Induction of phenolic and flavonoid compounds in leaves of saffron (Crocus sativus L.) by salicylic acid

Scientia Horticulturae 257 (2019) 108751

Contents lists available at ScienceDirect

Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti

Induction of phenolic and flavonoid compounds in leaves of saffron (Crocus sativus L.) by salicylic acid

T

⁎

Somayeh Tajika, Fatemeh Zarinkamara, , Bahram Mohammad Soltanib, Mehrdad Nazaria a b

Department of Plant Biology, Faculty of Biological Sciences, Tarbiat Modares University, Tehran, Iran Department of Genetics, Faculty of Biological Sciences, Tarbiat Modares University, Tehran, Iran

A R T I C LE I N FO

A B S T R A C T

Keywords: Histochemistry Phenolic compounds Phenylalanine ammonia-lyase Saffron Salicylic acid

Phenolic and flavonoid compounds have received specific attention for their applications in various industries. Salicylic acid (SA) plays an important role in the production of bioactive compounds in plants. Because of the significance of phenolic compounds as a potent antioxidant and their occurrence in saffron (Crocus sativus L.) organs, the present research was directed to assess the impacts of different concentrations of SA (0.01, 0.1 and 1 mM) on the phenolic and flavonoid contents in the leaves of saffron. The activity and gene expression of phenylalanine ammonia-lyase (PAL) enzyme were additionally estimated. Besides, histochemical investigations were done in order to localize in situ phenolic and flavonoid compound aggregation areas in the leaves. For this purpose, the corms of saffron were pretreated for 12 h with various concentrations of SA and after that were planted under a greenhouse condition. According to the acquired results, SA fundamentally increased the total phenolic and flavonoid contents as well as the activity and gene expression of PAL enzyme in the leaves of SApretreated plants against non-SA-pretreated plants. Nevertheless, the impact of SA pretreatment varied relying on the applied concentration of SA. The results of histochemical investigation affirmed the results of biochemical investigations.

1. Introduction Plants are potential wellsprings of bioactive compounds that are present in the form of secondary metabolites in various organs. Among secondary metabolites, phenolic and flavonoid compounds are natural antioxidants that are generally distributed in plants (Wojdyło et al., 2007). In many published papers, the antioxidant capacities of plants have been related with the existence of phytochemical compounds like anthocyanins, phenolic acids, flavonoids, and tannins (Baba et al., 2015; Blandón et al., 2017; Naczk et al., 2003). Saffron (Crocus sativus L.) is recognized as a profitable economic product but, during processing, a large quantity of leaves, approximately 1500 kg to get one kilogram of saffron is required. Besides, several researchers have demonstrated that various organs of this plant are sources of natural compounds with different antioxidant activities (Sánchez-Vioque et al., 2012; Zheng et al., 2011). Furthermore, the antioxidant capacity of the plant organs has been ascribed to the differences in the content of phenolic and flavonoid compounds (Baba et al., 2015; Goli et al., 2012; Termentzi and Kokkalou, 2008). It has been generally known that the secondary metabolite content

in plants is influenced by intrinsic and environmental factors (Nazari et al., 2018). The presence of these metabolites in plants relies upon many factors such as cultural conditions, climate factors, soil, and genetic background (Mikulajová et al., 2016). The biosynthesis and aggregation of phytochemical metabolites in plants can be activated through the stress-related compounds like methyl jasmonate and salicylic acid (SA) (Matkowski et al., 2008). SA as a non-enzyme antioxidant and growth controller plays an important role in regulating a number of physiological, biochemical and molecular processes in plants (Ashraf et al., 2010). In recent years, the impact of SA on the accumulation of secondary metabolites have been investigated in several plants like Uncaria tomentosa (SánchezRojo et al., 2015), Rumex vesicarius (Sayed et al., 2016), Salvia miltiorrhiza (Hao et al., 2015), Agrostis stolonifera (Li et al., 2017), Capsicum annuum (Zunun-Pérez et al., 2017), Centella asiatica (Ibrahim et al., 2017), Brassica napus (Gill et al., 2016), Thevetia peruviana (Mendoza et al., 2018) and Salvia miltiorrhiza (Li et al., 2016). Accordingly, SA an important plant signaling molecule has been recognized as a strategy to activate the secondary metabolism in plants (Giri and Zaheer, 2016; Kumari et al., 2018).

⁎ Corresponding author at: Department of Plant Biology, Faculty of Biological Sciences, Tarbiat Modares University, Jalal- Al-Ahmad Highway, Nasr Bridge, Tehran, Iran. E-mail address: [email protected] (F. Zarinkamar).

https://doi.org/10.1016/j.scienta.2019.108751 Received 3 June 2019; Received in revised form 3 August 2019; Accepted 7 August 2019 0304-4238/ © 2019 Elsevier B.V. All rights reserved.

Scientia Horticulturae 257 (2019) 108751

S. Tajik, et al.

2.2.2. Total phenolic compounds The total phenolic compound content was determined spectrophotometrically utilizing Folin–Ciocalteu reagent. To 2.5 mL of 10% (v/ v) Folin, 0.5 mL of supernatant was added and the subsequent mixture was put at room temperature for 5 min. Then, 2 mL of 7.5% sodium carbonate was added. After 90 min, the absorbance of each sample was determined at 765 nm against the blank. The total phenolic compounds content of the extract was quantified based on the standard curve expressed as mg gallic acid per gram of extract (Pinelo et al., 2004).

