- Email: [email protected]
Induction of transforming growth factor-beta 1 on dentine pulp cells in different culture patterns
Cell Biology International 30 (2006) 295e300 www.elsevier.com/locate/cellbi
Induction of transforming growth factor-beta 1 on dentine pulp cells in different culture patterns Xin Nie a,b, Weidong Tian a, Yongjie Zhang b,c, Xizhe Chen a, Rui Dong b,c, Ming Jiang b,c, Famin Chen b,c, Yan Jin b,c,* a
Department of Oral and Maxillofacial Surgery, West China Stomatology College, Sichuan University, Chengdu 610041, China b Department of Oral Pathology, Stomatology College, Fourth Military Medical University, Xi’an 710032, China c Center for tissue engineering, Fourth Military Medical University, Xi’an 710032, China Received 13 September 2005; revised 17 November 2005; accepted 10 December 2005
Abstract Recent studies have documented that TGF-b1 takes part in dental pulp tissue repair. Moreover, dental pulp cells have the potential to differentiate into odontoblast-like cells and produce reparative dentine in this process. However, the molecular mechanisms and potential interactions between TGF-b1 and dental pulp cells are not clear due to the complexity of the pulp/dentine microenvironment. In this study, we investigated the induction of TGF-b1 on the dental pulp cells in cell culture, tissue culture and three-dimensional culture patterns. These results demonstrated that TGF-b1 significantly increased the proliferation of cells and activity of ALPase. Dental pulp cells cultured in the presence of TGF-b1 formed mineralization nodules. In the organ culture, dental pulp cells treated with TGF-b1 differentiated into odontoblast-like cells and formed a pulp-dentinal complex; and TGF-b1 significantly induced synthesis of dentine relative proteins DSPP, DMP-1. The dental pulp cells share some characteristics of the odontoblast, such as a parallel arrangement with columnar form and a unilateral cell process. Together, these data indicate that TGF-b1 can make dental pulp cells differentiated into odontoblast-like cells and form the pulp-dentinal complex. Moreover, these results suggest that TGF-b1 is an important regulatory factor in odontoblast differentiation during tooth development and pulp repair. Ó 2005 International Federation for Cell Biology. Published by Elsevier Ltd. All rights reserved. Keywords: Dentine pulp cells; Odontoblast; Transforming growth factor; Tissue culture; Three-dimensional culture
1. Introduction Reparative dentine is formed locally in response to noxious stimuli such as caries, attrition, abrasion and operative procedures. After destruction of the odontoblast layer, dentine pulp cells migrate to the region of necrosis from the deeper region of the pulp and differentiate into odontoblasts. Following Abbreviations: DMEM, Dulbecco’s modified Eagle’s medium; FCS, fetal calf serum; ALPase, alkaline phosphatase; ECM, extracellular matrix; BMG, bone matrix gelatin; RTePCR, reverse transcriptionepolymerase chain reaction; TEM, transmission electron microscopy; DSPP, dentine sialophosphoprotein; DMP, dentine matrix protein. * Corresponding author. Department of Oral Pathology, Stomatology College, Fourth Military Medical University, Xi’an, Shannxi 710032, China. Tel.: þ81 029 84776174; fax: þ81 029 83218039. E-mail address: [email protected] (Y. Jin).
differentiation, the post-mitotic odontoblasts synthesize and secrete a kind of extracellular matrix, which mineralizes and confers the unique structure to dentine. Characterisation of the molecular and cellular events important in dental tissue injury and repair is critical to our understanding of these processes (Ruch et al., 1995). However, the molecular basis of odontoblast differentiation is not clear, but signaling molecules, especially the members of the transforming growth factor-beta (TGF-b) superfamily, which have important roles in regulating cell growth, differentiation and function, such as TGF-b and BMPs, have been implicated in controlling aspects of tooth development and tissue repair (Begue et al., 1992; Tucker and Sharpe, 1999; Sloan and Smith, 1999). This suggestion was supported by the transcript change of TGF-b and BMPs during embryonic tooth development and reparative dentineogenesis and the direct application of recombinant BMP-2, BMP-4 and
1065-6995/$ - see front matter Ó 2005 International Federation for Cell Biology. Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.cellbi.2005.12.001
296
X. Nie et al. / Cell Biology International 30 (2006) 295e300
BMP-7 (OP-1) on amputated pulp, which induced large amounts of reparative dentine (Sloan and Smith, 1999; Rutherford et al., 1993). The superfamily of TGF-b is a large group of growth factors and TGF-b1 has been suggested as a major candidate for regulating the pulpedentinal response to injury (Tziafas et al., 2001; Magloire et al., 2001). It has been shown that TGF-b1 is expressed throughout tooth development. Odontoblasts and dental pulp cells show the presence of TGF-b receptors I and II, where they could modulate the behavior of odontoblasts and dental pulp cells (Sloan et al., 1999). Activation of TGFb1 expression in sub-odontoblast cells after injury has been suggested to be associated with a differentiation pathway leading to odontoblast-like cells. Such activities might contribute to the maintenance of the odontoblast phenotype during reparative processes (Sloan et al., 1999). It initiates odontoblast differentiation and a local increase in predentine secretion. TGF-b1 is also used as a pulp-capping medicament to enhance the formation of reparative dentine in rat molars. However, the regulatory mechanisms of TGF-b1 on dental pulp cells as a response to external stimuli is not well understood. Previous experimental results revealed that TGF-b1 initiated the process of pulp repair through its ability to induce dentinal extracellular matrix (ECM). TGFb1 upregulates the secretion of extracellular matrix by odontoblasts, which are mitogenic to dental pulp cells in vitro and in vivo (Nishikawa et al., 2000; Magne et al., 2004). Isolated dentine extracellular matrix initiates odontoblast differentiation from dental papillae mesenchymal cells (Kikuchi et al., 2004). These inductive activities are associated with the formation of dentinal bridges or large areas of mineralization during pulp repair in vivo (Goldberg and Smith, 2004). Moreover, TGF-b1 can influence the behavior of dental pulp cells. Specifically, TGF-b1 has been shown to stimulate the three main events of human dental pulp repair (an odontoblastic functional feature); cell proliferation, cell migration, and type I collagen synthesis (Shiba et al., 1998). Recent results have shown that TGF-b1 has an effect on the differentiation of pulp cells into odontoblasts during tooth development and injury, but these are mainly based on indirect methods such as gene expression studies in vivo (Tziafas and Papadimitriou, 1998). However, simple gene expression changes do not accurately or comprehensively reflect events that occur in vivo. Direct evidence on the role of growth factors important in these repair processes has been limited due to the nature and location of the odontoblast cells. Therefore, to overcome the problems in single culture, we have sought different culture patterns in vitro to simulate a pulp microenvironment suitable for the maintenance of normal cell/cell and cell/dentine relationships, and on the basis of which, we investigated whether TGF-b1 could induce the expression of an odontoblast-like phenotype and the formation of dentine-like structures in dental pulp cells. 2. Materials and methods 2.1. Preparation of dental pulp cell cultures Healthy third molar teeth were collected immediately from the clinics at university with the patients’ informed consent. The pulp tissues were carefully
taken from dental crown and cut into several pieces. These tissue fragments were incubated at 37 C for 30 min in a solution containing 0.05% collagenase and 0.125% trypsin. The medium was replaced with fresh enzyme medium. The procedure was repeated 4 times. The first medium was decanted to prevent the contamination of odontoblast. Dental pulp cells were cultured with Dulbecco’s minimum essential medium (DMEM) supplemented with 2 mM glutamine, 100 IU/ml penicillin, 100 mg/ml streptomycin and 10% fetal calf serum (FCS). The medium was at 3-day intervals.
