CAAGCGGACTCATCTCCTTC
Cat
NM 130912.1
Forward: AGGGCAACTGGGATCTTACA Reverse: TTTATGGGACCAGACCTTGG
EF1␣
NM 131263.1
Forward: GTGCTGTGCTGATTGTTGCT Reverse: TGTATGCGCTGACTTCCTTG
3. Results
GPx1a
NM 001007281
Forward: ACCTGTCCGCGAAACTATTG Reverse: TGACTGTTGTGCCTCAAAGC
3.1. AgNPs
MT2
NM 001131053.2
Forward: AAATGGACCCCTGCGAAT Reverse: TTGCAGGTAGCACCACAGTT
Noxa
NM 001045474.1
Forward: ATGGCGAAGAAAGAGCAAAC Reverse: CGCTTCCCCTCCATTTGTAT
p21
NM 001002717
Forward: GGAAAGATGACCGATGAGGA Reverse: GACGCACCTTGTCCAATTTT
p53
NM 131327
Forward: GCTTGTCACAGGGGTCATTT Reverse: ACAAAGGTCCCAGTGGAGTG
SOD1
Y12236.1
Forward: GGCCAACCGATAGTGTTAGA Reverse: CCAGCGTTGCCAGTTTTTAG
As observed using TEM, most of the AgNPs in the waterbased solution were spherical, well dispersed, and approximately 5–20 nm in diameter (Fig. 1A). To determine the level of Ag+ ions in the AgNP solution used in this study, we deionized AgNP solutions at a concentration of approximately 270 mg Ag/L using ion exchange resin, and compared the Ag concentrations of the deionized solutions to that of the original solutions (Fig. 1B). We observed little change in the Ag concentrations of AgNP solutions before and after deionization, suggesting that the original AgNP solutions contained few if any free Ag+ ions. In contrast, the Ag concentrations in a solution of AgNO3 at approximately 230 mg Ag/L decreased with deionization to approximately one-ninth the levels of the original solutions (p < 0.05).
a
GenBank accession numbers (http://www.ncbi.nlm.nih.gov).
titation using a melting curve program (60–99 ◦ C with a heating rate of 0.1 ◦ C/s and continuous measurement of fluorescence).
2.13. Statistical analysis All data are expressed as means ± SE. Student’s unpaired t-test was performed using SPSS 15.0 (SPSS, Chicago, IL) to compare selected pairs of groups. A p-value less than 0.05 was considered significant.
3.2. Lethality 2.10. Histopathology Euthanized zebrafish were fixed by immersion in 10% buffered formalin for 24 h, dehydrated in a graded ethanol series, and embedded in paraffin. Serial sections with a thickness of 3 m were stained with hematoxylin and eosin (H&E) for histological analysis of liver tissues. 2.11. TUNEL (terminal deoxynucleotidyl-mediated dUTP nick labeling) assay Cell death in the liver tissues was determined using a TUNEL assay kit (Promega, Co., Madison, WI), according to the manufacturer’s instructions. Paraffin-embedded tissue sections were rehydrated by immersing the slide in a graded series of ethanol solutions, and permeabilized with a 20 g/ml proteinase K solution. Tissue sections were then incubated with biotinylated nucleotide mix, recombinant terminal deoxynucleotidyl transferase, and equilibration buffer for 1 h at 37 ◦ C. After incubation, tissue sections were immersed in 0.3% hydrogen peroxide in phosphate-buffered saline to block endogenous peroxidase, and then incubated with peroxidase solution for 30 min at room temperature. Tissue sections were stained with 3,3 -diaminobenzidine substrate and counterstained with hematoxylin. 2.12. Western blot Total hepatic protein was separated on sodium dodecyl sulfate-polyacrylamide electrophoresis gels and transferred to nitrocellulose membranes. The blots were then incubated with rabbit anti-zebrafish p53 antibody (1:500, Anaspec, San Jose, CA), rabbit anti-␥-H2AX antibody (1:500, Cell Signaling Technology, Danvers, MA), and mouse anti--actin antibody (1:1000) overnight at 4 ◦ C. Blots were then incubated with peroxidase-linked donkey anti-rabbit IgG or sheep anti-mouse IgG (1:5000) secondary
AgNPs were lethal to zebrafish with a 24 h LC50 of approximately 250 mg Ag/L (data not shown). Approximately one-half of the determined LC50 was used as the highest exposure concentration in the treatment of zebrafish. 3.3. Intracellular localization of AgNPs Ag concentrations in the liver tissues of zebrafish treated with 30 or 120 mg Ag/L AgNPs were 0.29 and 2.4 ng Ag/mg liver, respectively (Fig. 2A). TEM was used to examine the intracellular localization of AgNPs in the liver tissues. Agglomerated AgNPs, 50–300 nm in diameter, were found in a variety of cytoplasmic locations such as the vicinity of the plasma membrane (Fig. 2B) and the nuclear membrane (Fig. 2C and D). 3.4. Histopathology Morphological alterations of the liver tissues were observed in the H&E-stained sections. A number of cellular alterations including disruption of hepatic cell cords and apoptotic changes such as chromatin condensation and pyknosis were observed in the liver tissues of AgNP-treated zebrafish (Fig. 3A). However, untreated control liver tissues had normal histology (Fig. 3B). To confirm that the morphological changes observed were due to apoptosis, the TUNEL assay was performed to detect DNA fragmentation in apoptotic cells in situ. TUNEL-positive cells were observed in the liver tissues of AgNP-treated zebrafish (Fig. 3C), but not in control tissues (Fig. 3D). 3.5. Metallothionein 2 (MT2) mRNA expression Expression of the metal responsive MT2 mRNA was analyzed in the liver tissues of zebrafish treated with AgNPs (Fig. 4). The basal expression of MT2 has been detected previously in liver tissues of untreated zebrafish (Gonzalez et al., 2006). MT2 mRNA expression
154
J.E. Choi et al. / Aquatic Toxicology 100 (2010) 151–159
Fig. 1. Panel A shows a representative TEM image of AgNPs. AgNPs were approximately 5–20 nm in diameter and evenly dispersed. Scale bar, 50 nm. Panel B shows an ICP-MS analysis of Ag concentrations in deionized solutions of AgNP and AgNO3 and corresponding untreated solutions. After incubation at room temperature for 24 h, AgNP and AgNO3 solutions were deionized with ion exchange resin. Data represent means ± S.E. (n = 4). An asterisk indicates a significant difference in Ag concentration between deionized and un-deionized counterparts (p < 0.05).
was increased 3.9-, 5.4-, and 7.1-fold in a dose-dependent manner after treatment with 30, 60, and 120 mg Ag/L of AgNPs, respectively (p < 0.05). These data suggest that free Ag+ ions were available in the liver tissues of zebrafish exposed to AgNPs.
3.6. Tissue MDA and GSH levels Treatment with AgNPs at concentrations of 60 and 120 mg Ag/L induced 1.5- and 1.7-fold increases, respectively, in hepatic MDA
Fig. 2. Ag concentrations and localization of AgNPs in the liver tissues of AgNP-treated zebrafish. Panel A shows Ag concentrations in the liver tissues of AgNP-treated zebrafish. Panels B, C, and D are representative TEM images of 80-nm liver sections of zebrafish treated with 120 mg Ag/L AgNPs. AgNPs are visible in the hepatocytes as black electron-dense spots indicated by arrows. CY, cytoplasm; NU, nucleus; PM, plasma membrane. Scale bars, 200 nm in panels B and C; 100 nm in panel D.
J.E. Choi et al. / Aquatic Toxicology 100 (2010) 151–159
155
Fig. 3. Liver sections of (A) zebrafish treated with 120 mg Ag/L AgNPs for 24 h and (B) untreated control zebrafish show histological alterations including disruption of hepatic cell cords and apoptotic changes such as chromatin condensation and pyknosis (arrows). Sections were 3-m-thick and stained with H&E (200× magnification). In situ detection of apoptotic cells by TUNEL staining in (C) zebrafish treated with 120 mg Ag/L AgNPs for 24 h and (D) untreated control zebrafish. Apoptotic cells were identified by the presence of brown staining. Sections were 3-m-thick (1000× magnification).
levels in zebrafish compared to controls (Fig. 5A, p < 0.05), which suggests that AgNP treatment causes oxidative damage in the liver tissues. Simultaneously, AgNPs at 120 mg Ag/L increased total GSH concentrations (Fig. 5B, p < 0.05). This increase in total GSH concentration might be a physiological response for coping with the oxidative damage caused by AgNPs.
tissues (Fig. 6). Cat expression was decreased 2.6- and 16.3-fold compared to controls after treatment with AgNPs at 60 and 120 mg Ag/L, respectively, for 24 h (Fig. 6A, p < 0.05). The mRNA level of GPx1a in zebrafish liver tissues was also reduced 3.6-fold by AgNPs at 120 mg Ag/L compared to controls (Fig. 6B, p < 0.05). However, the expression of SOD1 mRNA in liver tissues was not significantly affected by treatment with AgNPs (Fig. 6C).
