Induction of salicylic acid (SA) on transcriptional expression of eight carotenoid genes and astaxanthin accumulation in Haematococcus pluvialis

Enzyme and Microbial Technology 51 (2012) 225–230

Contents lists available at SciVerse ScienceDirect

Enzyme and Microbial Technology journal homepage: www.elsevier.com/locate/emt

Induction of salicylic acid (SA) on transcriptional expression of eight carotenoid genes and astaxanthin accumulation in Haematococcus pluvialis Zhengquan Gao a,1 , Chunxiao Meng a,∗,1 , Xiaowen Zhang b , Dong Xu b , Xuexia Miao a , Yitao Wang a , Liming Yang a , Hongxin Lv a , Lingling Chen c , Naihao Ye b,∗∗ a

School of Life Sciences, Shandong University of Technology, Zibo, 255049, China Yellow Sea Fishery Research Institute, Qingdao, 266071, China c State Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Huazhong Agricultural University, Wuhan, 430070, China b

a r t i c l e

i n f o

Article history: Received 20 March 2012 Received in revised form 1 June 2012 Accepted 3 July 2012 Keywords: Haematococcus pluvialis Astaxanthin Salicylic acid (SA) Carotenoid genes Real-time fluorescence quantitative PCR (qRT-PCR)

a b s t r a c t The green alga Haematococcus pluvialis can produce large amounts of pink carotenoid astaxanthin which is a high value ketocarotenoid. In our study, transcriptional expression patterns of eight carotenoid genes in H. pluvialis in response to SA were measured using qRT-PCR. Results indicated that both 25 and 50 mg/L salicylic acid (SA) could increase astaxanthin productivity and enhance transcriptional expression of eight carotenoid genes in H. pluvialis. But these genes exhibited different expression profiles. Moreover, SA25 (25 mg/L SA) induction had a greater effect on the transcriptional expression of ipi-1, psy, pds, crtR-B and lyc (more than 6-fold up-regulation) than on ipi-2, bkt and crtO, but SA50 (50 mg/L SA) treatment had a greater impact on the transcriptional expression of ipi-1, ipi-2, pds, crtR-B and lyc than on psy, bkt and crtO. Furthermore, astaxanthin biosynthesis under SA was up-regulated mainly by ipi-1, ipi-2, psy, crtR-B, bkt and crtO at transcriptional level, lyc at post-transcriptional level and pds at both levels. Summarily, these results suggest that SA constitute molecular signals in the network of astaxanthin biosynthesis. Induction of astaxanthin accumulation by SA without any other stimuli presents an attractive application potential in astaxanthin production with H. pluvialis. © 2012 Elsevier Inc. All rights reserved.

1. Introduction The freshwater unicellular alga Haematococcus pluvialis is one of the best sources producing astaxanthin (3,3 -dihydroxy-␤,␤carotene-4,4-dione), which is a high-value carotenoid achieving considerable commercial success [1]. The pathway of astaxanthin synthesis in H. pluvialis had been clarified using specific inhibitors by pervious scientists [2]. Several carotenoid biosynthesis genes of H. pluvialis have been cloned and characterized. They are ␤-carotenoid oxygenase gene [3], three carotenoid ketolase genes [4,5], carotenoid hydroxylase gene [6], two isopentenyl diphosphate isomerase genes [7,8], lycopene ␤-cyclase gene [9],

Abbreviations: ABA, abscisic acid; bkt, carotenoid ketolase gene; crtO, carotenoid oxygenase gene; crtR-B, carotenoid hydroxylase gene; ipi, isopentenyl diphosphate isomerase gene; JA, jasmonic acid; lyc, lycopene ␤-cyclase gene; MJ, methyl jasmonate; pds, phytoene desaturase gene; psy, phytoene synthase gene; SA, salicylic acid. ∗ Corresponding author at: School of Life Sciences, Shandong University of Technology, Zibo, 255049, China. Tel.: +86 5332762265. ∗∗ Corresponding author at: Yellow Sea Fishery Research Institute, Qingdao, 266071, China. Tel.: +86 53285830360. E-mail addresses: [email protected] (C. Meng), [email protected] (N. Ye). 1 These authors contributed equally to this work. 0141-0229/$ – see front matter © 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.enzmictec.2012.07.001

