Inefficient translation initiation causes premature transcription termination in the IacZ gene

Cell, Vol. 44, 711-718,

March 14, 1988, Copyright

0 1986 by Call Press

lneff icient Translation Initiation Causes Premature Transcription Termination in the IacZ Gene Patrick Stanssens: Erik Remaut, and Walter Fiers Laboratory of Molecular Biology State University of Ghent Ledeganckstraat 35 B-9000 Ghent, Belgium

Summary Expression plasmids containing the E. coli lacZ coding region preceded by a set of different ribosomebinding sites and put under transcriptional control of the leftward promoter of phage lambda (PL) were used to study the synthesis of lad! mRNA. In a normal host the steady state level of full-length lacZ mRNA varied 100~fold with the different synthesis levels of f3-galactosidase, whereas in a host expressing the antitermination protein N of phage lambda, all vectors synthesized the same amount of full-length lacZ mRNA, while maintaining the differences in S-galactosidase expression. We present evidence for a causal relationship between the rate of ribosome loading and the continuation of transcription across the lacZ gene. We suggest that extended spacing between the RNA polymerase and the elongating ribosome causes transcriptional polarity by increasing the extent of premature termination. The conditional character of the termination event can best be explained by invoking termination factor Rho. Introduction We earlier described the construction of an expression vector that contains the h PL promoter and a synthetic translational initiation region (Stanssens et al., 1985). We have used this vector system to study the effect of the region 5’ to the SD sequence on expression. To this end a series of structural variants of the 5’ untranslated leader region was used to drive the expression of both the IFN-8 gene (coding for mature human fibroblast interferon) and the /acZ gene (encoding 8-galactosidase). It was found that sequences upstream from the SD box can considerably affect the expression level of both genes. Furthermore, the effect of these alterations was shown to depend on the downstream coding information, that is, a 5’ untranslated region that efficiently expresses IFN-8 does not necessarily direct the synthesis of a high level of 8-galactosidase and vice versa. These observations made it unlikely that the differential expression level resulted from variations in the frequency of transcription initiation or from transcription termination at the changed region. We believe the most plausible explanation for the results is that the leader variations influenced the rate of translation initiation by alterihg the RNA secondary structure folding. * Present address: Plant Genetic Systems, J. Plateaustraat Ghent, Belgium.

22, B-9000

In this study, we examine the role of various factors, such as mRNA stability, in the observed differential expression level. The transcripts specified by the different expression plasmids were analyzed by Northern blot. The experiments reported here focus primarily on the PL-/acZ transcription unit. We found that minor variations in the leader region not only result in a differential rate of translation initiation, but also dramatically affect the steady state amount of full-length mRNA. A model is proposed in which the rate of ribosome loading correlates inversely with the extent of premature transcription termination within the /acZ gene. This model is in agreement with the well known polarity phenomenon (Adhya and Gottesman, 1978) and with the current hypothesis regarding the mechanism of action of factor Rho. Results Steady State /acZ mRNA Levels Vary in P-gal Expression Vectors with Different 5’ Leader Regions The structure of the various IacZ expression vectors and a schematic representation of the hybrid PL-/acZ transcription units are shown in Figure 1. Transcription of the IacZ gene depends on the phage h PL promoter. The host strains used in this study, K12AHlAtrp and M5219, both code for a thermolabile repressor of PL and therefore allow easy control of the activity of this promoter. Transcription from PL towards the /acZ gene is turned on by a simple shift of the incubation temperature from 28% to 42%. Downstream from the lacZ gene two copies of the central terminator of phage fd are present. The fd transcription terminator functions with high efficiency (Marmenout et al., 1984). The P-gal series of vectors also contains the 8-lactamase gene (b/a; Figure 1B) which, unlike the /acZ gene, is under the control of a constitutive promoter. In some of the RNA blotting experiments, we have used the amount of b/a mRNA as an internal control. The transcripts encoded by this gene have been studied in detail (von Gabain et al., 1983). To quantitate