- Email: [email protected]
Induction of recombinant gene expression in stabily transfected cell lines using attenuated vaccinia virus MVA expressing T7 RNA polymerase with a nuclear localisation signal
Journal of Virological Methods 85 (2000) 1 – 10 www.elsevier.com/locate/jviromet
Induction of recombinant gene expression in stabily transfected cell lines using attenuated vaccinia virus MVA expressing T7 RNA polymerase with a nuclear localisation signal H.P. Huemer a,b,*, B. Strobl a, H. Shida c, C.P. Czerny d,1 b
a Institute of Molecular Biology, Austrian Academy of Sciences, Salzburg, Austria Institute for Hygiene, Uni6ersity Innshruck, PO Box 151, A-6010 Innsbruck, Austria c Institute of Virus Research, Uni6ersity Kyoto, Kyoto, Japan d Institute for Microbiology, Ludwigs Maximilian Uni6ersity, Munich, Germany
Received 22 June 1999; received in revised form 27 September 1999; accepted 28 September 1999
Abstract There are major drawbacks using vaccinia virus (VV) expressing T7 polymerase for eukaryotic expression. VV is infectious for humans and due to cytosolic replication of Pox6iridae, transient transfection of T7 promoter containing plasmids is necessary, which varies in efficiency. Several improvements have been introduced to this system to enhance expression of herpes viral glycoproteins. Stably transfected cell lines were generated with an EBV-based episomal plasmid vector which can be pushed to increasing copy numbers under selective pressure. The avirulent vaccine MVA strain was adopted to generate a safe laboratory vector for inserting the bacteriophage T7 RNA polymerase gene with (+ ) or without ( −)a nuclear localisation signal. Constructs were designed for recombination into the VV haemagglutinin gene as recombinants could not be isolated successfully when inserting into the MVA thymidine kinase locus. Both T7 MVA recombinants induced foreign protein expression in transiently transfected cells but only the T7 − / + MVA induced target protein expression in stably transfected cells. The level of protein expression by this induction mechanism was comparable to, or superior to levels obtained withVV recombinants expressing the gene under control of the VV 11 k IE promoter. The results suggests that the T7+ MVA virus can be used to induce gene expression in stable recombinant cell lines and offers an attractive and safe alternative to other inducible eucaryotic expression systems. © 2000 Elsevier Science B.V. All rights reserved. Keywords: Vaccinia; MVA; T7 polymerase; Stable transfectants; Expression
* Corresponding author. Tel.: + 43-512-5073422; fax: + 43-512-579726. E-mail address: [email protected] (H.P. Huemer) 1 Present address: Tiergesundheitsdienst Bayern EV, Zentralinstitut Senator Gerauer St23, D-85586 Grub, Germany. 0166-0934/00/$ - see front matter © 2000 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 6 - 0 9 3 4 ( 9 9 ) 0 0 1 4 7 - 0
2
H.P. Huemer et al. / Journal of Virological Methods 85 (2000) 1–10
1. Introduction Inducible gene expression is the method of choice when producing toxic viral proteins in eucaryotic cells. Vaccinia virus (VV) has been used for many years for expressing complex foreign proteins like viral glycoproteins because it can provide faithfully post translational processing of foreign proteins that sometimes cannot be achieved with yeast or baculovirus expression systems. There are numerous applications for recombinant VV strains (for review see Smith, 1991; Mackett et al., 1992) including induction of gene expression from a T7 promoter with a VV expressing the bacteriophage T7 RNA polymerase gene (Fuerst et al., 1986). Target gene expression can only be achieved after transient transfection of cells with plasmid DNA (Fuerst et al., 1986). but the efficiency of this process can be highly variable depending on the transfection method used and the mammalian cell type chosen. This difficulty could be overcome if stable recombinant cell lines were used and expression was induced by infection, but replication of poxviruses occur in the cytosol and usually there are only low copy numbers of plasmids integrated into the nucleus Lupton and Levine (1985) have constructed plasmids capable of persisting as episomes in cells by utilising the Epstein – Barr virus (EBV) nuclear antigen EBNA-I, a protein responsible for the episomal persistence of the EBV genome during virus latentcy. The intracellular copy number of these plasmids can be selectively increased by cultivating with hygromycin allowing high expression yields to be achieved. To use this technology a vaccinia recombinant was constructed expressing the T7 RNA polymerase with a nuclear targeting signal which allows us to induce high levels of expression in a stable cell line. The MVA (modified vaccinia virus ankara) strain was adopted for this work because after hundreds of passages on chicken fibroblasts. It has acquired major genomic deletions (Meyer et al., 1991; Antoine et al., 1998) that have reduced its virulence in many animal species, including man. It therefore has been licensed in central Europe for routine vaccination against orthopoxvirus infections of humans and animals (for review see (Mahnel
and Mayr, 1994). Despite expression of VV early and late proteins in infected cells MVA does not lead to productive infection in most mammalian cells and represents a safe and efficient vector for laboratory use (Blanchard et al., 1998). Until recently, MVA could only be maintained by laborious preparation in primary chicken fibroblasts (CHF) but has now been shown to grow sufficiently in a permanent hamster cell line (Drexler et al., 1998). By using high copy number plasmids in mammalian cells with a MVA vector expressing T7 RNA polymerase in describing a novel, safe and efficient inducible system for general laboratory use.
2. Material and methods
2.1. Viruses, cell culture Chicken adapted VV strain MVA has been described in detail (review see Mahnel and Mayr, 1994). Wild type virus and VV recombinants were raised on primary chicken fibroblasts cultures (CHF), grown in DMEM supplemented with penicillin/streptomycin, 5% fetal calf serum (FCS), 5% tryptose phosphate and L-glutamin (Gibco). The epithelial cell line 293-EBNA was obtained from Invitrogen. This cell line contains the EBV, EBNA-I gene, that for toxicity reasons has been truncated and was grown in DMEM containing 10% FCS and supplements under drug selection of 250 pg/ml G418 (geneticin). L-cell lines used for transient transfection were also grown in DMEM supplemented with 10% FCS. For the protein expression experiments cells were kept under serum free conditions using a commercial protein free medium (Cytofer™, from PAA Laboratories). The VV control strains used in this study vTF7-3 (Fuerst et al., 1986) and Western Reserve (WR) were grown on rabbit kidney cell line RK13 as well as equine herpesvirus type 1 (EHV-1) wildtype strain Piber.
2.2. Construction of plasmids 2.2.1. Construction of transfection 6ector pEPT7 As a basis for the transfection vector the eu-
H.P. Huemer et al. / Journal of Virological Methods 85 (2000) 1–10
caryotic plasmid pREP (Invitrogen) was used combining the EBV origin of replication with a hygromycin resistance gene. The sequences containing the Rous Sarcoma virus (RSV) promoter region were deleted by digestion with SalI and HindIII, followed by blunt ending with DNA polymerase klenow fragment and re-ligation with T4 DNA ligase. The bacteriophage T7 promoter sequence was amplified together with the truncated EHV-1 gp13 from plasmid pcDNA1/neo containing the EHV sequence (Huemer et al., 1995) using T7 primer CGCGTAATACGACTCACTATAGGG and reverse primer CTGTCCGGCCAAAACTGCTCGGTGGTAGTGGTAGTGGTAATCTTCGA A replacing the hydrophobic EHV transmembrane (EHV − tm) sequences with a His-tag and stop codon. The amplified PCR fragment of 1.4 kb was cloned into plasmid PCR3.1-uni (Invitrogen) and sequenced to confirm construction using an automated MWG LiCor sequencing apparatus and dye labelled primers. The His-tagged gp13 was excised with NheI/NotI and cloned into the compatible sites of the truncated p(R)EP plasmid lacking the RSV promoter, leading to a plasmid reffered to as pEPT7 containing the EHV − tm sequence under control of the bacteriophage T7 promoter (Fig. 1C).
