Inflammasome activation in bovine monocytes by extracellular ATP does not require the purinergic receptor P2X7

Developmental and Comparative Immunology 38 (2012) 312–320

Contents lists available at SciVerse ScienceDirect

Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/dci

Inflammasome activation in bovine monocytes by extracellular ATP does not require the purinergic receptor P2X7 Jamal Hussen, Anna Düvel, Mirja Koy, Hans-Joachim Schuberth ⇑ Institute for Immunology, University of Veterinary Medicine Hannover, Bischofsholer Damm 15, D-30173 Hannover, Germany

a r t i c l e

i n f o

Article history: Received 25 April 2012 Revised 8 June 2012 Accepted 8 June 2012 Available online 19 June 2012 Keywords: Monocyte Cattle Inflammasome ATP

a b s t r a c t Extracellular adenosine triphosphate (ATP) is a second signal for the assembly of the NLR family, pyrin domain-containing 3 (NLRP3) inflammasome, which form a framework to activate caspase 1, leading to the processing and secretion of the pro-inflammatory cytokine interleukin-1b (IL-1b). The aim of the present study was to investigate the role of the ATP-gated ion channel subtype P2X7 receptor in the inflammasome activation of bovine monocytes. ATP-induced inflammasome assembly in bovine monocytes was shown by caspase-1 activation and the release of IL-1b by LPS/ATP-stimulated bovine cells. The IL-1b release depended on potassium efflux but was independent of reactive oxygen generation of bovine monocytes. Unlike in the human system, a P2X7 receptor antagonist did not block the ATPinduced release of IL-1b of LPS-primed bovine cells. P2X7 mediated pore formation was observed in subsets of bovine T lymphocytes (CD4+ > CD8+) but not in monocytes. In addition, ATP and 2-MeSATP but not the high affinity P2X7 agonist BzATP induced calcium influx in bovine monocytes. The data indicate that ROS generation plays no role in the ATP-induced activation of inflammasome in bovine monocytes and that P2X7-mediated pore formation is not necessary for the release of Interleukin-1b. Ó 2012 Elsevier Ltd. All rights reserved.

1. Introduction Interleukin-1b plays a critical role both in antimicrobial immunity and in many sterile inflammatory conditions (Goldbach-Mansky and Kastner, 2009; McIntire et al., 2009). The assembly of the inflammasome mediates autoactivation of caspase-1 (Lamkanfi, 2011; Ogura et al., 2006; Yu and Finlay, 2008) and finally the processing of bioactive IL-1b. Inflammasome complexes are assembled around members of the NOD-like receptor family (NLR), which detect microbial pathogen-associated molecular patterns (PAMPs) and endogenous damage-associated molecular patterns (DAMPs) in intracellular compartments (Meylan et al., 2006; Skeldon and Saleh, 2011). Among multiple inflammasomes (Bauernfeind et al., 2011) the NLR family, pyrin domain-containing 3 (NLRP3) inflammasome is currently the most well characterized inflammasome (Martinon, 2008; Tschopp and Schroder, 2010). Secretion of the mature and bioactive form of IL-1b depends on a first priming signal, which activates NF-jB mediated transcription of pro-IL-1b. The second signal mediates caspase-1 activation (Mariathasan and Monack, 2007). Extracellular adenosine Abbreviations: NLR, NOD-like receptor family; NLRP3, NLR family, pyrin domaincontaining 3. ⇑ Corresponding author. Tel.: +49 511 856 7267; fax: +49 511 856 7682. E-mail addresses: [email protected] (J. Hussen), [email protected] (A. Düvel), [email protected] (M. Koy), [email protected] (H.-J. Schuberth). 0145-305X/$ - see front matter Ó 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.dci.2012.06.004

triphosphate (ATP), released from damaged, stressed or stimulated immune cells, has been shown to act as second signal for the assembly of the NLRP3 inflammasome (Mariathasan et al., 2006) and acts through different purinergic receptors (Junger, 2011; Ralevic and Burnstock, 1998). NLRP3 inflammasome activation and IL-1b release of human and murine monocytes requires expression of the purinergic receptor P2X7 (Ferrari et al., 2006; Mariathasan et al., 2006). P2X7 is highly expressed on human and murine monocytes, macrophages and lymphocytes (Bours et al., 2006). P2X7 receptor knockout mice are completely defective in the IL-1b release in response to exogenous ATP (Solle et al., 2001). ATP-mediated inflammasome activation depends on activation of the P2X7 ATP-gated ion channel (Di Virgilio, 2007; Ferrari et al., 2006). This selective cation channel allows the influx of divalent cations and the efflux of potassium ions (Jursik et al., 2007). Afterwards, a second permeability state develops (‘pore formation’) which allows ethidium bromide to pass into the cell (Tatham and Lindau, 1990). It has been proposed that P2X7-dependent pore formation allows extracellular NLRP3 activators such as bacterial products to get into the cell and to activate NLRP3 directly (Kanneganti et al., 2007). Several other factors seem to be necessary for inflammasome activation, triggering of caspase-1 activation and IL-1b release, among which K+ efflux (Chen and Brosnan, 2006; Petrilli et al., 2007), Ca2+ influx (Gudipaty et al., 2003; Qu et al., 2007), and reactive oxygen species (ROS) in (Dostert et al., 2008; Martinon, 2010; Zhou et al., 2010a; Cruz et al., 2007) are the most important.