the amount of /acZ mRNA, K12AHlAtrp cells harboring one of several P-gal plasmids were grown at 28% to a density of 2 x 108/ml. Following an induction period of 15 min at 42%, total cellular RNA was prepared as described in Experimental Procedures. After denaturation with glyoxal, the RNA was electrophoresed on a 1% agarose gel. The fractionated RNA was then transferred to a nylon membrane and analyzed with two radiolabeled DNA probes, one corresponding to the /acZ carboxyl terminus and one specific for b/a transcripts (Figure 1B). The DNA probe was added in excess over the total amount of specific mRNA bound to the filter. This condition was verified by showing that hybridization signals remained linear in the presence of a 3-fold increase of mRNA obtained from the clone expressing the highest amount of f3-galactosidase. The result of the analysis is shown in Figure 2A. Upon induction, a major RNA transcript of about 3400 nucleotides was synthesized, as determined by compari-

Cell 712

20

4

~~~AUCAGCAGGACGCACUGAC~ACCAUGA~UG~GCUCUUAAAAUUAAGCCCUGAA

Figure 1. Schematic

Representation

of the B-gal Expression

Vectors and Detailed Structure

of the /acZ and 6-lactamase

Transcription

Units

(A) Schematic representation of the B-gal expression vectors. The position of the /acZ gene, the p-lactamase gene (ApR), the phage fd transcription terminators (fdT), the origin of replication (ori), and the fL promoter are shown by arrows that indicate the functional orientation. Translation initiation of the lacZ gene depends on one of several synthetic ribosome-binding sites. The prototype ribosomsbinding site contains a chemically synthesized SD element (5’-AAGGAGGT-3’) flanked by unique restriction sites. These have been used to vary the sequence upstream from the SD element (Stanssens et al., 1985). The clone number (n) refers to the various 5’ untranslated regions (dashed line) that have been fused to the /acZ coding region. (6) Detailed structure of the /acZ and 8-lactamase (BLA) transcription units. Transcription of the /acZ gene is controlled by the leftward promoter of phage A. (PL). Translation depends upon one of several 5’ untranslated regions (dashed line). The coding region (indicated by an interrupted open bar) is followed by two copies (fdT) of the central transcription terminator of phage fd. In these plasmids the natural promoter of the 6-lactamase gene was replaced by the promoter of the kanamycin phosphotransferase gene of Tn963 (Remaut et al., 1981, and unpublished sequence data). T,, Ts, and T3 denote transcription termination sites of the 6-lactamase transcript (von Gabain et al., 1983). The probes used in this study are as follows: (a) a 427 bp Xbal-Hpal fragment corresponding to the amino-terminal part of the /acZ coding region; (b) a 363 bp carboxy-terminal Pvull fragment of lacZ; and (c) a 235 bp Seal-Pstl fragment of the 6-lactamase gene. (C) Structure of the leader region of several pPLcATn p-gal vectors. The upper part shows the sequence of the complete 5’ leader region of the pPLcAT1 vector. The size and position of the deletions, carried by the various derivatives, are marked by double-headed arrows. The pPLcAT14 and pPLcAT22 vectors contain a 52 bp Alul fragment derived from a proximal part of the human interferon-8 coding region (see Stanssens et al., 1985). The arrow indicates the orientation of this insert.

son with single-stranded DNA size markers (McMaster and Carmichael, 1977). This transcript had a mobility expected for the full-length /acZ mRNA transcribed from the PL promoter. In addition to this 3400 nucleotide species, a series of lower molecular weight RNAs was induced. Since we used a IacZ carboxy-terminal probe, we conclude that these RNA molecules are degradation products, rather than nascent chains. Two other prominent bands, with an apparent length of between 1000 and 1200 nucleotides, could be assigned to the b/a gene. Indeed, these RNA molecules were present in the same amount in uninduced cells, consistent with the fact that the b/a gene is transcribed from a constitutive promoter, and their sizes agreed well with the data obtained by von Gabain et

al. (1983). All bands migrating more slowly than full-length /acZ mRNA were attributable to plasmid DNA as demonstrated by DNAase I digestion of the extract prior to electrophoresis (see Figure 8). We have chosen not to treat most samples with DNAase I, since a representative plasmid band could be used as an additional internal standard. Quantitation of the RNA products by densitometric scanning of the autoradiogram showed that all plasmids synthesized essentially the same amount of b/a mRNA, while the level of B-gal transcripts varied by as much as two orders of magnitude. A comparison of the amount of full-length /acZ mRNA present in cultures induced for 15 min or 120 min showed that the relative divergence in the amount of mRNA was maintained throughout the induc-