3.7. Expression of oxyradical scavenging enzymes The mRNA expression of the oxyradical-scavenging enzymes catalase (Cat), glutathione peroxidase 1a (GPx1a), and superoxide dismutase 1 (SOD1) was analyzed in AgNP-treated zebrafish liver
3.8. DNA damage DNA damage in the liver tissues was detected using ␥-H2AX, a phosphorylated form of H2AX that is found at the sites of DNA double-strand breaks (Pilch et al., 2003). Among various types of DNA damage, double-strand breaks are considered the most biologically significant lesions in cells (Rothkamm and Lobrich, 2003). While ␥-H2AX was undetected in untreated controls and other treatment groups in western blot analysis, a high level of ␥-H2AX was detected in the 120 mg Ag/L AgNP treatment group, suggesting that AgNP induced DNA damage in the liver tissues (Fig. 7). We suggest that the induction of ␥-H2AX requires more than a certain level of genetic damage in the liver tissues of zebrafish. 3.9. Expression of apoptosis-related genes
Fig. 4. Expression of MT2 mRNA in the liver tissues of zebrafish treated with AgNPs for 24 h and untreated controls. The levels of MT2 mRNA are expressed relative to EF1␣ and presented as means ± S.E. (n = 4–5). The asterisks indicate significant differences between the groups at either end of the horizontal lines (p < 0.05).
p53 is involved in cellular stress response pathways, such as apoptosis, and serves to protect the organism from DNA-damaging stimuli (Lee et al., 2008). p53 protein was induced in a dosedependent manner after treatment with AgNPs in the liver tissues of zebrafish (Fig. 7). However, the mRNA level of p53 was not significantly affected by treatment with AgNPs (Fig. 8A). These data are consistent with the known mechanism of regulation of p53 in mammals, in which p53 protein is mainly regulated by posttranslational pathways (Kastan et al., 1991). In contrast, Chae et al. (2009) demonstrated the induction of hepatic p53 mRNA in
156
J.E. Choi et al. / Aquatic Toxicology 100 (2010) 151–159
Fig. 5. MDA content (A) and total GSH content (B) in the liver tissues of zebrafish treated with AgNPs for 24 h. Data are presented as means ± S.E. (n = 3–4). The asterisks indicate significant differences (p < 0.05) between the groups at either end of the horizontal lines.
Fig. 6. Expression of the oxyradical metabolism-associated mRNA species Cat (A), GPx1a (B), and SOD1 (C) in the liver tissues of zebrafish treated with AgNPs for 24 h and untreated controls. Levels of specific mRNA species are expressed relative to EF1␣ and presented as means ± S.E. (n = 4–5). The asterisks indicate significant differences between the groups at either end of the horizontal lines (p < 0.05).
Japanese medaka treated with AgNPs. This contrasting result may be due in part to strain differences in p53 regulation in response to AgNP exposure. Real-time RT-PCR was also performed to analyze the expression levels of p53 target genes, such as Bax, Noxa, and p21 (Fig. 8B–D). Pro-apoptotic Bax and Noxa mRNA species were upregulated after treatment with AgNPs in a dose-dependent manner with 5.6-fold and 1.7-fold increases, respectively, in the group treated with 120 mg Ag/L AgNP compared to controls (p < 0.05). It appears that Noxa expression reached an upper limit at a dose of 60 mg Ag/L. The cell cycle-associated p21 transcript was also upregulated 2.0fold after treatment with 120 mg Ag/L AgNP compared to controls. However, the expression of Blp1 mRNA, a pro-survival marker (Chakraborty et al., 2009), was not significantly altered by AgNP treatment in zebrafish liver tissues (Fig. 8E). 4. Discussion Fig. 7. Western blot analysis of ␥-H2AX and p53 in the liver tissues of zebrafish treated with various concentrations of AgNPs for 24 h and untreated controls. Actin was used as an internal control.
AgNPs tend to release free Ag+ ions and to agglomerate/aggregate in aqueous environments. The inherent instability of
J.E. Choi et al. / Aquatic Toxicology 100 (2010) 151–159
157
Fig. 8. Expression of p53 (A), Bax (B), Noxa (C), p21 (D), and Blp1 (E) mRNA species in the liver tissues of zebrafish treated with various concentrations AgNPs for 24 h and untreated controls. Levels of specific mRNA species are expressed relative to EF1␣ and presented as means ± S.E. (n = 4–5). The asterisks indicate significant differences between the groups at either end of the horizontal lines (p < 0.05).
AgNPs may contribute to toxicity and be a major concern in toxicity studies. In this study, zebrafish were treated with various concentrations of AgNP solution in which free Ag+ ions were absent at the time of treatment (Fig. 1). However, the possibility cannot be excluded that AgNPs release Ag+ ions in the aquarium and after being absorbed into the body (Santoro et al., 2007). It has been suggested that surface oxidation of AgNPs liberates Ag+ ions on contact with proteins (Asharani et al., 2009). In the present study, the metal-sensitive MT2 mRNA was induced in the liver tissues of AgNP-treated zebrafish (Fig. 4), suggesting that Ag+ ions were released from AgNPs and thus available in the tissues (Gonzalez et al., 2006). However, it is also possible that MT2 mRNA was induced by AgNP-generated free radicals. It has been demonstrated previously that MT mRNA is induced in rainbow trout gonadal cells after treatment with hydrogen peroxide (Kling and Olsson, 2000). In addition, MT mRNA levels are increased following exposure to benzo[a]pyrene in the liver tissues of olive flounder (An et al., 2008). Free Ag+ ions and AgNPs have been demonstrated to possess almost equivalent cytotoxicity, with IC50 s (half-maximal inhibitory
concentrations) of less than 5 mg Ag/L in various cytotoxicity assays (Kim et al., 2009). Ag+ ions display potent lethality to zebrafish with an LC50 of 22 g Ag/L (Griffitt et al., 2008), and exhibit toxicity to aquatic organisms at nanomolar concentrations (Hiriart-Baer et al., 2006; Lee et al., 2005). Thus, the high LC50 value for AgNPs in this study, approximately 250 mg Ag/L, suggests that AgNPs are not readily absorbed or bioavailable in zebrafish, presumably due to their bulky dimensions compared to Ag+ ions. Oxidative stress is an important factor in NP-induced toxicity (Nel et al., 2006). A possible role of oxidative stress in the induction and mediation of DNA damage and apoptosis has been documented (Simonian and Coyle, 1996). In light of those studies, our results demonstrate that AgNPs induce oxidative stress, DNA damage, and apoptosis in zebrafish liver tissues (Figs. 3, 5 and 7). The increased level of hepatic MDA, a byproduct of cellular lipid peroxidation, indicates that AgNP induced oxyradicals in the liver tissues (Fig. 5A). In addition, the induction of an endogenous antioxidant, GSH, suggests that the liver tissues respond defensively to the increased level of oxyradicals (Fig. 5B). GSH levels
158
J.E. Choi et al. / Aquatic Toxicology 100 (2010) 151–159
have been observed to increase in various cells and animal tissues exposed to oxidative stress-inducing xenobiotics including NPs (Arora et al., 2009; Li et al., 2008; Oberdörster, 2004; Wang et al., 2009). The increase in GSH levels is in agreement with previous studies addressing the effect of oxidative stress on induction of GSH-synthesizing enzymes (Mulcahy et al., 1997; Shi et al., 1994). Hydrogen peroxide is metabolized to water by Cat or GPx by GSH. The reduction of the levels of Cat and GPx, two major antioxidant enzymes, may thus result in the accumulation of hydrogen peroxide and other oxyradicals (Fig. 6), contributing to AgNPinduced oxidative damage. Atli et al. (2006) have shown that Cat activity is decreased by Ag in the liver of freshwater fish, although it is stimulated by other heavy metals such as copper, cadmium and zinc. Decreases of GPx and Cat mRNA species have been demonstrated in animals and cells exposed to toxicants (Gupta et al., 2006; Yamamoto et al., 2005). In contrast, the expression of SOD1 mRNA was not affected by AgNP treatment (Fig. 6). It has been demonstrated previously that expression of SOD is not affected in fish following treatment with zinc oxide NPs and heavy metals such as zinc and cadmium (Wong et al., 2010; Hansen et al., 2007). Activation of the transcription factor p53 in response to DNA damage can lead to cell cycle arrest or apoptosis (Langheinrich et al., 2002). p53 expression is tightly regulated at both the transcriptional and post-translational levels, but mainly at the posttranslational level. In this study, AgNP treatments caused DNA damage, as demonstrated by analysis of the double-strand break marker ␥-H2AX, and induction of p53 in the liver tissues (Fig. 7). The induction of p53 was mainly at the post-translational level, because p53 protein was increased although the mRNA level was unchanged (Fig. 8A). p21 was induced in the liver tissues after treatment with AgNPs (Fig. 8D). The p21 gene is under the control of p53, and p21 promotes p53-dependent cell cycle arrest or apoptosis (Chakraborty et al., 2009; Langheinrich et al., 2002). In addition, the p53-related pro-apoptotic Bcl-2 family genes, Bax and Noxa, were also induced after treatment with AgNPs, which might contribute to AgNPinduced apoptosis in the liver tissues (Fig. 8B and C). However, the expression of an anti-apoptotic Bcl-2 family gene, Blp1, was not affected in liver tissues of zebrafish after treatment with AgNPs (Fig. 8E) as shown in zebrafish embryos undergoing p53-dependent apoptosis (Chakraborty et al., 2009; Chen et al., 2001). In conclusion, we have characterized the hepatoxicity of AgNPs in zebrafish. This study provides one of the first overviews of AgNPinduced hepatotoxicity in adult fish. Our data demonstrates that oxidative stress, DNA damage, and apoptosis are associated with AgNP-induced hepatotoxicity in zebrafish. This research highlights the need for integrated environmental toxicological assessment of AgNPs. Acknowledgement This work was supported by the Eco-technopia 21 Project of the Korea Ministry of the Environment. References An, K.W., Shin, H.S., Choi, C.Y., 2008. Physiological responses and expression of metallothionein (MT) and superoxide dismutase (SOD) mRNAs in olive flounder, Paralichthys olivaceus exposed to benzo[a]pyrene. Comp. Biochem. Physiol. B 149, 534–539. Arora, S., Jain, J., Rajwade, J.M., Paknikar, K.M., 2009. Interactions of silver nanoparticles with primary mouse fibroblasts and liver cells. Toxicol. Appl. Pharmacol. 236, 310–318. Asharani, P.V., Mun, G.L.K., Hande, M.P., Valiyaveettil, S., 2009. Cytotoxicity and genotoxicity of silver nanoparticles in human cells. ACS Nano. 3, 279–290. Asharani, P.V., Wu, Y.L., Gong, Z., Valiyaveettil, S., 2008. Toxicity of silver nanoparticles in zebrafish models. Nanotechnology 19, 255102. Atli, G., Alptekin, Ö., T¨vkel, S., Canli, M., 2006. Response of catalase activity to Ag+ , Cd2+ , Cr6+ , Cu2+ and Zn2+ in five tissues of freshwater fish Oreochromis niloticus. Comp. Biochem. Physiol. C: Pharmacol. Toxicol. Endocrinol. 143, 218–224.