J. Hussen et al. / Developmental and Comparative Immunology 38 (2012) 312–320

This is the first study, which analyzes the ATP-mediated inflammasome activation in bovine monocytes. Especially we focused on the role of ATP-mediated pore formation, calcium influx, potassium efflux, and ROS generation for the IL-1b release and the relative role of the P2X7 purinergic receptor on bovine monocytes. 2. Materials and methods 2.1. Cells 2.1.1. Mononuclear cells Blood from healthy cattle (Holstein–Friesian) and from three healthy human volunteers was obtained by venipuncture of the vena jugularis externa into heparinized vacutainer tubes (Becton Dickinson, Heidelberg, Germany) or tubes containing EDTA. Bovine blood was layered on Ficoll-Isopaque (PAA, Pasching, Austria) and centrifuged at 10 °C for 30 min at 1000g (human blood: 10 °C, 30 min, 900g). The interphase containing mononuclear cells (MNC) was washed 3 times in PBS (500g, 250g, 100g) and finally suspended in culture medium (see below) or PBS. 2.1.2. Monocytes After density gradient separation, MNC were re-suspended in 5 mL PBS containing 2 mmol/L EDTA and filtered through a preseparation filter (mesh size: 30 lm) (Miltenyi Biotec, Bergisch Gladbach, Germany) to remove cell clumps. Cells were centrifuged at 70g (4 °C, 10 min) and labeled with paramagnetic MicroBeads™ coated with a CD14-specific monoclonal antibody (Clone: TÜK4, Miltenyi Biotec, Bergisch Gladbach, Germany) (20 min, 6 °C). After labelling, the cells were washed with PBS-EDTA (300g, 4 °C, 10 min) and the magnetic cell separation was performed according to the manufacturer’s instructions. Negatively (lymphocytes) and positively selected cells (monocytes) were suspended in 10 mL PBS-EDTA and checked flow cytometrically for their viability (P98%) and purity (P95%) after labelling the cells with a PE-conjugated mouse anti bovine CD14 monoclonal antibody (Clone: TÜK4, AbD Serotec, UK) and adding propidium iodide (2 lg/mL). 2.1.3. Endothelial cells Bovine umbilical vein endothelial cells served as a positive control for the expression of P2X4 and P2X7. They were isolated and cultured as described elsewhere (Hermosilla et al., 2006). 2.2. Flow cytometric detection of activated caspase-1 Caspase-1 activation was analyzed in live cells using FLICACaspase-1 detection KIT, a fluorescent inhibitor of active caspase1 (FAM-YVAD-FMK, Immunochemistry Technologies), which binds activated caspase-1. Bovine MNC or purified monocytes (1  106) were stimulated for 2 h with LPS (100 ng/mL). ATP (2 mmol/L) was then added to the cells for further 30 min. After stimulation cells were detached by adding 200 lL accutase (PAA laboratories) and further incubation for 15 min (37 °C, 5% CO2). Cells were then suspended in 300 lL RPMI medium and 10 lL of the 30 FLICA solution was added to each sample. After the incubation for 1 h (37 °C, 5% CO2) with FLICA cells were washed two times with the FLICA buffer and suspended in 200 lL FLICA buffer. Flow cytometric analysis was performed with the Accuri C6 flow cytometer according to manufacturer’s manual after adding propidium iodide (2 lg/mL) to exclude dead cells. 2.3. In vitro stimulation of IL-1b production Bovine MNC or monocytes or human MNC were plated in 96 well plates (2  105/well) and incubated with either culture med-

313

ium (RPMI 1640, negative control) or purified LPS (1 lg/mL, Sigma–Aldrich, Germany) for 4 h (37 °C, 5% CO2). ATP, BzATP or 2-MeSATP at indicated concentrations were added to the culture for an additional hour. To inhibit potassium efflux from the cells, potassium chloride (KCl) was added at a final concentration of 140 mmol/L at the start of the stimulation. In some experiments CE-224535 (Pfizer, USA), an antagonist of the human P2X7 receptor, was added to bovine or human MNC after 3.5 h of LPS stimulation and 30 min before adding ATP. Set-ups were made in parallel. After a total of 5 h in vitro, cells were briefly spun down and, cell culture supernatants were collected and stored at 70 °C until assayed. 2.4. IL-1b ELISA To measure bovine IL-1b, flat-bottomed 96-well plates (MaxiSorp; Nunc, Roskilde, Denmark) were coated with monoclonal anti-ovine IL-1b (AbD Serotec., 100 lL/well, 4 lg/mL) in carbonate–bicarbonate buffer (15 mmol/L Na2CO3, 35 mmol/L NaHCO3, pH 9.6) and incubated for 18 h at 4 °C. Plates were washed five times with phosphate buffer (2.5 mmol/L NaH2PO4, 7.5 mmol/L Na2HPO4, 145 mmol/L NaCl, 0.1% (v/v) Tween 20, pH 7.2). Unspecific binding sites were blocked by adding 200 lL/well of 2% fish gelatin (Sigma–Aldrich, Germany). After incubation for 1 h at room temperature (RT) each well was filled with 75 lL of sample and plates were incubated on a rotating platform for 1 h at RT. Serial dilutions of purified bovine recombinant IL-1b (AbD Serotec,) were included in each assay to construct a standard curve. Plates were washed five times with phosphate buffer and wells were filled with 75 lL of rabbit anti-bovine IL-1b polyclonal antibody (AbD Serotec, 2 lg/mL). Plates were incubated for 1 h at room temperature, washed, and peroxidase-conjugated affinity pure goat anti rabbit IgG (FC) (Dianova) was added. After 1 h at RT the plates were washed and subsequently filled with 75 lL/well peroxidase substrate buffer (33.3 mmol/L citric acid, 66.7 mmol/L NaH2PO4, pH 5.0) supplemented with 130 lg/mL 3,30 ,5,50 -tetramethylbenzidine (TMB, Sigma, Germany) and 0.01% (v/v) H2O2 (all chemicals from Sigma–Aldrich, Germany). After 20 min at RT in the dark adding 75 lL of 0.5 M H2SO4 to each well stopped the reaction. Optical densities were read in an ELISA microplate reader (MR 5000, Dynatech, Denkendorf, Germany) at 450 nm and 630 nm. Bovine IL-1b concentrations were calculated by referring to a standard curve. The detection limit of the assay was 100 pg/mL. A human IL-1b Quantikine ELISA Kit (R&D systems) was used to detect human IL-1b according to the manufacturer’s protocol. 2.5. Measurement of ethidium bromide-uptake by multi-color timeresolved flow cytometry Bovine MNC were stained with fluorochrome-labeled monoclonal antibodies specific for cell surface molecules (CD2-FITC (Clone: CC42), CD4-PE (Clone: CC8), CD8-Alexa647 (Clone: CC63), CD172aPE-Alexa64 (Clone: CC149), MHC-II-FITC (Clone: 73.68)) (AbD Serotec, Oxford, UK). In separate set ups the following combinations of monoclonal antibodies were added to 4  105 MNC in RPMI medium: CD2-FITC and CD4-Alexa647, CD2-FITC and CD8Alexa647, MHC-II-FITC and CD172a-PE-Alexa647. Cells were then incubated at 4 °C for 30 min and washed two times in 150 lL RPMI medium (300g, 4 min, 4 °C) thereafter. Finally, cells were suspended in 100 lL potassium medium (RPMI medium supplemented with 140 mmol/L KCl). Ethidium bromide (EB, 50 lL, final concentration 25 lmol/l) was added, followed 40 s later by addition of ATP, BzATP or 2-MeSATP at indicated concentrations. In parallel set ups cells were pre incubated with indicated concentrations of CE-224535 for 40 min before addition of the agonists, ATP or BzATP.