Coupling 713

Transcription

to Translation

pPLcAT- P gal 15 min-42°C A

-3400

- -

Figure 2. Northern Analysis of the Steady State Level of /acZ mRNA in Cells Synthesizing Length /acZ mRNA and o-gal Levels

Varying Amounts of @-gal and Correlation

between Full-

(A) RNA blot analysis of the steady state level of lacZ mRNA in cells synthesizing different amounts of P-galactosidase. Unfractionated RNA of cells harboring different o-gal expression vectors was electrophoresed on a 1% agarose gel. After blotting onto nylon membranes, the RNA was hybridized with a nick translated /acZ carboxy-terminal fragment as well as with a P-lactamase-specific probe. The amount of plactamase messenger (b/a) served as an internal standard. Products of a restriction digest of one of the b-gal expression plasmids was used as molecular weight markers (M). Particular fragments, the lengths of which are indicated, converted to the single-stranded form by glyoxal treatment, are revealed by hybridization to one of the probes. The position of the /acZ and b/a mRNA is indicated. Bands moving slower than the B-gal mRNA arise from plasmid DNA. The plasmids used, the temperature of incubation, and the induction period are indicated above the lanes. (B) Correlation between the relative amount of full-length /acZ mRNA and synthesis level of b-galactosidase, assayed 120 min after induction.

As shown in Figure 26, the amount of /acZmRNA correlates well with the a-galactosidase enzymatic activity produced by the various IacZ clones. In the next series of experiments, we probed the transcripts synthesized after induction of a few selected expression plasmids with a /acZ amino-terminal fragment. The result of this analysis confirmed our earlier observations (Figure 3). We found that variations in the 5’ leader region of the hybrid /acZ gene result in major differences in the amount of full-length messenger, which parallels the P-galactosidase production level. The amino-terminal probe also revealed the induction of a prominent short transcript, in most cases accompanied by a slightly smaller, less abundant species. The precise length of

tion

period.

specific

these two RNA transcripts depended on the plasmid used and apparently reflected the length of the 5’ untranslated region. We therefore believe that these RNA molecules represent a 5’terminal portion of the /acZ gene. The relative abundance of these 5’terminal fragments was largely independent of the amount of complete /acZ mRNA. We tentatively interpret these short RNA molecules as the result of RNA processing. The Variation in the RNA Levels Does Not Reflect a Differential Stability The above results clearly show that the leader regions that are fused to the /acZ structural gene have a drastic effect on the steady state level of P-gal mRNA. One explanation

Cell 714

Figure 3. Comparison of Steady State b-gal mRNA Levels after a 15 Min and 120 Min Induction Period

pPLcAT-n-flgal 15'-42% A

-3400-

;

120'-42°C A

-

for the observed differences could be a differential rate of degradation. We therefore compared the functional halflife of the /acZ mRNA of three expression plasmids (pPLcAT14-, pPLcAT528-, and pPLcAT588-pgal) displaying a 3-fold difference in mRNA synthesis level. The t,/, values were deduced from the decrease of P-galactosidase-synthesizing ability of cultures following addition of rifampicin (Kepes, 1983; Experimental Procedures). The functional half-life of the P-gal mRNA was found to vary from 3.2 to 4.3 min (Figure 4). This small variation, however, was not related to the observed difference in expression. Attempts to measure the tlIS value for very low expressing clones (e.g., pPLcAT22-pgal) have been inconclusive because of the very small increase in 5-galactosidase levels after addition of rifampicin. Within this narrow range, the experimental error was too large to allow accurate determination of the tl/, value. /acZ mRNA stabilities were also determined in rifampicin-treated cultures using Northern blot analysis (data not shown). Again, clones differing greatly in the mRNA and protein synthesis level did not show an appreciable difference in the degradation rate of the full-length S-gal mRNA. We conclude that the fairly constant relative stabilities cannot account for the widely different mRNA levels.

The analysis was performed with alacZaminoterminal probe. The representative clones from which the RNA was isolated, the temperature of incubation, and the induction time are indicated above the lanes. M, size standards. The position of the /acZ mRNA is shown by an arrow.