phytoene desaturase gene [2,10], and phytoene synthase gene [11]. Many reports have been explored to reveal regulation of the carotenogenic genes related to the formation of astaxanthin and the physiological role of astaxanthin in H. pluvialis response to various stresses [3–12]. Since H. pluvialis differentiates in response to environmental stress, the alga would provide an appropriate model with which to study the physiological role in higher and lower plants [12]. Salicylic acid (SA), as a signal molecule, is involved in plant response to several environmental stress factors and reported to affect growth and development of plants. SA responsive elements including (salicylic acid)-responsive element (TCA-element) in 5 flanking region of key genes of astaxanthin biosynthesis, such as bkt, crtO, ipi, were found and reported previously [13–17], which suggested that SA could be used as an effective regulator to stimulate astaxanthin productivity in H. pluvialis. Latest studies also indicated that SA might stimulate astaxanthin accumulate in H. pluvialis [18], yet the regulatory and physiological role under SA to carotenogenesis during astaxanthin biosynthesis is not clear. In this study, transcriptional expression patterns of eight carotenoid genes (ipi-1, ipi-2, psy, pds, lyc, crtR-B, bkt and crtO) in H. pluvialis treated with SA (25 and 50 mg/L) were analyzed using qRT-PCR, respectively. The purpose of this contribution is to provide evidences for a relationship between SA mediated signaling

226

Z. Gao et al. / Enzyme and Microbial Technology 51 (2012) 225–230

network and the astaxanthin biosynthetic pathway. The study could potentially lead to a scale application of exogenous SA in astaxanthin production of H. pluvialis and provide new insight into the multifunctional roles of carotenogenesis in response to SA. 2. Materials and methods 2.1. Algal strain and growth conditions 712 strain of H. pluvialis was bought from Institute of Oceanology, Chinese Academy of Sciences. Samples of H. pluvialis were grown in a liquid medium (MCM) [19] and cultured in 1000 mL erlenmeyer flasks under a light intensity of 25 ␮mol photons m−2 s−1 on a 12 h:12 h light/dark cycle at 20 ◦ C without aeration. The erlenmeyer flasks were put in illuminating incubator (Ningbo Jiangnan Instrument Factory, GXZ-380, Ningbo, China). 2.2. SA treatment To determine the effect of SA on astaxanthin accumulation, H. pluvialis were treated with two SA concentrations and analyzed astaxanthin accumulation in the algae over time. SA was dissolved deionized water. Algae at the logarithmic phase were divided into three treatments, three replicates for each treatment: 50 mg/L SA (SA50), 25 mg/L SA (SA25) and 0 mg/L SA (control). An equal amount of deionized water was added to the controls. From the time SA solution added, the number of days were counted. The algal cells were harvested at regular intervals over the course of 18 d. 2.3. Observation of optical microscope and measurement of astaxanthin content Optical microscope observation of the morphology, color, and pigment accumulation in H. pluvialis from the treatment and control groups was performed using a Nikon Eclipse 80i microscope (Nikon, Tokyo, Japan). The astaxanthin was extracted and analyzed following Boussiba and Vonshak [19]. The absorption peak is at 490 nm, thus it can represent the astaxanthin concentration. The formula C (mg/L) = (4.5OD490 × Va )/Vb was used to calculated astaxanthin concentration (Va and Vb represented volume of dimethylsulfoxide and microalgae samples, respectively). Equal aliquots of culture from each treatment and the controls were harvested at different intervals and lyophilized. Then lyophilized cells were extracted with dimethylsulfoxide repeatedly until the pellet became colorless. Absorbance of the pooled extracts was read at 490 nm (the type of spectrophotometer: T6 new century, Beijing General Instrument Ltd., China). The blank was dimethylsulfoxide used for the measurement. 2.4. Observation of scanning electron microscope Observation the morphology change of cell surface using scanning electron microscopes was performed using a JEOL Neoscope JCM-5000 (JEOL Ltd. 1-2, Musashino 3-chome Akishima Tokyo 196-8558, Japan). The procedures were according to direction for use of the instrument: (1) alga culture solution was filtered by filter membrane; (2) samples were fixed by 2.5% glutaraldehyde for 1 h; (3) samples were washed with 0.1 M PBS solution three times, 5 min/time; (4) samples were dehydrated with 50, 60, 70, 80, 90, 100% ethanol gradually; (5) samples were dried at critical point; (6) samples were coated with gold; (7) samples were observed and photoed. 2.5. RNA isolation and cDNA acquisition by RT-PCR Algal samples were ground into a fine powder using a mortar and pestle. The total RNA was subsequently extracted using Trizol Reagent according to the user’s manual, after which it was dissolved in diethypylrocarbonate-treated water. In this protocol, genome DNA interlarded RNA samples was digested with DNaseI. The quanlity and quantity were determined by NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, USA). The cDNA used for real-time PCR was synthesized from total RNA using Moloney murine leukemia virus reverse transcriptase (Promega Biotech Co., Madison, WI, USA). The gene-specific primers for eight genes were designed using Primer3 software (Table 1) and synthesized (Biosune, China). The reaction mixture was consist of 14.5 ␮L pure water, 2 ␮L 10× PCR buffer (containing Mg2+ ), 0.4 ␮L dNTP (10 mM L−1 ), 1 ␮L (10 ␮M L−1 ) of each primer, and 0.2 ␮L rTaq DNA Polymerase (Takara) per 20 ␮L reaction. PCR amplification was conducted by subjecting the samples to the following conditions: initial denaturation at 94 ◦ C for 4 min, followed by 33 cycles of 94 ◦ C for 40 s, 55 ◦ C (psy, crtO, act)/58 ◦ C (pds)/61 ◦ C (bkt, lyc, ipi-1)/62 ◦ C (ipi-2, crtRB) for 40 s, and 72 ◦ C for 2 min, with a final extension at 72 ◦ C for 7 min. The PCR products were then resolved by electrophoresis on 1% agarose gel, after which the fragment of interest was excised, purified using an agarose gel DNA fragment recovery kit (TaKaRa), cloned into PMD-18T vector (TaKaRa) and sequenced (BGI, China). The sequence was examined for homology with known sequences using the BLAST program available at the National Center for Biotechnology Information website (http://www.ncbi.nlm.nih.gov/blast).