2.2. Effects of TGF-b1 on dental pulp cells To ensure the viability of the cells in these cultures and to study the effects of TGF-b1, we incubated the 5th passage cells in the medium with or without 5 ng/ml TGF-b1 (Sigma, St Louis, MO, USA), then these cells were inoculated in the 96-well plates (Costar, Cambridge, MA, USA). During culture 3 and 6 days, the proliferation of cells was measured with MTT and alkaline phosphatase (ALPase) activity was measured using p-nitrophenyl phosphate as a substrate. All results are shown as mean SEM (n ¼ 6). The statistical significance of the differences between two groups was determined with a two-tailed Student’s t-test. Any difference was considered significant when p < 0.05. Von Kossa’s staining of these cells was performed to quantify the mineralized nodules when dental pulp cells were continuous culture 30 days.
2.3. Induction of TGF-b1 in tissue culture Allogeneic demineralized bone matrix gelatin (BMG) was widely used as a substitute of the bone graft in orthopedics and dentistry. In this study, it has been used as tissue-culture carriers in the form of arcuate segments. For pulp tissue cultures, the method of culture designed according to Towel-type cultures, brief described as below: human pulp tissues from third molar teeth were minced into 1 mm3 pieces with fine blade. These pieces were mixed with dentine powder (gift from Prof Smith AJ) and 5 mg/ml TGF-b1, the operation of control group was similar except for TGF-b1. The mixture transferred to a sterile BMG supported with a stainless steel filter and suspended on the surface of culture medium for 3, 7, 14, and 21 days on BMG. In different time, these pulp tissues were fixed with 10% formaldehyde, demineralized and embedded in paraffin, and cut into 5-mm sections. The characteristics of mixture were studied through histology analysis including hematoxylin and eosin, toluidine blue and Mallory staining. Immunohistochemical staining had been performed to investigate the expression of DSPP and DMP-1 (monoclonal antibodies to DSPP and DMP-1 at 1:200 dilutions, gifts from Prof Yin Zhang) in the pulp cells.
2.4. Induction of TGF-b1 in three-dimensional culture Collagen I (Sigma) was used to construct the system of pulp cell in three-dimensional culture; dentine powder was added in the gel to imitate human dentine. The dental pulp cells were mixed together with 8 mg/ml collagen, FCS and dentine powder. The mixture was incubated with DMEM medium with or without 5 ng/ml TGF-b1 at room temperature. In the three-dimensional culture, collagen assembled spontaneously into fibrillar gel to form artificial pulp, in which human dental pulp cells were interspersed. After culture 2 weeks, all specimens were divided into 3 groups for evaluation, which include HE staining, transmission electron microscopy (TEM) analysis, and reverse transcription-polymerase chain reaction (RT-PCR) analysis, respectively. One group for histological analysis was fixed with 10% formaldehyde, demineralized and embedded in paraffin, and cut into 5-mm sections. These sections were stained with hematoxylin and eosin. The second group was fixed with 1% OsO4, dehydrated in an ethanol series, and embedded in Quetol-812. Then sections were examined by transmission electron microscopy (TEM-2000EX, JEOL, JP). The third group was prepared for RT-PCR analysis as follows: dental pulp cells in gel were digested with collagenase and total RNA was extracted from the cultures of cells using Trizol reagent (GIBCOeBRL, Bethesda, MD) and quantified by spectrometry at 260 and 280 nm. Expression of dentine sialophosphoprotein (DSPP) and dentine matrix protein-1 (DMP-1) mRNA was investigated with RT-PCR. The cDNA primer was
X. Nie et al. / Cell Biology International 30 (2006) 295e300
297
designed with Genebank, (sense: GCTAGCTGGTGGCTTCTCCA, antisense: CAGCAATTGGCTGCCACCTG for DMP-1; sense: GGTGTCCTGGTGCAT GAAGGT, antisense: CCTCGTCTTCATCCTCATCTG for DSPP). PCR products were separated by electrophoresis in a 1.5% agarose gel and stained with ethidium bromide.
3. Results 3.1. Characteristics of TGF-b1 in dental pulp cells We investigated the effects of TGF-b1 on the proliferation and ALPase activity of dental pulp cells. TGF-b1 stimulated the proliferation of these dental pulp cells (0.31 0.067 vs 0.234 0.042 for 3 days; 0.44 0.079 vs 0.35 0.083 for 6 days, respectively). ALPase are generally regarded as a differentiation marker in dental pulp cells. Odontoblasts show much higher ALPase activity than dental pulp cells. In this study, compared with the control group, the test group (cells treated with TGF-b1) showed more ALPase activity (0.36 0.045 vs 0.25 0.038 for 3 days; 0.41 0.056 vs 0.29 0.095 for 6 days, respectively). There was significant difference between the 2 groups by statistical analysis ( p < 0.05). The formation of mineralized nodules reveals the secretion of dentine-like matrix and calcification of pulp tissues (Ruch et al., 1995; Shirakawa et al., 1994). When treated with TGF-b1, dentine pulp cells proliferated on day 3, and reached confluence and synthesized extracellular matrix on day 7. The cells became multilayered around day 14. Heavily multilayered nodules were formed around day 30 (Fig. 1A). Dark areas progressively appeared in the nodules, while nodules were not observed in the dental pulp cells without TGF-b1 (Fig. 1B). These findings suggest that dental pulp cells cultured in medium with TGF-b1 share some characteristics of odontoblasts. 3.2. Changes in dental pulp cells in tissue culture Pulp tissues cultured in the presence or absence of TGF-b1 exhibited similar gross morphology and pulp pieces and dentine powder began to aggregate together. After 21 days, some pulp fibroblast cells differentiated into odontoblast-like cells in vitro. Toluidine blue analysis revealed localized deposition of mineralized ECM that was detected at the site of dental pulp cells. The deposited matrix in such areas appeared histological distinct from the existing dentine powder and BMG was stained with more intensity than the ECM (Fig. 2A). The mixture consisted of mineralized matrix and dental pulp cells from dentine pulp like composite adjacent to the dentine powder. Further evidence with modified Mallory’s staining proved that this matrix has similar staining characteristics to the dentine matrix, and in which dentine matrix appears blue-green and pulp cells bright red (Fig. 2B). Immunohistochemical analysis demonstrated that the DSPP and DMP-1 synthesized in these cells (Fig. 2C and D). This experiment shows that the pulp pieces in tissue culture were able to develop into more progressive stages. TGF-b1 probably contributes cells to secrete dentine matrix by up-regulating DSPP and DMP-1 expression. There were no obvious changes in tissue cultures without TGF-b1. These experiments showed that cells of the pulpedentinal complex treated with
Fig. 1. Dentine pulp cells were treated with TGF-b1. Following culture for 30 days, Von Kossa’s staining indicated that these cells aggregated continuously and then formed mineralized nodules. Dark areas progressively appeared in the nodules (A). There were no significant changes in the dentine pulp cells without TGF-b1 (B).