Bar-Ilan, O., Albrecht, R.M., Fako, V.E., Furgeson, D.Y., 2009. Toxicity assessments of multisized gold and silver nanoparticles in zebrafish embryos. Small 5, 1897–1910. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein–dye binding. Anal. Biochem. 72, 248–254. Chae, Y.J., Pham, C.H., Lee, J., Bae, E., Yi, J., Gu, M.B., 2009. Evaluation of the toxic impact of silver nanoparticles on Japanese medaka (Oryzias latipes). Aquat. Toxicol. 94, 320–327. Chakraborty, A., Uechi, T., Higa, S., Torihara, H., Kenmochi, N., 2009. Loss of ribosomal protein L11 affects zebrafish embryonic development through a p53-dependent apoptotic response. PLoS ONE 4, e4152. Chen, M.C., Gong, H.Y., Cheng, C.Y., Wang, J.P., Hong, J.R., Wu, J.L., 2001. Cloning and characterization of zfBLP1, a Bcl-XL homologue from the zebrafish, Danio rerio. Biochim. Biophys. Acta 1519, 127–133. Cohen, M.S., Stern, J.M., Vanni, A.J., Kelley, R.S., Baumgart, E., Field, D., Libertino, J.A., Summerhayes, I.C., 2007. In vitro analysis of a nanocrystalline silver-coated surgical mesh. Surg. Infect. (Larchmt.) 8, 397–403. Federici, G., Shaw, B.J., Handy, R.D., 2007. Toxicity of titanium dioxide nanoparticles to rainbow trout (Oncorhynchus mykiss): gill injury, oxidative stress, and other physiological effects. Aquat. Toxicol. 84, 415–430. Gerard-Monnier, D., Erdelmeier, I., Regnard, K., Moze-Henry, N., Yadan, J.C., Chaudiere, J., 1998. Reactions of 1-methyl-2-phenylindole with malondialdehyde and 4-hydroxyalkenals. Analytical applications to a colorimetric assay of lipid peroxidation. Chem. Res. Toxicol. 11, 1176–1183. Gonzalez, P., Baudrimont, M., Boudou, A., Bourdineaud, J.P., 2006. Comparative effects of direct cadmium contamination on gene expression in gills, liver, skeletal muscles and brain of the zebrafish (Danio rerio). Biometals 19, 225–235. Griffitt, R.J., Luo, J., Gao, J., Bonzongo, J.C., Barber, D.S., 2008. Effects of particle composition and species on toxicity of metallic nanomaterials in aquatic organisms. Environ. Toxicol. Chem. 27, 1972–1978. Gupta, R.K., Schuh, R.A., Fiskum, G., Flaws, J.A., 2006. Methoxychlor causes mitochondrial dysfunction and oxidative damage in the mouse ovary. Toxicol. Appl. Pharmacol. 216, 436–445. Hansen, B.H., Romma, S., Garmo, O.A., Pedersen, S.A., Olsvik, P.A., Andersen, R.A., 2007. Induction and activity of oxidative stress-related proteins during waterborne Cd/Zn-exposure in brown trout (Salmo trutta). Chemosphere 67, 2241–2249. Hiriart-Baer, V.P., Fortin, C., Lee, D.Y., Campbell, P.G.C., 2006. Toxicity of silver to two freshwater algae, Chlamydomonas reinhardtii and Pseudokirchneriella subcapitata, grown under continuous culture conditions: Influence of thiosulphate. Aquat. Toxicol. 78, 136–148. Hwang, E.T., Lee, J.H., Chae, Y.J., Kim, Y.S., Kim, B.C., Sang, B.I., Gu, M.B., 2008. Analysis of the toxic mode of action of silver nanoparticles using stress-specific bioluminescent bacteria. Small 4, 746–750. Kashiwada, S., 2006. Distribution of nanoparticles in the see-through medaka (Oryzias latipes). Environ. Health Perspect. 114, 1697–1702. Kastan, M.B., Onyekwere, O., Sidransky, D., Vogelstein, B., Craig, R.W., 1991. Participation of p53 protein in the cellular response to DNA damage. Cancer Res. 51, 6304–6311. Kim, S., Choi, J.E., Choi, J., Chung, K.H., Park, K., Yi, J., Ryu, D.Y., 2009. Oxidative stressdependent toxicity of silver nanoparticles in human hepatoma cells. Toxicol. In Vitro 23, 1076–1084. Kling, P.G., Olsson, P., 2000. Involvement of differential metallothionein expression in free radical sensitivity of RTG-2 and CHSE-214 cells. Free Radic. Biol. Med. 28, 1628–1637. Langheinrich, U., Hennen, E., Stott, G., Vacun, G., 2002. Zebrafish as a model organism for the identification and characterization of drugs and genes affecting p53 signaling. Curr. Biol. 12, 2023–2028. Lee, D.Y., Fortin, C., Campbell, P.G.C., 2005. Contrasting effects of chloride on the toxicity of silver to two green algae, Pseudokirchneriella subcapitata and Chlamydomonas reinhardtii. Aquat. Toxicol. 75, 127–135. Lee, K.C., Goh, W.L.P., Xu, M., Kua, N., Lunny, D., Wong, J.S., Coomber, D., Vojtesek, B., Lane, E.B., Lane, D.P., 2008. Detection of the p53 response in zebrafish embryos using new monoclonal antibodies. Oncogene 27, 629–640. Lee, K.J., Nallathamby, P.D., Browning, L.M., Osgood, C.J., Xu, X.H.N., 2007. In vivo imaging of transport and biocompatibility of single silver nanoparticles in early development of zebrafish embryos. ACS Nano. 1, 133–143. Li, H., Zhang, J., Wang, T., Luo, W., Zhou, Q., Jiang, G., 2008. Elemental selenium particles at nano-size (Nano-Se) are more toxic to Medaka (Oryzias latipes) as a consequence of hyper-accumulation of selenium: a comparison with sodium selenite. Aquat. Toxicol. 89, 251–256. Lin, S.H., Lai, S.L., Leu, H.G., 2000. Removal of heavy metals from aqueous solution by chelating resin in a multistage adsorption process. J. Hazard. Mater. B76, 139–153. Maynard, A.D., Kuempel, E.D., 2005. Airborne nanostructured particles and occupational health. J. Nanopart. Res. 7, 587–614. Mulcahy, R.T., Wartman, M.A., Bailey, H.H., Gipp, J.J., 1997. Constitutive and betanaphthoflavone-induced expression of the human gamma-glutamylcysteine synthetase heavy subunit gene is regulated by a distal antioxidant response element/TRE sequence. J. Biol. Chem. 272, 7445–7454. Navarro, E., Piccapietra, F., Wagner, B., Marconi, F., Kaegi, R., Odzak, N., Sigg, L., Behra, R., 2008. Toxicity of silver nanoparticles to Chlamydomonas reinhardtii. Environ. Sci. Technol. 42, 8959–8964. Nel, A., Xia, T., Mädler, L., Li, N., 2006. Toxic potential of materials at the nanolevel. Science 311, 622–627.