Phenylalanine ammonia-lyase (PAL, EC 4.3.1.5) is a key regulatory enzyme for the metabolism of many secondary metabolites, such as phenolic compounds, that catalyzes a reaction converting L-phenylalanine to ammonia and trans-cinnamic acid (Mrázová et al., 2017). It has been suggested that PAL enzyme has a regulatory role in the biosynthesis of SA, as a phenolic compound, in some plants (Chen et al., 2009). However, the possible relationships and interactions between SA, the phenolic compounds biosynthesis, and the secondary metabolism enzymes (such as PAL) are not well known. Notwithstanding the known significant roles of phenolic and flavonoid compounds in plants, these beneficial compounds have numerous applications in medicinal, pharmaceutical and nourishment ventures (Chouhan et al., 2017). Nonetheless, there are not any published reports about the impact of various concentrations of SA on the content of phenolic compounds, localization of these compounds, and the activity, and gene expression of PAL enzyme in the leaves of saffron. Clearly, additional researches are needed in this field because the factors regulating the biosynthesis and aggregation of secondary metabolites like phenolic and flavonoid compounds in plants are inadequately comprehended. Furthermore, leaves of saffron are discarded as byproducts generated during the processing of the stigmas. Therefore, because of the SA role in plants and the yearly loss of saffron by-products, the impact of various concentrations of SA on the content of phenolic and flavonoid compounds as well as the activity and gene expression of PAL enzyme in the leaves was explored. Histochemical investigation was also utilized to localize the aggregation sites of these valuable compounds inside the leaf tissues. This investigation was required to better understand the effect of SA on the aggregated distribution of phenolic and flavonoid compounds.

2.2.3. Total flavonoid compounds The total flavonoid compound content was measured utilizing aluminium chloride colorimetric method. In this method, 100 μL of 1 M potassium acetate was added to 0.5 mL of extract and after 5 min, 100 μL of 10% (v/v) aluminium chloride was added to the mixture. Then, 1.5 mL of 80% (v/v) methanol and 2.8 mL of deionized water were added to the solution. After 30 min, the absorbance of samples was perused at 415 nm. To ascertain the total flavonoid compound content, a standard curve was drawn utilizing routine and the content of total flavonoid compounds was expressed as mg of routine in gram of dry weight (Chang et al., 2002). 2.3. Assay of PAL (EC 4.3.1.5) activity PAL activity was estimated as described by Shang et al. (2012). The leaves (300 mg) were extracted with a solution containing 5 mL 0.06 M sodium borate buffer (pH 8.8), 5 mM b-mercaptoethanol, and 3% (w/v) PVPP. The subsequent supernatant was centrifuged and filtered, and the reaction was initiated through the addition of 5 mL of 0.06 M L-phenylalanine. The reaction was ceased through the addition of 0.5 mL of 35% (w/v) trifluoroacetic acid (TFA) after incubation at 37 °C for 1 h, and then centrifuged for 10 min at 5000 g. The PAL activity was monitored through the production of cinnamate during 1 h at 30 °C, as measured through the absorbance change of the supernatant at 290 nm.

2. Materials and methods 2.1. Pretreatment, planting, and sampling The corms of saffron (Crocus sativus L.) were collected from the farms situated in Torbat-e Heydarieh (Razavi Khorasan province, Iran). The corms were weighed, and the intact and heavier samples were then chosen (average weights of corms were 10.35 g). Afterward, the corms were drenched in 20% sodium hypochlorite solution for 20 min with 5% superficial antiseptic chlorine for surface sterilization and then rinsed with distilled water. The SA solutions (0.01, 0.1, and 1 mM) were prepared by dissolving SA powder in distilled water with stirring. These concentrations were selected based on the results of the preliminary experiment, which indicated that at these concentrations the effect of SA on phenolic and flavonoid compounds could be clearly observed. For pretreatment, the corms were immersed in SA solutions at the concentrations mentioned above for 12 h in darkness at 25 °C. The control plants were pretreated with equal amount of the distilled water (without SA) in the same way. After the pretreatment period, the corms were planted in the pots containing perlite and were irrigated with Hoagland nutrient solution two times each week. This was done in a completely randomized design with three replications per treatment. Eventually, at the same time as the flowers emerged, the leaves were gathered for the biochemical, molecular and histochemical assessments.

2.4. Assay of PAL gene expression Total RNA from the leaves of non-SA-pretreated and SA-pretreated (0.01, 0.1, and 1 mM) plants was extracted utilizing RNX-plus kit (RN7713C, CinnaGen, Iran), as per manufacturer’s protocol. Then, RNA was qualified on the agarose gel and quantified utilizing spectrophotometry. In the following stage, cDNA was prepared from 1 to 2 μg total RNA as previously mentioned by Zarinkamar et al. (2012). The primers sequences utilized for the quantification of the mRNA expression were shown in Table 1. To date, PAL gene has not been sequenced in the saffron leaves, therefore, the primers were designed based on the highly conserved nucleotide sequences of other reported plants such as Phoenix dactylifera, Ananas comosus, Musa acuminata, Zea mays and Setaria italica. The housekeeping gene tubulin was utilized as the standard gene in this examination. The semi-quantitative RT-PCR was carried out as previously described by Nazari et al. (2017). After PCR, the samples were separated on 1.7% agarose gel and visualized through ethidium bromide. The gel pictures were acquired utilizing Gel-Doc Transilluminator (UVP

2.2. Total phenols and flavonoids determinations

Table 1 List of specific primers utilized in qRT-PCR.

2.2.1. Preparation of extract The samples were dried in oven at 50 °C for 24 h and then powdered with mortar and pestle. Powdered sample (0.1 g) was extracted with 10 ml of 80% (v/v) methanol in a warm bath for 3 h at 70 °C. The subsequent mixture was centrifuged for 20 min in 5000 g and the subsequent supernatant was filtered with Whatman No.4 filter paper and utilized for the measurements of the contents of phenolic and flavonoid compounds (Niknam and Ebrahimzadeh, 2002).