314

J. Hussen et al. / Developmental and Comparative Immunology 38 (2012) 312–320

Before addition of the agonists, events with high EB fluorescence intensity were considered dead cells and excluded from the analysis. Twenty thousand events of viable cells were flow cytometrically acquired. EB-fluorescence for each gated subpopulation (CFlow plus software, Becton Dickinson) was plotted against time. 2.6. Measurement of calcium influx Bovine MNC (5  106) were incubated for 30 min at 37 °C with Fluo-4 AM (1 lmol/L final, Molecular Probes, Eugene OR) at 37 °C in Ca2+/Mg2+ HBSS (CM-HBSS, PAA laboratories). Cells were washed three times with CM-HBSS (6 min, 180g) and finally suspended in CM-HBSS with propidium iodide (PI, 2 mg/mL final, Calbiochem, Bad Soden, Germany). PI-positive cells were excluded from the analysis. Baseline Fluo-4 fluorescence was recorded flow cytometrically for 20 s before ATP, BzATP or 2-MeSATP were added at indicated concentrations. The cellular response towards ionomycin (Sigma–Aldrich, Germany, 250 nmol/L final) served as positive control. 2.7. Measurement of ROS generation Bovine MNC or monocytes (3  105/well) were seeded in 96well round-bottom microtiter plates (Corning, NY, USA), loaded

with dihydrorhodamine (DHR 123, 750 ng/mL final, Mobitec, Goettingen, Germany) and incubated with different concentrations of ATP, BzATP or 2-MeSATP for 15 min (37 °C, 5% CO2). Parallel setups were stimulated with 1 lmol/L PMA (Sigma–Aldrich, Germany). The relative amount of generated ROS was determined flow cytometrically by recording the mean green fluorescence intensity of gated cell populations. At least 30,000 events (gated viable cells) were acquired.

2.8. Measurement of potassium efflux Potassium efflux from bovine MNC was measured flow cytometrically as described (Krjukova et al., 2000). The voltagesensitive fluorescent dye DiBAC4 (3) (Sigma–Aldrich, Germany) was dissolved in DMSO (25 mmol/L). MNC (3  105) were incubated with 100 nmol/l DiBAC4 (3) for 10 min at RT and ATP, BzATP or 2-MeSATP were added at indicated concentrations to the cells for further 10 min at RT. Hyperpolarization of cells results in an extrusion of the dye from cells and a subsequent decrease in fluorescence intensity. The mean green fluorescence intensity of gated populations was recorded flow cytometrically after acquisition of at least 30,000 events (gated viable cells). For dead cell discrimination, propidium iodide was added at 2 lg/mL.

Table 1 Primer sequences used for PCR analysis. Sequence of forward (for) and reverse (rev) primer (50 ? 30 )

Fragment size (bp)

P2X4

TATCCAGATCAAGTGGGACTGCAAC (for) TCTTCATGCAGTAGAGGACTATGAC (rev)

325

P2X7a

AAGAGCCTGTCATCAGTTCTGTGCAC (for) AGATCTCAATGCCCATGATTCCTCCC (rev)

608

Gene a

a

Ramirez and Kunze, (2002).

Fig. 1. Inflammasome activation in bovine monocytes. (A) ATP induced caspase-1 activation in bovine monocytes. MACS-separated bovine monocytes were left untreated (medium), stimulated for 4 h with LPS (100 ng/mL), or 3 h with LPS and 3 mmol ATP for additional 30 min (LPS+ ATP) or ATP alone. Caspase-1 activation was quantified using the fluorescent inhibitor of active caspase-1 (FLICA) reagent and analyzed by flow cytometry (data are shown for one animal of three tested). (B) ATP-induced IL-1bproduction in LPS-primed bovine mononuclear cells (MNC) or monocytes. Bovine MNC or MACS-separated monocytes (n = 5 animals) were stimulated for 5 h with LPS (1 lg/mL) and 5 mmol/L ATP was added to the culture for an additional hour. IL-1b in cell supernatants was measured by ELISA. Differences between groups (one-way ANOVA) were considered significant (⁄) at p < 0.05.