J.E. Choi et al. / Aquatic Toxicology 100 (2010) 151–159 Oberdörster, E., 2004. Manufactured nanomaterials (Fullerenes, C60) induce oxidative stress in the brain of juvenile largemouth bass. Environ. Health Perspect. 112, 1058–1062. Oberdörster, E., Zhu, S., Blickley, T.M., McClellan-Green, P., Haasch, M.L., 2006. Ecotoxicology of carbon-based engineered nanoparticles: effects of fullerene (C60) on aquatic organisms. Carbon 44, 1112–1120. Pilch, D.R., Sedelnikova, O.A., Redon, C., Celeste, A., Nussenzweig, A., Bonner, W.M., 2003. Characteristics of ␥-H2AX foci at DNA double-strand breaks sites. Biochem. Cell Biol. 81, 123–129. Rothkamm, K., Lobrich, M., 2003. Evidence for a lack of DNA double-strand break repair in human cells exposed to very low X-ray doses. Proc. Natl. Acad. Sci. U.S.A. 100, 5057–5062. Santoro, C.M., Duchsherer, N.L., Grainger, D.W., 2007. Minimal in vitro antimicrobial efficacy and ocular cell toxicity from silver nanoparticles. Nanobiotechnology 3, 55–65. Shi, M.M., Kugelman, A., Iwamoto, T., Tian, L., Forman, H.J., 1994. Quinone-induced oxidative stress elevates glutathione and induces gamma-glutamylcysteine synthetase activity in rat lung epithelial L2 cells. J. Biol. Chem. 269, 26512–26517. Simeonova, A., Godjevargova, T., Vladkova, D., 2006. Copper sorption from aqueous solutions by plasma modified polyacrylonitrile beads. Polym. Bull. 57, 765–773. Simonian, N.A., Coyle, J.T., 1996. Oxidative stress in neurodegenerative diseases. Annu. Rev. Pharmacol. Toxicol. 36, 83–106. Skebo, J.E., Grabinski, C.M., Schrand, A.M., Schlager, J.J., Hussain, S.M., 2007. Assessment of metal nanoparticle agglomeration, uptake, and interaction using high-illuminating system. Int. J. Toxicol. 26, 135–141. Smith, C.J., Shaw, B.J., Handy, R.D., 2007. Toxicity of single walled carbon nanotubes to rainbow trout, (Oncorhynchus mykiss): respiratory toxicity, organ pathologies, and other physiological effects. Aquat. Toxicol. 82, 94–109.
159
Sondi, I., Salopek-Sondi, B., 2004. Silver nanoparticles as antimicrobial agent: a case study on E. coli as a model for Gram-negative bacteria. J. Colloid Interface Sci. 275, 177–182. Tietze, F., 1969. Enzymic method for quantitative determination of nanogram amounts of total and oxidized glutathione: applications to mammalian blood and other tissues. Anal. Biochem. 27, 502–522. Usenko, C.Y., Harper, S.L., Tanguay, R.L., 2007. In vivo evaluation of carbon fullerene toxicity using embryonic zebrafish. Carbon 45, 1891– 1898. Wallace, W.E., Keane, M.J., Murray, D.K., Chisholm, W.P., Maynard, A.D., Ong, T.M., 2007. Phospholipid lung surfactant and nanoparticle surface toxicity: lessons from diesel soots and silicate dusts. J. Nanopart. Res. 9, 23– 38. Wang, J.X., Fan, Y.B., Gao, Y., Hu, Q.H., Wang, T.C., 2009. TiO2 nanoparticles translocation and potential toxicological effect in rats after intraarticular injection. Biomaterials 30, 4590–4600. Wong, S.W.Y., Leung, P.T.Y., Djurisic, A.B., Leung, K.M.Y., 2010. Toxicities of nano zinc oxide to five marine organisms: influences of aggregate size and ion solubility. Anal. Bioanal. Chem. 396, 609–618. Yamamoto, T., Kikkawa, R., Yamada, H., Horii, I., 2005. Identification of oxidative stress-related proteins for predictive screening of hepatotoxicity using a proteomic approach. J. Toxicol. Sci. 30, 213–227. Yon, J.N., Lead, J.R., 2008. Manufactured nanoparticles: an overview of their chemistry, interactions and potential environmental implications. Sci. Total Environ. 400, 396–414. Zhu, S., Oberdörster, E., Haasch, M.L., 2006. Toxicity of an engineered nanoparticle (fullerene, C60) in two aquatic species, daphnia and fathead minnow. Mar. Environ. Res. 62, S5–S9.
Contents lists available at ScienceDirect
Aquatic Toxicology journal homepage: www.elsevier.com/locate/aquatox
Induction of oxidative stress and apoptosis by silver nanoparticles in the liver of adult zebrafish Ji Eun Choi a , Soohee Kim a , Jin Hee Ahn a , Pilju Youn a , Jin Seok Kang b , Kwangsik Park c , Jongheop Yi d , Doug-Young Ryu a,∗ a
College of Veterinary Medicine, Seoul National University, 599 Gwanak, Gwanak, Seoul, 151-742, Republic of Korea Department of Biomedical Laboratory Science, Namseoul University, Cheonan, 330-707, Republic of Korea College of Pharmacy, Dongduk Women’s University, Seoul, 136-714, Republic of Korea d College of Engineering, Seoul National University, Seoul, 151-742, Republic of Korea b c
a r t i c l e
i n f o
Article history: Received 19 August 2009 Received in revised form 2 December 2009 Accepted 12 December 2009 Keywords: Ag Nanoparticle Zebrafish Liver Oxidative stress Apoptosis
a b s t r a c t Silver nanoparticles (AgNPs) may induce deleterious effects in aquatic life on environmental release. The hepatotoxicity of AgNPs was assessed in the liver of adult zebrafish, with the aim of studying the roles of oxidative damage and apoptosis. Zebrafish were exposed to an AgNP solution in which free Ag+ ions were absent at the time of treatment. However, the metal-sensitive metallothionein 2 (MT2) mRNA was induced in the liver tissues of AgNP-treated zebrafish, suggesting that Ag+ ions were released from AgNPs after treatment. It is also possible that MT2 mRNA was induced in the liver tissues by AgNP-generated free radicals. A number of cellular alterations including disruption of hepatic cell cords and apoptotic changes were observed in histological analysis of the liver tissues. The levels of malondialdehyde, a byproduct of cellular lipid peroxidation, and total glutathione were increased in the tissues after treatment with AgNPs. The mRNA levels of the oxyradical-scavenging enzymes catalase and glutathione peroxidase 1a were reduced in the tissues. AgNP treatment induced DNA damage, as demonstrated by analysis with the double-strand break marker ␥-H2AX and the expression of p53 protein in liver tissues. In addition, the p53-related pro-apoptotic genes Bax, Noxa, and p21 were upregulated after treatment with AgNPs. These data suggest that oxidative stress and apoptosis are associated with AgNP toxicity in the liver of adult zebrafish. © 2009 Elsevier B.V. All rights reserved.
1. Introduction Nanoparticles (NPs) have at least one dimension of 100 nm or less and represent an intermediate supramolecular state of matter between bulk and molecular material (Maynard and Kuempel, 2005). NPs are used to produce novel materials with unique physicochemical properties, which become an environmental concern in the event of unintended release into the environment. NPs may induce deleterious effects in aquatic systems as well as in aquatic life. The small size, chemical composition, surface structure, solubility, shape, agglomeration, and aggregation of these particles may be associated with NP-induced toxicity (Nel et al., 2006; Skebo et al., 2007; Wallace et al., 2007). Nonspecific oxidative stress has been suggested as one of the greatest concerns in NP-induced toxicity (Nel et al., 2006). A variety of toxic changes has been observed in NP-exposed fish and embryos, including oxidative stress-related
∗ Corresponding author. Tel.: +82 2 880 1253; fax: +82 2 878 2360. E-mail address: [email protected] (D.-Y. Ryu). 0166-445X/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.aquatox.2009.12.012
changes such as lipid oxidation, apoptosis, and changes in gene expression (Oberdörster, 2004; Oberdörster et al., 2006; Smith et al., 2007; Usenko et al., 2007; Zhu et al., 2006). Silver (Ag) has received much attention because of its toxicity at low ionic concentrations. The most common oxidation state of Ag is +1; in addition, +2 compounds and the less-common +3 compounds are also known. The antibacterial activity exhibited by Ag has led to the widespread use of AgNPs in many commercial products, such as shampoo, food packaging, odor resistant textiles, kitchen utensils, water filters, household appliances, and medical devices (Cohen et al., 2007; Sondi and Salopek-Sondi, 2004; Yon and Lead, 2008). AgNP-induced toxicity has been frequently studied in fish embryos. A concentration-dependent increase in mortality and delayed hatching has been observed in embryos treated with AgNP. The 72-h and 120-h LC50 s of AgNPs in zebrafish embryos range from 25–50 mg Ag/L (Asharani et al., 2008) to 10–15 mg Ag/L (Bar-Ilan et al., 2009), respectively. AgNPs have been observed in the brain, testis, liver, and blood of medaka embryos (Kashiwada, 2006). In zebrafish embryos, AgNP treatment induces circulatory and morphological abnormalities (Asharani et al., 2008; Bar-Ilan et al., 2009; Lee et al., 2007). Apoptotic changes have
152
J.E. Choi et al. / Aquatic Toxicology 100 (2010) 151–159
been detected in AgNP-treated zebrafish embryos (Asharani et al., 2008). AgNPs are also acutely lethal to adult zebrafish, with an LC50 of 7.07 mg Ag/L (Griffitt et al., 2008). However, few studies have examined organ-specific AgNP-induced toxicity in adult fish. AgNPs release Ag+ ions in the presence of water (Santoro et al., 2007). Thus, it is necessary to distinguish between the toxic effects of AgNPs and those of dissolved Ag+ ions. For this purpose, AgNPs were rinsed in pure water to remove Ag+ ions (Sondi and Salopek-Sondi, 2004). In another study, the amino acid cysteine was added to the AgNP solution to bind free Ag+ ions (Navarro et al., 2008). In addition, Ag concentrations in AgNP solutions have been analyzed after treatment with ion exchange resin to ensure that the AgNP solution is free of Ag+ ions (Kim et al., 2009). In this study, we assessed the toxicity of AgNPs in zebrafish liver tissues, with the specific aim of studying the role of oxidative damage and apoptosis in hepatotoxicity. To ensure that the AgNP solution lacked Ag+ ions, we analyzed Ag concentrations in the AgNP solutions after treatment with ion exchange resin. We examined the intracellular distribution of AgNPs using transmission electron microscopy (TEM) and analyzed histological changes, markers of oxidative and genetic damage, and gene expression in the liver tissues of AgNP-treated zebrafish. 2. Materials and methods 2.1. Chemicals All chemicals were reagent grade or higher and were obtained from Sigma–Aldrich (St. Louis, MO) unless otherwise specified. 2.2. AgNP solution A water-based solution of AgNPs containing approximately 1.0 g/L Ag was purchased from Nanopoly (Seoul, Korea; Hwang et al., 2008). To ensure that the AgNP solution was free of Ag+ ions, the AgNP solution was incubated for 24 h at room temperature and then deionized by treatment with 4 mg/ml Dowex Marathon C ion exchange resin for 1 h on a shaker set to 200 rpm (Lin et al., 2000; Simeonova et al., 2006; Kim et al., 2009). Ag concentrations in the deionized and untreated AgNP solutions were determined using inductively coupled plasma-mass spectrometry (ICP-MS, PerkinElmer SCIEX, Ontario, Canada). A drop of AgNP solution was placed onto a carbon-coated copper grid, air-dried, and observed using TEM (JEOL, Tokyo, Japan). 2.3. Zebrafish Adult zebrafish of both sexes (Danio rerio) were purchased from a local pet shop and acclimated in aerated recirculating tanks containing commercially available bottled water. Zebrafish were fed with a commercial fish food twice a day and kept at approximately 28 ◦ C with a 14 h:10 h light–dark cycle. Zebrafish were removed from the recirculating tanks, placed in static tanks, and fasted for 24 h both prior to and during experimentation (Li et al., 2008; Federici et al., 2007). Each zebrafish weighed 0.2–0.3 g, and each five zebrafish were treated in static tanks containing 2.0 L water. For treatment, AgNP solutions of various concentrations were sonicated for 30 s and added to the static tanks. After treatment for 24 h, zebrafish were quickly euthanized in melting ice. The liver tissues were separated and used immediately for analysis. The Institute of Laboratory Animal Resources of Seoul National University approved all procedures for handling of the animals described in this study.