TGF-b1 were capable of synthesizing proteins such as DSPP and DMP-1, have previously been shown to be preferentially expressed by odontoblasts, and subsequently sequestered into the dentine matrix. 3.3. Differentiation of dental pulp cells in three-dimensional culture Using a novel three-dimensional culture system, growing conditions of pulp cells in gel were similar to that of pulp cells in vivo. The implanted dental pulp cells could survive and proliferate on collagen lattice. Dental pulp cells treated with TGFb1 show some characteristics of odontoblasts, such as typical parallel arrangement with columnar morphology and unilateral cell process surrounding dentine powder, compared to the dental pulp cells which grow dispersed in the control group (Fig. 3 A). The morphological changes of cells were obvious, when cells were transferred into Petri dishes, the processes became longer and asymmetrical (Fig. 3 B). RT-PCR results showed expression of DSPP and DMP-1 mRNA in the dental pulp cells. The DSPP and DMP-1 began to express in dental pulp cells when treated with TGF-b1, while there was no signal in the normal dental pulp cells (Fig. 3C). Although the
298
X. Nie et al. / Cell Biology International 30 (2006) 295e300
Fig. 2. In the tissue culture, the deposited matrix exhibited a weak violet staining, which was distinct from the dentine powder and BMG with toluidine blue (A). Modified Mallory’s staining further proved that the matrix element adjacent to pulp tissue was in fact dentine matrix, which stained blue-green as described previously (B). Immunohistochemical analysis demonstrated the expression of DSPP and DMP-1 in these cells treated with TGF-b1 (C and D).
significant distinction between odontoblast and dental pulp cells remains uncertain in ultrastructure, the TEM analyses demonstrates that the dental pulp cells treated with TGF-b1 show some changes, such as increasing rough endoplasmic reticulum and secretory vesicles, which are associated with the change of function. These changes demonstrate that the secretory function of the cells increased, which is consistent with the results of RT-PCR. 4. Discussion The repair activity of the pulp depends on several factors, including age, the extent of physical irritation, and expression of relative growth factor in the tooth. Furthermore, characteristic of the molecular and cellular events important in dental tissue injury and repair is critical to our understanding of these processes. Previous experiments with pulp injury models have demonstrated that TGF-b1 is capable of stimulating matrix secretion and producing collagen to initiate reparative dentine deposition (Hu et al., 1998; Tziafas et al., 2001). However, most studies on the effect of TGF-b1 on dental pulp have focused on the processes helping the soft and hard tissue to repair after pulp injury, enhancing reparative dentine formation in vivo, without detailed observations of the biological characteristics of dental pulp itself. The molecular basis of the initiation of reparative dentineogenesis and differentiation into odontoblastlike cells is unknown. In this study, we provide a different model for approaching the study of the molecular requirements
of the induction of odontoblast and deposition of reparative dentine. Otherwise we also provide a useful tool, which has some distinct advantages compared with previous methods, to study the effect of growth factors on human dental pulp cells in culture for the first time. TGF-b1 was shown to stimulate alkaline phosphatase activity and proliferation in cultures of dental pulp cells (Sloan et al., 1999). Our results were in agreement with those obtained in vitro in mammalian pulp cells and rat pulp organ cultures (Melin et al., 2000; Shiba et al., 2003; Kikuchi et al., 2004). Such activities might be important during reparative processes in the dentine pulp complex after tissue injury. In addition, TGF-b1 may also regulate the production of extracellular matrix, which might be involved in the modulation of matrix for dentineogenesis (Smith et al., 1995, 1998; Shiba et al., 1998). We found that the mineralized activity in the dental pulp cells treated with TGF-b1 was similar to the odontoblast (Smith et al., 1994). The formation process of mineralized nodules was very similar to reactionary dentineogenesis in vivo. On the contrary, evidence suggested that dental pulp cells themselves failed to assemble and produce cell nodules when they were nearly confluent. On this evidence, it is likely that dental pulp cells develop similar characteristics to odontoblasts. Such findings may be important in the response of these cells to tissue injury (Shirakawa et al., 1994; Sloan et al., 1999). Moreover, TGFb1 induces alkaline phosphatase activity and ECM production in the dental pulp cells, the marked stimulatory effect of TGFb1 on dental pulp cells revealed that dental pulp cells in the
X. Nie et al. / Cell Biology International 30 (2006) 295e300
299
Fig. 3. Dentine pulp cells were seeded and maintained in three-dimensional patterns. A shows that dentine pulp cells treated with TGF-b1 have some characteristics of odontoblasts, such as typical parallel arrangement with columnar morphology and unilateral cell process surrounding dentine powder. The morphological changes were obvious when these cells were transferred into Petri dishes, the processes becoming longer and asymmetrical (B). Expression of DSPP and DMP-l in these cells treated with TGF-b1 was detected with RT-PCR analysis. Lane 1e5: DNA Marker; DSPP in dentine pulp cells with TGF-b1; DSPP in dentine pulp cells without TGF-b1; Dmp-1 in dentine pulp cells with TGF-b1; DMP-1 in dentine pulp cells without TGF-b1 (C). The TEM analysis of dentine pulp cells treated with TGF-b1 demonstrated the change in ultrastructure such as increasing rough endoplasmic reticulum and secretory vesicle, which are associated with the secretory function of the cells (D).