Gene

Primer name

Sequence (5' to 3')

Tm (oC)

Product length (bp)

Tubulin

Tubulin F Tubulin R PAL F PAL R

ATGATTTCCAACTCGACCAGTGTC ATACTCATCACCCTCGTCACCATC CGGCGTCACCACCGGCTTC CAAGATCTCGACCGCCTCCG

54.8 58.2 63.6 59.8

225

PAL

2

800

Scientia Horticulturae 257 (2019) 108751

S. Tajik, et al.

hydrogen donor, thus acting as an effective antioxidant (Chen et al., 2003; Ghasemzadeh et al., 2012). One of the important activities of SA in plants is the induction of secondary metabolites and the subsequent activation of defensive reactions in them. The previous investigators have demonstrated that the utilization of SA increased the production of alkaloids, anthraquinones, glucosinolates and capsicinoids in plants (Zhao et al., 2005). Since SA as an important signaling molecule, has diverse roles in the regulation of physiological, biochemical and molecular processes, it can influence the growth, development, and production of secondary metabolites in plants (Khan et al., 2015). The earlier study by War et al. (2011) showed that the SA application enhanced the accumulation of total phenols in chickpea. In the recent study by Syeed et al. (2011), the SA caused changes in photosynthesis, nutrients content and antioxidant metabolism in two mustard (Brassica juncea L.) cultivars. The findings of Dong et al. (2010) also indicated that SA enhanced the accumulation of salicylic acid-induced phenolic compounds and activities of secondary metabolic and antioxidative enzymes in Salvia miltiorrhiza cell culture. Also, Ibrahim et al. (2017) found that SA could enhance the photosynthesis, secondary metabolites, antioxidant and lipoxygenase inhibitory activity in Centella asiatica. Moreover, the SA pretreatment improved the antioxidant systems in maize genotypes (Saruhan et al., 2012), Prunus persica (Wang et al., 2006), Citrus sinensis (Huang et al., 2008) and eggplant seedlings (Chen et al., 2011). Besides that, in a study by Shakirova et al. (2003), changes in the hormonal status of wheat seedlings were found with SA pretreatment. According to the results acquired from relevant previous investigations, the detected changes in the content of phenolic compounds may be due to the impact of SA pretreatment on the genes expression (Wen et al., 2005) as well as the pattern and activity of proteins (Dong et al., 2010) associated with the biosynthetic pathway of phenolic and flavonoid compounds. Furthermore, the observed increase in the content of phenolic and flavonoid compounds in the saffron leaves can be due to the production of reactive oxygen species (ROS) by SA and its role in signaling (Tewari and Paek, 2011).

Bioimaging system, USA). Subsequently, densitometric analyses of all the gel bands were performed utilizing the image j program. 2.5. Analysis of phenolic compounds by HPLC Extract preparation for high performance liquid chromatography (HPLC) analysis was done according to the procedure of Bourgou et al. (2008) with some modification as follows; 0.1 g of fine powder of the leaves was extracted with 10 ml absolute methanol for 24 h in the dark. The samples were centrifuged at 15,000 g for 30 min and the subsequent supernatant was filtered (0.45 μm) and methanol evacuated through rotary evaporator. Lastly, the extract was dissolved in 200 μl methanol and 20 μl infused to HPLC. A Knauer HPLC system equipped with a reversed-phase column (250 × 4.6 mm, C18-ODS3) was utilized. For phenolic acids, a linear gradient of acetonitrile (10–50%) in water (1% (v/v) acetic acid) was utilized as a mobile phase for a maximum elution time of 40 min at room temperature. Besides, for flavonoid compounds, the mobile phase consisted of absolute methanol (10–70%) in water (1% (v/v) acetic acid) for a maximum elution time of 35 min. The flow rate was 1.0 ml/ min. Phenolic acids and flavonoids were detected at 280 nm and 360 nm, respectively. The quantitative determination of these compounds was performed utilizing external standards through the calibration curves of these compounds. 2.6. Histochemical investigations For examination of phenolic compounds localization in the leaves tissue, Neu’s regent was utilized (Mondolot-Cosson and Andary, 1993). After preparation of the reagent, the segments of leaves that were newly prepared were placed in the reagent for 30 s, they were placed in glycerol-water (90-10) for 1 min and after that samples were investigated with a fluorescent microscope (365 nm excitation filter). UV radiation was used to stimulate DAPI fluorescence. In this condition, the phenolic and flavonoid compounds were clearly seen under fluorescence microscope.

3.2. PAL enzyme

2.7. Statistical analysis

The relative expression level of PAL gene was fundamentally enhanced in the leaves of saffron plants with increasing concentration of SA (P < 0.05) (Fig. 1B). The relative expression level of PAL gene in the plants pretreated with 0.01, 0.1, and 1 mM of SA was increased by 1.4-, 1.8-, and 2.2-fold, respectively, compared to the non-SA-pretreated plants. Accordingly, the lowest and the highest expression levels of PAL gene were found in the non-SA-pretreated plants and the 1 mMpretreated plants, respectively. Therefore, with increasing the SA concentration, the relative expression level of PAL gene increased. Our data demonstrated that there was a positive relationship between the PAL expression level and the concentration of SA pretreatment. According to these results, we suggest that increased expression of PAL gene may be one of the reasons that the content of phenolic compounds in the SApretreated was higher than that in the non-SA-pretreated plants. These observations appear to indicate that SA acts as signaling molecule that causes specific changes in gene expression levels. It has been previously demonstrated that environmental factors influence the expression of genes associated with the biosynthesis of secondary metabolites in plants (Nazari et al., 2017). In the past years, various analyses have revealed that external utilization of SA activates signaling pathways that result in the regulation of genes encoding the enzymes associated with the secondary metabolite biosynthesis in plants (Wang et al., 2007; Zhu et al., 2011). These data suggest that pretreatment with SA could induce the expression of genes involved in metabolism of phenolic compounds. Our results are consistent with the notion that SA can prompt mRNA level of PAL in plants such as pharbitis (Wada et al., 2014) and grape berry (Wen et al., 2005). Morris et al. (2000) reported that SA has a role in regulating gene expression in Arabidopsis plants. The similar effect was also observed by Kiselev et al. (2010) in Vitis