2.4. Tissue Ag content Ag concentrations were analyzed in liver tissues. Liver samples of approximately 300 mg were dried at 150 ◦ C and cooled. To each sample, 6 ml HNO3 was added and samples were heated to 150 ◦ C. Samples were re-weighed for measurement of dry weight and resuspended in deionized distilled water to a mass of approximately 12 g. Subsequently, Ag content was analyzed using ICP-MS. 2.5. Intrahepatic localization of AgNPs After zebrafish were treated with AgNPs for 24 h, the liver tissues were harvested and fixed in 2% glutaraldehyde in cacodylate buffer, pH 7.2, and post-fixed in 1% osmium tetroxide. The tissues were dehydrated in a graded ethanol series and embedded in London resin white (Electron Microscopy Science, Hatfield, PA). Sections with a thickness of 80 nm were prepared from the embedded tissues and examined using TEM. 2.6. Protein assay The protein content of each sample was determined as described by Bradford (1976) using bovine serum albumin as a standard. 2.7. Malondialdehyde (MDA) levels The extent of lipid peroxidation in the tissues was determined by measuring the quantity of MDA (Gerard-Monnier et al., 1998). Briefly, liver tissues were homogenized in ice-cold 20 mM Tris buffer (pH 7.4), and 200 l sample was added to 650 l of a solution of 10.3 mM 1-methyl-2-phenylindole in a 3:1 mixture of acetonitrile/methanol. The reaction was initiated by adding 150 l of 37% hydrochloric acid. After incubation at 45 ◦ C for 60 min, the sample was cooled on ice and then centrifuged at 15,000 × g for 15 min. The absorbance of the supernatant at 586 nm was measured and compared to that of a control. A standard curve was prepared with solutions of 1,1,3,3-tetramethoxypropane, an MDA precursor. 2.8. Total glutathione (GSH) levels The total GSH levels were assayed as described by Tietze (1969). The liver tissues were homogenized in ice-cold 5% sulfosalicylic acid and centrifuged for 10 min at 4 ◦ C, after which the supernatant was incubated with 6.3 mM Na-EDTA, 6 mM dithionitrobenzoic acid, 0.25 mg/L NADPH, and 1 unit/ml GSH reductase in 143 mM sodium phosphate (pH 7.5) at room temperature for 6 min. The absorbance was then measured at 405 nm. A standard curve was prepared using known amounts of GSH. 2.9. Real time reverse transcription-polymerase chain reaction (RT-PCR) Liver tissues were homogenized in TRIzol reagent (Invitrogen, Carlsbad, CA), and total RNA was extracted according to the manufacturer’s instructions. The RNA samples were quantitated using a NanoDrop spectrophotometer (NanoDrop Technologies, Wilmington, DE). One microgram total RNA was reverse transcribed using reverse transcriptase and random primers (Promega, Madison, WI), after which real-time PCR was performed with cDNAs and genespecific primer pairs (Table 1) mixed with ABI SYBR Green PCR master mix (Applied Biosystems, Foster City, CA) in an ABI Prism 7000 Sequence Detection System (Applied Biosystems). The samples were first denatured for 10 min at 95 ◦ C and then amplified using 40 cycles of 15 s at 95 ◦ C and 1 min at 60 ◦ C followed by quan-
J.E. Choi et al. / Aquatic Toxicology 100 (2010) 151–159 Table 1 Primer sets employed in real-time RT-PCR analysis.
153
antibody for 1 h and developed with chemiluminescence detection reagents.
mRNA
Accession no.a
Primer sequence (5 to 3 )
Bax1
NM 131562.2
Forward: ACAGGGATGCTGAAGTGACC Reverse: GAAAAGCGCCACAACTCTTC
Blp1
NM 131807.1
Forward: TCCTCACAGCTCCACATCAC Reverse: CAAGCGGACTCATCTCCTTC
Cat
NM 130912.1
Forward: AGGGCAACTGGGATCTTACA Reverse: TTTATGGGACCAGACCTTGG
EF1␣
NM 131263.1
Forward: GTGCTGTGCTGATTGTTGCT Reverse: TGTATGCGCTGACTTCCTTG
3. Results
GPx1a
NM 001007281
Forward: ACCTGTCCGCGAAACTATTG Reverse: TGACTGTTGTGCCTCAAAGC
3.1. AgNPs
MT2
NM 001131053.2
Forward: AAATGGACCCCTGCGAAT Reverse: TTGCAGGTAGCACCACAGTT
Noxa
NM 001045474.1
Forward: ATGGCGAAGAAAGAGCAAAC Reverse: CGCTTCCCCTCCATTTGTAT
p21
NM 001002717
Forward: GGAAAGATGACCGATGAGGA Reverse: GACGCACCTTGTCCAATTTT
p53
NM 131327
Forward: GCTTGTCACAGGGGTCATTT Reverse: ACAAAGGTCCCAGTGGAGTG
SOD1
Y12236.1
Forward: GGCCAACCGATAGTGTTAGA Reverse: CCAGCGTTGCCAGTTTTTAG
As observed using TEM, most of the AgNPs in the waterbased solution were spherical, well dispersed, and approximately 5–20 nm in diameter (Fig. 1A). To determine the level of Ag+ ions in the AgNP solution used in this study, we deionized AgNP solutions at a concentration of approximately 270 mg Ag/L using ion exchange resin, and compared the Ag concentrations of the deionized solutions to that of the original solutions (Fig. 1B). We observed little change in the Ag concentrations of AgNP solutions before and after deionization, suggesting that the original AgNP solutions contained few if any free Ag+ ions. In contrast, the Ag concentrations in a solution of AgNO3 at approximately 230 mg Ag/L decreased with deionization to approximately one-ninth the levels of the original solutions (p < 0.05).
a
GenBank accession numbers (http://www.ncbi.nlm.nih.gov).
titation using a melting curve program (60–99 ◦ C with a heating rate of 0.1 ◦ C/s and continuous measurement of fluorescence).
2.13. Statistical analysis All data are expressed as means ± SE. Student’s unpaired t-test was performed using SPSS 15.0 (SPSS, Chicago, IL) to compare selected pairs of groups. A p-value less than 0.05 was considered significant.