2.2.2. Construction of recombination plasmids pHA7, 5 k/gpt and pHA11 k/gpt The pUC based plasmid pHA13 containing the VV haemagglutinin (HA) gene has been described before (Shida, 1986). This plasmid was digested using the unique NruI site cleaving the VV HA gene in half. Both the VV 7.5 k immediate early promoter and the 11 k early promoter were inserted into the HA gene. The VV 7.5 k IE promoter or the 11 k promoter and a short polylinker region and the gpt-resistence gene were excised from vectors PEMBL-I3-gpt and pATA-gpt (Stunnenberg et al., 1988) by digestion with EcoRI or HindIII and AatII, respectively. the fragment end-filled with klenow, and ligated into the NruI site of pHA13 (Fig. 1A, B). The full length EHVgp13 coding sequence was excised from plasmid pCDNA1-NEOgp13 described previ-
3
ously (Huemer et al., 1995) and inserted into pHA 11 k-gpt using the EcoRI and XhoI restriction sites. For comparison the full length gp13 gene was also inserted into pATA-gpt and the resulting plasmid used for recombination into the TK-locus of VV strain WR.
2.2.3. Construction of T7 reporter plasmid pBSII/gfp, testing of T7 polymerase expression in transient expression The coding sequence of green fluorescence protein (gfp) was excised from expression plasmid pCSGFP (Clontech) and ligated into pBSII-KS Bluescript (Stratagene) leading to a plasmid containing the gfp gene under control of the bacteriophage T7 promoter sequence (pBSII/gfp). Plaque purified recombinant viruses were tested for expression of T7 polymerase by transient transfection of CHF and L-cells with plasmid pBSII/gfp using lipofection (Transfast, Boehringer) and coinfection with the different VV Constructs for 24 h at high m.o.i. Cells were examined for expression of the gfp by fluorescence microscopy. 2.3. Production of the recombinant VV and MVA containing bacteriophage T7 polymerase The bacteriophage T7 polymerase genes fused to a nuclear localisation signal or lacking this signal sequence were excised from expression plasmids pAR3126 and pAR3132, respectively (Dunn et al., 1988). Plasmids were digested with HindIII and BamHI the fragments were blunt-ended and ligated into the SmaI site of recombination plasmid pHA7.5 k/gpt described above. These T7 polymerase constructs were transfected with lipofection (Lipofectase™, Gibco) into primary CHF which had been infected with vaccinia strain MVA for 2 h. At 4 days post infection, virus was released from cells by repeat freeze/thaw cycles and centrifuged at low speed to remove cell debris. Recombinant viruses were selected on chicken fibroblast cultures with a cocktail of xanthine, hypoxanthine and mycophenolic acid according to standard methodology and plaque, purified several times on CHF using drug selection and soft agarose overlays. Constructs pHA
4
H.P. Huemer et al. / Journal of Virological Methods 85 (2000) 1–10
Fig. 1. (A) Map of recombination plasmid pHA 7.5 k/gpt-T7 for production of recombinant vaccinia virus MVA containing the bacteriophage T7 polymerase (T7 − / + MVA). Amp r, ampicillin resistance; 7.5k IE, vaccinia virus (VV), 7.5 k immediate early promoter; gpt, guanosyl phosphoribosyltransferase gene; T7 Pol., coding sequence of the bacteriophage T7 polymerase; Nucl., nuclear localisation sequence; VV HA, sequences derived from the VV haemagglutinin gene. (B) Map of recombination plasmid pHA 11 k-gpt EHV for production of recombinant MVA expressing EHV gp13. Amp r, ampicillin resistance; 11 k E, VV 11 k early promoter; gpt, guanosyl phosphoribosyltransferase gene; EHV gp13, coding sequence of glycoprotein 13 of EHV-1; VV HA, sequences derived from the VV haemagglutinin gene. (C) Map of pEPT7 transfection plasmid for episomal persistence of the truncated EHV gp13 sequence in 293-EBNA cells. 0riP, Epstein – Barr virus origin of replication; Amp r, ampicillin resistance; T7, bacteriophage T7 promoter; EBNA-1, EBNA-1 gene; Hyg, hygromycin resistance; EHV gp13, equine herpes virus gp13 coding sequence; His, histidine-tag replacing gp13 transmembrane sequence.
H.P. Huemer et al. / Journal of Virological Methods 85 (2000) 1–10
11 k-gpt and pATA-gpt containing the EHV gp13 sequence under control of the VV 11 k early promoter were produced accordingly.
2.4. Production of.stable episomal transfectants containing the EHV-1 gp13 gene and induction by T7 + MVA 293-EBNA cells were transfected with plasmid pEPT7 containing the EHV-1 gp13 coding sequence under the control of the bacteriophage T7 promoter by electroporation using a Biorad gene purser set at 400 V, 960 mf at a pulse length of : 30 ms. Cells were selected in DMEM supplemented with 250 mg/mg 418 and 100 mg/ml hygromycin and recombinant clones transferred to 24 well plates. Genomic DNA extracted from drug resistant cell clones was confirmed containing inserts by PCR and Southern blotting with EHV-1 specific primers (listed above) or EHV-1 gp13 restriction fragments labelled with digoxigenin (Boehringer). Stable transfectants containing the EHV gp13 gene were infected with different MVA constructs at high m.o.i. overnight in 24 well plates. Cells were air-dried and fixed with ice cold acetone/methanol and analysed for induction of protein expression by immune staining using anti-gp13 specific monoclonal antibody 1B6 (described in Huemer et al., 1995) or a polyvalent anti-EHV rabbit serum followed by alkaline phosphatase labelled second antibody (Dako) and BCIP (Boehringer, Mannheim) as substrate. Supernatants of infected cells were concentrated over size exclusion filters and the gp13 protein detected by western blotting using the antibodies above.
2.5. Delection of secreted protein in supernatants of T7 MVA induced cell lines The supernatants of infected cell cultures were analysed for His-tagged virus protein by Immunoprecipitation as described above or by binding to Ni-ion coated microtitreplates (Qiagen. Nl-NTA HisSorb strips) using a standard ELISA procedure. In brief, plates were blocked with 1% bovine serum albumin in PBS and the supernatants added. Bound protein was detected by reaction
5
with anti EHV specific rabbit antiserum and peroxidase-labelled second antibody. Washing with PBS 0.1% Tween 20 was included between incubation steps. Substrate reaction was performed with ABTS/H2O2 and the reaction read at 404 nm.
2.6. Purification of EHV gp13 from supernatants of serum free cell cultures Serum free culture supernatants were concentrated over Millipore size exclusion spin columns (Centricon plus 20) and the filtrate analysed by western blotting. Supernatant from one roller bottle, equivalent to : 109 cells induced with T7 MVA for 4 days, was harvested and applied to a nickel-sepharose (Qiagen). The column was washed with 20 mm imidazole in PBS and the protein bound via its His tag was eluted with 250 mM imidazole. Fractions then were analysed by SDS-PAGE on 10% gels under reducing conditions. 3. Results
3.1. Production of stable transfectants with episomal plasmid persistence The herpes viral glycoprotein C of EHV (gp13) was adopted as a target protein in this study. The EHV gp13 coding sequence was stably transfected into the EBNA-1 containing epithelial cell line 293-EBNA using our modified expression plasmid pEPT7 (see Fig. 1C) Several stable clones were isolated by virtue of their hygromycin resistance. and the EHV gene was confirmed present in these cells by PCR analysis and Southern blotting (not shown).