i$ I

4

0

5

10

15

20

0

5

10. t(mm)

15

20

I. 1 0

Figure 4. Functional Decay of the /acZ Messenger ous Expression Vectors

5

10

15

20

J

Encoded by Vari-

Rifampicin was added to induced cultures at zero time, and the accumulation of enzyme was measured. Shown is the decrease of synthesizing ability versus time. The 1% values (indicated in parentheses) were calculated from the slope of the curve (see Experimental Procedures).

The P-gal mRNA Amount Does Not Correlate with the Protein Synthesis Level in an IV+ Background The observed variation in the full-length /acZ mRNA level may also be explained by assuming that avariable degree

Coupling 715

Transcription

to Translation

N+ 15'-42°C

+CM

/

:

15'-42°C ; 15'-42°C x x-55

-3400-

-970-

- 290-

-970Figure 5. Comparison of the Amount of Full-Length lacZ mRNA Synthesized by Some Representative P-gal Plasmids in an N- or N+ Background The analysis was performed with a /acZ amino-terminal probe. Experimental conditions are indicated above the lanes. The structure of plasmid pPLcATOlrl$gal is described in Experimental Procedures. The position of the /acZ messenger is shown by an arrow. The results shown in the N- and N+ lanes were obtained in separate electrophoretic runs.

of early termination of transcription is taking place within the /acZ gene. To test this possibility, the amount of /acZ mRNA directed by various expression vectors in an Nhost (strain K12AHlAtrp) was compared with the synthesis level in an N+ host (strain M5219). The N protein of phage h has been shown to act as an antitermination factor for RNA transcripts initiated at the PL promoter (Adhya et al., 1974; Gottesman et al., 1980). The h phage sequences present on the P-gal expression plasmids include the n&L site, necessary for antitermination by N protein (Salstrom and Szybalski, 1978). We have earlier shown that the N protein, supplied in tram from a resident, defective prophage, allows the cloned PL promoter to override transcription termination signals (Marmenout et al., 1984). Figure 5 shows that, in the presence of N protein, the vectors pPLcATl-, pPLcAT14-, and pPLcAT522-f3gal produced essentially the same amount of /acZ mRNA. The same plasmids gave rise to widely divergent mRNA levels in N- cells. The observation that in M5219 an equal level of /acZ mRNA is synthesized from various plasmids corroborates our finding, mentioned above, that the relative stabilities of the various messengers are comparable.

-290Figure 6. Effect of Protein Synthesis on the Level of Full-Length /acZ mRNA The amount of mRNA accumulating in cells containing one of three different plasmids was measured in the absence (-CM) and presence (+CM) of chloramphenicol, using a /acZ amino-terminal probe. The last lane on the right is identical with the fourth lane, except that the extract in the last lane was treated with DNAase I prior to electrophoresis. The position of the lacZ mRNA is shown by an arrow.

The N+ and N- hosts produced IacZ messengers of the same length. It follows that the tandemly repeated fd termination signal is (at least partially) resistant to the action of N protein. As is evident from Figure 5, the maximum amount of full-length /acZ mRNA (induced by pPLcAT14bgal) is lower in the N+ strain than in the N- strain. The reason for this difference is not clear. It may be that the strains differ in the overall synthetic capacity. Although they derive from the same parental strain (Bernards et al., 1979; Greer, 1975) they display slightly different growth rates, even at 28%. We also measured the 8-galactosidase activity accumulating in N+ hosts containing the various IacZvectors. Since, in this strain, several P-gal expression plasmids displayed similar RNA levels, the amount of f3-galactosidase enzyme synthesized can be used as an independent parameter to assess their relative translational efficiencies. The clones differed by as much as lOO-

end, we compared the levels of IacZ mRNA synthesized by pPLcAT14-pgal with the levels synthesized by its derivative pPLcATO14-pgal (see Experimental Procedures). We observed a drastic fall in the amount of full-length /acZ mRNA as a result of removing the ribosome-binding site (see Figure 5). In accordance with the chloramphenicol experiment, the level of the small 5’specific transcript was unaffected. Figure 5 also demonstrates that, in the NC host, both plasmids produced the Same amount of mRNA. Discussion

= 2 / I

I

I

I,

I,

500

1

fl gal synthesrs level rn NC background (U/ml/Oo65OUnit)

I

I

1000

Figure 7. Correlation between the Enzyme Synthesis Level in the IV+ Background (Strain M5219) and the Amount of Full-Length /acZ m R N A Produced by the Same Plasmids in the N- Host Cells (Strain K12AH1 A@). M5219 cells containing pPLcAT522; pPLcAT22-, pPLcAT1; pPLcAT55-, or pPLcAT166gal and induced for 15 min were found to contain 6. 56, 83, 401, and 1048 U of 8-galactosidase/ml/ODso, unit, respectively.