The data acquired in the present investigations were statistical analysed utilizing SPSS software version 23. Duncan's multiple range tests were applied to compare the group means and P-value ≤0.05 was considered as significant. 3. Results and discussion 3.1. Total phenolic and flavonoid compounds Total phenolic and flavonoid compound contents in the leaves of saffron plants influenced by various SA concentrations demonstrated that the contents of these compounds in the SA-pretreated plants were higher than that of the non-SA-pretreated plants (Fig. 1). The lowest and highest contents of total phenolic and flavonoid compounds were seen in the non-SA-pretreated group and plants pretreated with 1 mM of SA, respectively. Thus, the impact of SA pretreatment on the content of these compounds was positive and they increased according to the increment of SA concentration. The results showed that SA pretreatment increased the secondary metabolism in the leaf tissues as indicated by the increased accumulation of phenolic and flavonoid compounds. These findings indicate that the pretreatment with SA is recommended when the objective is the production of phenolic and flavonoid compounds. When a plant is exposed to stressful environmental factors, the antioxidant system of plant plays a crucial protective role through enhancing the content of certain compounds. Plant-derived secondary metabolites, like phenolic and flavonoid compounds, effectively act as a 3

Scientia Horticulturae 257 (2019) 108751

S. Tajik, et al.

Fig. 1. Impact of various concentrations of salicylic acid pretreatment on the content of total phenolic and flavonoid compounds (A), relative expression of PAL gene (B) and specific activity of PAL enzyme (C) in the leaves of Crocus sativus. Distinctive letters show significant differences (P < 0.05).

plant has been proven. The observed relationship between the gene expression and activity of PAL enzyme, SA and phenolic and flavonoid compounds may express the regulatory role of SA in the biosynthesis of phenolic compounds in the saffron leaves. The results indicated that SA activated PAL by increasing the accumulation of PAL mRNA and enzyme activity. The findings from this present study indicated that the PAL gene expression, PAL activity, and phenolic compound accumulations were increased obviously after the SA pretreatment, indicating that PAL is the key enzyme in regulating the biosynthesis and accumulation of phenolic compounds in saffron plant.

amurensis cell culture. The activity of PAL enzyme was also fundamentally enhanced following the SA pretreatment (P < 0.05) (Fig. 1C). The activity of this enzyme in the leaves pretreated with 0.01, 0.1, and 1 mM of SA were increased by 1.1-, 1.4-, and 1.7-folds, respectively, and the highest SA concentration (1 mM) resulted in the highest activity of PAL in the leaves of saffron plants. As a result of the increased PAL activity, phenylpropanoid derivatives (such as phenolic acids and flavonoids) accumulated in the SA-affected tissues and were thought to have an important function in the physiology of plant cells. Thus, the SA-induced phenolic compound accumulations may be related to the PAL activity. However, the increase in PAL activity could explain the subsequent changes of phenolic and flavonoid compounds. Some studies on plants like Salvia miltiorrhiza (Dong et al., 2010) and pharbitis (Wada et al., 2014) have demonstrated that SA induced the enzymatic activity of PAL which is a key enzyme for biosynthesis of phenolic compounds. The results acquired in the present study confirmed this opinion. The previous investigation also demonstrated that SA influences the pattern of proteins in barley plant (Mutlu et al., 2013). In plants, the activity of various enzymes determines the biosynthesis and accumulation of phenolic compounds (Tomás‐Barberán and Espín, 2001). Wen et al. (2008) revealed that exogenous SA could prompt an increase in the mRNA level of PAL gene in grape berry. In addition, report by Campos et al. (2003) also found that SA improved the activity of PAL enzyme in four cultivars of the common bean. In fact, SA, by affecting the activity of PAL enzyme, activates the phenylpropanoid pathway and increases the production of phenolic compounds in plant (Dong et al., 2010). An increase in the gene expression and enzymatic activity of PAL leads to an increase in the accumulation of phenolic compounds in plant. In a study by Chaman et al. (2003), a positive correlation between the activity of PAL enzyme and the content of phenolic compounds in barley

3.3. Analysis of phenolic and flavonoid compounds HPLC examination of some phenolic acids and flavonoid compounds in the leaves of non-SA-pretreated and SA-pretreated plants were shown in Table 2. The results demonstrated that SA pretreatment changed the content of phenolic and flavonoid compounds in the leaves of saffron plants in a concentration-dependent fashion. In this work, the lowest and highest contents of gallic acid, cinnamic acid, and ferulic acid were found in the non-SA-pretreated and 0.1 mM-pretreated plants, respectively. These results showed that the contents of these compounds first increased and then began to decrease with increasing concentration of SA. However, their contents were higher than that in the non-SA-pretreated plants. In addition, the highest contents of coumaric acid, caffeic acid, and salicylic acid were observed in plants pretreated with 1 mM of SA, while the lowest contents of them were recorded in the non-SA-pretreated plants. For quercetin, the lowest and highest contents of quercetin were observed in the non-SA-pretreated and 0.01 mM-pretreated plants, respectively. The lowest and highest contents of Kaempferol were found in the 0.01 mM-pretreated and 1 mM4

Scientia Horticulturae 257 (2019) 108751

S. Tajik, et al.

Table 2 Impact of various concentrations of salicylic acid pretreatment on the contents of phenolic and flavonoid compounds in the leaves of Crocus sativus. Each value is average of five independent replicates, with standard deviations. Distinctive letters showed significant differences (P < 0.05). Phenolic compounds

Gallic acid (mg g−1DW) Cinnamic acid (mg g−1DW) Coumaric acid (mg g−1DW) Caffeic acid (mg g−1DW) Ferulic acid (mg g−1DW) Salicylic acid (mg g−1DW) Quercetin (mg g−1DW) Kaempferol (mg g−1DW)

Salicylic acid (mM) 0

0.01

0.1

1

0.087 ± 0.006 c 0.087 ± 0.0025 c 0.061 ± 0.0031 b 0.0117 ± 0.0023 b 0.011 ± 0.002 d 0.145 ± 0.004 c 0.0014 ± 0.003 d 0.0026 ± 0.0005 b

0.11 ± 0.001 b 0.097 ± 0.0028 b 0.069 ± 0.0026 ab 0.0167 ± 0.0034 ab 0.112 ± 0.006 c 0.185 ± 0.008 b 0.0121 ± 0.002 a 0.0013 ± 0.0006 c

0.138 ± 0.009 a 0.119 ± 0.045 a 0.071 ± 0.0032 ab 0.017 ± 0.0046 ab 0.222 ± 0.006 a 0.207 ± 0.008 ab 0.0056 ± 0.0001 c 0.0034 ± 0.0008 b