J. Hussen et al. / Developmental and Comparative Immunology 38 (2012) 312–320

315

2.9. PCR amplification of ATP receptor cDNA fragments Total RNA of monocytes, CD4+ cells and endothelial cells was extracted using the RNeasy Micro Plus Kit (QIAGEN, Hilden, Germany) according to manufacturer’s instructions including the elimination of contaminating genomic DNA with a DNA eliminator column. The integrity and the concentration of isolated RNA was checked photometrically (OD260 nm/OD280 nm absorption). cDNA synthesis was performed using the SuperScript II reverse transcriptase and oligo (dT) nucleotide primers (both Invitrogen, Karlsruhe, Germany) according to the manufacturer’s instructions with 400 ng total RNA. First-strand cDNA products were used directly as templates for PCR amplification. Conventional PCR was performed using a Biometra T-Gradient (Biometra, Göttingen, Germany) with specific primer (Table 1). Each PCR vial contained 5 lL template cDNA sample, 10 lmol/L each of sense and antisense primers, 10 mmol/L dNTP Mix, 50 mmol/L MgCl2 (both Invitrogen, Karlsruhe, Germany) and 1 unit recombinant Taq DNA polymerase (Fermentas, St. Leon-Rot, Germany) in a total volume of 50 lL. A negative control without cDNA template was included in each assay. The reaction mix was heated for 3 min (94 °C), followed by 30 cycles of 45 s each at 94 °C, 30 s at 60 °C and 1 min 30 s at 72 °C, with a final extension at 72 °C for 10 min. After agarose gel (1.5%) electrophoresis with GelStarÒNucleic Acid Gel Stain (Lonza, Cologne, Germany) the PCR products were visualized under UV light. A 1 kb Plus DNA ladder (Fermentas, St. Leon-Rot, Germany) was included in each electrophoretic run to estimate the size of the amplified products. The experiment was repeated with RNA of three cell donors. 2.10. Statistical analyses Statistical analysis was carried out using the software Prism (GraphPad software). Results are expressed as means ± S.E. of the mean (SEM). Differences between means were tested by one-factorial analysis of variance (ANOVA). Results were considered statistically significant at a p-value of less than 0.05.

3. Results

Fig. 2. P2X7 agonist-induced ethidium bromide uptake into bovine mononuclear cells. Cells were suspended in potassium medium (RPMI medium supplemented with 140 mmol/L KCl). Ethidium bromide (EB, 25 lmol/L) was added, followed 40 s later by addition of ATP, BzATP or 2-MeSATP (arrows) at indicated final concentrations. Cells were gated on viable (propidium-iodide-negative) monocytes (A) or lymphocytes (B) based on forward and side scatter characteristics. EB-fluorescence for each gated cell populations was plotted against time. Data are shown for cells from one of three tested animals.

ATP-induced pore formation and dye-uptake. No dye-uptake could be seen in B cells or monocytes (Fig. 3A and B).

3.1. Inflammasome activation in bovine monocytes LPS alone was not able to stimulate detectable caspase-1 activation in bovine monocytes (Fig. 1A). The latter was dependent on costimulation with ATP, which alone caused already caspase-1 activation (Fig. 1A). The release of IL-1b was minimal when MNC were stimulated with LPS alone but 6-fold higher in the presence of ATP (Fig. 1B, MNC). Stimulation of bovine MNC with ATP alone induced nearly no secretion of IL-1b. Separated monocytes displayed the same type of IL-1b induction dependency and released amounts of IL-1b (Fig. 1B, monocytes). 3.2. ATP does not induce pore formation and ethidium bromide uptake in monocytes To evaluate the function of the cell surface pore-forming ATP receptors in bovine MNC, agonist-induced ethidium bromide (EB) uptake in MNC was assessed using time-resolved flow cytometry. ATP, BzATP and 2-MeSATP induced pore formation and uptake of EB in bovine lymphocytes (Fig. 2B) but not in monocytes (Fig. 2A). BzATP appeared to be 10 times more potent compared to ATP and about 18 times more potent than 2-MeSATP (Fig. 2B). Analysis of lymphocyte subsets showed that mainly bovine CD4+ T cells and to a lesser extent CD8+ T cells are involved in the

3.3. Human P2X7 receptor antagonist inhibits pore formation but not IL-1b release To analyze whether ATP-induced activation of the inflammasome and the release of IL-1b of bovine monocytes is mediated by P2X7 receptors, an antagonist of the human P2X7 receptor (CE-224535) was used to block pore formation in bovine CD4+ T cells and the IL-1b release of bovine MNC. CE224535 was significantly able to reduce the EB uptake of ATP or BzATP stimulated CD4+ T cells (Fig. 4A) when used at P25 lmol/L (ATP stimulation) or P100 lmol/l (BzATP stimulation). However, CE-224535 (100 lmol/L) had no inhibiting effect on the IL-1b release of LPS+ ATP-stimulated bovine MNC, whereas the IL-1b release of stimulated human MNC was significantly reduced in the presence of CE-224535 (Fig. 4B). 3.4. P2X4 and P2X7 are expressed in various bovine cells at the mRNA level A range of bovine cell types expressed the ATP receptors P2X4 and P2X7 at the mRNA level. PCR products of the expected size (325 bp and 608 bp) were detected in endothelial cells, CD4+ T cells and monocytes (Fig. 5).

316

J. Hussen et al. / Developmental and Comparative Immunology 38 (2012) 312–320

Fig. 3. ATP induces ethidium bromide uptake into distinct subsets of bovine mononuclear cells. Bovine MNC were stained with fluorochrome-labeled monoclonal antibodies specific for cell surface molecules (CD2, CD4, CD8, CD172a, MHC-II) and suspended in 100 lL potassium medium. Ethidium bromide (25 lmol/L) was added 40 s before the addition of ATP (1 mmol/L final, arrows). (A) Upper row from left to right: CD2+/CD4+ T cells, CD2+/CD8+ T cells, MHC II+/CD172a B cells, and CD172a+/MHC II+ monocytes. For the gated cell population (within the rectangle region) the EB fluorescence versus time is shown in the lower row. EB fluorescence was measured flow cytometrically for gated cell subsets (red rectangles) versus time. (B) After addition of ATP (at the intersection of the quadrant marker, A: lower row) the percentage of events with a higher EB fluorescence (upper right quadrant in the lower row density plots) was recorded for each identified cellular subpopulation. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