fold in their enzyme production capacity, indicating that the alterations introduced in the 5’ untranslated region elicit a differential efficiency of translation initiation (see Figure 7). Translational Efficiency Controls the mRNA Level To examine the role of translation in the mechanism underlying differential transcription efficiency, we monitored mRNA production during inhibition of protein synthesis by chloramphenicol. Three clones, pPLcAT522-, pPLcATl-, and pPLcATlCpgal, directing the synthesis of varying levels of mRNA, were induced in the presence of chloramphenicol (100 f.tg/ml). Fifteen minutes after induction, RNA was prepared as described in Experimental Procedures. As expected, we could not detect 6-galactosidase synthesis during the induction period. Figure 6 demonstrates that under the above conditions the three /acZ gene8 produced an equally low amount of message. The argument that a translation block results in a prompt reduction of the mRNA quantity is obscured by the increase of mRNA stability by chloramphenicol (Schneider et al., 1976). The final steady state mRNA level is thus determined by two opposing effects. This may explain why chloramphenicol causes a dramatic reduction in the amount of mRNA transcribed from pPLcATlCpgal, while there is a detectable increase in the intensity of the pPLcAT522 transcript. Chloramphenicol had no effect on the level of Yterminal RNA fragments. It follows that the frequency of transcription across the proximal part of the IacZ gene is unaffected by a block in protein initiation. In a parallel experiment, we analyzed the effect of deleting the SD sequence and ATG initiation codon. To this

We have earlier shown that the amounts of B-galactosidase directed by a series of expression vectors vary as much as 70-fold, depending on the 5’ untranslated leader (Stanssens et al., 1965). The mRNA quantitation data presented here demonstrate that the alterations in the leader region also have a dramatic effect on the steady state level of full-length /acZ mRNA. The amount of /acZ mRNA was found to change in parallel with the level of f3-galactosidase production. Studies on a collection of ompA-/acZ fusions have led to similar conclusions (Green and Inouye, 1964). It is unlikely that the alterations in the 5’ leader affect the frequency of transcription initiation or result in transcription termination within the 5’ untranslated region, a8 it was found that the efficiency of the expression signals (& and 5’ untranslated region) depends on the downstream coding region (Stanssens et al., 1965). Determination of the half-life of some of the P-gal messengers indicated that the structure of the leader region has little effect on the degradation rate. Thus, differences in the steady state level of the lacZ mRNA are not caused by a differential stability. In the presence of the antitermination activity of N protein (strain M5219), the steady state levels of full-length /acZ mRNA were equalized, while the production of 6-galactosidase still differed markedly between the clones. Moreover, for the clones tested, the relative order of P-gal synthesis levels remained the same in the NC as in the Nhost. The antitermination properties of the N protein suggest that the observed differences in the level of fulllength /acZ mRNA are the result of a variable degree of premature termination within the lacZ gene. As shown in Figure 7, the amount of /acZ mRNA detected in N- cells correlates well with the translation efficiencies observed in N+ cells, suggesting that the degree of premature termination is inversely proportional to the efficiency of translation. This was further substantiated by the observation that deletion of the ribosome-binding site of a highproducer plasmid or addition of chloramphenicol to the culture resulted in a drastic fall of the level of full-length /acZ mRNA. In both cases, the amount of a 5’ terminal RNA fragment remained unaltered, again arguing that not the transcription initiation frequency but rather the elongation process was affected. We propose that latent transcription termination points present in the IacZ gene are activated when the distance between the RNA polymerase and the leading ribosome is sufficiently large to allow interaction of a terminator factor with the template. Factor Rho is a good candidate for

Coupling 717

Transcription

to Translation