culture are responsive to TGF-b1, and differentiate into the odontoblast. The morphology and differentiation of dental pulp cells were observed in the tissue culture and three-dimensional culture. These patterns were considered as a best model to mimic the microsphere in vitro, such conditions were suitable for the differentiation of dentine pulp cells into odontoblast-like cells and the formation of mineralized matrix in vitro. Dentineogenesis ability had only been characterized at a morphological level by observing cytological and functional changes in dental pulp cells, i.e., elongation, nuclear polarization and dentine-like matrix deposit (Nakashima et al., 1998). Histological studies strongly tend to support the evidence that TGF-b1 induces dental pulp cells to odontoblasts throughout the culture period. The cell morphology demonstrated by TEM was consistent with this, as discussed previously. Therefore, our findings can be correlated with the earlier work on the temporo-spatial presentation of TGF-b1 to dentine during pulp development and repair. Moreover, expression of DMP-1 and DSPP is also important characteristic of odontoblasts (Bleicher et al., 2001; Feng et al., 2003). Thus, upregulation of DSPP and DMP-1
in dental pulp cells by the effect of TGF-b1 might also reflect the changes in their function or differentiation of these cells. Notably, after 21 days in tissue culture, the significant expression of dentine special proteins demonstrated that the dental pulp cells in culture have similar function to odontoblasts. Finally, the upregulation of DSPP and DMP-1 expression in three-dimensional cultures treated with TGF-b1 suggests the reason that its application to dental pulp cells might promote increased extracellular matrix synthesis and mineralization in the pulp, The TGF-b1 can attach pulp and express the phenotype of odontoblast-like cells, and further trigger the cytodifferentiational event. Recent single experimental protocols cannot fully explore the mechanism of TGF-b1 on dentine pulp cells. Our method offers several advantages compared with traditional cell culture methods. In conclusion, we offer new evidence that TGF-b1 can stimulate the proliferation and alkaline phosphatase activity of dental human pulp cells. These observations suggest that TGF-b1 is involved in the regulation of dentine special proteins and extracellular matrix production in human dental pulp. Furthermore, TGF-b1 may play a role in the differentiation of dental pulp cells into
300
X. Nie et al. / Cell Biology International 30 (2006) 295e300
odontoblasts, and eventually, participate in the repair process. These results further support the important role of TGF-b1 in tissue development and repair events. Acknowledgments We thank Dr. A.J. Smith (Oral Biology, School of Dentistry, University of Birmingham, Birmingham, UK) for his continued guidance. References Begue KC, Smith AJ, Ruch W, Wozney TM, Purchio A, Hartman D, et al. Effect of dentine proteins, transforming growth factor b1 (TGF-b1) and bone morphogenic protein 2 (BMP-2) on the differentiation of odontoblasts in-vitro. Int J Dev Biol 1992;36:491e503. Bleicher F, Couble ML, Buchaille R, Farges JC, Magloire H. New genes involved in odontoblast differentiation. Adv Dent Res 2001;15:30e3. Feng JQ, Huang H, Lu Y, Ye L, Xie Y, Tsutsui TW, et al. The Dentine matrix protein 1 (Dmp1) is specifically expressed in mineralized, but not soft, tissues during development. J Dent Res 2003;82:776e80. Goldberg M, Smith AJ. Cell and extracellular matrices of dentine and pulp: a biological basis for repair and tissue engineering. Crit Rev Oral Biol Med 2004;15:13e27. Hu CC, Zhang C, Qian Q, Tatum NB. Reparative dentine formation in rat molars after direct pulp capping with growth factors. J Endod 1998;24:744e51. Kikuchi H, Suzuki K, Sakai N, Yamada S. Odontoblasts induced from mesenchymal cells of murine dental papillae in three-dimensional cell culture. Cell Tissue Res 2004;317:173e85. Magloire H, Romeas A, Melin M, Couble ML, Bleicher F, Farges JC. Molecular regulation of odontoblast activity under dentine injury. Adv Dent Res 2001;15:46e50. Magne D, Bluteau G, Cazaux S, Weiss P, Pilet P, Ritchie H, et al. Development of an odontoblast in vitro model to study dentine mineralization. Connect Tissue Res 2004;45:101e8. Melin M, Joffre-Romeas A, Farges JC, Couble ML, Magloire H, Bleicher F. Effects of TGFbeta1 on dental pulp cells in cultured human tooth slices. J Dent Res 2000;79:1689e96.
Nakashima M, Toyono T, Murakami T, Akamine A. Transforming growth factor-beta superfamily members expressed in rat incisor pulp. Arch Oral Biol 1998;43:745e51. Nishikawa H, Ueno A, Nishikawa S, Kido J, Ohishi M, Inoue H, et al. Sulfated glycosaminoglycan synthesis and its regulation by transforming growth factor-beta in rat clonal dental pulp cells. J Endod 2000;26:169e71. Ruch JV, Lesot H, Begue CK. Odontoblast differentiation. Int J Dev Biol 1995;39:51e68. Rutherford RB, Wahle J, Tucker M, Rueger D, Charette M. Induction of reparative dentine formation in monkeys by recombinant human osteogenic protein-1. Arch oral Biol 1993;38:571e6. Shiba H, Fujita T, Doi N, Nakamura S, Nakanishi K, Takemoto T, et al. Differential effects of various growth factors and cytokines on the syntheses of DNA, type I collagen, laminin, fibronectin, osteonectin/secreted protein, acidic and rich in cysteine (SPARC), and alkaline phosphatase by human pulp cells in culture. J Cell Physiol 1998;174:194e205. Shiba H, Mouri Y, Komatsuzawa H, Mizuno N, Xu W, Noguchi T, et al. Related articles, links enhancement of alkaline phosphatase synthesis in pulp cells co-cultured with epithelial cells derived from lower rabbit incisors. Cell Biol Int 2003;27:815e23. Shirakawa M, Shiba H, Nakanishi K, Ogawa T, Okamoto H, Nakashima K, et al. Transforming growth factorbeta-I reduces alkaline phosphatase mRNA and activity and stimulates cell proliferation in cultures of human pulp cells. J Dent Res 1994;73:1509e14. Sloan AJ, Smith AJ. Stimulation of the dentine-pulp complex of rat incisor teeth by transforming growth factor-beta isoforms 1 3 in vitro. Arch Oral Biol 1999;44:149e56. Sloan AJ, Matthews JB, Smith AJ. TGF-beta receptor expression in human odontoblasts and pulpal cells. Histochem J 1999;31:565e9. Smith AJ, Cassidy N, Perry H, Begue-Kirn C, Ruch JV, Lesot H. Reactionary dentineogenesis. Int J Dev Biol 1995;39:273e80. Smith AJ, Matthews JB, Hall RC. Transforming growth factor-beta 1 (TGFbeta 1) in dentine matrix. Ligand activation and receptor expression. Eur J Oral Sci 1998;106:179e84. Tucker AS, Sharpe PT. Molecular genetics of tooth morphogenesis and patterning: the right shape in the right place. J Dent Res 1999;78: 826e34. Tziafas D, Belibasakis G, Veis A, Papadimitriou S. Dentine regeneration in vital pulp therapy: design principles. Adv Dent Res 2001;15:96e100. Tziafas D, Papadimitriou S. Role of exogenous TGF-beta in induction of reparative dentineogenesis in vivo. Eur J Oral Sci 1998;106:192e6.