3.2. Production of bacteriophage T7 RNA polymerase by recombinant MVA We were unable to isolate viable recombinants when inserting the T7 RNA polymerase gene into the MVA thymidine kinase (tk) gene with plasmids based on constructs pEMBL-13-gpt or pATA-gpt, (Stunnenberg et al., 1988), a finding also observed by other investigators (Scheiflinger et al., 1996). However, viable recombinants were
6
H.P. Huemer et al. / Journal of Virological Methods 85 (2000) 1–10
Fig. 2. Production of full length and truncated gp13 by recombinant MVA. S35-methionine labelled proteins from 293 cells were immunoprecipitated from lysates (panel A) or cell culture supernatants (panel B). Cells were infected with a recombinant MVA construct expressing gp13 without the transmembrane anchor region (lane 1). or an MVA construct containing the full length gp13 gene (lane 2). or the wild type MVA strain (lane 3).
isolated containing the bacteriophage T7 RNA polymerase gene with and without a nuclear localisation signal by inserting into the HA gene using our newly developed plasmid pHA7.5 k/gpt (Fig. 1A). After repeated rounds of drug selection plaque purified MVA isolates were analysed by Southern blot hybridization and tested for induction of expression of marker genes.
3.3. Expression of full-length and truncated EHV gp13 in MVA In order to compare the efficacy of our T7 expressed gp13 gene product with a MVA inducible system, a recombinant MVA-construct was also generated containing the equine herpes virus gp13 gene under the control of the VV 11 k late promoter. Using this construct high levels of recombinant EHV expression were induced with the VV recombinants expressing truncated or fulllength gp13 in the cell cytosol, whereas only the truncated form was detected in the cell supernatant, indicative that only constructs lacking the
gp13 transmembrane anchor sequence were capable of actively secreting gp13 from infected cells (Fig. 2). These pulse labelling studies demonstrate that the underglycosylated precursor of gp13 is predominant in the cell (Fig. 2A, lane 1 and 2, lower arrow) whereas only the fully processed protein is secreted (Fig. 2B, lane 1). The lack of the transmembrane sequence in gp13 results in a slight decrease in molecular size for the soluble protein (Fig. 2B, arrow) as compared to the full length gp13 glycoprotein (Fig. 2A, upper arrow). For comparison also, recombinants containing the full-length gp13 gene in the tk locus of VV strain WR, were produced. After repeated plaque purification on RK13 cells several recombinant viruses were obtained and clone 2B2 was used in this study.
3.4. Validation of T7 RNA polymerase expression by recombinant MVA using green fluorescence protein Mouse L-cells were infected transiently with PSII/gfp and were infected with either recombinant MVA constructs to confirm this virus was expressing T7 RNA polymerase (Fig. 3 middle panel). For comparison. the established VV strain, WR based recombinant virus vTF7-3 (Fuerst et al., 1986) containing full-length T7 polymerase was also used and showed a similar staining pattern on transient transfectants (Fig. 3, right panel).The recombinant MVA construct induced comparable levels of expression of green fluorescence protein as the WR based strain but the MVA construct apparently induced less cytolytic activity and cells infected with the T7 MVA’s maintained their spindle shape for significantly longer than cells infected with the WR based strain.
3.5. A nuclear localisation signal in the T7 RNA polymerase gene is necessary to induce protein expression in stable transfected cell lines Gpl3 expression was analysed in stably transfected 293-EBNA cells after virus infection with different vaccinia recombinants by immunofluorescence (Fig. 4). Induction of protein ex-
H.P. Huemer et al. / Journal of Virological Methods 85 (2000) 1–10
pression was observed only after infection with T7 MVA (Fig. 4, panel A and B) containing the nuclear localisation signal, whereas the identical construct lacking the signal T7 MVA (Fig. 4, panel e) nor the equivalent WR based vTF7-3 construct (Fig. 4, panel c), were ineffective at inducing gp13 expression. Recombinant MVA strains containing gp13 sequence with and with-
7
out transmembrane sequences under the control of the VV 11 k promoter are included for comparison and did show significant gp13 protein expression by immunofluorescence (Fig. 4. panel f and g ,respectively). Constructs including the gp13 transmembrane sequence were found incorporated into the cell membrane (Fig. 4D and F). whereas the viruses expressing truncated gp13
Fig. 3. Induction of expression of green fluorescence protein by recombinant T7 MVA. Expression of T7 RNA polymerase by recombinant VV was tested by transient transfection of CHF cell with the plasmid pBSII/gfp and infection with the recombinant viruses at high m.o.i. for 24 h. Cells were then examined for T7 driven induction of gft expression using fluorescence microscopy. T7 MVA infected cells are shown on the left panel. vTF7-3 infected in the middle panel. On the right panel the weak cytopathic effect of MVA on the infected cell layer is shown.
Fig. 4. Induction of expression of EHV gp13 in stable transfected 293-EBNA cells by T7+ MVA. Immunofluorescence staining using anti-gp13 specific antibody of stable transfected 293-EBNA cells containing episomal persisting plasmid pEPT7. Infection with the different MVA constructs and control viruses is shown: (A) and (B) T7+ MVA, MVA, construct containing bacteriophage T7 polymerase gene linked with nuclear localisation signal; (C) vTF7-3, VV strain WR based isolate expressing T7 polymerase; (D) clon 2B2, VV strain WR containing full-length EHV gp13 in thymidine kinase (tk) locus; (E) T7 MVA, MVA containing T7 polymerase gene without nuclear localisation; (F) MVAgp13, MVA containing the full length gp13 gene under control of VV 11 k promoter in HA locus; (G) MVAgp13-™, MVA containing gp13 gene lacking the transmembrane region; (H) EHV-1, equine herpesvirus type 1 strain Piber.
8
H.P. Huemer et al. / Journal of Virological Methods 85 (2000) 1–10
molecular size of approx. 70 kd (lane 1), whereas only negligible expression was observed in the construct lacking the nuclear localisation sequence (lane 2). For comparison an MVA construct with a truncated EHV gp13 gene under control of the VV 11 k promoter expressed a predominantly underglycosilated protein of 45 kd (lane 3) and produced degradation fragments suggesting that the late promoter might influence protein stability. Protein purification was also performed by attachment to Ni-resins and elution by imidazole. Protein yield was about 0.5 mg obtained from one roller bottle with enhanced surface which contained :109 cells (not shown).
4. Discussion Fig. 5. Secretion of recombinant gp13 by stable transfectants induced with T7+ MVA. Filtrates of serum free supernatants from 293-EBNA cells stably transfected with plasmid pEPT7 containing the truncated gp13 sequence were analysed by western blotting using EHV gp13 specific antibody. Cells infected with T7 MVA (lane 1). T7 MVA (lane 2) and MVAgp13™, (lane 3) are shown. Full length gp13 from EHV-1 virions is shown for comparison (lane 4). Positions of the molecular size standards used are indicated in kilodaltons (kd).
produced an intracellular perinuclear staining (Fig. 4B) similar to Golgi staining. Another interesting observation was that the gp13 protein lacking a transmembrane sequence appeared to be secreted in rather large aggregates as observed by immunofluorescence (Fig. 4A and G).