0.118 ± 0.007 b 0.098 ± 0.0057 b 0.079 ± 0.0053 a 0.0199 ± 0.0053 a 0.203 ± 0035 b 0.228 ± 0.009 a 0.0064 ± 0.0004 b 0.0123 ± 0.0009 a

yellow fluorescence in the palisade parenchyma, vascular bundles, and sclerenchyma tissues in 1 mM pretreatment demonstrated an augmentation in the flavonoids content in previously mentioned pretreatment. The pretreatment with SA can induce the increase in accumulation of secondary metabolites in the plant tissues. This was shown by an increase in accumulation of phenolic and flavonoid compounds in the leaves as the concentration enhanced from 0 to 1 mM. These results indicated that SA pretreatment regulate the biosynthesis and accumulation of phenolic and flavonoid compounds in the leaves of saffron plants. It is possible that the increase in production of phenolic and flavonoid compounds in the tissues could be attributed to an increase in PAL activity in SA-pretreated plants. Generally, phenolic and flavonoid compounds have been reported to react to changes in the external conditions in various plants like grape berry (Blancquaert et al., 2019) and Vaccinium corymbosum (Manquián-Cerda et al., 2016). The significant augmentation of phenolic and flavonoid compounds in the leaves tissue can be straightforwardly related to the role of SA in the regulation of secondary metabolism in plants. In an investigation in palm plants exposed to fungal pathogens, SA caused protection against pathogenic agents and prevented the infiltration of pathogenic agents into the root tissues through the induction of biosynthesis of phenolic compounds (Dihazi et al., 2011). In line with our findings, histochemical investigation through Neu’s regent affirmed the aggregation of phenolic compounds in the roots of date palm (Dihazi et al., 2011).

pretreated plants, respectively. The changes in the content of phenolic acids and flavonoid compounds did not exhibit the same trend, indicating that the enzymes involved in their metabolism may be differently affected by SA pretreatments. Phenolic and flavonoid compounds protect plants against herbivores, pathogens, and abiotic stresses, and ensure the plant's survival by attracting pollinating insects (Ferreres et al., 2008). According to the data acquired from HPLC investigation, it could be the reason that the content of phenolic and flavonoid compounds in the leaves of saffron is largely dependent on external factors. These outcomes propose that the content of phenolic acids and flavonoid compounds in the leaves is related to SA concentration. In concurrence with our findings, several investigations had in like manner shown that the metabolism of phenolic compounds was changed in the SA-pretreated plants of grape berries (Chen et al., 2006) and Matricaria chamomilla (Kováčik et al., 2009). In such manner, the relationship between the SA pretreatment, gene expression and activity of PAL enzyme and content of phenolic compounds, indicating the regulatory role of SA in the biosynthesis of phenolic compounds in plants. Moreover, in the previous study, Pu et al. (2009) indicated that SA application activates artemisinin biosynthesis in Artemisia annua. Ghasemzadeh and Jaafar (2012) revealed that the SA application altered the quality and quantity of some phenolic acids and flavonoid compounds in Zingiber officinale. Tewari and Paek (2011) have also shown that SA-induced nitric oxide and ROS generation stimulate the ginsenoside accumulation in Panax ginseng. 3.4. Histochemical investigation

4. Conclusion

In the present investigation, notwithstanding the biochemical analysis of phenolic compounds, histochemical investigations were performed with the Neu’s reagent to localize the aggregation areas of phenolic and flavonoid compounds in the tissues of saffron’ leaves (Fig. 2). In the leaves of plants, the phenolic and flavonoid compounds were obviously seen in the different tissues of epidermis, the cell walls of cortical parenchyma and vascular bundles, sclerenchyma, and stomata. By and large, phenolic acids that were mainly found in the cell walls of cortical and vascular bundles parenchyma were stained blue and flavonoid compounds stained greenish yellow through Neu’s reagent under UV light. According to biochemical results, SA caused an augmentation in the content of phenolic and flavonoid compounds in the leaves of pretreated plants as compared with the non-SA-pretreated plants. The results gained from the histochemical investigation, as appeared in Figs. 2 and 3, demonstrating the increased aggregation of these compounds in the SA-pretreated plants compared to the non-SA-pretreated plants. As biochemical investigations demonstrated that the highest contents of total phenolic and flavonoid compounds were observed in the leaves of plants pretreated with 1 mM of SA. The histochemical investigation of phenolic and flavonoid compounds in the leaves likewise demonstrated an increased content of them in the pretreatment of 1 mM compared to other pretreatments and non-SA-pretreated plants. The intensity of

Due to the economic, medical, pharmaceutical, and cosmetic importance of phenolic and flavonoid compounds, numerous researchers are searching for approaches to augment the content of these compounds in plants. The current effort described for the first time the SA impacts on the quantity of phenolic and flavonoid compounds, the gene expression and activity of PAL enzyme in the leaves of saffron. Furthermore, the histochemical investigation was utilized to localize the aggregation areas of these compounds, which possesses antioxidant properties. Results demonstrated that the phenolic and flavonoid compounds contents and the gene expression and activity of PAL enzyme in the leaves of saffron pretreated with SA were fundamentally higher than that of non-SA-pretreated. Therefore, it can be reasoned from these results that SA can be a powerful tool to increase the content of phenolic and flavonoid compounds in plants. Notwithstanding, further research is needed to investigate a wider range of concentrations and comprehend the accurate mechanisms through which SA influences the content and aggregation of phenolic and flavonoid compounds in plants. Declaration of Competing Interest None. 5