such a role. Several lines of evidence suggest that Rho binding is relatively sequence nonspecific but requires a sufficiently long (70-90 nucleotides) unstructured RNA stretch (Morgan et al., 1983; 1985). Subsequent translocation along the nascent RNA, depending on the NTPase activity of Rho, allows the protein to catalyze the dissociation of transcription complexes at a downstream Rho-dependent termination site (Platt and Bear, 1983; Morgan et al., 1984). The presence of at least one Rho-dependent termination site near the middle of the /acZ gene has been inferred from in vitro experiments (de Crombrugghe et al., 1973). Our data do not allow us to determine whether the postulated intracistronic termination is occurring at this specific site or at other, as yet unidentified, sites. Using a /acZ amino-terminal probe, we have been unable to detect a specific RNA the relative abundance of which was inversely correlated with the amount of full-length transcript. This may be explained by rapid breakdown of the prematurely terminated transcript, or alternatively, by the fall of RNA product levels below the detection limits of our assay, in the event that termination occurs at many points. Independent of their effectiveness in directing the synthesis of full-length /acZ mRNA, all clones synthesized a prominent short transcript that corresponds to the 5’ end of the gene, the variable length of which reflected the length of the 5’ untranslated region. The 3’ end of these RNA products was estimated to map around nucleotide position 200 of the coding region. How these fragments arise is not known. Possibly, they derive from site-specific RNAase III cleavage; in vitro studies have indeed shown that this particular region of lac mRNA is cleaved by purified RNAase III (Shen et al., 1982). Alternatively, the mRNA template may contain a specific signal or assume a specific structure, capable of arresting the 3’to 5’directional degradation. Our observations suggest that transcriptional polarity does not require complete arrest of translation, as is the case in the well known polarity caused by nonsense mutations (Adhya and Gottesman, 1978). Increased spacing between the RNA polymerase and the leading ribosome would seem to satisfy the requirements for intracistronic termination to occur. In general, the coupling between translation and transcription may depend not only on the movement of the leading ribosome, but also on the rate of mRNA elongation. This is exemplified by recent studies on the expression of the E. coli pyrE gene (Bonekamp et al., 1984; 1985). It should be noted that the term coupling is used here in a passive sense, merely indicating the proximity of RNA polymerase and the first ribosome. We believe the above considerations may provide an explanation for the finding that NusA prevents Rho-dependent termination within the LacZ gene (Kung et al., 1975; Greenblatt et al., 1980). Indeed, available evidence indicates that the NusA protein slows down the transcriptional rate (von Hippel et al., 1984), an activity that may allow the translating ribosome to remain close behind the RNA polymerase and thus reduce the extent of termination at downstream Rho-sensitive sites. In IV+ cells different plasmids display S-gal levels varying as much as lOO-fold, yet they synthesize essentially

the same amount of full-length /acZ mRNA. First, this observation clearly shows that the sequence alterations 5’to the SD box intrinsically affect translation initiation. Second, it also argues against a model whereby N protein suppresses polarity by establishing (together with host factors) a physical linkage between the polymerase and the ribosome (Ward and Gottesman, 1982). Similar conclusions were recently reported using a ribosome-free in vitro transcription system (Goda and Greenblatt, 1985). In conclusion, our results show that in a wild-type background the amount of full-length message may not only depend on the efficiency of transcription initiation, but also on the efficiency of translation initiation. Experimental

Procedures