3.6. Purification and characterisation of secreted gp13 from stable transfectants Truncated gp13 was modified by replacing the viral transmembrane sequence with the addition of a His-tag to aid its purification. Cell supernatants were analysed by western blotting using EHV-specific antibodies. As shown in (Fig. 5), only T7 MVA construct containing the nuclear localisation signal was capable of inducing secretion of the truncated EHV glycoprotein with a
The modified vaccinia virus Ankara (MVA) strain of VV has several key advantages in comparison with other VV strains used commonly for application in an expression system. Most VV strains productively infect a broad spectrum of susceptible eukaryotic cells leading to rapid cell death within 24 h post infection. However, the MVA strain, due to its extensive adaptation to CHF has a severely restricted host range of cells that it can productively infect, but still expresses its virally encoded proteins strongly despite undergoing an abortive infection, in the same range of cells that other vaccinia strains infect. As a result, the reduction in cytotoxicity and increase in safety makes MVA a superior tool for expressing recombinant proteins. MVA is slightly more difficult to use than other VV strains, due to its slower replication and the requirement for primary CHF cultures. However, the use of BHK-21 cells leading to sufficient virus titres (Drexler et al., 1998) or the CHF cell line DF-1 (Himly et al., 1998) which unfortunately is not available to the scientific community so far, could solve this problem. The difficulties associated with recombination plasmids based on insertion into the MVA thymidine kinase (tk) gene has been also observed by other investigators. The failure to obtain viable MVA recombinants with the flanking sequences of the tk locus can be overcome by coexpression
H.P. Huemer et al. / Journal of Virological Methods 85 (2000) 1–10
of the tk gene from another poxvirus species (Scheiflinger et al., 1996). Instead an alternative approach was chosen by producing insertion plasmids for recombination into the VV HA gene. As the VV HA protein presumably is also involved in pathogenicity, disruption of this gene may represent an additional safety feature of our recombinant MVA constructs. which can also be utilised in vaccination studies (Huemar et al., 1999). Whether the observed secretion of protein aggregates by the constructs lacking the transmembrane sequence, may be useful for immunization purposes too, will require further investigation. In summary the advantages of the system described in this paper are as follows: Using VV strain MVA with its limited host range of susceptible cells, protein expression can be induced in a variety of haematopoietic and epithelial cell lines. This occurs without production of infectious viral particles as MVA is non replicative in most mammalian cells, due to its adaptation to CHF. MVA constructs containing the T7 RNA polymerase gene linked to a nuclear localization signal can induce gene expression also from plasmids which are stably transfected into eukaryotic cells. This avoids problems associated with differential transfection efficiencies obtained with available transient transfection methods. High expression rates can be obtained using stable transfected cells with episomal plasmid persistence which are equivalent to, or even superior to, direct insertion of the target gene into VV. In contrast to transient transfection or stable integration of plasmids in the nuclear genome, copy numbers of such episomal persisting plasmids can be increased under selective pressure, especially in cell lines containing a truncated EBNA-1 gene. Using serum free culture conditions, secreted proteins can be induced by highly efficient infection and easily obtained by ultrafiltration and purification. This makes the T7 MVA a useful system for inducible and non leaking eukaryotic gene expression especially of toxic proteins which cannot be expressed constitutuvely in cell lines.
9
Acknowledgements This work was supported by the Austrian Academy of Sciences program tor the advancement of research and technology (APART) and the Jubila¨umsfonds of the Austrian National Bank.
References Antoine, G., Scheiflinger, F., Dorner, F., Falkner, F.G., 1998. The complete genomic sequence of the modified vaccinia Ankara strain: comparison with other orthopoxviruses. Virology 244, 365 – 396. Blanchard, T.J., Alcami, A., Panayiota, A., Smith, G.L., 1998. Modified vaccinia virus Ankara undergoes limited replication in human cells and lacks several immunomodulatory proteins: implications for use as a human vaccine. J. Gen. Virol. 79, 1159 – 1167. Drexler, I., Heller, K., Erfle, V., Sutter, G., 1998. Highly attenuated modified vaccinia virus ankara replicates in baby hamster kidney cells. a potential host for virus propagation. but not in various human transformed and primary cells. J. Gen. Virol. 79, 347 – 352. Dunn, J.J., Krippl, B., Bernstein, K.E., Westphal, H., Studier, F.W., 1988. Targeting bacteriophage T7 RNA polymerase to the mammalian cell nucleus. Gene 68, 259 – 266. Fuerst, T.R., Niles, E.G., Studier, F.W., Moss, B., 1986. Eukaryotic transient-expression system based on recombinant vaccinia virus that synthesizes bacteriophage T7 RNA polymerase. Proc. Natl. Acad. Sci. USA 83, 8122 – 8126. Himly, M., Foster, D.N., Bottoli, I., Iacovoni, J.S., Vogt, P.K., 1998. The DF-I chicken fibroblast cell line: transformation induced by diverse oncogenes and cell death resulting from infection by avian leukosis viruses. Virology 248, 295 – 304. Huemer, H.P., Nowotny, N., Crabb, B.S., Meyer, H., Hubert, P.H., 1995. Gpl3 (EHV-gC): a complement receptor induced by equine herpes viruses. Virus Res. 37, 113 – 126. Huemar, H.P., Strobl, B., Nowotny, N., 1999. Use of apathogenic vaccinia virus MVA expressing EHV-1 gC as basis of a combined recombinant MVA/DNA vaccination scheme. Vaccine (in press). Lupton, S., Levine, A.J., 1985. Mapping genetic elements of Epstein – Barr virus that facilitate extrachromosomal persistence of Epstein – Barr virus-derived plasmids in human cells. Mol. Cell. Biol. 5, 2533 – 2542. Mahnel, H., Mayr, A., 1994. Erfahrung bei der Schutzimpfung gegen Orthopocken von Mensch und Tier mit dem Impfstamm MVA (Experience in vaccination against human and animal orthopoxviruses with the vaccine strain MVA).
10
H.P. Huemer et al. / Journal of Virological Methods 85 (2000) 1–10 highly attenuated vaccinia MVA strain. Arch. Virol. 141, 663 – 669. Shida, H., 1986. Nucleotide sequence of the vaccinia virus hemagglutinin gene. Virology 30, 451 – 462. Smith, G.L., 1991. Vaccinia virus vectors for gene expression. Curr. Opin. Biotechnol. 2, 713 – 717. Stunnenberg, H.G., Lange, H., Philipson, L., van-Miltenburg, R.T., van-der-Vliet, P.C., 1988. High expression of functional adenovirus DNA polymerase and precursor terminal protein using recombinant vaccinia virus. Nucleic Acids Res. 16, 2431 – 2444.
Berliner und Munchner Tierarztliche Wochenschrift 107, 253 – 256.Mackett, M., Smith, G.L., Moss, B., 1992. Vaccinia virus: a selectable eukaryotic cloning and expression vector. Biotechnology 24, 495–499. Meyer, H., Sutter, G., Mayr’, A., 1991. Mapping of deletions on the genome of the highly attenuated vaccinia virus MVA and their influence on virulence. J. Gen. Virol. 72, 1031 – 1038. Scheiflinger, F., Falkner, F.G., Dorner, F., 1996. Evaluation of the thymidine kinase (tk) locus as an insertion site in the
.