Scientia Horticulturae 257 (2019) 108751

S. Tajik, et al.

Fig. 2. Histochemical investigation of phenolic and flavonoid compounds in the transversal section of Crocus sativus leaves under various concentrations of salicylic acid pretreatment. A: 0, B: 0.01, C: 0.1 and D: 1 mM. composition and biological activities of Tunisian Nigella sativa L. shoots and roots. C. R. Biol. 331, 48–55. Campos, Â.D., Ferreira, A.G., Hampe, M.M.V., Antunes, I.F., Brancão, N., Silveira, E.P., Silva, J.Bda, Osório, V.A., 2003. Induction of chalcone synthase and phenylalanine ammonia-lyase by salicylic acid and Colletotrichum lindemuthianum in common bean. Brazilian J. Plant Physiol. 15, 129–134. Chaman, M.E., Copaja, S.V., Argandoña, V.H., 2003. Relationships between salicylic acid content, phenylalanine ammonia-lyase (PAL) activity, and resistance of barley to aphid infestation. J. Agric. Food Chem. 51, 2227–2231. Chang, C.-C., Yang, M.-H., Wen, H.-M., Chern, J.-C., 2002. Estimation of total flavonoid content in propolis by two complementary colorimetric methods. J. Food Drug Anal. 10. Chen, F., D’auria, J.C., Tholl, D., Ross, J.R., Gershenzon, J., Noel, J.P., Pichersky, E., 2003. An Arabidopsis thaliana gene for methylsalicylate biosynthesis, identified by a biochemical genomics approach, has a role in defense. Plant J. 36, 577–588. Chen, J.-Y., Wen, P.-F., Kong, W.-F., Pan, Q.-H., Zhan, J.-C., Li, J.-M., Wan, S.-B., Huang, W.-D., 2006. Effect of salicylic acid on phenylpropanoids and phenylalanine ammonia-lyase in harvested grape berries. Postharvest Biol. Technol. 40, 64–72. Chen, S., Zimei, L., Cui, J., Jiangang, D., Xia, X., Liu, D., Yu, J., 2011. Alleviation of chilling-induced oxidative damage by salicylic acid pretreatment and related gene expression in eggplant seedlings. Plant Growth Regul. 65, 101–108. Chen, Z., Zheng, Z., Huang, J., Lai, Z., Fan, B., 2009. Biosynthesis of salicylic acid in plants. Plant Signal. Behav. 4, 493–496. Chouhan, S., Sharma, K., Zha, J., Guleria, S., Koffas, M.A.G., 2017. Recent advances in the recombinant biosynthesis of polyphenols. Front. Microbiol. 8, 2259. Dihazi, A., Serghini, M.A., Jaiti, F., Daayf, F., Driouich, A., Dihazi, H., El Hadrami, I., 2011. Structural and biochemical changes in salicylic-acid-treated date palm roots challenged with Fusarium oxysporum f. Sp. albedinis. J. Pathog. 2011. Dong, J., Wan, G., Liang, Z., 2010. Accumulation of salicylic acid-induced phenolic compounds and raised activities of secondary metabolic and antioxidative enzymes in Salvia miltiorrhiza cell culture. J. Biotechnol. 148, 99–104. Ferreres, F., Valentão, P., Pereira, J.A., Bento, A., Noites, A., Seabra, R.M., Andrade, P.B., 2008. HPLC-DAD-MS/MS-ESI screening of phenolic compounds in Pieris brassicae L. reared on Brassica rapa var. rapa L. J. Agric. Food Chem. 56, 844–853. Ghasemzadeh, A., Jaafar, H.Z.E., 2012. Effect of salicylic acid application on biochemical changes in ginger (Zingiber officinale Roscoe). J. Med. Plants Res. 6, 790–795. Ghasemzadeh, A., Jaafar, H.Z.E., Karimi, E., 2012. Involvement of salicylic acid on antioxidant and anticancer properties, anthocyanin production and chalcone synthase activity in ginger (Zingiber officinale Roscoe) varieties. Int. J. Mol. Sci. 13, 14828–14844. Gill, R.A., Zhang, N., Ali, B., Farooq, M.A., Xu, J., Gill, M.B., Mao, B., Zhou, W., 2016. Role of exogenous salicylic acid in regulating physio-morphic and molecular changes under chromium toxicity in black-and yellow-seeded Brassica napus L. Environ. Sci. Pollut. Res. 23, 20483–20496. Giri, C.C., Zaheer, M., 2016. Chemical elicitors versus secondary metabolite production in vitro using plant cell, tissue and organ cultures: recent trends and a sky eye view appraisal. Plant Cell Tissue Organ Cult. 126, 1–18. Goli, S.A.H., Mokhtari, F., Rahimmalek, M., 2012. Phenolic compounds and antioxidant

Fig. 3. Comparison of fluorescence intensity of phenolic compounds in the leaves of Crocus sativus under various concentrations of salicylic acid pretreatment. Distinctive letters show significant differences (P < 0.05).

Acknowledgment The authors are grateful to Tarbiat Modares University for supporting this work. References Ashraf, M., Akram, N.A., Arteca, R.N., Foolad, M.R., 2010. The physiological, biochemical and molecular roles of brassinosteroids and salicylic acid in plant processes and salt tolerance. Crit. Rev. Plant Sci. 29, 162–190. Baba, S.A., Malik, A.H., Wani, Z.A., Mohiuddin, T., Shah, Z., Abbas, N., Ashraf, N., 2015. Phytochemical analysis and antioxidant activity of different tissue types of Crocus sativus and oxidative stress alleviating potential of saffron extract in plants, bacteria, and yeast. S. Afr. J. Bot. 99, 80–87. Blancquaert, E.H., Oberholster, A., Ricardo-da-Silva, J.M., Deloire, A.J., 2019. Effects of abiotic factors on phenolic compounds in the grape berry–a review. South African J. Enol. Vitic. 40. Blandón, A.M., Mosquera, O.M., Sant’ana, A.E.G., dos Santos, A.F., Pires, L.L.S., 2017. Antioxidant activity of plant extracts from Colombian coffee-growing eco-region. Rev. Fac. Ciencias Básicas 13, 56–59. Bourgou, S., Ksouri, R., Bellila, A., Skandrani, I., Falleh, H., Marzouk, B., 2008. Phenolic