3.5. ATP and 2-MesATP induce Ca2+ influx in bovine monocytes To investigate the role of Ca2+ influx for ATP-induced inflammasome activation, bovine MNC were loaded with the fluorochrome Fluo-4, and a continuous measurement of cytosolic calcium was measured by flow cytometry. ATP and 2-MeSATP induced a short rise in cytosolic calcium of bovine monocytes (Fig. 6A), whereas the P2X7 high affinity agonist BzATP had no effect on the Ca2+ concentration in monocytes (Fig. 6A). In contrast, BzATP and ATP (P300 lmol/L) induced elevated calcium level in a subset of bovine lymphocytes (Fig. 6) whereas 2-MeSATP had no effect on these cells.

only PMA but none of the three ATP isomers was able to induce ROS-formation (Fig. 7B) 3.7. K+ efflux is required for the IL-1b release of activated bovine monocytes To test the importance of potassium efflux for the ATP-induced inflammasome activation, bovine MNC were loaded with the voltage sensitive dye DiBAC4 (3). The stimulation with all three ATP isomers caused a significantly reduced concentration of intracellular potassium in bovine monocytes (Fig. 8A). Inhibition of K+ efflux by high extracellular K+ concentrations (140 mmol/L) completely blocked the LPS/ATP-induced release of IL-1b (Fig. 8B).

3.6. ATP, 2-MeSATP and BzATP do not induce ROS formation in bovine monocytes

4. Discussion

When cells were loaded with the ROS-sensitive dye DHR-123, all ATP isomers induced ROS formation in bovine lymphocytes with BzATP being the most effective one (Fig. 7A). In monocytes

Interleukin-1b, mainly produced by activated monocytes and macrophages, is one of the key players in the innate and adaptive immune response (Netea et al., 2010). Since ATP is one of the major

J. Hussen et al. / Developmental and Comparative Immunology 38 (2012) 312–320

317

Fig. 4. A human-specific P2X7 receptor antagonist inhibits the agonist-induced ethidium bromide (EB) uptake of bovine CD4+ T cells but does not inhibit the LPS/ATPinduced IL-1b release of bovine MNC. (A) Bovine MNC were stained with a fluorochrome-labeled monoclonal antibody specific for bovine CD4+ T cells. Cells were preincubated (40 min) with different concentrations of CE-224535, an antagonist of human P2X7 receptor before stimulation with ATP (300 lmol/L) or BzATP (100 lmol/L). The percentage of EB+ CD+ cells in the absence of inhibitor was set to 100% (mean ± SEM, n = 4). (B) Bovine or human MNC were stimulated for 5 h with LPS (1 lg/mL). ATP (5 mmol/L) was added to the culture for the last hour of incubation. After 3.5 h of LPS stimulation (30 min before adding ATP) 100 lmol/L of CE-224535 were added to the culture. Solvent control set ups contained DMSO (0.01%). IL-1b in supernatants was measured by ELISA. Response to LPS+ ATP in the absence of P2X7 antagonist was set to 100% (mean ± SEM; n = 3). Differences between groups (one-way ANOVA) were considered significant at p < 0.05 (⁄).

Fig. 5. P2X4 and P2X7 mRNA is expressed in different bovine cell types. Messenger RNA was isolated from bovine endothelial cells (E), MAC-separated monocytes (M) and MAC-separated CD4+ T cells (CD4+). A set-up without template served as negative control (N). PCR products of P2X4 (325 bp) and P2X7 (608 bp) were demonstrated after 1.5% agarose gel electrophoresis and nucleic acid gel stain. Data are shown for cells of one animal (of three tested). Band sizes (top to bottom) are 700, 600, 500, 400, 300 and 200 bp.

second signals required for inflammasome activation, our objectives were to analyse the requirements for ATP-induced inflammasome activation in bovine monocytes and to clarify the role of different ATP receptors. The LPS-induced and ATP-enhanced release of IL-1b (Fig. 1B) proves that ATP acts as a second messenger for IL-1b secretion

from bovine MNC and monocytes. In addition, we could show that ATP co-induced inflammasome assembly resulted in caspase-1 activation in bovine monocytes. Inhibition of caspase-1 activation with a pan-caspase-inhibitor completely blocked IL-1b release (data not shown). Although stimulation with ATP could induce IL-1b secretion only in LPS-primed cells, stimulation with ATP alone was able to induce caspase-1 activation in bovine monocytes. Although this was not followed by IL-1b release, it contradicts published findings were cell priming (e.g. with LPS) appeared to be necessary for the induction of NFjB-dependent NLRP3 transcription prior to inflammasome activation by ATP (Bauernfeind et al., 2009; Netea et al., 2010). The ATP-induced reduced intracellular K+ concentration in bovine MNC was comparable to the reduction seen in ATP-stimulated murine cells (Perregaux and Gabel, 1994; Petrilli et al., 2007). The relevance for the IL-1b release could be shown by its complete inhibition after raising the extracellular K+ concentration. Although not further analyzed, it seems more likely that the mode of inhibition took place at the level of inflammasome activation, since the addition of extracellular K+ could block NLRP3 inflammasome activation in response to several stimuli (Dostert et al., 2009).

318

J. Hussen et al. / Developmental and Comparative Immunology 38 (2012) 312–320

Fig. 6. P2X7 agonist induced Ca2+ influx in bovine mononuclear cells. Cells were preloaded with Fluo-4. Baseline calcium levels were recorded for 20 s followed by addition of ATP, BzATP or 2-MeSATP at indicated concentrations (arrows). The addition of medium served as negative control (), the addition of ionomycin (250 nmol/L final) served as positive control. Cells were gated on viable (propidiumiodide-negative) monocytes (A) or lymphocytes (B) based on forward and side scatter characteristics. Fluo-4 fluorescence for each gated cell populations was plotted against time. Data are shown for cells from one of three tested animals.