Table 1 Gene-specific primers and annealing temperatures used for qRT-PCR. Primer

Primer sequence (5 -3 )

Annealing temperature (◦ C)

GenBank ID

psyF psyR pdsF pdsR lycF lycR crtR-bF crtR-bR bktF bktR ipi-1F ipi-1R ipi-2F ipi-2R crtOF crtOR actF actR

CGATACCAGACCTTCGACG TGCCTTATAGACCACATCCAT ACCACGTCGAAGGAATATCG TCTGTCGGGAACAGCCG TGGAGCTGCTGCTGTCCCT GAAGAAGAGCGTGATGCCGA ACACCTCGCACTGGACCCT GTATAGCGTGATGCCCAGCC CAATCTTGTCAGCATTCCGC CAGGAAGCTCATCACATCAGAT GCGAGCACGAAATGGACTAC GCTGCATCATCTGCCGCA AGTACCTGGCGCAAAAGCTG GTTGGCCCGGATGAATAAGA ACGTACATGCCCCACAAG CAGGTCGAAGTGGTAGCAGGT TGCCGAGCGTGAAATTGTGAGG CGTGAATGCCAGCAGCCTCCA

55

AF305430

58

X86783

61

AY182008

62

AF162276

61

AY603347

61

AF082325

62

AF082326

55

X86782

55

Huang et al. [5]

2.6. Real-time quantitative PCR analysis To better understand the effect of SA on the astaxanthin synthetic pathway at the molecular level, real-time fluorescence quantitative PCR was used to investigate the expression profiles of eight kinds of carotenoid genes simultaneously in response to SA treatment. The actin gene was used as a reference for total RNA. For real-time PCR, pairs of gene-specific primers were designed according to GenBank data. PCR products were then quantified continuously with the ABI StepOne Plus Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) using SYBR green fluorescence (Takara) according to the manufacturer’s instructions. The PCR amplification profile was 95 ◦ C for 30 s followed by 40 cycles of 95 ◦ C for 5 s, 55 ◦ C (psy, crtO, act)/58 ◦ C (pds)/61 ◦ C (bkt, lyc, ipi-1)/62 ◦ C (ipi-2, crtR-B) for 15 s, and 72 ◦ C for 35 s. The 2−CT method was used to analyze quantitative real-time PCR data [20]. 2.7. Statistical analysis The means ± standard deviation (SD) were derived from all data and were statistically analyzed with one-way ANOVA (SPSS 17.0). LSD multiple comparisons test were used to test the differences among groups of different trials. P-values of less than 0.05 were considered to be statistically significant.