Induction of recombinant gene expression in stabily transfected cell lines using attenuated vaccinia virus MVA expressing T7 RNA polymerase with a nuclear localisation signal H.P. Huemer a,b,*, B. Strobl a, H. Shida c, C.P. Czerny d,1 b
a Institute of Molecular Biology, Austrian Academy of Sciences, Salzburg, Austria Institute for Hygiene, Uni6ersity Innshruck, PO Box 151, A-6010 Innsbruck, Austria c Institute of Virus Research, Uni6ersity Kyoto, Kyoto, Japan d Institute for Microbiology, Ludwigs Maximilian Uni6ersity, Munich, Germany
Received 22 June 1999; received in revised form 27 September 1999; accepted 28 September 1999
Abstract There are major drawbacks using vaccinia virus (VV) expressing T7 polymerase for eukaryotic expression. VV is infectious for humans and due to cytosolic replication of Pox6iridae, transient transfection of T7 promoter containing plasmids is necessary, which varies in efficiency. Several improvements have been introduced to this system to enhance expression of herpes viral glycoproteins. Stably transfected cell lines were generated with an EBV-based episomal plasmid vector which can be pushed to increasing copy numbers under selective pressure. The avirulent vaccine MVA strain was adopted to generate a safe laboratory vector for inserting the bacteriophage T7 RNA polymerase gene with (+ ) or without ( −)a nuclear localisation signal. Constructs were designed for recombination into the VV haemagglutinin gene as recombinants could not be isolated successfully when inserting into the MVA thymidine kinase locus. Both T7 MVA recombinants induced foreign protein expression in transiently transfected cells but only the T7 − / + MVA induced target protein expression in stably transfected cells. The level of protein expression by this induction mechanism was comparable to, or superior to levels obtained withVV recombinants expressing the gene under control of the VV 11 k IE promoter. The results suggests that the T7+ MVA virus can be used to induce gene expression in stable recombinant cell lines and offers an attractive and safe alternative to other inducible eucaryotic expression systems. © 2000 Elsevier Science B.V. All rights reserved. Keywords: Vaccinia; MVA; T7 polymerase; Stable transfectants; Expression
* Corresponding author. Tel.: + 43-512-5073422; fax: + 43-512-579726. E-mail address: [email protected] (H.P. Huemer) 1 Present address: Tiergesundheitsdienst Bayern EV, Zentralinstitut Senator Gerauer St23, D-85586 Grub, Germany. 0166-0934/00/$ - see front matter © 2000 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 6 - 0 9 3 4 ( 9 9 ) 0 0 1 4 7 - 0
2
H.P. Huemer et al. / Journal of Virological Methods 85 (2000) 1–10
1. Introduction Inducible gene expression is the method of choice when producing toxic viral proteins in eucaryotic cells. Vaccinia virus (VV) has been used for many years for expressing complex foreign proteins like viral glycoproteins because it can provide faithfully post translational processing of foreign proteins that sometimes cannot be achieved with yeast or baculovirus expression systems. There are numerous applications for recombinant VV strains (for review see Smith, 1991; Mackett et al., 1992) including induction of gene expression from a T7 promoter with a VV expressing the bacteriophage T7 RNA polymerase gene (Fuerst et al., 1986). Target gene expression can only be achieved after transient transfection of cells with plasmid DNA (Fuerst et al., 1986). but the efficiency of this process can be highly variable depending on the transfection method used and the mammalian cell type chosen. This difficulty could be overcome if stable recombinant cell lines were used and expression was induced by infection, but replication of poxviruses occur in the cytosol and usually there are only low copy numbers of plasmids integrated into the nucleus Lupton and Levine (1985) have constructed plasmids capable of persisting as episomes in cells by utilising the Epstein – Barr virus (EBV) nuclear antigen EBNA-I, a protein responsible for the episomal persistence of the EBV genome during virus latentcy. The intracellular copy number of these plasmids can be selectively increased by cultivating with hygromycin allowing high expression yields to be achieved. To use this technology a vaccinia recombinant was constructed expressing the T7 RNA polymerase with a nuclear targeting signal which allows us to induce high levels of expression in a stable cell line. The MVA (modified vaccinia virus ankara) strain was adopted for this work because after hundreds of passages on chicken fibroblasts. It has acquired major genomic deletions (Meyer et al., 1991; Antoine et al., 1998) that have reduced its virulence in many animal species, including man. It therefore has been licensed in central Europe for routine vaccination against orthopoxvirus infections of humans and animals (for review see (Mahnel
and Mayr, 1994). Despite expression of VV early and late proteins in infected cells MVA does not lead to productive infection in most mammalian cells and represents a safe and efficient vector for laboratory use (Blanchard et al., 1998). Until recently, MVA could only be maintained by laborious preparation in primary chicken fibroblasts (CHF) but has now been shown to grow sufficiently in a permanent hamster cell line (Drexler et al., 1998). By using high copy number plasmids in mammalian cells with a MVA vector expressing T7 RNA polymerase in describing a novel, safe and efficient inducible system for general laboratory use.
2. Material and methods
2.1. Viruses, cell culture Chicken adapted VV strain MVA has been described in detail (review see Mahnel and Mayr, 1994). Wild type virus and VV recombinants were raised on primary chicken fibroblasts cultures (CHF), grown in DMEM supplemented with penicillin/streptomycin, 5% fetal calf serum (FCS), 5% tryptose phosphate and L-glutamin (Gibco). The epithelial cell line 293-EBNA was obtained from Invitrogen. This cell line contains the EBV, EBNA-I gene, that for toxicity reasons has been truncated and was grown in DMEM containing 10% FCS and supplements under drug selection of 250 pg/ml G418 (geneticin). L-cell lines used for transient transfection were also grown in DMEM supplemented with 10% FCS. For the protein expression experiments cells were kept under serum free conditions using a commercial protein free medium (Cytofer™, from PAA Laboratories). The VV control strains used in this study vTF7-3 (Fuerst et al., 1986) and Western Reserve (WR) were grown on rabbit kidney cell line RK13 as well as equine herpesvirus type 1 (EHV-1) wildtype strain Piber.
2.2. Construction of plasmids 2.2.1. Construction of transfection 6ector pEPT7 As a basis for the transfection vector the eu-
H.P. Huemer et al. / Journal of Virological Methods 85 (2000) 1–10
caryotic plasmid pREP (Invitrogen) was used combining the EBV origin of replication with a hygromycin resistance gene. The sequences containing the Rous Sarcoma virus (RSV) promoter region were deleted by digestion with SalI and HindIII, followed by blunt ending with DNA polymerase klenow fragment and re-ligation with T4 DNA ligase. The bacteriophage T7 promoter sequence was amplified together with the truncated EHV-1 gp13 from plasmid pcDNA1/neo containing the EHV sequence (Huemer et al., 1995) using T7 primer CGCGTAATACGACTCACTATAGGG and reverse primer CTGTCCGGCCAAAACTGCTCGGTGGTAGTGGTAGTGGTAATCTTCGA A replacing the hydrophobic EHV transmembrane (EHV − tm) sequences with a His-tag and stop codon. The amplified PCR fragment of 1.4 kb was cloned into plasmid PCR3.1-uni (Invitrogen) and sequenced to confirm construction using an automated MWG LiCor sequencing apparatus and dye labelled primers. The His-tagged gp13 was excised with NheI/NotI and cloned into the compatible sites of the truncated p(R)EP plasmid lacking the RSV promoter, leading to a plasmid reffered to as pEPT7 containing the EHV − tm sequence under control of the bacteriophage T7 promoter (Fig. 1C).