6

Scientia Horticulturae 257 (2019) 108751

S. Tajik, et al.

28, 1127–1135. Sánchez-Rojo, S., Cerda-García-Rojas, C.M., Esparza-García, F., Plasencia, J., PoggiVaraldo, H.M., Ponce-Noyola, T., Ramos-Valdivia, A.C., 2015. Long-term response on growth, antioxidant enzymes, and secondary metabolites in salicylic acid pre-treated Uncaria tomentosa microplants. Biotechnol. Lett. 37, 2489–2496. Sánchez-Vioque, R., Rodríguez-Conde, M.F., Reina-Ureña, J.V., Escolano-Tercero, M.A., Herraiz-Peñalver, D., Santana-Méridas, O., 2012. In vitro antioxidant and metal chelating properties of corm, tepal and leaf from saffron (Crocus sativus L.). Ind. Crops Prod. 39, 149–153. Saruhan, N., Saglam, A., Kadioglu, A., 2012. Salicylic acid pretreatment induces drought tolerance and delays leaf rolling by inducing antioxidant systems in maize genotypes. Acta Physiol. Plant. 34, 97–106. Sayed, M., Khodary, S.E.A., Ahmed, E.S., Hammouda, O., Hassan, H.M., El-Shafey, N.M., 2016. Elicitation of flavonoids by chitosan and salicylic acid in callus of Rumex vesicarius L. IX International Symposium on In Vitro Culture and Horticultural Breeding, vol. 1187, 165–176. Shakirova, F.M., Sakhabutdinova, A.R., Bezrukova, M.V., Fatkhutdinova, R.A., Fatkhutdinova, D.R., 2003. Changes in the hormonal status of wheat seedlings induced by salicylic acid and salinity. Plant Sci. 164, 317–322. Shang, Q.-M., Li, L., Dong, C.-J., 2012. Multiple tandem duplication of the phenylalanine ammonia-lyase genes in Cucumis sativus L. Planta 236, 1093–1105. Syeed, S., Anjum, N.A., Nazar, R., Iqbal, N., Masood, A., Khan, N.A., 2011. Salicylic acidmediated changes in photosynthesis, nutrients content and antioxidant metabolism in two mustard (Brassica juncea L.) cultivars differing in salt tolerance. Acta Physiol. Plant. 33, 877–886. Termentzi, A., Kokkalou, E., 2008. LC-DAD-MS (ESI+) analysis and antioxidant capacity of Crocus sativus petal extracts. Planta Med. 74, 573–581. Tewari, R.K., Paek, K.-Y., 2011. Salicylic acid-induced nitric oxide and ROS generation stimulate ginsenoside accumulation in Panax ginseng roots. J. Plant Growth Regul. 30, 396–404. Tomás‐Barberán, F.A., Espín, J.C., 2001. Phenolic compounds and related enzymes as determinants of quality in fruits and vegetables. J. Sci. Food Agric. 81, 853–876. Wada, K.C., Mizuuchi, K., Koshio, A., Kaneko, K., Mitsui, T., Takeno, K., 2014. Stress enhances the gene expression and enzyme activity of phenylalanine ammonia-lyase and the endogenous content of salicylic acid to induce flowering in pharbitis. J. Plant Physiol. 171, 895–902. Wang, D., Pajerowska-Mukhtar, K., Culler, A.H., Dong, X., 2007. Salicylic acid inhibits pathogen growth in plants through repression of the auxin signaling pathway. Curr. Biol. 17, 1784–1790. Wang, L., Chen, S., Kong, W., Li, S., Archbold, D.D., 2006. Salicylic acid pretreatment alleviates chilling injury and affects the antioxidant system and heat shock proteins of peaches during cold storage. Postharvest Biol. Technol. 41, 244–251. War, A.R., Paulraj, M.G., War, M.Y., Ignacimuthu, S., 2011. Role of salicylic acid in induction of plant defense system in chickpea (Cicer arietinum L.). Plant Signal. Behav. 6, 1787–1792. Wen, P.-F., Chen, J.-Y., Kong, W.-F., Pan, Q.-H., Wan, S.-B., Huang, W.-D., 2005. Salicylic acid induced the expression of phenylalanine ammonia-lyase gene in grape berry. Plant Sci. 169, 928–934. Wen, P.-F., Chen, J.-Y., Wan, S.-B., Kong, W.-F., Zhang, P., Wang, W., Zhan, J.-C., Pan, Q.H., Huang, W.-D., 2008. Salicylic acid activates phenylalanine ammonia-lyase in grape berry in response to high temperature stress. Plant Growth Regul. 55, 1–10. Wojdyło, A., Oszmiański, J., Czemerys, R., 2007. Antioxidant activity and phenolic compounds in 32 selected herbs. Food Chem. 105, 940–949. Zarinkamar, F., Ghannadnia, M., Haddad, R., 2012. Limonene synthase gene expression under different concentrations of manganese in Cuminum cyminum L. J. Med. Plants Res. 6, 1437–1446. Zhao, J., Davis, L.C., Verpoorte, R., 2005. Elicitor signal transduction leading to production of plant secondary metabolites. Biotechnol. Adv. 23, 283–333. Zheng, C.-J., Li, L., Ma, W.-H., Han, T., Qin, L.-P., 2011. Chemical constituents and bioactivities of the liposoluble fraction from different medicinal parts of Crocus sativus. Pharm. Biol. 49, 756–763. Zhu, K.-X., Lian, C.-X., Guo, X.-N., Peng, W., Zhou, H.-M., 2011. Antioxidant activities and total phenolic contents of various extracts from defatted wheat germ. Food Chem. 126, 1122–1126. Zunun-Pérez, A.Y., Guevara-Figueroa, T., Jimenez-Garcia, S.N., Feregrino-Pérez, A.A., Gautier, F., Guevara-González, R.G., 2017. Effect of foliar application of salicylic acid, hydrogen peroxide and a xyloglucan oligosaccharide on capsiate content and gene expression associated with capsinoids synthesis in Capsicum annuum L. J. Biosci. 42, 245–250.