3. Results and discussion 3.1. Observation of microscope and measurement of astaxanthin content Significant difference in astaxanthin accumulation was observed using optical microscope between the controls and SA treatments (SA25 and SA50). Microscopy observations revealed the initial color change from green to red on days 1 and 2 after application of SA25 and SA50, respectively. On day 3, there was great difference between controls and treatments (Fig. 1a–c). On day 18, more than 60% of single alga cell in SA25 treatments turned red, and almost 85% of cells changed red thoroughly in SA50 treatments, respectively (Fig. 1d–f). At the same time, about 15% of the algae cells were whitened or disintegrated in the SA50 samples. The scanning electron microscopes was used to observe the change of the alga cell surface in different status during astaxanthin accumulation. In Fig. 2a–b represented green cells (from SA50 cultivated for 0 days), partial red cells (from SA50 cultivated for 9 days) and red cells (from SA50 cultivated for 18 days). The pictures showed green cells displayed some irregular protuberances; partial red cells had much more irregular protuberances; red cells presented much irregular corrugation instead of protuberances, which illustrated the surface of alga cells changed drastically during astaxanthin accumulation.

Z. Gao et al. / Enzyme and Microbial Technology 51 (2012) 225–230

227

Fig. 1. Microscopic images (400×) of H. pluvialis cells culture samples days 3 and 18 after treatment with SA. (a), (b), (c) represent the control, SA25 sample and SA50 sample after 3 days of treatment, (d), (e), (f) represent the control, SA25 sample and SA50 sample after 18 days of treatment, respectively.

Measurement of astaxanthin content showed that SA50 treatment resulted in the highest astaxanthin production (2.74 mg L−1 alga culture solution), followed SA25 treatment (1.63 mg L−1 alga culture solution). The astaxanthin content of the controls was 0.391 mg L−1 alga culture solution after culture for 18 d (Fig. 3). SA is a key player in regulating abiotic stress-induced gene expression in higher plants [21,22]. Little is known about the putative role of phytohormones on algae physiology and especially about their implication in the regulation of secondary metabolism in algae [24]. Both SA and jasmonic acid (JA) had impact on the growth and biochemical activity of Chlorella vulgaris [23,24]. SA affected the secondary carotenogenesis mainly by scavenging the free radicals necessary for secondary carotenoid induction [18].Recently, the influence of SA and MJ on the antioxidant systems in H. pluvialis was investigated by Vidhyavathi et al. [18]. They found that SA at lower concentrations (100 ␮M) could be used for elicitation of secondary carotenoid production. This was in agreement with our results, which indicated that 25 and 50 mg/L SA stimulated astaxanthin accumulation in H. pluvialis, in which 50 mg/L SA induction have better effect (Fig. 3). The high level of astaxanthin accumulation was likely due to the up-regulation of eight carotenoid genes (ipi-1, ipi-2, psy, pds, lyc, crtR-B, bkt and crtO) under SA.

3.2. Patterns of SA-induced transcriptional expression of carotenoid genes Many studies have reported enhancement of carotenogenic genes expression and increases in total carotenoid and secondary carotenoid content under various stresses in H. pluvialis, such as carotenoid inhibitors [24], high light [25], photon flux [26,27], regeneration [28], nutrient stress [29], EMS and NTG [30], MJ and GA3 treatment [31]. Despite numbers of research explored and remarkable performance in astaxanthin production, lack of information about regulatory mechanism has kept H. pluvialis from commercial uses in a large scale. For a better understanding regulation mechanism of astaxanthin biosynthesis, knowledge on astaxanthin accumulation and their relationship with expression pattern of carotenoid genes are necessary. In order to better understand the regulatory mechanism of astaxanthin biosynthesis under SA in H. pluvialis, the transcriptional expression of the carotenoid genes monitored simultaneously by qRT-PCR was performed in our paper. The OD260/280 of total sample was 1.97 and the concentration was 950 ng/␮L. There are five time points exhibits up-expression about ipi-1 in both SA25 and SA50 treatments. The five up-expression peaks occurred on days 1, 6, 8, 10 and 16 with 2.2-, 2.0-, 11.0-, 4.1- and 2.0-fold of

228

Z. Gao et al. / Enzyme and Microbial Technology 51 (2012) 225–230

Absorbtion of OD490

Ataxanthin content in different cultivation time 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0

control SA25 SA50

0

2

4

6

8

10

12

14

16

18

Cultivation time (day) Fig. 3. Astaxanthin accumulation of control, SA25 sample and SA50 sample during the cultivation. OD490 represents relative astaxanthin content in alga culture solution.