Induction of transforming growth factor-beta 1 on dentine pulp cells in different culture patterns Xin Nie a,b, Weidong Tian a, Yongjie Zhang b,c, Xizhe Chen a, Rui Dong b,c, Ming Jiang b,c, Famin Chen b,c, Yan Jin b,c,* a
Department of Oral and Maxillofacial Surgery, West China Stomatology College, Sichuan University, Chengdu 610041, China b Department of Oral Pathology, Stomatology College, Fourth Military Medical University, Xi’an 710032, China c Center for tissue engineering, Fourth Military Medical University, Xi’an 710032, China Received 13 September 2005; revised 17 November 2005; accepted 10 December 2005
Abstract Recent studies have documented that TGF-b1 takes part in dental pulp tissue repair. Moreover, dental pulp cells have the potential to differentiate into odontoblast-like cells and produce reparative dentine in this process. However, the molecular mechanisms and potential interactions between TGF-b1 and dental pulp cells are not clear due to the complexity of the pulp/dentine microenvironment. In this study, we investigated the induction of TGF-b1 on the dental pulp cells in cell culture, tissue culture and three-dimensional culture patterns. These results demonstrated that TGF-b1 significantly increased the proliferation of cells and activity of ALPase. Dental pulp cells cultured in the presence of TGF-b1 formed mineralization nodules. In the organ culture, dental pulp cells treated with TGF-b1 differentiated into odontoblast-like cells and formed a pulp-dentinal complex; and TGF-b1 significantly induced synthesis of dentine relative proteins DSPP, DMP-1. The dental pulp cells share some characteristics of the odontoblast, such as a parallel arrangement with columnar form and a unilateral cell process. Together, these data indicate that TGF-b1 can make dental pulp cells differentiated into odontoblast-like cells and form the pulp-dentinal complex. Moreover, these results suggest that TGF-b1 is an important regulatory factor in odontoblast differentiation during tooth development and pulp repair. Ó 2005 International Federation for Cell Biology. Published by Elsevier Ltd. All rights reserved. Keywords: Dentine pulp cells; Odontoblast; Transforming growth factor; Tissue culture; Three-dimensional culture
1. Introduction Reparative dentine is formed locally in response to noxious stimuli such as caries, attrition, abrasion and operative procedures. After destruction of the odontoblast layer, dentine pulp cells migrate to the region of necrosis from the deeper region of the pulp and differentiate into odontoblasts. Following Abbreviations: DMEM, Dulbecco’s modified Eagle’s medium; FCS, fetal calf serum; ALPase, alkaline phosphatase; ECM, extracellular matrix; BMG, bone matrix gelatin; RTePCR, reverse transcriptionepolymerase chain reaction; TEM, transmission electron microscopy; DSPP, dentine sialophosphoprotein; DMP, dentine matrix protein. * Corresponding author. Department of Oral Pathology, Stomatology College, Fourth Military Medical University, Xi’an, Shannxi 710032, China. Tel.: þ81 029 84776174; fax: þ81 029 83218039. E-mail address: [email protected] (Y. Jin).
differentiation, the post-mitotic odontoblasts synthesize and secrete a kind of extracellular matrix, which mineralizes and confers the unique structure to dentine. Characterisation of the molecular and cellular events important in dental tissue injury and repair is critical to our understanding of these processes (Ruch et al., 1995). However, the molecular basis of odontoblast differentiation is not clear, but signaling molecules, especially the members of the transforming growth factor-beta (TGF-b) superfamily, which have important roles in regulating cell growth, differentiation and function, such as TGF-b and BMPs, have been implicated in controlling aspects of tooth development and tissue repair (Begue et al., 1992; Tucker and Sharpe, 1999; Sloan and Smith, 1999). This suggestion was supported by the transcript change of TGF-b and BMPs during embryonic tooth development and reparative dentineogenesis and the direct application of recombinant BMP-2, BMP-4 and
1065-6995/$ - see front matter Ó 2005 International Federation for Cell Biology. Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.cellbi.2005.12.001
296
X. Nie et al. / Cell Biology International 30 (2006) 295e300
BMP-7 (OP-1) on amputated pulp, which induced large amounts of reparative dentine (Sloan and Smith, 1999; Rutherford et al., 1993). The superfamily of TGF-b is a large group of growth factors and TGF-b1 has been suggested as a major candidate for regulating the pulpedentinal response to injury (Tziafas et al., 2001; Magloire et al., 2001). It has been shown that TGF-b1 is expressed throughout tooth development. Odontoblasts and dental pulp cells show the presence of TGF-b receptors I and II, where they could modulate the behavior of odontoblasts and dental pulp cells (Sloan et al., 1999). Activation of TGFb1 expression in sub-odontoblast cells after injury has been suggested to be associated with a differentiation pathway leading to odontoblast-like cells. Such activities might contribute to the maintenance of the odontoblast phenotype during reparative processes (Sloan et al., 1999). It initiates odontoblast differentiation and a local increase in predentine secretion. TGF-b1 is also used as a pulp-capping medicament to enhance the formation of reparative dentine in rat molars. However, the regulatory mechanisms of TGF-b1 on dental pulp cells as a response to external stimuli is not well understood. Previous experimental results revealed that TGF-b1 initiated the process of pulp repair through its ability to induce dentinal extracellular matrix (ECM). TGFb1 upregulates the secretion of extracellular matrix by odontoblasts, which are mitogenic to dental pulp cells in vitro and in vivo (Nishikawa et al., 2000; Magne et al., 2004). Isolated dentine extracellular matrix initiates odontoblast differentiation from dental papillae mesenchymal cells (Kikuchi et al., 2004). These inductive activities are associated with the formation of dentinal bridges or large areas of mineralization during pulp repair in vivo (Goldberg and Smith, 2004). Moreover, TGF-b1 can influence the behavior of dental pulp cells. Specifically, TGF-b1 has been shown to stimulate the three main events of human dental pulp repair (an odontoblastic functional feature); cell proliferation, cell migration, and type I collagen synthesis (Shiba et al., 1998). Recent results have shown that TGF-b1 has an effect on the differentiation of pulp cells into odontoblasts during tooth development and injury, but these are mainly based on indirect methods such as gene expression studies in vivo (Tziafas and Papadimitriou, 1998). However, simple gene expression changes do not accurately or comprehensively reflect events that occur in vivo. Direct evidence on the role of growth factors important in these repair processes has been limited due to the nature and location of the odontoblast cells. Therefore, to overcome the problems in single culture, we have sought different culture patterns in vitro to simulate a pulp microenvironment suitable for the maintenance of normal cell/cell and cell/dentine relationships, and on the basis of which, we investigated whether TGF-b1 could induce the expression of an odontoblast-like phenotype and the formation of dentine-like structures in dental pulp cells. 2. Materials and methods 2.1. Preparation of dental pulp cell cultures Healthy third molar teeth were collected immediately from the clinics at university with the patients’ informed consent. The pulp tissues were carefully
taken from dental crown and cut into several pieces. These tissue fragments were incubated at 37 C for 30 min in a solution containing 0.05% collagenase and 0.125% trypsin. The medium was replaced with fresh enzyme medium. The procedure was repeated 4 times. The first medium was decanted to prevent the contamination of odontoblast. Dental pulp cells were cultured with Dulbecco’s minimum essential medium (DMEM) supplemented with 2 mM glutamine, 100 IU/ml penicillin, 100 mg/ml streptomycin and 10% fetal calf serum (FCS). The medium was at 3-day intervals.