3.2. Lethality 2.10. Histopathology Euthanized zebrafish were fixed by immersion in 10% buffered formalin for 24 h, dehydrated in a graded ethanol series, and embedded in paraffin. Serial sections with a thickness of 3 m were stained with hematoxylin and eosin (H&E) for histological analysis of liver tissues. 2.11. TUNEL (terminal deoxynucleotidyl-mediated dUTP nick labeling) assay Cell death in the liver tissues was determined using a TUNEL assay kit (Promega, Co., Madison, WI), according to the manufacturer’s instructions. Paraffin-embedded tissue sections were rehydrated by immersing the slide in a graded series of ethanol solutions, and permeabilized with a 20 g/ml proteinase K solution. Tissue sections were then incubated with biotinylated nucleotide mix, recombinant terminal deoxynucleotidyl transferase, and equilibration buffer for 1 h at 37 ◦ C. After incubation, tissue sections were immersed in 0.3% hydrogen peroxide in phosphate-buffered saline to block endogenous peroxidase, and then incubated with peroxidase solution for 30 min at room temperature. Tissue sections were stained with 3,3 -diaminobenzidine substrate and counterstained with hematoxylin. 2.12. Western blot Total hepatic protein was separated on sodium dodecyl sulfate-polyacrylamide electrophoresis gels and transferred to nitrocellulose membranes. The blots were then incubated with rabbit anti-zebrafish p53 antibody (1:500, Anaspec, San Jose, CA), rabbit anti-␥-H2AX antibody (1:500, Cell Signaling Technology, Danvers, MA), and mouse anti--actin antibody (1:1000) overnight at 4 ◦ C. Blots were then incubated with peroxidase-linked donkey anti-rabbit IgG or sheep anti-mouse IgG (1:5000) secondary
AgNPs were lethal to zebrafish with a 24 h LC50 of approximately 250 mg Ag/L (data not shown). Approximately one-half of the determined LC50 was used as the highest exposure concentration in the treatment of zebrafish. 3.3. Intracellular localization of AgNPs Ag concentrations in the liver tissues of zebrafish treated with 30 or 120 mg Ag/L AgNPs were 0.29 and 2.4 ng Ag/mg liver, respectively (Fig. 2A). TEM was used to examine the intracellular localization of AgNPs in the liver tissues. Agglomerated AgNPs, 50–300 nm in diameter, were found in a variety of cytoplasmic locations such as the vicinity of the plasma membrane (Fig. 2B) and the nuclear membrane (Fig. 2C and D). 3.4. Histopathology Morphological alterations of the liver tissues were observed in the H&E-stained sections. A number of cellular alterations including disruption of hepatic cell cords and apoptotic changes such as chromatin condensation and pyknosis were observed in the liver tissues of AgNP-treated zebrafish (Fig. 3A). However, untreated control liver tissues had normal histology (Fig. 3B). To confirm that the morphological changes observed were due to apoptosis, the TUNEL assay was performed to detect DNA fragmentation in apoptotic cells in situ. TUNEL-positive cells were observed in the liver tissues of AgNP-treated zebrafish (Fig. 3C), but not in control tissues (Fig. 3D). 3.5. Metallothionein 2 (MT2) mRNA expression Expression of the metal responsive MT2 mRNA was analyzed in the liver tissues of zebrafish treated with AgNPs (Fig. 4). The basal expression of MT2 has been detected previously in liver tissues of untreated zebrafish (Gonzalez et al., 2006). MT2 mRNA expression
154
J.E. Choi et al. / Aquatic Toxicology 100 (2010) 151–159
Fig. 1. Panel A shows a representative TEM image of AgNPs. AgNPs were approximately 5–20 nm in diameter and evenly dispersed. Scale bar, 50 nm. Panel B shows an ICP-MS analysis of Ag concentrations in deionized solutions of AgNP and AgNO3 and corresponding untreated solutions. After incubation at room temperature for 24 h, AgNP and AgNO3 solutions were deionized with ion exchange resin. Data represent means ± S.E. (n = 4). An asterisk indicates a significant difference in Ag concentration between deionized and un-deionized counterparts (p < 0.05).
was increased 3.9-, 5.4-, and 7.1-fold in a dose-dependent manner after treatment with 30, 60, and 120 mg Ag/L of AgNPs, respectively (p < 0.05). These data suggest that free Ag+ ions were available in the liver tissues of zebrafish exposed to AgNPs.
3.6. Tissue MDA and GSH levels Treatment with AgNPs at concentrations of 60 and 120 mg Ag/L induced 1.5- and 1.7-fold increases, respectively, in hepatic MDA
Fig. 2. Ag concentrations and localization of AgNPs in the liver tissues of AgNP-treated zebrafish. Panel A shows Ag concentrations in the liver tissues of AgNP-treated zebrafish. Panels B, C, and D are representative TEM images of 80-nm liver sections of zebrafish treated with 120 mg Ag/L AgNPs. AgNPs are visible in the hepatocytes as black electron-dense spots indicated by arrows. CY, cytoplasm; NU, nucleus; PM, plasma membrane. Scale bars, 200 nm in panels B and C; 100 nm in panel D.
J.E. Choi et al. / Aquatic Toxicology 100 (2010) 151–159
155
Fig. 3. Liver sections of (A) zebrafish treated with 120 mg Ag/L AgNPs for 24 h and (B) untreated control zebrafish show histological alterations including disruption of hepatic cell cords and apoptotic changes such as chromatin condensation and pyknosis (arrows). Sections were 3-m-thick and stained with H&E (200× magnification). In situ detection of apoptotic cells by TUNEL staining in (C) zebrafish treated with 120 mg Ag/L AgNPs for 24 h and (D) untreated control zebrafish. Apoptotic cells were identified by the presence of brown staining. Sections were 3-m-thick (1000× magnification).
levels in zebrafish compared to controls (Fig. 5A, p < 0.05), which suggests that AgNP treatment causes oxidative damage in the liver tissues. Simultaneously, AgNPs at 120 mg Ag/L increased total GSH concentrations (Fig. 5B, p < 0.05). This increase in total GSH concentration might be a physiological response for coping with the oxidative damage caused by AgNPs.
tissues (Fig. 6). Cat expression was decreased 2.6- and 16.3-fold compared to controls after treatment with AgNPs at 60 and 120 mg Ag/L, respectively, for 24 h (Fig. 6A, p < 0.05). The mRNA level of GPx1a in zebrafish liver tissues was also reduced 3.6-fold by AgNPs at 120 mg Ag/L compared to controls (Fig. 6B, p < 0.05). However, the expression of SOD1 mRNA in liver tissues was not significantly affected by treatment with AgNPs (Fig. 6C).
3.7. Expression of oxyradical scavenging enzymes The mRNA expression of the oxyradical-scavenging enzymes catalase (Cat), glutathione peroxidase 1a (GPx1a), and superoxide dismutase 1 (SOD1) was analyzed in AgNP-treated zebrafish liver
3.8. DNA damage DNA damage in the liver tissues was detected using ␥-H2AX, a phosphorylated form of H2AX that is found at the sites of DNA double-strand breaks (Pilch et al., 2003). Among various types of DNA damage, double-strand breaks are considered the most biologically significant lesions in cells (Rothkamm and Lobrich, 2003). While ␥-H2AX was undetected in untreated controls and other treatment groups in western blot analysis, a high level of ␥-H2AX was detected in the 120 mg Ag/L AgNP treatment group, suggesting that AgNP induced DNA damage in the liver tissues (Fig. 7). We suggest that the induction of ␥-H2AX requires more than a certain level of genetic damage in the liver tissues of zebrafish. 3.9. Expression of apoptosis-related genes
Fig. 4. Expression of MT2 mRNA in the liver tissues of zebrafish treated with AgNPs for 24 h and untreated controls. The levels of MT2 mRNA are expressed relative to EF1␣ and presented as means ± S.E. (n = 4–5). The asterisks indicate significant differences between the groups at either end of the horizontal lines (p < 0.05).
p53 is involved in cellular stress response pathways, such as apoptosis, and serves to protect the organism from DNA-damaging stimuli (Lee et al., 2008). p53 protein was induced in a dosedependent manner after treatment with AgNPs in the liver tissues of zebrafish (Fig. 7). However, the mRNA level of p53 was not significantly affected by treatment with AgNPs (Fig. 8A). These data are consistent with the known mechanism of regulation of p53 in mammals, in which p53 protein is mainly regulated by posttranslational pathways (Kastan et al., 1991). In contrast, Chae et al. (2009) demonstrated the induction of hepatic p53 mRNA in
156
J.E. Choi et al. / Aquatic Toxicology 100 (2010) 151–159
Fig. 5. MDA content (A) and total GSH content (B) in the liver tissues of zebrafish treated with AgNPs for 24 h. Data are presented as means ± S.E. (n = 3–4). The asterisks indicate significant differences (p < 0.05) between the groups at either end of the horizontal lines.
Fig. 6. Expression of the oxyradical metabolism-associated mRNA species Cat (A), GPx1a (B), and SOD1 (C) in the liver tissues of zebrafish treated with AgNPs for 24 h and untreated controls. Levels of specific mRNA species are expressed relative to EF1␣ and presented as means ± S.E. (n = 4–5). The asterisks indicate significant differences between the groups at either end of the horizontal lines (p < 0.05).
Japanese medaka treated with AgNPs. This contrasting result may be due in part to strain differences in p53 regulation in response to AgNP exposure. Real-time RT-PCR was also performed to analyze the expression levels of p53 target genes, such as Bax, Noxa, and p21 (Fig. 8B–D). Pro-apoptotic Bax and Noxa mRNA species were upregulated after treatment with AgNPs in a dose-dependent manner with 5.6-fold and 1.7-fold increases, respectively, in the group treated with 120 mg Ag/L AgNP compared to controls (p < 0.05). It appears that Noxa expression reached an upper limit at a dose of 60 mg Ag/L. The cell cycle-associated p21 transcript was also upregulated 2.0fold after treatment with 120 mg Ag/L AgNP compared to controls. However, the expression of Blp1 mRNA, a pro-survival marker (Chakraborty et al., 2009), was not significantly altered by AgNP treatment in zebrafish liver tissues (Fig. 8E). 4. Discussion Fig. 7. Western blot analysis of ␥-H2AX and p53 in the liver tissues of zebrafish treated with various concentrations of AgNPs for 24 h and untreated controls. Actin was used as an internal control.