Fig. 2. The scanning electron microscopes of the microalgal cells in different status during astaxanthin accumulation. (a), (b), and (c) represented green cells (from SA50 cultivated for 0 days), partial red cells (from SA50 cultivated for 9 days) and red cells (from SA50 cultivated for 18 days).

transcriptional expression of control in SA25 treatment. And SA50 treatment displayed overexpression at transcriptional on days 1, 6, 8, 10 and 16, too, with 2.1-, 2.0-, 9.3-, 9.4, 4.1-fold of that of control. The maximum transcript levels occurred on days 8 and 10 in the SA25 and SA50 treatments, respectively (Fig. 4a). Ipi-2 also appeared five up-expression peaks in SA25 treatment with 3.4-, 5.5-, 2.4-, 2.3- and 2.3-fold of transcriptional expression of control. And only two overexpression peaks appeared in SA50 treatment with 6.3- and 21.6-fold on days 8 and 16, respectively. The maximum peaks were observed on days 8 and 16 with 5.5- and 21.6-fold of control, respectively (Fig. 4b). Different from

previous studies indicated the maximum transcript level of ipi occurs at about 6–12 h under high light [8,26], ipi-1 and ipi-2 did not displayed significant overexpression before 24 h in the present study. It may be the result under two different inductions, high light and SA. The first sampling time was 12 h after treatment, beyond 6–12 h. Therefore, missing the optimal sampling time point could not excluded in haste in our experiment. The initial increased expression of psy was 1.9- and 1.5-fold of controls on day 2.5 in both treatment, and declined suddenly on day 3. Two and one overexpression peaks were observed in SA25 and SA50 treatments, respectively. The two peaks appeared on days 4 and 16 with 2.0- and 6.2-fold of transcriptional expression of control in SA25 treatment, respectively. The maximum peaks were observed on day 16 in both treatments with 6.2- and 4.6-fold of control, respectively (Fig. 4c). The transcriptional expression profiles of psy was also different from results reported by Sun et al. [8] and Li et al. [26], in which the maximum transcripts of psy occur at 12 h after exposed to high light stress. In both treatments, the first increase of transcriptional levels of pds occurred on day 1 (4.5- and 2.3-fold of controls, respectively), then declined and up-expressed significantly from day 2.5 to day 4 steadily. The highest peaks occurred on days 3 and 4 in SA25 and SA50, with 6.8- and 7.5-fold of controls, respectively (Fig. 4d). Lyc gene up-expressed significantly from day 2.5 to 4 continuously. The initial increased expression was 2.2- and 3.8-fold of controls on day 2.5, respectively, and the maximum levels occurred on day 3 with 6.6-fold of controls in both treatments, then declined to 3.0- and 2.9- fold of controls on day 4 (Fig. 4e). The initial increased expression of crtR-B was 2.3- and 2.5-fold of controls on day 1 in both treatments. The maximum transcriptional levels of crtR-B in both treatments occurred on day 4, with 9.2- and 13.2-fold of controls, respectively (Fig. 4f). But the maximum crtR-B appeared at 12 h after exposed to high light stress [8,26]. There are two up-expression peaks of bkt were detected, while they occurred in different time points in the two treatments. In SA25 treatments, the two peaks appeared on days 1 and 14 with 2.0- and 2.4-fold of transcriptional level of control. The two overexpression peaks of SA50 treatment occurred on days 0.5 and 16 with 2.0- and 4.4-fold of control transcriptional expression (Fig. 4g). The initial increased expression of crtO occurred on day 1 (2.4- and 2-fold of controls, respectively) in both treatments. The maximum levels (4.1- and 3.6-fold of controls, respectively) appeared on days 10 and 16 in SA25 and SA50 treatment, respectively (Fig. 4h). Transcriptional expression of some carotenoid genes was studied within 48 h under stress conditions in the previous studies and results showed most of all these genes have shown significant upregulation on 24–48 h [5,9,26,27,31,32]. In concurrence with the above reports, ipi-1, pds, crtR-B, bkt and crtO seems to be increased transcriptional expression levels at one time point at least among the three ones at 24, 36, 48 h; in contrast to above results, there are

Z. Gao et al. / Enzyme and Microbial Technology 51 (2012) 225–230

(a)

14

(e)

SA25

8

ipi-1

Relative transcript levels

10 8 6 4 2

6 5 4 3 2 1

15 10 5 0

18

14

16

12

8

10

6

4

3

2

2. 5

1

1. 5

18

co nt ro l 0. 5

14

16

12

8

10

ipi- 2

20

Time(day) (f) crtR-B

SA25 SA50

SA25 SA50

14 12 10 8 6 4 2

Time(day)

6

psy

5 4 3 2 1

18

16

14

12

10

8

6

3

4

2

2. 5

5 1.