2.2. Effects of TGF-b1 on dental pulp cells To ensure the viability of the cells in these cultures and to study the effects of TGF-b1, we incubated the 5th passage cells in the medium with or without 5 ng/ml TGF-b1 (Sigma, St Louis, MO, USA), then these cells were inoculated in the 96-well plates (Costar, Cambridge, MA, USA). During culture 3 and 6 days, the proliferation of cells was measured with MTT and alkaline phosphatase (ALPase) activity was measured using p-nitrophenyl phosphate as a substrate. All results are shown as mean SEM (n ¼ 6). The statistical significance of the differences between two groups was determined with a two-tailed Student’s t-test. Any difference was considered significant when p < 0.05. Von Kossa’s staining of these cells was performed to quantify the mineralized nodules when dental pulp cells were continuous culture 30 days.
2.3. Induction of TGF-b1 in tissue culture Allogeneic demineralized bone matrix gelatin (BMG) was widely used as a substitute of the bone graft in orthopedics and dentistry. In this study, it has been used as tissue-culture carriers in the form of arcuate segments. For pulp tissue cultures, the method of culture designed according to Towel-type cultures, brief described as below: human pulp tissues from third molar teeth were minced into 1 mm3 pieces with fine blade. These pieces were mixed with dentine powder (gift from Prof Smith AJ) and 5 mg/ml TGF-b1, the operation of control group was similar except for TGF-b1. The mixture transferred to a sterile BMG supported with a stainless steel filter and suspended on the surface of culture medium for 3, 7, 14, and 21 days on BMG. In different time, these pulp tissues were fixed with 10% formaldehyde, demineralized and embedded in paraffin, and cut into 5-mm sections. The characteristics of mixture were studied through histology analysis including hematoxylin and eosin, toluidine blue and Mallory staining. Immunohistochemical staining had been performed to investigate the expression of DSPP and DMP-1 (monoclonal antibodies to DSPP and DMP-1 at 1:200 dilutions, gifts from Prof Yin Zhang) in the pulp cells.
2.4. Induction of TGF-b1 in three-dimensional culture Collagen I (Sigma) was used to construct the system of pulp cell in three-dimensional culture; dentine powder was added in the gel to imitate human dentine. The dental pulp cells were mixed together with 8 mg/ml collagen, FCS and dentine powder. The mixture was incubated with DMEM medium with or without 5 ng/ml TGF-b1 at room temperature. In the three-dimensional culture, collagen assembled spontaneously into fibrillar gel to form artificial pulp, in which human dental pulp cells were interspersed. After culture 2 weeks, all specimens were divided into 3 groups for evaluation, which include HE staining, transmission electron microscopy (TEM) analysis, and reverse transcription-polymerase chain reaction (RT-PCR) analysis, respectively. One group for histological analysis was fixed with 10% formaldehyde, demineralized and embedded in paraffin, and cut into 5-mm sections. These sections were stained with hematoxylin and eosin. The second group was fixed with 1% OsO4, dehydrated in an ethanol series, and embedded in Quetol-812. Then sections were examined by transmission electron microscopy (TEM-2000EX, JEOL, JP). The third group was prepared for RT-PCR analysis as follows: dental pulp cells in gel were digested with collagenase and total RNA was extracted from the cultures of cells using Trizol reagent (GIBCOeBRL, Bethesda, MD) and quantified by spectrometry at 260 and 280 nm. Expression of dentine sialophosphoprotein (DSPP) and dentine matrix protein-1 (DMP-1) mRNA was investigated with RT-PCR. The cDNA primer was
X. Nie et al. / Cell Biology International 30 (2006) 295e300
297
designed with Genebank, (sense: GCTAGCTGGTGGCTTCTCCA, antisense: CAGCAATTGGCTGCCACCTG for DMP-1; sense: GGTGTCCTGGTGCAT GAAGGT, antisense: CCTCGTCTTCATCCTCATCTG for DSPP). PCR products were separated by electrophoresis in a 1.5% agarose gel and stained with ethidium bromide.
3. Results 3.1. Characteristics of TGF-b1 in dental pulp cells We investigated the effects of TGF-b1 on the proliferation and ALPase activity of dental pulp cells. TGF-b1 stimulated the proliferation of these dental pulp cells (0.31 0.067 vs 0.234 0.042 for 3 days; 0.44 0.079 vs 0.35 0.083 for 6 days, respectively). ALPase are generally regarded as a differentiation marker in dental pulp cells. Odontoblasts show much higher ALPase activity than dental pulp cells. In this study, compared with the control group, the test group (cells treated with TGF-b1) showed more ALPase activity (0.36 0.045 vs 0.25 0.038 for 3 days; 0.41 0.056 vs 0.29 0.095 for 6 days, respectively). There was significant difference between the 2 groups by statistical analysis ( p < 0.05). The formation of mineralized nodules reveals the secretion of dentine-like matrix and calcification of pulp tissues (Ruch et al., 1995; Shirakawa et al., 1994). When treated with TGF-b1, dentine pulp cells proliferated on day 3, and reached confluence and synthesized extracellular matrix on day 7. The cells became multilayered around day 14. Heavily multilayered nodules were formed around day 30 (Fig. 1A). Dark areas progressively appeared in the nodules, while nodules were not observed in the dental pulp cells without TGF-b1 (Fig. 1B). These findings suggest that dental pulp cells cultured in medium with TGF-b1 share some characteristics of odontoblasts. 3.2. Changes in dental pulp cells in tissue culture Pulp tissues cultured in the presence or absence of TGF-b1 exhibited similar gross morphology and pulp pieces and dentine powder began to aggregate together. After 21 days, some pulp fibroblast cells differentiated into odontoblast-like cells in vitro. Toluidine blue analysis revealed localized deposition of mineralized ECM that was detected at the site of dental pulp cells. The deposited matrix in such areas appeared histological distinct from the existing dentine powder and BMG was stained with more intensity than the ECM (Fig. 2A). The mixture consisted of mineralized matrix and dental pulp cells from dentine pulp like composite adjacent to the dentine powder. Further evidence with modified Mallory’s staining proved that this matrix has similar staining characteristics to the dentine matrix, and in which dentine matrix appears blue-green and pulp cells bright red (Fig. 2B). Immunohistochemical analysis demonstrated that the DSPP and DMP-1 synthesized in these cells (Fig. 2C and D). This experiment shows that the pulp pieces in tissue culture were able to develop into more progressive stages. TGF-b1 probably contributes cells to secrete dentine matrix by up-regulating DSPP and DMP-1 expression. There were no obvious changes in tissue cultures without TGF-b1. These experiments showed that cells of the pulpedentinal complex treated with
Fig. 1. Dentine pulp cells were treated with TGF-b1. Following culture for 30 days, Von Kossa’s staining indicated that these cells aggregated continuously and then formed mineralized nodules. Dark areas progressively appeared in the nodules (A). There were no significant changes in the dentine pulp cells without TGF-b1 (B).