AgNPs tend to release free Ag+ ions and to agglomerate/aggregate in aqueous environments. The inherent instability of
J.E. Choi et al. / Aquatic Toxicology 100 (2010) 151–159
157
Fig. 8. Expression of p53 (A), Bax (B), Noxa (C), p21 (D), and Blp1 (E) mRNA species in the liver tissues of zebrafish treated with various concentrations AgNPs for 24 h and untreated controls. Levels of specific mRNA species are expressed relative to EF1␣ and presented as means ± S.E. (n = 4–5). The asterisks indicate significant differences between the groups at either end of the horizontal lines (p < 0.05).
AgNPs may contribute to toxicity and be a major concern in toxicity studies. In this study, zebrafish were treated with various concentrations of AgNP solution in which free Ag+ ions were absent at the time of treatment (Fig. 1). However, the possibility cannot be excluded that AgNPs release Ag+ ions in the aquarium and after being absorbed into the body (Santoro et al., 2007). It has been suggested that surface oxidation of AgNPs liberates Ag+ ions on contact with proteins (Asharani et al., 2009). In the present study, the metal-sensitive MT2 mRNA was induced in the liver tissues of AgNP-treated zebrafish (Fig. 4), suggesting that Ag+ ions were released from AgNPs and thus available in the tissues (Gonzalez et al., 2006). However, it is also possible that MT2 mRNA was induced by AgNP-generated free radicals. It has been demonstrated previously that MT mRNA is induced in rainbow trout gonadal cells after treatment with hydrogen peroxide (Kling and Olsson, 2000). In addition, MT mRNA levels are increased following exposure to benzo[a]pyrene in the liver tissues of olive flounder (An et al., 2008). Free Ag+ ions and AgNPs have been demonstrated to possess almost equivalent cytotoxicity, with IC50 s (half-maximal inhibitory
concentrations) of less than 5 mg Ag/L in various cytotoxicity assays (Kim et al., 2009). Ag+ ions display potent lethality to zebrafish with an LC50 of 22 g Ag/L (Griffitt et al., 2008), and exhibit toxicity to aquatic organisms at nanomolar concentrations (Hiriart-Baer et al., 2006; Lee et al., 2005). Thus, the high LC50 value for AgNPs in this study, approximately 250 mg Ag/L, suggests that AgNPs are not readily absorbed or bioavailable in zebrafish, presumably due to their bulky dimensions compared to Ag+ ions. Oxidative stress is an important factor in NP-induced toxicity (Nel et al., 2006). A possible role of oxidative stress in the induction and mediation of DNA damage and apoptosis has been documented (Simonian and Coyle, 1996). In light of those studies, our results demonstrate that AgNPs induce oxidative stress, DNA damage, and apoptosis in zebrafish liver tissues (Figs. 3, 5 and 7). The increased level of hepatic MDA, a byproduct of cellular lipid peroxidation, indicates that AgNP induced oxyradicals in the liver tissues (Fig. 5A). In addition, the induction of an endogenous antioxidant, GSH, suggests that the liver tissues respond defensively to the increased level of oxyradicals (Fig. 5B). GSH levels
158
J.E. Choi et al. / Aquatic Toxicology 100 (2010) 151–159
have been observed to increase in various cells and animal tissues exposed to oxidative stress-inducing xenobiotics including NPs (Arora et al., 2009; Li et al., 2008; Oberdörster, 2004; Wang et al., 2009). The increase in GSH levels is in agreement with previous studies addressing the effect of oxidative stress on induction of GSH-synthesizing enzymes (Mulcahy et al., 1997; Shi et al., 1994). Hydrogen peroxide is metabolized to water by Cat or GPx by GSH. The reduction of the levels of Cat and GPx, two major antioxidant enzymes, may thus result in the accumulation of hydrogen peroxide and other oxyradicals (Fig. 6), contributing to AgNPinduced oxidative damage. Atli et al. (2006) have shown that Cat activity is decreased by Ag in the liver of freshwater fish, although it is stimulated by other heavy metals such as copper, cadmium and zinc. Decreases of GPx and Cat mRNA species have been demonstrated in animals and cells exposed to toxicants (Gupta et al., 2006; Yamamoto et al., 2005). In contrast, the expression of SOD1 mRNA was not affected by AgNP treatment (Fig. 6). It has been demonstrated previously that expression of SOD is not affected in fish following treatment with zinc oxide NPs and heavy metals such as zinc and cadmium (Wong et al., 2010; Hansen et al., 2007). Activation of the transcription factor p53 in response to DNA damage can lead to cell cycle arrest or apoptosis (Langheinrich et al., 2002). p53 expression is tightly regulated at both the transcriptional and post-translational levels, but mainly at the posttranslational level. In this study, AgNP treatments caused DNA damage, as demonstrated by analysis of the double-strand break marker ␥-H2AX, and induction of p53 in the liver tissues (Fig. 7). The induction of p53 was mainly at the post-translational level, because p53 protein was increased although the mRNA level was unchanged (Fig. 8A). p21 was induced in the liver tissues after treatment with AgNPs (Fig. 8D). The p21 gene is under the control of p53, and p21 promotes p53-dependent cell cycle arrest or apoptosis (Chakraborty et al., 2009; Langheinrich et al., 2002). In addition, the p53-related pro-apoptotic Bcl-2 family genes, Bax and Noxa, were also induced after treatment with AgNPs, which might contribute to AgNPinduced apoptosis in the liver tissues (Fig. 8B and C). However, the expression of an anti-apoptotic Bcl-2 family gene, Blp1, was not affected in liver tissues of zebrafish after treatment with AgNPs (Fig. 8E) as shown in zebrafish embryos undergoing p53-dependent apoptosis (Chakraborty et al., 2009; Chen et al., 2001). In conclusion, we have characterized the hepatoxicity of AgNPs in zebrafish. This study provides one of the first overviews of AgNPinduced hepatotoxicity in adult fish. Our data demonstrates that oxidative stress, DNA damage, and apoptosis are associated with AgNP-induced hepatotoxicity in zebrafish. This research highlights the need for integrated environmental toxicological assessment of AgNPs. Acknowledgement This work was supported by the Eco-technopia 21 Project of the Korea Ministry of the Environment. References An, K.W., Shin, H.S., Choi, C.Y., 2008. Physiological responses and expression of metallothionein (MT) and superoxide dismutase (SOD) mRNAs in olive flounder, Paralichthys olivaceus exposed to benzo[a]pyrene. Comp. Biochem. Physiol. B 149, 534–539. Arora, S., Jain, J., Rajwade, J.M., Paknikar, K.M., 2009. Interactions of silver nanoparticles with primary mouse fibroblasts and liver cells. Toxicol. Appl. Pharmacol. 236, 310–318. Asharani, P.V., Mun, G.L.K., Hande, M.P., Valiyaveettil, S., 2009. Cytotoxicity and genotoxicity of silver nanoparticles in human cells. ACS Nano. 3, 279–290. Asharani, P.V., Wu, Y.L., Gong, Z., Valiyaveettil, S., 2008. Toxicity of silver nanoparticles in zebrafish models. Nanotechnology 19, 255102. Atli, G., Alptekin, Ö., T¨vkel, S., Canli, M., 2006. Response of catalase activity to Ag+ , Cd2+ , Cr6+ , Cu2+ and Zn2+ in five tissues of freshwater fish Oreochromis niloticus. Comp. Biochem. Physiol. C: Pharmacol. Toxicol. Endocrinol. 143, 218–224.