activity from saffron (Crocus sativus L.) petal. J. Agric. Sci. 4, 175. Hao, X., Shi, M., Cui, L., Xu, C., Zhang, Y., Kai, G., 2015. Effects of methyl jasmonate and salicylic acid on tanshinone production and biosynthetic gene expression in transgenic Salvia miltiorrhiza hairy roots. Biotechnol. Appl. Biochem. 62, 24–31. Huang, R.-H., Liu, J.-H., Lu, Y.-M., Xia, R.-X., 2008. Effect of salicylic acid on the antioxidant system in the pulp of ‘Cara cara’navel orange (Citrus sinensis L. Osbeck) at different storage temperatures. Postharvest Biol. Technol. 47, 168–175. Ibrahim, M.H., Omar, H., Zain, N.A.M., 2017. Salicylic acid enhanced photosynthesis, secondary metabolites, antioxidant and lipoxygenase inhibitory activity (lox) in Centella asiatica. Annu. Res. Rev. Biol. 17. Khan, M.I.R., Fatma, M., Per, T.S., Anjum, N.A., Khan, N.A., 2015. Salicylic acid-induced abiotic stress tolerance and underlying mechanisms in plants. Front. Plant Sci. 6, 462. Kiselev, K.V., Dubrovina, A.S., Isaeva, G.A., Zhuravlev, Y.N., 2010. The effect of salicylic acid on phenylalanine ammonia-lyase and stilbene synthase gene expression in Vitis amurensis cell culture. Russ. J. Plant Physiol. 57, 415–421. Kováčik, J., Grúz, J., Bačkor, M., Strnad, M., Repčák, M., 2009. Salicylic acid-induced changes to growth and phenolic metabolism in Matricaria chamomilla plants. Plant Cell Rep. 28, 135. Kumari, A., Pandey, N., Pandey-Rai, S., 2018. Exogenous salicylic acid-mediated modulation of arsenic stress tolerance with enhanced accumulation of secondary metabolites and improved size of glandular trichomes in Artemisia annua L. Protoplasma 255, 139–152. Li, X., Guo, H., Qi, Y., Liu, H., Zhang, X., Ma, P., Liang, Z., Dong, J., 2016. Salicylic acidinduced cytosolic acidification increases the accumulation of phenolic acids in Salvia miltiorrhiza cells. Plant Cell Tissue Organ Cult. 126, 333–341. Li, Z., Yu, J., Peng, Y., Huang, B., 2017. Metabolic pathways regulated by abscisic acid, salicylic acid and γ‐aminobutyric acid in association with improved drought tolerance in creeping bentgrass (Agrostis stolonifera). Physiol. Plant. 159, 42–58. Manquián-Cerda, K., Escudey, M., Zúñiga, G., Arancibia-Miranda, N., Molina, M., Cruces, E., 2016. Effect of cadmium on phenolic compounds, antioxidant enzyme activity and oxidative stress in blueberry (Vaccinium corymbosum L.) plantlets grown in vitro. Ecotoxicol. Environ. Saf. 133, 316–326. Matkowski, A., Zielińska, S., Oszmiański, J., Lamer-Zarawska, E., 2008. Antioxidant activity of extracts from leaves and roots of Salvia miltiorrhiza Bunge, S. przewalskiiMaxim., andS. verticillata L. Bioresour. Technol. 99, 7892–7896. Mendoza, D., Cuaspud, O., Arias, J.P., Ruiz, O., Arias, M., 2018. Effect of salicylic acid and methyl jasmonate in the production of phenolic compounds in plant cell suspension cultures of Thevetia peruviana. Biotechnol. Rep. 19, e00273. Mikulajová, A., Šedivá, D., Hybenová, E., Mošovská, S., 2016. Buckwheat cultivars—phenolic compounds profiles and antioxidant properties. Acta Chim. Slovaca 9, 124–129. Mondolot-Cosson, L., Andary, C., 1993. Resistance factors of a wild species of sunflower, Helianthus resinosus, to Sclerotinia sclerotiorum. Int. Symp. Natural Phenols Plant Resistance 381, 642–645. Morris, K., Mackerness, S.A., Page, T., John, C.F., Murphy, A.M., Carr, J.P., Buchanan‐Wollaston, V., 2000. Salicylic acid has a role in regulating gene expression during leaf senescence. Plant J. 23, 677–685. Mrázová, A., Belay, S.A., Eliášová, A., Perez-Delgado, C., Kaducová, M., Betti, M., Vega, J.M., Paľove-Balang, P., 2017. Expression, activity of phenylalanine-ammonia-lyase and accumulation of phenolic compounds in Lotus japonicus under salt stress. Biologia 72, 36–42. Mutlu, S., Karadağoğlu, Ö., Atici, Ö., Nalbantoğlu, B., 2013. Protective role of salicylic acid applied before cold stress on antioxidative system and protein patterns in barley apoplast. Biol. Plant. 57, 507–513. Naczk, M., Amarowicz, R., Zadernowski, R., Pegg, R.B., Shahidi, F., 2003. Antioxidant activity of crude phenolic extracts from wild blueberry leaves. Pol. J. Food Nutr. Sci. 12, 166–169. Nazari, M., Zarinkamar, F., Mohammad Soltani, B., Niknam, V., 2018. Manganese-induced changes in glandular trichomes density and essential oils production of Mentha aquatica L. at different growth stages. J. Trace Elem. Med. Biol. 50, 57–66. Nazari, M., Zarinkamar, F., Soltani, B.M., 2017. Physiological, biochemical and molecular responses of Mentha aquatica L. to manganese. Plant Physiol. Biochem. 120, 202–212. Niknam, V., Ebrahimzadeh, H., 2002. Phenolics content in Astragalus species. Pak. J. Bot. 34, 283–289. Pinelo, M., Rubilar, M., Sineiro, J., Nunez, M.J., 2004. Extraction of antioxidant phenolics from almond hulls (Prunus amygdalus) and pine sawdust (Pinus pinaster). Food Chem. 85, 267–273. Pu, G.-B., Ma, D.-M., Chen, J.-L., Ma, L.-Q., Wang, H., Li, G.-F., Ye, H.-C., Liu, B.-Y., 2009. Salicylic acid activates artemisinin biosynthesis in Artemisia annua L. Plant Cell Rep.

7