TGF-b1 were capable of synthesizing proteins such as DSPP and DMP-1, have previously been shown to be preferentially expressed by odontoblasts, and subsequently sequestered into the dentine matrix. 3.3. Differentiation of dental pulp cells in three-dimensional culture Using a novel three-dimensional culture system, growing conditions of pulp cells in gel were similar to that of pulp cells in vivo. The implanted dental pulp cells could survive and proliferate on collagen lattice. Dental pulp cells treated with TGFb1 show some characteristics of odontoblasts, such as typical parallel arrangement with columnar morphology and unilateral cell process surrounding dentine powder, compared to the dental pulp cells which grow dispersed in the control group (Fig. 3 A). The morphological changes of cells were obvious, when cells were transferred into Petri dishes, the processes became longer and asymmetrical (Fig. 3 B). RT-PCR results showed expression of DSPP and DMP-1 mRNA in the dental pulp cells. The DSPP and DMP-1 began to express in dental pulp cells when treated with TGF-b1, while there was no signal in the normal dental pulp cells (Fig. 3C). Although the
298
X. Nie et al. / Cell Biology International 30 (2006) 295e300
Fig. 2. In the tissue culture, the deposited matrix exhibited a weak violet staining, which was distinct from the dentine powder and BMG with toluidine blue (A). Modified Mallory’s staining further proved that the matrix element adjacent to pulp tissue was in fact dentine matrix, which stained blue-green as described previously (B). Immunohistochemical analysis demonstrated the expression of DSPP and DMP-1 in these cells treated with TGF-b1 (C and D).
significant distinction between odontoblast and dental pulp cells remains uncertain in ultrastructure, the TEM analyses demonstrates that the dental pulp cells treated with TGF-b1 show some changes, such as increasing rough endoplasmic reticulum and secretory vesicles, which are associated with the change of function. These changes demonstrate that the secretory function of the cells increased, which is consistent with the results of RT-PCR. 4. Discussion The repair activity of the pulp depends on several factors, including age, the extent of physical irritation, and expression of relative growth factor in the tooth. Furthermore, characteristic of the molecular and cellular events important in dental tissue injury and repair is critical to our understanding of these processes. Previous experiments with pulp injury models have demonstrated that TGF-b1 is capable of stimulating matrix secretion and producing collagen to initiate reparative dentine deposition (Hu et al., 1998; Tziafas et al., 2001). However, most studies on the effect of TGF-b1 on dental pulp have focused on the processes helping the soft and hard tissue to repair after pulp injury, enhancing reparative dentine formation in vivo, without detailed observations of the biological characteristics of dental pulp itself. The molecular basis of the initiation of reparative dentineogenesis and differentiation into odontoblastlike cells is unknown. In this study, we provide a different model for approaching the study of the molecular requirements
of the induction of odontoblast and deposition of reparative dentine. Otherwise we also provide a useful tool, which has some distinct advantages compared with previous methods, to study the effect of growth factors on human dental pulp cells in culture for the first time. TGF-b1 was shown to stimulate alkaline phosphatase activity and proliferation in cultures of dental pulp cells (Sloan et al., 1999). Our results were in agreement with those obtained in vitro in mammalian pulp cells and rat pulp organ cultures (Melin et al., 2000; Shiba et al., 2003; Kikuchi et al., 2004). Such activities might be important during reparative processes in the dentine pulp complex after tissue injury. In addition, TGF-b1 may also regulate the production of extracellular matrix, which might be involved in the modulation of matrix for dentineogenesis (Smith et al., 1995, 1998; Shiba et al., 1998). We found that the mineralized activity in the dental pulp cells treated with TGF-b1 was similar to the odontoblast (Smith et al., 1994). The formation process of mineralized nodules was very similar to reactionary dentineogenesis in vivo. On the contrary, evidence suggested that dental pulp cells themselves failed to assemble and produce cell nodules when they were nearly confluent. On this evidence, it is likely that dental pulp cells develop similar characteristics to odontoblasts. Such findings may be important in the response of these cells to tissue injury (Shirakawa et al., 1994; Sloan et al., 1999). Moreover, TGFb1 induces alkaline phosphatase activity and ECM production in the dental pulp cells, the marked stimulatory effect of TGFb1 on dental pulp cells revealed that dental pulp cells in the
X. Nie et al. / Cell Biology International 30 (2006) 295e300
299
Fig. 3. Dentine pulp cells were seeded and maintained in three-dimensional patterns. A shows that dentine pulp cells treated with TGF-b1 have some characteristics of odontoblasts, such as typical parallel arrangement with columnar morphology and unilateral cell process surrounding dentine powder. The morphological changes were obvious when these cells were transferred into Petri dishes, the processes becoming longer and asymmetrical (B). Expression of DSPP and DMP-l in these cells treated with TGF-b1 was detected with RT-PCR analysis. Lane 1e5: DNA Marker; DSPP in dentine pulp cells with TGF-b1; DSPP in dentine pulp cells without TGF-b1; Dmp-1 in dentine pulp cells with TGF-b1; DMP-1 in dentine pulp cells without TGF-b1 (C). The TEM analysis of dentine pulp cells treated with TGF-b1 demonstrated the change in ultrastructure such as increasing rough endoplasmic reticulum and secretory vesicle, which are associated with the secretory function of the cells (D).