2.2.2. Construction of recombination plasmids pHA7, 5 k/gpt and pHA11 k/gpt The pUC based plasmid pHA13 containing the VV haemagglutinin (HA) gene has been described before (Shida, 1986). This plasmid was digested using the unique NruI site cleaving the VV HA gene in half. Both the VV 7.5 k immediate early promoter and the 11 k early promoter were inserted into the HA gene. The VV 7.5 k IE promoter or the 11 k promoter and a short polylinker region and the gpt-resistence gene were excised from vectors PEMBL-I3-gpt and pATA-gpt (Stunnenberg et al., 1988) by digestion with EcoRI or HindIII and AatII, respectively. the fragment end-filled with klenow, and ligated into the NruI site of pHA13 (Fig. 1A, B). The full length EHVgp13 coding sequence was excised from plasmid pCDNA1-NEOgp13 described previ-
3
ously (Huemer et al., 1995) and inserted into pHA 11 k-gpt using the EcoRI and XhoI restriction sites. For comparison the full length gp13 gene was also inserted into pATA-gpt and the resulting plasmid used for recombination into the TK-locus of VV strain WR.
2.2.3. Construction of T7 reporter plasmid pBSII/gfp, testing of T7 polymerase expression in transient expression The coding sequence of green fluorescence protein (gfp) was excised from expression plasmid pCSGFP (Clontech) and ligated into pBSII-KS Bluescript (Stratagene) leading to a plasmid containing the gfp gene under control of the bacteriophage T7 promoter sequence (pBSII/gfp). Plaque purified recombinant viruses were tested for expression of T7 polymerase by transient transfection of CHF and L-cells with plasmid pBSII/gfp using lipofection (Transfast, Boehringer) and coinfection with the different VV Constructs for 24 h at high m.o.i. Cells were examined for expression of the gfp by fluorescence microscopy. 2.3. Production of the recombinant VV and MVA containing bacteriophage T7 polymerase The bacteriophage T7 polymerase genes fused to a nuclear localisation signal or lacking this signal sequence were excised from expression plasmids pAR3126 and pAR3132, respectively (Dunn et al., 1988). Plasmids were digested with HindIII and BamHI the fragments were blunt-ended and ligated into the SmaI site of recombination plasmid pHA7.5 k/gpt described above. These T7 polymerase constructs were transfected with lipofection (Lipofectase™, Gibco) into primary CHF which had been infected with vaccinia strain MVA for 2 h. At 4 days post infection, virus was released from cells by repeat freeze/thaw cycles and centrifuged at low speed to remove cell debris. Recombinant viruses were selected on chicken fibroblast cultures with a cocktail of xanthine, hypoxanthine and mycophenolic acid according to standard methodology and plaque, purified several times on CHF using drug selection and soft agarose overlays. Constructs pHA
4
H.P. Huemer et al. / Journal of Virological Methods 85 (2000) 1–10
Fig. 1. (A) Map of recombination plasmid pHA 7.5 k/gpt-T7 for production of recombinant vaccinia virus MVA containing the bacteriophage T7 polymerase (T7 − / + MVA). Amp r, ampicillin resistance; 7.5k IE, vaccinia virus (VV), 7.5 k immediate early promoter; gpt, guanosyl phosphoribosyltransferase gene; T7 Pol., coding sequence of the bacteriophage T7 polymerase; Nucl., nuclear localisation sequence; VV HA, sequences derived from the VV haemagglutinin gene. (B) Map of recombination plasmid pHA 11 k-gpt EHV for production of recombinant MVA expressing EHV gp13. Amp r, ampicillin resistance; 11 k E, VV 11 k early promoter; gpt, guanosyl phosphoribosyltransferase gene; EHV gp13, coding sequence of glycoprotein 13 of EHV-1; VV HA, sequences derived from the VV haemagglutinin gene. (C) Map of pEPT7 transfection plasmid for episomal persistence of the truncated EHV gp13 sequence in 293-EBNA cells. 0riP, Epstein – Barr virus origin of replication; Amp r, ampicillin resistance; T7, bacteriophage T7 promoter; EBNA-1, EBNA-1 gene; Hyg, hygromycin resistance; EHV gp13, equine herpes virus gp13 coding sequence; His, histidine-tag replacing gp13 transmembrane sequence.
H.P. Huemer et al. / Journal of Virological Methods 85 (2000) 1–10
11 k-gpt and pATA-gpt containing the EHV gp13 sequence under control of the VV 11 k early promoter were produced accordingly.
2.4. Production of.stable episomal transfectants containing the EHV-1 gp13 gene and induction by T7 + MVA 293-EBNA cells were transfected with plasmid pEPT7 containing the EHV-1 gp13 coding sequence under the control of the bacteriophage T7 promoter by electroporation using a Biorad gene purser set at 400 V, 960 mf at a pulse length of : 30 ms. Cells were selected in DMEM supplemented with 250 mg/mg 418 and 100 mg/ml hygromycin and recombinant clones transferred to 24 well plates. Genomic DNA extracted from drug resistant cell clones was confirmed containing inserts by PCR and Southern blotting with EHV-1 specific primers (listed above) or EHV-1 gp13 restriction fragments labelled with digoxigenin (Boehringer). Stable transfectants containing the EHV gp13 gene were infected with different MVA constructs at high m.o.i. overnight in 24 well plates. Cells were air-dried and fixed with ice cold acetone/methanol and analysed for induction of protein expression by immune staining using anti-gp13 specific monoclonal antibody 1B6 (described in Huemer et al., 1995) or a polyvalent anti-EHV rabbit serum followed by alkaline phosphatase labelled second antibody (Dako) and BCIP (Boehringer, Mannheim) as substrate. Supernatants of infected cells were concentrated over size exclusion filters and the gp13 protein detected by western blotting using the antibodies above.
2.5. Delection of secreted protein in supernatants of T7 MVA induced cell lines The supernatants of infected cell cultures were analysed for His-tagged virus protein by Immunoprecipitation as described above or by binding to Ni-ion coated microtitreplates (Qiagen. Nl-NTA HisSorb strips) using a standard ELISA procedure. In brief, plates were blocked with 1% bovine serum albumin in PBS and the supernatants added. Bound protein was detected by reaction
5
with anti EHV specific rabbit antiserum and peroxidase-labelled second antibody. Washing with PBS 0.1% Tween 20 was included between incubation steps. Substrate reaction was performed with ABTS/H2O2 and the reaction read at 404 nm.
2.6. Purification of EHV gp13 from supernatants of serum free cell cultures Serum free culture supernatants were concentrated over Millipore size exclusion spin columns (Centricon plus 20) and the filtrate analysed by western blotting. Supernatant from one roller bottle, equivalent to : 109 cells induced with T7 MVA for 4 days, was harvested and applied to a nickel-sepharose (Qiagen). The column was washed with 20 mm imidazole in PBS and the protein bound via its His tag was eluted with 250 mM imidazole. Fractions then were analysed by SDS-PAGE on 10% gels under reducing conditions. 3. Results
3.1. Production of stable transfectants with episomal plasmid persistence The herpes viral glycoprotein C of EHV (gp13) was adopted as a target protein in this study. The EHV gp13 coding sequence was stably transfected into the EBNA-1 containing epithelial cell line 293-EBNA using our modified expression plasmid pEPT7 (see Fig. 1C) Several stable clones were isolated by virtue of their hygromycin resistance. and the EHV gene was confirmed present in these cells by PCR analysis and Southern blotting (not shown).