The mRNA expression of two ATP receptors (P2X4, P2X7) in different cell types (endothelial cells, CD4+ T cells, monocytes) (Fig. 4) confirms previous findings for bovine dendritic cells, macrophages, T cells, B cells and endothelial cells (Ramirez and Kunze, 2002; Smith et al., 2001). Demonstration of protein expression failed, since human-specific P2X7-antibodies showed no cross-reactivity on Western blots (data not shown). Therefore, the functional expression of ATP receptors was analyzed by using different ATP isomers which show different affinities for various P2X receptors with BzATP having the highest affinity for P2X7 receptors followed by ATP and 2-MeSATP (Nihei et al., 2000). We focused on P2X7 since this receptor was reported to be decisive for the calcium- and ROS-dependency of inflammasome activation in human and murine monocytes(Cruz et al., 2007; Gudipaty et al., 2003). First evidence that functional expression of P2X7 is not necessary for inflammasome activation in bovine monocytes came from the observation that ATP stimulation did not result in ethidium bromide uptake of stimulated cells. This is in striking contrast to human and murine cells (Jursik et al., 2007; Pelegrin and Surprenant, 2006; Tatham and Lindau, 1990). An artifact can be excluded, since EB uptake took place in defined lymphocyte subsets with CD4+ T cells being more responsive than CD8+ T cells. The higher potency of BzATP for pore formation in these cells is also consistent with the known affinities of P2X7 receptors for the three

Fig. 7. P2X7 agonists induced ROS generation in bovine mononuclear cells. Cells were incubated with the non-fluorescent dye dihydrorhodamine (DHR 123) in the presence or absence (control) of PMA (1 lmol/L final), ATP, BzATP or 2-MeSATP at indicated concentrations for 15 min (37 °C, 5% CO2). The percentage of cells with higher rhodamin-123 fluorescence was recorded for gated lymphocytes (A) and monocytes (B) in rhodamin-123 versus side scatter dot plots (cells of 5 animals, mean ± SEM). Differences between groups were calculated using the one-way ANOVA and were considered significant (⁄) if p < 0.01.

used ATP isotypes and indicates that pore formation in bovine T cells is mediated through P2X7 receptor. If P2X7 is considered essential for pore formation, these results provide at least evidence for the functional expression of P2X7 on bovine cellular subsets. Conversely, the missing response of bovine monocytes and B cells indicates their lack of functional P2X7 expression. This is in contrast to the murine and human system, were P2X7 has been shown to be highly expressed on monocytes, macrophages, T and B cells (Junger, 2011). The ability of low concentrations of the high affinity ligand BzATP and higher concentrations of 2-MeSATP to induce ROS in bovine lymphocytes supported the selective P2X7-mediated pore formation in bovine T lymphocytes. Bovine monocytes did not produce ROS after stimulation with either P2X7 agonist. This is again in contrast to human monocytes (Hewinson et al., 2008) and macrophages where ATP-induced ROS generation was mediated exclusively by P2X7 receptors (Cruz et al., 2007). The lack of functional P2X7 expression on bovine monocytes may explain the lack of ROS generation and further suggests that ROS generation, as opposed to the human or murine system (Dostert et al., 2008; Petrilli et al., 2007; Sorbara and Girardin, 2010; Zhou et al., 2010b), is not a prerequisite for inflammasome activation in these cells. Missing ROS generation may even support caspase-1 activation in bovine monocytes, since ROS were recently reported to inhibit caspase 1 activation through redox signaling in murine macrophages (Meissner et al., 2008). As opposed to ATP and 2-MeSATP, the high affinity P2X7 receptor agonist BzATP induced no Ca2+ influx in bovine monocytes and

J. Hussen et al. / Developmental and Comparative Immunology 38 (2012) 312–320

319

5. Conclusion For the inflammasome-dependent IL-1b release, bovine monocytes require ATP in addition to a primary stimulus. This IL-1b release depends on potassium efflux, but, in contrast to human and murine monocytes, does not require calcium influx or generation of reaction oxygen and is independent of the P2X7 receptor. Acknowledgements The P2X7 antagonist was kindly provided by Mark Eppler, Pfizer, USA. The work was supported by a grant to H.J.S. by the Bundesministerium für Bildung und Forschung (BMBF, Grant-No: 0315161). References

Fig. 8. Role of potassium in ATP-induced inflammasome activation. (A) P2X7 agonist-induced K+ efflux from bovine mononuclear cells. Bovine MNC were preloaded with DiBAC4 (3) and incubated with ATP, BzATP or 2-MeSATP (each 0.5 mmol/L final). The mean green fluorescence intensity (MFI) of gated viable monocytes was recorded after flow cytometrical acquisition of 30,000 events. Hyperpolarization caused by reduced concentration of intracellular potassium results in an extrusion of the dye from cells and a subsequent decrease in fluorescence intensity. (B) High extracellular potassium concentration inhibits the IL-1b release of bovine MNC. Cells of three animals were left untreated (medium) or stimulated 4 h with LPS (1 lg/mL). ATP (5 mmol/L) was added for an additional hour (LPS+ ATP). One set up contained 140 mmol/L KCl (LPS+ ATP+ KCl). IL-1b in cell supernatants was measured by ELISA. Data are presented for cells of 3 animals (mean ± SEM). Differences between groups were considered significant if p < 0.01 (⁄).