5

(g)

5

SA50

Relative transcript levels

(c)

SA25

bkt

4.5

SA50

4 3.5 3 2.5 2 1.5 1 0.5

(d)

Relative transcript levels

7 6 5 4 3 2 1

18

16

14

10

12

8

SA25

(h) crtO

5

SA50

6

Time(day)

SA25

pds

8

4

5

3

2

2.

1. 5

co nt

ro l 0. 5

18

16

12

14

10

8

6

4

3

5 2.

2

1. 5

1

co nt

Time(day)

9

1

0

0

4.5

SA50

4 3.5 3 2.5 2 1.5 1 0.5

18

16

14

12

8

10

6

4

3

2 2. 5

1. 5

18

16

14

12

10

8

6

3

2. 5

2

1. 5

1

4

Time(day)

1

0

0

co nt ro l 0. 5

ro l 0. 5

Time(day)

SA25

7

co nt ro l 0. 5

1

ro l co nt

18

16

14

12

10

8

6

3

4

2. 5

2

1. 5

1

0 0. 5

co nt ro l

SA50

16

(b)

Relative transcript levels

Relative transcript levels

6

4

3

2. 5

5

2

1.

5

1

0.

tr ol co n

Time(day)

25

Relative transcript levels

SA25

0

0

Relative transcript levels

lyc

7

0.

Relative transcript levels

SA50

12

229

Time(day)

Fig. 4. The effects of SA on the transcript levels expression kinetics of eight carotenogenic genes in H. pluvialis during incubation. (a), (b), (c), (d), (e), (f), (g) and (h) represent transcript levels expression kinetics of ipi-1, ipi-2, psy, pds, lyc, crtR-B, bkt and crtO, respectively.

three carotenoid genes, ipi-2, psy and lcy are not up-expressed transcriptional expression levels significantly at the three time points according to the present results (Fig. 4). Eight carotenoid genes exhibited different expression profiles when exposed to the SA25 and SA50, respectively. The maximum transcriptional levels of ipi-1, ipi-2, psy, pds, crtR-B, lyc, bkt and crtO of SA25 samples were 11-, 5.5-, 6.2-, 6.8-, 9.2-, 6.6-, 2.4- and 4.1fold of controls on days 8, 8, 16, 3, 4, 3, 14 and 10, respectively. These results showed that SA25 induction had a greater effect on the transcriptional expression levels of ipi-1, psy, pds, crtR-B and lyc (more than 6-fold up-regulation) than on ipi-2, bkt and crtO. Those maximum levels of SA50 samples were 9.4-, 21.6-, 4.6-, 7.5-, 13.2-, 6.6-, 4.4- and 3.6-fold of controls on days 10, 16, 16, 4, 4, 3, 16 and

16, which showed that SA50 treatment had a greater impact on the transcriptional expression of ipi-1, ipi-2, pds, crtR-B and lyc (more than 6-fold up-regulation) than on psy, bkt and crtO. The astaxanthin content of both treatments increased significantly from day 4 in present paper. In SA25 treatment, both the mRNA expression maximum peaks of pds and lyc occurred on day 3, which preceded the initial fast astaxanthin accumulation. Thus, the two genes might up-regulate astaxanthin biosynthesis at post-transcriptional level. The maximum transcription level of crtR-B occurred in day 4, which was in accord with the course of astaxanthin accumulation. Thus it might up-regulate astaxanthin biosynthesis at transcriptional level. The maximum transcriptional peaks of ipi-1, ipi-2, psy, bkt and crtO appeared on days 8, 8, 16,