Bacterial Strains and Plasmids The Escherichia coli strains Kl2AHlAtrp (M72 SmR /acZam Abiouvf8 AkpfA2)/S(Nan?7am53 c/857 AHl) (Bernard et al., 1979) and M5219 (M72 SmR l8cZam trpAam)/5(bio252 C/857 AHl) (Greer, 1975) were used as hosts for the expression vectors. In all experiments these strains were grown in LB medium (1% Bacto-tryptone, 0.5% yeast extract, and 0.5% NaCI). The collection of B-galactosidase-expressing vectors used in this study has been previously described (Stanssens et al., 1985). An additional plasmid, designated pPLcATO14-pgal, was derived from pPLcATlC~gal by deleting the information between the “filled-in” Sal1 and BamHl sites (Stanssens et al., 1985). The resulting 17 bp deletion removes the SD sequence and the ATG initiation codon. While the parental clone directs the synthesis of high levels of b-galactosidase, K12AHlAtrp cells containing pPLcATO1Cpgal were readily identified as lac- on EMB plates supplemented with carbenicillin. RNA Analysis Samples of induced cultures were mixed at 65OC with an equal volume of phenol containing 1% SDS. Following an additional phenol extraction and two chloroform extractions, the nucleic acids were precipitated by adding 2 volumes of ethanol and allowing them to stand overnight at -20%. The pellet was dissolved in electrophoresis buffer, treated with glyoxal, and electrophoresed on a 1% agarose gel, essentially as described by Thomas (1980). Transfer of the RNA from the gel to Biodyne A nylon membranes (Fall. Portsmouth, England) and hy bridization were carried out according to the manufacturer’s specifications with the following addition: prior to prehybridization, filters were treated with 20 m M Tris-HCI (pH 80) at lOO% for 5 min. Restriction fragments, to be used as probes, were uniformly labeled by nick translation (Maniatis et al., 1982). The various probes used in this study are shown in Figure 16. In a few instances we have treated the cell extract with DNAase I (~500 Ulmg RNA) to discriminate between RNA molecules and bands associated with the presence of plasmid DNA. Trace amounts of RNAase, which might contaminate the DNAase I preparation, were removed using the method of Tullis and Rubin (1980). Measurement of the Half-Life of kc2 mRNAs Rifampicin (300 &ml) was added to fully induced cultures of Kl2AHlAtrp harboring one of the pgal plasmids. Tdal cellular RNA was prepared at time intervals after rifampicin addition and was analyzed by gel electrophoresis and RNA blotting as described above. To determine the functional half-life, samples were removed every minute and were pipetted into a solution containing 50 Kg/ml chloramphenicol and 10 m M Na-azide. The P-galactosidase content was measured as described before (Stanssens et al., 1985). The t’h values were calculated according to the method described by Kepes (1963).

We thank B. van Oosterhout and W. Drijvers for editorial and artistic work, respectively. This research was supported by the Gekoncerteerde Akties of the Belgian Ministery of sciences and the Fonds voor Geneeskundig Wetsnschappelijk Onderzoek (F.G.W.O.).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 USC. Section 1734 solely to indicate this fact. Received October 2, 1985; revised December

11, 1985.

Adhya, S., and Gottesman, M. (1978). Control of transcription tion. Ann. Rev. Biochem. 47, 967-996.

termina-

Adhya, S., Gottesman, M., and de Crombrugghe, B. (1974). Release of polarity in Escherichia co/i by gene N of phage h: termination and antitermination of transcription. Proc. Natl. Acad. Sci. USA 77, 25342538. Bernard, H. U., Remaut, E., Hershfield, M. V., Das, H. K., Helinski, D. R., Yanofsky, C., and Franklin, N. (1979). Construction of plasmid cloning vehicles that promote gene expression from the bacteriophage lambda pL promoter. Gene 5, 59-76. Bonekamp, F, Clemmesen, K., Karlstrom, O., and Jensen, K. F. (1984). Mechanism of UTP-modulated attenuation at the pyr.E gene of Escherichia co/i: an example of operon polarity control through the coupling of translation to transcription. EMBO J. 3, 2857-2861. Bonekamp, F., Andersen, H. D., Christensen, T., and Jensen, K. F. (1985). Codon-defined ribosomal pausing in Escherichia co/i detected by using the pyrE attenuator to probe the coupling between transcription and translation. Nucl. Acids Res. 13, 4113-4123. de Crombrugghe, B., Adhya, S., Gottesman, M., and Pastan, I. (1973). Effect of Rho on transcription of bacterial operons. Nature New Biol. 241, 260-264. Goda, Y., and Greenblatt, J. (1985). Efficient modification of E. co/i RNA polymerase in vitro by the N gene transcription antitermination protein of bacteriophage lambda. Nucl. Acids Res. 13, 2569-2582. Gottesman, M. E., Adhya, S., and Das, A. (1980). Transcription antitermination by bacteriophage lambda N gene product. J. Mol. Biol. 140, 57-75. Green, F! J., and Inouye, M. (1984). Roles of the 5’leader ompA mRNA. J. Mol. Biol. 176, 431-442.