3.2. Production of bacteriophage T7 RNA polymerase by recombinant MVA We were unable to isolate viable recombinants when inserting the T7 RNA polymerase gene into the MVA thymidine kinase (tk) gene with plasmids based on constructs pEMBL-13-gpt or pATA-gpt, (Stunnenberg et al., 1988), a finding also observed by other investigators (Scheiflinger et al., 1996). However, viable recombinants were
6
H.P. Huemer et al. / Journal of Virological Methods 85 (2000) 1–10
Fig. 2. Production of full length and truncated gp13 by recombinant MVA. S35-methionine labelled proteins from 293 cells were immunoprecipitated from lysates (panel A) or cell culture supernatants (panel B). Cells were infected with a recombinant MVA construct expressing gp13 without the transmembrane anchor region (lane 1). or an MVA construct containing the full length gp13 gene (lane 2). or the wild type MVA strain (lane 3).
isolated containing the bacteriophage T7 RNA polymerase gene with and without a nuclear localisation signal by inserting into the HA gene using our newly developed plasmid pHA7.5 k/gpt (Fig. 1A). After repeated rounds of drug selection plaque purified MVA isolates were analysed by Southern blot hybridization and tested for induction of expression of marker genes.
3.3. Expression of full-length and truncated EHV gp13 in MVA In order to compare the efficacy of our T7 expressed gp13 gene product with a MVA inducible system, a recombinant MVA-construct was also generated containing the equine herpes virus gp13 gene under the control of the VV 11 k late promoter. Using this construct high levels of recombinant EHV expression were induced with the VV recombinants expressing truncated or fulllength gp13 in the cell cytosol, whereas only the truncated form was detected in the cell supernatant, indicative that only constructs lacking the
gp13 transmembrane anchor sequence were capable of actively secreting gp13 from infected cells (Fig. 2). These pulse labelling studies demonstrate that the underglycosylated precursor of gp13 is predominant in the cell (Fig. 2A, lane 1 and 2, lower arrow) whereas only the fully processed protein is secreted (Fig. 2B, lane 1). The lack of the transmembrane sequence in gp13 results in a slight decrease in molecular size for the soluble protein (Fig. 2B, arrow) as compared to the full length gp13 glycoprotein (Fig. 2A, upper arrow). For comparison also, recombinants containing the full-length gp13 gene in the tk locus of VV strain WR, were produced. After repeated plaque purification on RK13 cells several recombinant viruses were obtained and clone 2B2 was used in this study.
3.4. Validation of T7 RNA polymerase expression by recombinant MVA using green fluorescence protein Mouse L-cells were infected transiently with PSII/gfp and were infected with either recombinant MVA constructs to confirm this virus was expressing T7 RNA polymerase (Fig. 3 middle panel). For comparison. the established VV strain, WR based recombinant virus vTF7-3 (Fuerst et al., 1986) containing full-length T7 polymerase was also used and showed a similar staining pattern on transient transfectants (Fig. 3, right panel).The recombinant MVA construct induced comparable levels of expression of green fluorescence protein as the WR based strain but the MVA construct apparently induced less cytolytic activity and cells infected with the T7 MVA’s maintained their spindle shape for significantly longer than cells infected with the WR based strain.
3.5. A nuclear localisation signal in the T7 RNA polymerase gene is necessary to induce protein expression in stable transfected cell lines Gpl3 expression was analysed in stably transfected 293-EBNA cells after virus infection with different vaccinia recombinants by immunofluorescence (Fig. 4). Induction of protein ex-
H.P. Huemer et al. / Journal of Virological Methods 85 (2000) 1–10
pression was observed only after infection with T7 MVA (Fig. 4, panel A and B) containing the nuclear localisation signal, whereas the identical construct lacking the signal T7 MVA (Fig. 4, panel e) nor the equivalent WR based vTF7-3 construct (Fig. 4, panel c), were ineffective at inducing gp13 expression. Recombinant MVA strains containing gp13 sequence with and with-
7
out transmembrane sequences under the control of the VV 11 k promoter are included for comparison and did show significant gp13 protein expression by immunofluorescence (Fig. 4. panel f and g ,respectively). Constructs including the gp13 transmembrane sequence were found incorporated into the cell membrane (Fig. 4D and F). whereas the viruses expressing truncated gp13
Fig. 3. Induction of expression of green fluorescence protein by recombinant T7 MVA. Expression of T7 RNA polymerase by recombinant VV was tested by transient transfection of CHF cell with the plasmid pBSII/gfp and infection with the recombinant viruses at high m.o.i. for 24 h. Cells were then examined for T7 driven induction of gft expression using fluorescence microscopy. T7 MVA infected cells are shown on the left panel. vTF7-3 infected in the middle panel. On the right panel the weak cytopathic effect of MVA on the infected cell layer is shown.
Fig. 4. Induction of expression of EHV gp13 in stable transfected 293-EBNA cells by T7+ MVA. Immunofluorescence staining using anti-gp13 specific antibody of stable transfected 293-EBNA cells containing episomal persisting plasmid pEPT7. Infection with the different MVA constructs and control viruses is shown: (A) and (B) T7+ MVA, MVA, construct containing bacteriophage T7 polymerase gene linked with nuclear localisation signal; (C) vTF7-3, VV strain WR based isolate expressing T7 polymerase; (D) clon 2B2, VV strain WR containing full-length EHV gp13 in thymidine kinase (tk) locus; (E) T7 MVA, MVA containing T7 polymerase gene without nuclear localisation; (F) MVAgp13, MVA containing the full length gp13 gene under control of VV 11 k promoter in HA locus; (G) MVAgp13-™, MVA containing gp13 gene lacking the transmembrane region; (H) EHV-1, equine herpesvirus type 1 strain Piber.
8
H.P. Huemer et al. / Journal of Virological Methods 85 (2000) 1–10
molecular size of approx. 70 kd (lane 1), whereas only negligible expression was observed in the construct lacking the nuclear localisation sequence (lane 2). For comparison an MVA construct with a truncated EHV gp13 gene under control of the VV 11 k promoter expressed a predominantly underglycosilated protein of 45 kd (lane 3) and produced degradation fragments suggesting that the late promoter might influence protein stability. Protein purification was also performed by attachment to Ni-resins and elution by imidazole. Protein yield was about 0.5 mg obtained from one roller bottle with enhanced surface which contained :109 cells (not shown).
4. Discussion Fig. 5. Secretion of recombinant gp13 by stable transfectants induced with T7+ MVA. Filtrates of serum free supernatants from 293-EBNA cells stably transfected with plasmid pEPT7 containing the truncated gp13 sequence were analysed by western blotting using EHV gp13 specific antibody. Cells infected with T7 MVA (lane 1). T7 MVA (lane 2) and MVAgp13™, (lane 3) are shown. Full length gp13 from EHV-1 virions is shown for comparison (lane 4). Positions of the molecular size standards used are indicated in kilodaltons (kd).
produced an intracellular perinuclear staining (Fig. 4B) similar to Golgi staining. Another interesting observation was that the gp13 protein lacking a transmembrane sequence appeared to be secreted in rather large aggregates as observed by immunofluorescence (Fig. 4A and G).