only a weak transient rise in cytosolic Ca2+ in bovine lymphocytes. Since all three ATP receptor agonists induced secretion of IL-1b from monocytes (data not shown), it can be concluded that Ca2+ influx is not a prerequisite for IL-1b release of bovine monocytes. This is in opposite to the essential role of Ca2+ influx for ATPinduced IL-1b secretion from human monocytes and macrophages (Gudipaty et al., 2003) and the lack of both Ca2+ influx and IL-1b secretion of bone marrow derived macrophages from P2X7 deficient mice (Qu et al., 2007). Since the seven mammalian P2X receptor family members (P2X1–7), with exception of P2X5, can facilitate entry of Ca2+ in response to stimulation by extracellular ATP (Woehrle et al., 2010), the lack of calcium influx after BzATP stimulation of bovine monocytes indirectly indicates that BzATP shows selective binding to P2X7 in the bovine system and provides further evidence that bovine monocytes lack P2X7 expression. To confirm that P2X7 receptors do not contribute to inflammasome activation in bovine blood monocytes we utilized an antagonist specific for human P2X7 receptor (Duplantier et al., 2011). The antagonist blocked the ATP or BzATP induced EB uptake in bovine CD4+ T cells, demonstrating the role of P2X7 in pore formation, but it had no effect on the ATP induced IL-1b release from LPSprimed bovine MNC. This finally indicates that P2X7 receptors play no role in the ATP co-induced release of IL-1b from bovine monocytes.

Bauernfeind, F., Ablasser, A., Bartok, E., Kim, S., Schmid-Burgk, J., Cavlar, T., Hornung, V., 2011. Inflammasomes: current understanding and open questions. Cell. Mol. Life Sci. 68, 765–783. Bauernfeind, F.G., Horvath, G., Stutz, A., Alnemri, E.S., MacDonald, K., Speert, D., Fernandes-Alnemri, T., Wu, J., Monks, B.G., Fitzgerald, K.A., Hornung, V., Latz, E., 2009. Cutting edge: NF-kappaB activating pattern recognition and cytokine receptors license NLRP3 inflammasome activation by regulating NLRP3 expression. J. Immunol. 183, 787–791. Bours, M.J., Swennen, E.L., Di Virgilio, F., Cronstein, B.N., Dagnelie, P.C., 2006. Adenosine 5‘-triphosphate and adenosine as endogenous signaling molecules in immunity and inflammation. Pharmacol. Ther. 112, 358–404. Chen, L., Brosnan, C.F., 2006. Regulation of immune response by P2X7 receptor. Crit. Rev. Immunol. 26, 499–513. Cruz, C.M., Rinna, A., Forman, H.J., Ventura, A.L., Persechini, P.M., Ojcius, D.M., 2007. ATP activates a reactive oxygen species-dependent oxidative stress response and secretion of proinflammatory cytokines in macrophages. J. Biol. Chem. 282, 2871–2879. Di Virgilio, F., 2007. Liaisons dangereuses: P2X(7) and the inflammasome. Trends Pharmacol. Sci. 28, 465–472. Dostert, C., Guarda, G., Romero, J.F., Menu, P., Gross, O., Tardivel, A., Suva, M.L., Stehle, J.C., Kopf, M., Stamenkovic, I., Corradin, G., Tschopp, J., 2009. Malarial hemozoin is a Nalp3 inflammasome activating danger signal. PLoS One 4, e6510. Dostert, C., Petrilli, V., Van Bruggen, R., Steele, C., Mossman, B.T., Tschopp, J., 2008. Innate immune activation through Nalp3 inflammasome sensing of asbestos and silica. Science 320, 674–677. Duplantier, A.J., Dombroski, M.A., Subramanyam, C., Beaulieu, A.M., Chang, S.P., Gabel, C.A., Jordan, C., Kalgutkar, A.S., Kraus, K.G., Labasi, J.M., Mussari, C., Perregaux, D.G., Shepard, R., Taylor, T.J., Trevena, K.A., Whitney-Pickett, C., Yoon, K., 2011. Optimization of the physicochemical and pharmacokinetic attributes in a 6-azauracil series of P2X7 receptor antagonists leading to the discovery of the clinical candidate CE-224535. Bioorg. Med. Chem. Lett. 21, 3708–3711. Ferrari, D., Pizzirani, C., Adinolfi, E., Lemoli, R.M., Curti, A., Idzko, M., Panther, E., Di Virgilio, F., 2006. The P2X7 receptor: a key player in IL-1 processing and release. J. Immunol. 176, 3877–3883. Goldbach-Mansky, R., Kastner, D.L., 2009. Autoinflammation: the prominent role of IL-1 in monogenic autoinflammatory diseases and implications for common illnesses. J. Allergy Clin. Immunol. 124, 1141–1149 (quiz 1141–1150). Gudipaty, L., Munetz, J., Verhoef, P.A., Dubyak, G.R., 2003. Essential role for Ca2+ in regulation of IL-1beta secretion by P2X7 nucleotide receptor in monocytes, macrophages, and HEK-293 cells. Am. J. Physiol. Cell Physiol. 285, C286–299. Hermosilla, C., Zahner, H., Taubert, A., 2006. Eimeria bovis modulates adhesion molecule gene transcription in and PMN adhesion to infected bovine endothelial cells. Int. J. Parasitol. 36, 423–431. Hewinson, J., Moore, S.F., Glover, C., Watts, A.G., MacKenzie, A.B., 2008. A key role for redox signaling in rapid P2X7 receptor-induced IL-1 beta processing in human monocytes. J. Immunol. 180, 8410–8420. Junger, W.G., 2011. Immune cell regulation by autocrine purinergic signalling. Nat. Rev. Immunol. 11, 201–212. Jursik, C., Sluyter, R., Georgiou, J.G., Fuller, S.J., Wiley, J.S., Gu, B.J., 2007. A quantitative method for routine measurement of cell surface P2X7 receptor function in leucocyte subsets by two-colour time-resolved flow cytometry. J. Immunol. Methods 325, 67–77. Kanneganti, T.D., Lamkanfi, M., Kim, Y.G., Chen, G., Park, J.H., Franchi, L., Vandenabeele, P., Nunez, G., 2007. Pannexin-1-mediated recognition of bacterial molecules activates the cryopyrin inflammasome independent of toll-like receptor signaling. Immunity 26, 433–443. Krjukova, J., Osna, N., Pilmane, M., 2000. Investigation of K+ channel expression in human peripheral lymphocytes of healthy donors by means of flow cytometry. Scand. J. Clin. Lab. Invest. 60, 419–427. Lamkanfi, M., 2011. Emerging inflammasome effector mechanisms. Nat. Rev. Immunol. 11, 213–220. Mariathasan, S., Monack, D.M., 2007. Inflammasome adaptors and sensors: intracellular regulators of infection and inflammation. Nat. Rev. Immunol. 7, 31–40.