Bar-Ilan, O., Albrecht, R.M., Fako, V.E., Furgeson, D.Y., 2009. Toxicity assessments of multisized gold and silver nanoparticles in zebrafish embryos. Small 5, 1897–1910. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein–dye binding. Anal. Biochem. 72, 248–254. Chae, Y.J., Pham, C.H., Lee, J., Bae, E., Yi, J., Gu, M.B., 2009. Evaluation of the toxic impact of silver nanoparticles on Japanese medaka (Oryzias latipes). Aquat. Toxicol. 94, 320–327. Chakraborty, A., Uechi, T., Higa, S., Torihara, H., Kenmochi, N., 2009. Loss of ribosomal protein L11 affects zebrafish embryonic development through a p53-dependent apoptotic response. PLoS ONE 4, e4152. Chen, M.C., Gong, H.Y., Cheng, C.Y., Wang, J.P., Hong, J.R., Wu, J.L., 2001. Cloning and characterization of zfBLP1, a Bcl-XL homologue from the zebrafish, Danio rerio. Biochim. Biophys. Acta 1519, 127–133. Cohen, M.S., Stern, J.M., Vanni, A.J., Kelley, R.S., Baumgart, E., Field, D., Libertino, J.A., Summerhayes, I.C., 2007. In vitro analysis of a nanocrystalline silver-coated surgical mesh. Surg. Infect. (Larchmt.) 8, 397–403. Federici, G., Shaw, B.J., Handy, R.D., 2007. Toxicity of titanium dioxide nanoparticles to rainbow trout (Oncorhynchus mykiss): gill injury, oxidative stress, and other physiological effects. Aquat. Toxicol. 84, 415–430. Gerard-Monnier, D., Erdelmeier, I., Regnard, K., Moze-Henry, N., Yadan, J.C., Chaudiere, J., 1998. Reactions of 1-methyl-2-phenylindole with malondialdehyde and 4-hydroxyalkenals. Analytical applications to a colorimetric assay of lipid peroxidation. Chem. Res. Toxicol. 11, 1176–1183. Gonzalez, P., Baudrimont, M., Boudou, A., Bourdineaud, J.P., 2006. Comparative effects of direct cadmium contamination on gene expression in gills, liver, skeletal muscles and brain of the zebrafish (Danio rerio). Biometals 19, 225–235. Griffitt, R.J., Luo, J., Gao, J., Bonzongo, J.C., Barber, D.S., 2008. Effects of particle composition and species on toxicity of metallic nanomaterials in aquatic organisms. Environ. Toxicol. Chem. 27, 1972–1978. Gupta, R.K., Schuh, R.A., Fiskum, G., Flaws, J.A., 2006. Methoxychlor causes mitochondrial dysfunction and oxidative damage in the mouse ovary. Toxicol. Appl. Pharmacol. 216, 436–445. Hansen, B.H., Romma, S., Garmo, O.A., Pedersen, S.A., Olsvik, P.A., Andersen, R.A., 2007. Induction and activity of oxidative stress-related proteins during waterborne Cd/Zn-exposure in brown trout (Salmo trutta). Chemosphere 67, 2241–2249. Hiriart-Baer, V.P., Fortin, C., Lee, D.Y., Campbell, P.G.C., 2006. Toxicity of silver to two freshwater algae, Chlamydomonas reinhardtii and Pseudokirchneriella subcapitata, grown under continuous culture conditions: Influence of thiosulphate. Aquat. Toxicol. 78, 136–148. Hwang, E.T., Lee, J.H., Chae, Y.J., Kim, Y.S., Kim, B.C., Sang, B.I., Gu, M.B., 2008. Analysis of the toxic mode of action of silver nanoparticles using stress-specific bioluminescent bacteria. Small 4, 746–750. Kashiwada, S., 2006. Distribution of nanoparticles in the see-through medaka (Oryzias latipes). Environ. Health Perspect. 114, 1697–1702. Kastan, M.B., Onyekwere, O., Sidransky, D., Vogelstein, B., Craig, R.W., 1991. Participation of p53 protein in the cellular response to DNA damage. Cancer Res. 51, 6304–6311. Kim, S., Choi, J.E., Choi, J., Chung, K.H., Park, K., Yi, J., Ryu, D.Y., 2009. Oxidative stressdependent toxicity of silver nanoparticles in human hepatoma cells. Toxicol. In Vitro 23, 1076–1084. Kling, P.G., Olsson, P., 2000. Involvement of differential metallothionein expression in free radical sensitivity of RTG-2 and CHSE-214 cells. Free Radic. Biol. Med. 28, 1628–1637. Langheinrich, U., Hennen, E., Stott, G., Vacun, G., 2002. Zebrafish as a model organism for the identification and characterization of drugs and genes affecting p53 signaling. Curr. Biol. 12, 2023–2028. Lee, D.Y., Fortin, C., Campbell, P.G.C., 2005. Contrasting effects of chloride on the toxicity of silver to two green algae, Pseudokirchneriella subcapitata and Chlamydomonas reinhardtii. Aquat. Toxicol. 75, 127–135. Lee, K.C., Goh, W.L.P., Xu, M., Kua, N., Lunny, D., Wong, J.S., Coomber, D., Vojtesek, B., Lane, E.B., Lane, D.P., 2008. Detection of the p53 response in zebrafish embryos using new monoclonal antibodies. Oncogene 27, 629–640. Lee, K.J., Nallathamby, P.D., Browning, L.M., Osgood, C.J., Xu, X.H.N., 2007. In vivo imaging of transport and biocompatibility of single silver nanoparticles in early development of zebrafish embryos. ACS Nano. 1, 133–143. Li, H., Zhang, J., Wang, T., Luo, W., Zhou, Q., Jiang, G., 2008. Elemental selenium particles at nano-size (Nano-Se) are more toxic to Medaka (Oryzias latipes) as a consequence of hyper-accumulation of selenium: a comparison with sodium selenite. Aquat. Toxicol. 89, 251–256. Lin, S.H., Lai, S.L., Leu, H.G., 2000. Removal of heavy metals from aqueous solution by chelating resin in a multistage adsorption process. J. Hazard. Mater. B76, 139–153. Maynard, A.D., Kuempel, E.D., 2005. Airborne nanostructured particles and occupational health. J. Nanopart. Res. 7, 587–614. Mulcahy, R.T., Wartman, M.A., Bailey, H.H., Gipp, J.J., 1997. Constitutive and betanaphthoflavone-induced expression of the human gamma-glutamylcysteine synthetase heavy subunit gene is regulated by a distal antioxidant response element/TRE sequence. J. Biol. Chem. 272, 7445–7454. Navarro, E., Piccapietra, F., Wagner, B., Marconi, F., Kaegi, R., Odzak, N., Sigg, L., Behra, R., 2008. Toxicity of silver nanoparticles to Chlamydomonas reinhardtii. Environ. Sci. Technol. 42, 8959–8964. Nel, A., Xia, T., Mädler, L., Li, N., 2006. Toxic potential of materials at the nanolevel. Science 311, 622–627.
J.E. Choi et al. / Aquatic Toxicology 100 (2010) 151–159 Oberdörster, E., 2004. Manufactured nanomaterials (Fullerenes, C60) induce oxidative stress in the brain of juvenile largemouth bass. Environ. Health Perspect. 112, 1058–1062. Oberdörster, E., Zhu, S., Blickley, T.M., McClellan-Green, P., Haasch, M.L., 2006. Ecotoxicology of carbon-based engineered nanoparticles: effects of fullerene (C60) on aquatic organisms. Carbon 44, 1112–1120. Pilch, D.R., Sedelnikova, O.A., Redon, C., Celeste, A., Nussenzweig, A., Bonner, W.M., 2003. Characteristics of ␥-H2AX foci at DNA double-strand breaks sites. Biochem. Cell Biol. 81, 123–129. Rothkamm, K., Lobrich, M., 2003. Evidence for a lack of DNA double-strand break repair in human cells exposed to very low X-ray doses. Proc. Natl. Acad. Sci. U.S.A. 100, 5057–5062. Santoro, C.M., Duchsherer, N.L., Grainger, D.W., 2007. Minimal in vitro antimicrobial efficacy and ocular cell toxicity from silver nanoparticles. Nanobiotechnology 3, 55–65. Shi, M.M., Kugelman, A., Iwamoto, T., Tian, L., Forman, H.J., 1994. Quinone-induced oxidative stress elevates glutathione and induces gamma-glutamylcysteine synthetase activity in rat lung epithelial L2 cells. J. Biol. Chem. 269, 26512–26517. Simeonova, A., Godjevargova, T., Vladkova, D., 2006. Copper sorption from aqueous solutions by plasma modified polyacrylonitrile beads. Polym. Bull. 57, 765–773. Simonian, N.A., Coyle, J.T., 1996. Oxidative stress in neurodegenerative diseases. Annu. Rev. Pharmacol. Toxicol. 36, 83–106. Skebo, J.E., Grabinski, C.M., Schrand, A.M., Schlager, J.J., Hussain, S.M., 2007. Assessment of metal nanoparticle agglomeration, uptake, and interaction using high-illuminating system. Int. J. Toxicol. 26, 135–141. Smith, C.J., Shaw, B.J., Handy, R.D., 2007. Toxicity of single walled carbon nanotubes to rainbow trout, (Oncorhynchus mykiss): respiratory toxicity, organ pathologies, and other physiological effects. Aquat. Toxicol. 82, 94–109.
159
Sondi, I., Salopek-Sondi, B., 2004. Silver nanoparticles as antimicrobial agent: a case study on E. coli as a model for Gram-negative bacteria. J. Colloid Interface Sci. 275, 177–182. Tietze, F., 1969. Enzymic method for quantitative determination of nanogram amounts of total and oxidized glutathione: applications to mammalian blood and other tissues. Anal. Biochem. 27, 502–522. Usenko, C.Y., Harper, S.L., Tanguay, R.L., 2007. In vivo evaluation of carbon fullerene toxicity using embryonic zebrafish. Carbon 45, 1891– 1898. Wallace, W.E., Keane, M.J., Murray, D.K., Chisholm, W.P., Maynard, A.D., Ong, T.M., 2007. Phospholipid lung surfactant and nanoparticle surface toxicity: lessons from diesel soots and silicate dusts. J. Nanopart. Res. 9, 23– 38. Wang, J.X., Fan, Y.B., Gao, Y., Hu, Q.H., Wang, T.C., 2009. TiO2 nanoparticles translocation and potential toxicological effect in rats after intraarticular injection. Biomaterials 30, 4590–4600. Wong, S.W.Y., Leung, P.T.Y., Djurisic, A.B., Leung, K.M.Y., 2010. Toxicities of nano zinc oxide to five marine organisms: influences of aggregate size and ion solubility. Anal. Bioanal. Chem. 396, 609–618. Yamamoto, T., Kikkawa, R., Yamada, H., Horii, I., 2005. Identification of oxidative stress-related proteins for predictive screening of hepatotoxicity using a proteomic approach. J. Toxicol. Sci. 30, 213–227. Yon, J.N., Lead, J.R., 2008. Manufactured nanoparticles: an overview of their chemistry, interactions and potential environmental implications. Sci. Total Environ. 400, 396–414. Zhu, S., Oberdörster, E., Haasch, M.L., 2006. Toxicity of an engineered nanoparticle (fullerene, C60) in two aquatic species, daphnia and fathead minnow. Mar. Environ. Res. 62, S5–S9.