230

Z. Gao et al. / Enzyme and Microbial Technology 51 (2012) 225–230

14 and 10, respectively, which lagged behind the initial fast astaxanthin accumulation. Therefore, the five genes might up-regulate astaxanthin biosynthesis at transcriptional level [26,27]. With respect to SA50 samples, the transcriptional maximum level of lyc appeared on day 3, preceding the initial fast astaxanthin accumulation, it might up-regulate astaxanthin biosynthesis at post-transcriptional level. Both the mRNA expression maximum levels of pds and crtR-B occurred in day 4, which were in line with the course of astaxanthin accumulation. Thus the two genes might up-regulate astaxanthin biosynthesis at transcriptional level. The rest five genes, ipi-1, ipi-2, psy, bkt and crtO expressed transcriptional peaks on days 10, 16, 16, 16 and 16, respectively, which lagged behind the initial fast astaxanthin accumulation. Therefore, these five genes also might up-regulate astaxanthin biosynthesis at transcriptional level [26,27]. A more detailed study involving protein expression level rather than only on transcription would likely provide more insight into the action of SA. However, the current study provide an attractive biotechnological option which must be helpful for the critical issue for the development of a high-performance astaxanthin production platform is the optimization of culture parameters and the use of genetic engineered microorganisms highlighted [30]. 4. Conclusion Two SA treatments stimulated astaxanthin accumulation in H. pluvialis, in which 50 mg/L SA induction have an optimal effect in our experiment. The high level of astaxanthin accumulation was probably due to the up-regulation of eight carotenoid genes. The high expression upon the existence of SA makes it easy to reach a threshold of total mRNA of eight carotenoid genes that is essential for the biosynthesis of large amounts of astaxanthin. Astaxanthin biosynthesis under SA was up-regulated mainly by ipi-1, ipi-2, psy, crtR-B, bkt and crtO genes at transcriptional level, lyc gene at posttranscriptional level and pds gene at both levels. Acknowledgements The present study was supported by the National Natural Science Foundation of China (41106124, 31170279), the National Natural Science Foundation of Shandong province (ZR2011DM006, ZR2011CQ010), the open funds of State Key Laboratory of Agricultural Microbiology (AMLKF201003) and the supporting project for young teachers in Shandong University of Technology (4072110045). References [1] Kim ZH, Kim SH, Lee HS, Lee CG. Enhanced production of astaxanthin by flashing light using Haematococcus pluvialis. Enzyme and Microbial Technology 2006;39:414–9. [2] Grünewald K, Eckert M, Hirschberg J, Hagen C. Phytoene desaturase is localized exclusively in the chloroplast and up-regulated at the mRNA level during accumulation of secondary carotenoids in Haematococcus pluvialis (Volvocales, Chlorophyceae). Plant Physiology 2000;122:1261–8. [3] Lotan T, Hirschberg J. Cloning and expression in Escherichia coli of the gene encoding b-C-4-oxygenase, that converts ␤ carotene to the ketocarotenoid canthaxanthin in Haematococcus pluvialis. FEBS Letters 1995;364:125–8. [4] Breitenbach J, Misawa N, Kajiwara S, Sandmann G. Expression in Escherichia coli and properties of the carotene ketolase from Haematococcus pluvialis. FEMS Microbiology Letters 1996;140:241–6. [5] Huang JC, Chen F, Sandmann G. Stress-related differential expression of multiple ␤-carotene ketolase genes in the unicellular green alga Haematococcus pluvialis. Journal of Biotechnology 2006;122:176–85. [6] Linden H. Carotenoid hydroxylase from Haematococcus pluvialis: cDNA sequence, regulation and functional complementation. Biochimica et Biophysica Acta 1999;1446:203–12.