320

J. Hussen et al. / Developmental and Comparative Immunology 38 (2012) 312–320

Mariathasan, S., Weiss, D.S., Newton, K., McBride, J., O‘Rourke, K., Roose-Girma, M., Lee, W.P., Weinrauch, Y., Monack, D.M., Dixit, V.M., 2006. Cryopyrin activates the inflammasome in response to toxins and ATP. Nature 440, 228–232. Martinon, F., 2008. Detection of immune danger signals by NALP3. J. Leukoc. Biol. 83, 507–511. Martinon, F., 2010. Signaling by ROS drives inflammasome activation. Eur. J. Immunol. 40, 616–619. McIntire, C.R., Yeretssian, G., Saleh, M., 2009. Inflammasomes in infection and inflammation. Apoptosis 14, 522–535. Meissner, F., Molawi, K., Zychlinsky, A., 2008. Superoxide dismutase 1 regulates caspase-1 and endotoxic shock. Nat. Immunol. 9, 866–872. Meylan, E., Tschopp, J., Karin, M., 2006. Intracellular pattern recognition receptors in the host response. Nature 442, 39–44. Netea, M.G., Simon, A., van de Veerdonk, F., Kullberg, B.J., Van der Meer, J.W., Joosten, L.A., 2010. IL-1beta processing in host defense: beyond the inflammasomes. PLoS Pathog. 6, e1000661. Nihei, O.K., Savino, W., Alves, L.A., 2000. Procedures to characterize and study P2Z/ P2X7 purinoceptor: flow cytometry as a promising practical, reliable tool. Mem. Inst. Oswaldo Cruz 95, 415–428. Ogura, Y., Sutterwala, F.S., Flavell, R.A., 2006. The inflammasome: first line of the immune response to cell stress. Cell 126, 659–662. Pelegrin, P., Surprenant, A., 2006. Pannexin-1 mediates large pore formation and interleukin-1beta release by the ATP-gated P2X7 receptor. EMBO J. 25, 5071– 5082. Perregaux, D., Gabel, C.A., 1994. Interleukin-1 beta maturation and release in response to ATP and nigericin. Evidence that potassium depletion mediated by these agents is a necessary and common feature of their activity. J. Biol. Chem. 269, 15195–15203. Petrilli, V., Papin, S., Dostert, C., Mayor, A., Martinon, F., Tschopp, J., 2007. Activation of the NALP3 inflammasome is triggered by low intracellular potassium concentration. Cell Death Differ. 14, 1583–1589. Qu, Y., Franchi, L., Nunez, G., Dubyak, G.R., 2007. Nonclassical IL-1 beta secretion stimulated by P2X7 receptors is dependent on inflammasome activation and

correlated with exosome release in murine macrophages. J. Immunol. 179, 1913–1925. Ralevic, V., Burnstock, G., 1998. Receptors for purines and pyrimidines. Pharmacol. Rev. 50, 413–492. Ramirez, A.N., Kunze, D.L., 2002. P2X purinergic receptor channel expression and function in bovine aortic endothelium. Am. J. Physiol. Heart Circ. Physiol 282, H2106–2116. Skeldon, A., Saleh, M., 2011. The inflammasomes: molecular effectors of host resistance against bacterial, viral, parasitic, and fungal infections. Front. Microbiol. 2, 15. Smith, R.A., Alvarez, A.J., Estes, D.M., 2001. The P2X7 purinergic receptor on bovine macrophages mediates mycobacterial death. Vet. Immunol. Immunopathol. 78, 249–262. Solle, M., Labasi, J., Perregaux, D.G., Stam, E., Petrushova, N., Koller, B.H., Griffiths, R.J., Gabel, C.A., 2001. Altered cytokine production in mice lacking P2X(7) receptors. J. Biol. Chem. 276, 125–132. Sorbara, M.T., Girardin, S.E., 2010. Mitochondrial ROS fuel the inflammasome. Cell Res. 21, 558–560. Tatham, P.E., Lindau, M., 1990. ATP-induced pore formation in the plasma membrane of rat peritoneal mast cells. J. Gen. Physiol. 95, 459–476. Tschopp, J., Schroder, K., 2010. NLRP3 inflammasome activation: The convergence of multiple signalling pathways on ROS production? Nat. Rev. Immunol. 10, 210–215. Woehrle, T., Yip, L., Elkhal, A., Sumi, Y., Chen, Y., Yao, Y., Insel, P.A., Junger, W.G., 2010. Pannexin-1 hemichannel-mediated ATP release together with P2X1 and P2X4 receptors regulate T cell activation at the immune synapse. Blood 116, 3475–3484. Yu, H.B., Finlay, B.B., 2008. The caspase-1 inflammasome: a pilot of innate immune responses. Cell Host Microbe. 4, 198–208. Zhou, R., Tardivel, A., Thorens, B., Choi, I., Tschopp, J., 2010a. Thioredoxin-interacting protein links oxidative stress to inflammasome activation. Nat. Immunol. 11, 136–140. Zhou, R., Yazdi, A.S., Menu, P., Tschopp, J., 2010b. A role for mitochondria in NLRP3 inflammasome activation. Nature 469, 221–225.