culture are responsive to TGF-b1, and differentiate into the odontoblast. The morphology and differentiation of dental pulp cells were observed in the tissue culture and three-dimensional culture. These patterns were considered as a best model to mimic the microsphere in vitro, such conditions were suitable for the differentiation of dentine pulp cells into odontoblast-like cells and the formation of mineralized matrix in vitro. Dentineogenesis ability had only been characterized at a morphological level by observing cytological and functional changes in dental pulp cells, i.e., elongation, nuclear polarization and dentine-like matrix deposit (Nakashima et al., 1998). Histological studies strongly tend to support the evidence that TGF-b1 induces dental pulp cells to odontoblasts throughout the culture period. The cell morphology demonstrated by TEM was consistent with this, as discussed previously. Therefore, our findings can be correlated with the earlier work on the temporo-spatial presentation of TGF-b1 to dentine during pulp development and repair. Moreover, expression of DMP-1 and DSPP is also important characteristic of odontoblasts (Bleicher et al., 2001; Feng et al., 2003). Thus, upregulation of DSPP and DMP-1
in dental pulp cells by the effect of TGF-b1 might also reflect the changes in their function or differentiation of these cells. Notably, after 21 days in tissue culture, the significant expression of dentine special proteins demonstrated that the dental pulp cells in culture have similar function to odontoblasts. Finally, the upregulation of DSPP and DMP-1 expression in three-dimensional cultures treated with TGF-b1 suggests the reason that its application to dental pulp cells might promote increased extracellular matrix synthesis and mineralization in the pulp, The TGF-b1 can attach pulp and express the phenotype of odontoblast-like cells, and further trigger the cytodifferentiational event. Recent single experimental protocols cannot fully explore the mechanism of TGF-b1 on dentine pulp cells. Our method offers several advantages compared with traditional cell culture methods. In conclusion, we offer new evidence that TGF-b1 can stimulate the proliferation and alkaline phosphatase activity of dental human pulp cells. These observations suggest that TGF-b1 is involved in the regulation of dentine special proteins and extracellular matrix production in human dental pulp. Furthermore, TGF-b1 may play a role in the differentiation of dental pulp cells into
300
X. Nie et al. / Cell Biology International 30 (2006) 295e300
odontoblasts, and eventually, participate in the repair process. These results further support the important role of TGF-b1 in tissue development and repair events. Acknowledgments We thank Dr. A.J. Smith (Oral Biology, School of Dentistry, University of Birmingham, Birmingham, UK) for his continued guidance. References Begue KC, Smith AJ, Ruch W, Wozney TM, Purchio A, Hartman D, et al. Effect of dentine proteins, transforming growth factor b1 (TGF-b1) and bone morphogenic protein 2 (BMP-2) on the differentiation of odontoblasts in-vitro. Int J Dev Biol 1992;36:491e503. Bleicher F, Couble ML, Buchaille R, Farges JC, Magloire H. New genes involved in odontoblast differentiation. Adv Dent Res 2001;15:30e3. Feng JQ, Huang H, Lu Y, Ye L, Xie Y, Tsutsui TW, et al. The Dentine matrix protein 1 (Dmp1) is specifically expressed in mineralized, but not soft, tissues during development. J Dent Res 2003;82:776e80. Goldberg M, Smith AJ. Cell and extracellular matrices of dentine and pulp: a biological basis for repair and tissue engineering. Crit Rev Oral Biol Med 2004;15:13e27. Hu CC, Zhang C, Qian Q, Tatum NB. Reparative dentine formation in rat molars after direct pulp capping with growth factors. J Endod 1998;24:744e51. Kikuchi H, Suzuki K, Sakai N, Yamada S. Odontoblasts induced from mesenchymal cells of murine dental papillae in three-dimensional cell culture. Cell Tissue Res 2004;317:173e85. Magloire H, Romeas A, Melin M, Couble ML, Bleicher F, Farges JC. Molecular regulation of odontoblast activity under dentine injury. Adv Dent Res 2001;15:46e50. Magne D, Bluteau G, Cazaux S, Weiss P, Pilet P, Ritchie H, et al. Development of an odontoblast in vitro model to study dentine mineralization. Connect Tissue Res 2004;45:101e8. Melin M, Joffre-Romeas A, Farges JC, Couble ML, Magloire H, Bleicher F. Effects of TGFbeta1 on dental pulp cells in cultured human tooth slices. J Dent Res 2000;79:1689e96.
Nakashima M, Toyono T, Murakami T, Akamine A. Transforming growth factor-beta superfamily members expressed in rat incisor pulp. Arch Oral Biol 1998;43:745e51. Nishikawa H, Ueno A, Nishikawa S, Kido J, Ohishi M, Inoue H, et al. Sulfated glycosaminoglycan synthesis and its regulation by transforming growth factor-beta in rat clonal dental pulp cells. J Endod 2000;26:169e71. Ruch JV, Lesot H, Begue CK. Odontoblast differentiation. Int J Dev Biol 1995;39:51e68. Rutherford RB, Wahle J, Tucker M, Rueger D, Charette M. Induction of reparative dentine formation in monkeys by recombinant human osteogenic protein-1. Arch oral Biol 1993;38:571e6. Shiba H, Fujita T, Doi N, Nakamura S, Nakanishi K, Takemoto T, et al. Differential effects of various growth factors and cytokines on the syntheses of DNA, type I collagen, laminin, fibronectin, osteonectin/secreted protein, acidic and rich in cysteine (SPARC), and alkaline phosphatase by human pulp cells in culture. J Cell Physiol 1998;174:194e205. Shiba H, Mouri Y, Komatsuzawa H, Mizuno N, Xu W, Noguchi T, et al. Related articles, links enhancement of alkaline phosphatase synthesis in pulp cells co-cultured with epithelial cells derived from lower rabbit incisors. Cell Biol Int 2003;27:815e23. Shirakawa M, Shiba H, Nakanishi K, Ogawa T, Okamoto H, Nakashima K, et al. Transforming growth factorbeta-I reduces alkaline phosphatase mRNA and activity and stimulates cell proliferation in cultures of human pulp cells. J Dent Res 1994;73:1509e14. Sloan AJ, Smith AJ. Stimulation of the dentine-pulp complex of rat incisor teeth by transforming growth factor-beta isoforms 1 3 in vitro. Arch Oral Biol 1999;44:149e56. Sloan AJ, Matthews JB, Smith AJ. TGF-beta receptor expression in human odontoblasts and pulpal cells. Histochem J 1999;31:565e9. Smith AJ, Cassidy N, Perry H, Begue-Kirn C, Ruch JV, Lesot H. Reactionary dentineogenesis. Int J Dev Biol 1995;39:273e80. Smith AJ, Matthews JB, Hall RC. Transforming growth factor-beta 1 (TGFbeta 1) in dentine matrix. Ligand activation and receptor expression. Eur J Oral Sci 1998;106:179e84. Tucker AS, Sharpe PT. Molecular genetics of tooth morphogenesis and patterning: the right shape in the right place. J Dent Res 1999;78: 826e34. Tziafas D, Belibasakis G, Veis A, Papadimitriou S. Dentine regeneration in vital pulp therapy: design principles. Adv Dent Res 2001;15:96e100. Tziafas D, Papadimitriou S. Role of exogenous TGF-beta in induction of reparative dentineogenesis in vivo. Eur J Oral Sci 1998;106:192e6.