[7] Kajiwara S, Fraser PD, Kondo K, Misawa N. Expression of an exogenous isopentenyl diphosphate isomerase gene enhances isoprenoid biosynthesis in Escherichia coli. Biochemical Journal 1997;324:421–6. [8] Sun Z, Cunningham FX, Gantt E. Differential expression of two isopentenylyrophosphate isomerases and enhanced carotenoid accumulation in a unicellular Chlorophyte. Proceedings of the National Academy of Sciences of the United States of America 1998;95:11482–8. [9] Steinbrenner J, Linden H. Light induction of carotenoid biosynthesis genes in the green alga Haematococcus pluvialis: regulation by photosynthetic redox control. Plant Molecular Biology 2003;52:343–56. [10] Steinbrenner J, Sandmann G. Transformation of the green alga Haematococcus pluvialis with a phytoene desaturase for accelerated astaxanthin biosynthesis. Applied and Environment Microbiology 2006;72:7477–84. [11] Steinbrenner J, Linden H. Regulation of two carotenoid biosynthetic genes coding for phytoene synthase and carotenoid hydroxylase during stress-induced astaxanthin formation in the green alga Haematococcus pluvialis. Plant Physiology 2001;125:810–7. [12] Kobayashi M, Kakizono T, Nagai S. Enhanced carotenoid biosynthesis by oxidative stress in acetate-induced cyst cells of a green unicellular alga, Haematococcus pluvialis. Applied and Environment Microbiology 1993;59:867–73. [13] Meng CX, Teng CY, Jiang P, Qin S, Tseng CK. Cloning and characterization of ␤-carotene ketolase gene promoter in Haematococcus pluvialis. Acta Biochim Biophys Sinica 2005;37:270–5. [14] Meng CX, Liang CW, Su ZL, Qin S, Tseng CK. There are two 5 -flanking regions of bkt encoding beta-carotene ketolase in the Haematococcus pluvialis. Phycologia 2006;45:218–24. [15] Meng CX, Wei W, Su ZL, Qin S, Tseng CK. Characterization of carotenoid hydroxylase gene promoter in Haematococcus pluvialis. Indian Journal of Biochemistry and Biophysics 2006;43:284–8. [16] Gao ZQ, Meng CX, Ye NH. Three 5 -flanking regions of crtO encoding ␤carotene oxygenase in Haematococcus pluvialis. Bulletin of Marine Science 2010;12:59–64. [17] Gao ZQ, Meng CX, Ye NH. Regulatory Analysis of IPP isomerase gene in Haematococcus pluvialis. Bulletin of Marine Science 2009;11:37–42. [18] Vidhyavathi R, Sarada R. Effect of salicylic acid and methyl jasmonate on antioxidant systems of Haematococcus pluvialis. Acta Physiologiae Plantarum 2011;33:1043–9. [19] Boussiba S, Vonshak A. Astaxanthin accumulation in the green alga Haematococcus pluvialis. Plant and Cell Physiology 1991;32:1077–82. [20] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2−CT method. Methods 2001;25:402–8. [21] Sudha G, Ravishankar GA. Influence of methyl jasmonate and salicylic acid in the enhancement of capsaicin production in cell suspension cultures of Capsicum frutescens Mill. Current Science 2003;85:1212–7. [22] Wang HH, Feng T, Peng XX, Yan ML, Tang XK. Up-regulation of chloroplastic antioxidant capacity is involved in alleviation of nickel toxicity of Zea mays L. by exogenous salicylic acid. Ecotoxicology and Environmental Safety 2009;72:1354–62. [23] Czerpak R, Piotrowska A, Szulecka K. Jasmonic acid affects changes in the growth and some components content in alga Chlorella vulgaris. Acta Physiologiae Plantarum 2006;28:195–203. [24] Czerpak R, Bajguz A, Gromek M, Kozlowska G, Nowak I. Activity of salicylic acid on the growth and biochemism of Chlorella vulgaris Beijerinck. Acta Physiologiae Plantarum 2002;24:45–52. [25] Vidhyavathi R, Sarada R, Ravishankar GA. Expression of carotenogenic genes and carotenoid production in Haematococcus pluvialis under the influence of carotenoid and fatty acid synthesis inhibitors. Enzyme and Microbial Technology 2009;45:88–93. [26] Li YT, Sommerfelda M, Chen F, Hu Q. Consumption of oxygen by astaxanthin biosynthesis: a protective mechanism against oxidative stress in Haematococcus pluvialis (Chlorophyceae). Journal of Plant Physiology 2008;165:1783–97. [27] Li YT, Sommerfelda M, Chen F, Hu Q. Effect of photon flux densities on regulation of carotenogenesis and cell viability of Haematococcus pluvialis (Chlorophyceae). Journal of Applied Phycology 2010;22:253–63. [28] Vidhyavathi R, Venkatachalam L, Kamath BS, Sarada R, Ravishankar GA. Differential expression of carotenogenic genes and associated changes in pigment profile during regeneration of Haematococcus pluvialis cyst. Applied Microbiology and Biotechnology 2007;75:879–87. [29] Vidhyavathi R, Venkatachalam L, Sarada R, Ravishankar GA. Regulation of carotenoid biosynthetic genes expression and carotenoid accumulation in the green alga Haematococcus pluvialis under nutrient stress conditions. Journal of Experimental Botany 2008;59:1409–18. [30] Kamath BS, Vidhyavathi R, Sarada R, Ravishankar GA. Enhancement of carotenoids by mutation and stress induced carotenogenic genes in Haematococcus pluvialis mutants. Bioresource Technology 2008;99:8667–73. [31] Lu YD, Jiang P, Liu SF, Gan QH, Cui HL, Qin S. Methyl jasmonate or gibberellins A3-induced astaxanthin accumulation is associated with up-regulation of transcription of ␤-carotene ketolase genes (bkts) in microalga Haematococcus pluvialis. Bioresource Technology 2010;101:6468–74. [32] Wang SB, Chen F, Sommerfeld M, Hu Q. Proteomic analysis of molecular response to oxidative stress by the green alga Haematococcus pluvialis (Chlorophyceae). Planta 2004;220:17–29.