3.6. Purification and characterisation of secreted gp13 from stable transfectants Truncated gp13 was modified by replacing the viral transmembrane sequence with the addition of a His-tag to aid its purification. Cell supernatants were analysed by western blotting using EHV-specific antibodies. As shown in (Fig. 5), only T7 MVA construct containing the nuclear localisation signal was capable of inducing secretion of the truncated EHV glycoprotein with a
The modified vaccinia virus Ankara (MVA) strain of VV has several key advantages in comparison with other VV strains used commonly for application in an expression system. Most VV strains productively infect a broad spectrum of susceptible eukaryotic cells leading to rapid cell death within 24 h post infection. However, the MVA strain, due to its extensive adaptation to CHF has a severely restricted host range of cells that it can productively infect, but still expresses its virally encoded proteins strongly despite undergoing an abortive infection, in the same range of cells that other vaccinia strains infect. As a result, the reduction in cytotoxicity and increase in safety makes MVA a superior tool for expressing recombinant proteins. MVA is slightly more difficult to use than other VV strains, due to its slower replication and the requirement for primary CHF cultures. However, the use of BHK-21 cells leading to sufficient virus titres (Drexler et al., 1998) or the CHF cell line DF-1 (Himly et al., 1998) which unfortunately is not available to the scientific community so far, could solve this problem. The difficulties associated with recombination plasmids based on insertion into the MVA thymidine kinase (tk) gene has been also observed by other investigators. The failure to obtain viable MVA recombinants with the flanking sequences of the tk locus can be overcome by coexpression
H.P. Huemer et al. / Journal of Virological Methods 85 (2000) 1–10
of the tk gene from another poxvirus species (Scheiflinger et al., 1996). Instead an alternative approach was chosen by producing insertion plasmids for recombination into the VV HA gene. As the VV HA protein presumably is also involved in pathogenicity, disruption of this gene may represent an additional safety feature of our recombinant MVA constructs. which can also be utilised in vaccination studies (Huemar et al., 1999). Whether the observed secretion of protein aggregates by the constructs lacking the transmembrane sequence, may be useful for immunization purposes too, will require further investigation. In summary the advantages of the system described in this paper are as follows: Using VV strain MVA with its limited host range of susceptible cells, protein expression can be induced in a variety of haematopoietic and epithelial cell lines. This occurs without production of infectious viral particles as MVA is non replicative in most mammalian cells, due to its adaptation to CHF. MVA constructs containing the T7 RNA polymerase gene linked to a nuclear localization signal can induce gene expression also from plasmids which are stably transfected into eukaryotic cells. This avoids problems associated with differential transfection efficiencies obtained with available transient transfection methods. High expression rates can be obtained using stable transfected cells with episomal plasmid persistence which are equivalent to, or even superior to, direct insertion of the target gene into VV. In contrast to transient transfection or stable integration of plasmids in the nuclear genome, copy numbers of such episomal persisting plasmids can be increased under selective pressure, especially in cell lines containing a truncated EBNA-1 gene. Using serum free culture conditions, secreted proteins can be induced by highly efficient infection and easily obtained by ultrafiltration and purification. This makes the T7 MVA a useful system for inducible and non leaking eukaryotic gene expression especially of toxic proteins which cannot be expressed constitutuvely in cell lines.
9
Acknowledgements This work was supported by the Austrian Academy of Sciences program tor the advancement of research and technology (APART) and the Jubila¨umsfonds of the Austrian National Bank.
References Antoine, G., Scheiflinger, F., Dorner, F., Falkner, F.G., 1998. The complete genomic sequence of the modified vaccinia Ankara strain: comparison with other orthopoxviruses. Virology 244, 365 – 396. Blanchard, T.J., Alcami, A., Panayiota, A., Smith, G.L., 1998. Modified vaccinia virus Ankara undergoes limited replication in human cells and lacks several immunomodulatory proteins: implications for use as a human vaccine. J. Gen. Virol. 79, 1159 – 1167. Drexler, I., Heller, K., Erfle, V., Sutter, G., 1998. Highly attenuated modified vaccinia virus ankara replicates in baby hamster kidney cells. a potential host for virus propagation. but not in various human transformed and primary cells. J. Gen. Virol. 79, 347 – 352. Dunn, J.J., Krippl, B., Bernstein, K.E., Westphal, H., Studier, F.W., 1988. Targeting bacteriophage T7 RNA polymerase to the mammalian cell nucleus. Gene 68, 259 – 266. Fuerst, T.R., Niles, E.G., Studier, F.W., Moss, B., 1986. Eukaryotic transient-expression system based on recombinant vaccinia virus that synthesizes bacteriophage T7 RNA polymerase. Proc. Natl. Acad. Sci. USA 83, 8122 – 8126. Himly, M., Foster, D.N., Bottoli, I., Iacovoni, J.S., Vogt, P.K., 1998. The DF-I chicken fibroblast cell line: transformation induced by diverse oncogenes and cell death resulting from infection by avian leukosis viruses. Virology 248, 295 – 304. Huemer, H.P., Nowotny, N., Crabb, B.S., Meyer, H., Hubert, P.H., 1995. Gpl3 (EHV-gC): a complement receptor induced by equine herpes viruses. Virus Res. 37, 113 – 126. Huemar, H.P., Strobl, B., Nowotny, N., 1999. Use of apathogenic vaccinia virus MVA expressing EHV-1 gC as basis of a combined recombinant MVA/DNA vaccination scheme. Vaccine (in press). Lupton, S., Levine, A.J., 1985. Mapping genetic elements of Epstein – Barr virus that facilitate extrachromosomal persistence of Epstein – Barr virus-derived plasmids in human cells. Mol. Cell. Biol. 5, 2533 – 2542. Mahnel, H., Mayr, A., 1994. Erfahrung bei der Schutzimpfung gegen Orthopocken von Mensch und Tier mit dem Impfstamm MVA (Experience in vaccination against human and animal orthopoxviruses with the vaccine strain MVA).
10
H.P. Huemer et al. / Journal of Virological Methods 85 (2000) 1–10 highly attenuated vaccinia MVA strain. Arch. Virol. 141, 663 – 669. Shida, H., 1986. Nucleotide sequence of the vaccinia virus hemagglutinin gene. Virology 30, 451 – 462. Smith, G.L., 1991. Vaccinia virus vectors for gene expression. Curr. Opin. Biotechnol. 2, 713 – 717. Stunnenberg, H.G., Lange, H., Philipson, L., van-Miltenburg, R.T., van-der-Vliet, P.C., 1988. High expression of functional adenovirus DNA polymerase and precursor terminal protein using recombinant vaccinia virus. Nucleic Acids Res. 16, 2431 – 2444.
Berliner und Munchner Tierarztliche Wochenschrift 107, 253 – 256.Mackett, M., Smith, G.L., Moss, B., 1992. Vaccinia virus: a selectable eukaryotic cloning and expression vector. Biotechnology 24, 495–499. Meyer, H., Sutter, G., Mayr’, A., 1991. Mapping of deletions on the genome of the highly attenuated vaccinia virus MVA and their influence on virulence. J. Gen. Virol. 72, 1031 – 1038. Scheiflinger, F., Falkner, F.G., Dorner, F., 1996. Evaluation of the thymidine kinase (tk) locus as an insertion site in the
.