region of the

Greenblatt, J., Li, J., Adhya, S., Friedman, D. I., Baron, L. S., Redfield, B., Kung, H.-F, and Weissbach, H. (1980). L factor that is required for 8galactosidase synthesis is the nusA gene product involved in transcription termination. Proc. Natl. Acad. Sci. USA 77; 1991-1994. Greer, H. (1975). The kil gene of bacteriophage 589-604.

lambda. Virology 66,

Kepes, A. (1963). Kinetics of induced enzyme synthesis. Determination of the mean life of galactosidase-specific messenger RNA. Biochim. Biophys. Acta 76, 293-309. Kung, H.-F., Spears, C., and Weissbach, H. (1975). Purification and properties of a soluble factor required for the deoxyribonucleic aciddirected in vitro synthesis of 8-galactosidase. J. Biol. Chem. 250, 1556-1562. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982). Molecular Cloning. (Cold Spring Harbor, New York: Cold Spring Harbor Laboratory), pp. 109-112. Marmenout, A., Remaut, E., van Boom, J., and Fiers, W. (1984). Oligonucleotide directed mutagenesis: selection of mutants by hemimethylation of GATC-sequences. Mol. Gen. Genet. 795, 126133. McMaster, G. K., and Carmichael, G. G. (1977). Analysis of single- and double-stranded nucleic acids on polyacrylamide and agarose gels by using glyoxal and acridine orange. Proc. Natl. Acad. Sci. USA 74, 4835-4838. Morgan, W. D., Bear, D. G., and von Hippel. P H. (1983). Rhodependent termination of transcription. II. Kinetics of mRNA elongation during transcription from the bacteriophage ), Pn promoter. J. Biol. Chem. 258, 9565-9574. Morgan, W. D., Bear, D. G., and von Hippel, P H. (1984). Specificity of release by Escherichia co/i transcription termination factor Rho of nascent mRNA transcripts initiated at the k Pe promoter. J. Biol. Chem. 259, 6664-8671.

Morgan, W. D., Bear, D. G., Litchman, B. L., and von Hippel, P. H. (1985). RNA sequence and secondary structure requirements for Rhodependent transcription termination. Nucl. Acids Res. 73, 3739-3754. Platt, T., and Bear, D. G. (1963). Role of RNA polymerase, p factor, and ribosomes in transcription termination. In Gene Function in Prokary otes, J. Beckwith, J. Davies, and J. A. Gallant, eds. (Cold Spring Harbor, New York: Cold Spring Harbor Laboratory), pp. 123-161. Remaut, E., Stanssens, t?, and Fiers, W. (1981). Plasmid vectors for high-efficiency expression controlled by the PL promoter of coliphage lambda. Gene 75, 81-93. Salstrom, J. S., and Szybalski, W. (1978). Coliphage 1 nufL-: a unique class of mutants defective in the site of gene N product utilization for antitermination of leftward transcription. J. Mol. Biol. 124, 195-221. Schneider, E., Blundell, M., and Kennell, D. (1978). Translation mRNA decay. Mol. Gen. Genet. 160, 121-129.

and

Shen, V., Imamoto, F., and Schlessinger, D. (1982). RNase III cleavage of Escherichia coli 8-galactosidase and tryptophan operon mRNA. J. Bacterial. 754 1489-1494. Stanssens, P., Remaut, E., and Fiers, W. (1985). Alterations upstream from the Shine-Dalgarno region and their effect on bacterial expression. Gene 36, 211-223. Thomas, P S. (1980). Hybridization of denatured RNA and small DNA fragments transferred to nitrocellulose. Proc. Natl. Acad. Sci. USA 77, 5201-5205. Tullis, R. H., and Rubin, H. (1980). Calcium protects DNase I from proteinase K: a new method for the removal of contaminating RNase from DNase I. Anal. Biochem. 107, 260-264. von Gabain, A., Belasco, J. G., Schottel, J. L., Chang, A. C. Y., and Cohen, S. N. (1983). Decay of mRNA in Escherichie co/i: investigation of the fate of specific segments of transcripts. Proc. Natl. Acad. Sci. USA 80, 653-657. von Hippel, P H., Bear, D. G., Morgan, W. D., and McSwiggen, J. A. (1984). Protein-nucleic acid interactions in transcription: a molecular analysis. Ann. Rev. Biochem. 53, 389-446. Ward, D. F., and Gottesman, M. E. (1982). Suppression of transcription termination by phage lambda. Science 276, 946-951.