Inflammatory and stress biomarker response of Aeromonas hydrophila infected rohu, Labeo rohita fingerlings to dietary microbial levan

Aquaculture 521 (2020) 735020

Contents lists available at ScienceDirect

Aquaculture journal homepage: www.elsevier.com/locate/aquaculture

Inflammatory and stress biomarker response of Aeromonas hydrophila infected rohu, Labeo rohita fingerlings to dietary microbial levan

T

⁎

Sanjay K. Guptaa, , B. Sarkara, Manisha Priyama, Neeraj Kumarb, S. Naskara, Md Javed Foysalc,d, Shailesh Saurabhe, T.R. Sharmaa a

ICAR-Indian Institute of Agricultural Biotechnology, Namkum, Ranchi 834010, India ICAR-National Institute of Abiotic Stress Management, Baramati, Pune 413115, India c School of Molecular and Life Sciences, Curtin University, Bentley, WA, Australia d Department of Genetic Engineering and Biotechnology, Shahjalal University of Science and Technology, Sylhet, Bangladesh e ICAR- Central Institute of Freshwater Aquaculture, Bhubaneswar 751 002, Odisha, India b

A R T I C LE I N FO

A B S T R A C T

Keywords: Microbial Levan TLR22 Immune system IFN-γ HSP70 Infection A. hydrophila

An experiment was conducted to study the effect of microbial levan supplemented diet on innate and adaptive immune responses as well as stress biomarkers of pathogen challenged Labeo rohita fingerlings. Fish were randomly divided into two groups in triplicates and fed with a pre-standardized dose of 1.25% (w/w%) levan and without levan (control group) for 60 days. Post completion of the feeding trial, fish from both treatment groups were challenged with a pathogenic strain of A. hydrophila and samples were collected on different time points till 96 h. The results of the study showed that supplementation of microbial levan significantly upregulated the mRNA levels of TLR22, β-2 M and IFN-γ, and downregulated TGF-β in the intestine, gill, kidney and liver in a time-dependent manner. Significant decrease in the expression of TGF-β in the hepatic cells was noticed at later time points of 24, 48 and 96 h post-challenge with the highest of 2.66 fold at 48 h. Upregulation of the β-2 M gene at 48 h and 96 h was noticed in the intestine, gill, liver and kidney. Maximum expression of IFN-γ was observed at highest time points of 96 h in both intestine and gill, whereas 3.4-fold in the liver at 6 h and 2.6-fold in the kidney at 24 h was noticed. TGF-β expression analysis displayed the significant downregulation with a maximum decrease of 2.6 fold in the gill at 12 h, while a 2.3-fold and 2.5-fold decrease were noticed at 48 h in the kidney and liver, respectively. Total immunoglobulin level and myeloperoxidase content of A. hydrophila infected rohu increased upto 24 h in the levan-fed group compared to the control. Remarkable decrease of stress biomarkers such as serum cortisol, blood glucose, and HSP70 in the liver, muscle and gill, was observed due to dietary feeding of levan at 24 h. In totality, the present study revealed the significant upregulation of immune responsive genes (TLR22, β-2 M and IFN-γ), downregulation of regulatory gene (TGF-β) and decrease of HSP70, cortisol and blood glucose with dietary microbial levan supplementaion in infected Labeo rohita fingerlings. These findings on the modulation of immune responsive gene and stress parameters provide an understanding about the molecular basis of the function of prospective prebiotic, microbial levan.

1. Introduction The application of dietary nutraceuticals /functional foods as feed supplements for weight gain, enhanced feed efficiency, improved immune response and disease resistance have been advocated for the sustainable and eco-friendly aquaculture practices to restrict the abuse of antibiotics, chemicals and drugs (Hoseinifar et al., 2015; Dawood et al., 2018). These functional foods may be derived from plant or algal extracts or microbe-associated molecular patterns (MAMPs) (Wang et al., 2017). Recognition of these molecular motifs initiates an immune

⁎

cascade inducing inflammatory genes and activating immune cells. Health-promoting properties of functional foods often coincide with prebiotics. Prebiotics are non-digestible selectively fermented substances that promote growth and/or activity of beneficial microbes present in the gastrointestinal tract of the host (Bindels et al., 2015). The most common prebiotics used for improving fish health within the aquaculture sector includes fructose oligosaccharides (FOS), mannan oligosaccharides (MOS) and transgalactooligosaccharide (TOS) (Jose Meseguer, 2011). Out of these, FOS and its mechanism of action as a dietary supplement on fish physiology have been explored quite

Corresponding author: School of Molecular Diagnostics and Prophylactics, ICAR-Indian Institute of Agricultural Biotechnology, Namkum, Ranchi 834010, India. E-mail address: sanfi[email protected] (S.K. Gupta).

https://doi.org/10.1016/j.aquaculture.2020.735020 Received 30 September 2019; Received in revised form 19 January 2020; Accepted 25 January 2020 Available online 25 January 2020 0044-8486/ © 2020 Elsevier B.V. All rights reserved.

Aquaculture 521 (2020) 735020

S.K. Gupta, et al.

responses (Rairakhwada et al., 2007; Hoseinifar et al., 2015; Huang et al., 2015; Yarahmadi et al., 2016). However, most of these studies focus on the impact of microbial levan on non-specific immunity and therefore, the understanding of its molecular mechanism bears a void. Through this study, we intend to provide a bird's eye view of the hierarchy of immune effector response to prebiotic, levan in pathogen challenged L. rohita fingerlings along with stress biomarker responses.

extensively. Levan, a type of FOS, is a potent prebiotic found in plants as well as microbial products. It is a polysaccharide fructan comprised of D-fructosyl residues attached by β (2 → 6) linkages with some branching in β (2 → 1) linkages (Öner et al., 2016). Microbial levans are produced by various bacterial genera from sucrose-based substrates by the transfructosylation reaction of levansucrase and are demonstrated to have multidimensional features for its application in various industries (Öner et al., 2016). Perusal of accessible literature indicated that supplementation of microbial levan in diet could effectively augment growth performance and non-specific immune response, improve thermal tolerance and maintain liver homeostasis under fipronil toxicity in fishes (Gupta et al., 2008; Gupta et al., 2010; Gupta et al., 2013; Gupta et al., 2015; Huang et al., 2015; Rairakhwada et al., 2007). Our recent finding established a significant pro-inflammatory response in pathogen-challenged L. rohita (rohu) fed on levan supplemented diet (Gupta et al., 2018). Although the effect of prebiotics on the expression profile of inflammatory biomarker genes has been studied in few fishes (Biswas et al., 2012; Cerezuela et al., 2013; Lokesh et al., 2012; Zduńczyk and Pareek, 2009), research in this direction warrants further investigation, especially with regards to microbial levan for a deeper insight of its immuno-protective role. Hence, as an extension to our previous study (Gupta et al., 2018), we intended to look into the modulation in the host's defense mechanism by further assessment of its immune and stress parameters. Our first choice was toll-like receptor 22 (TLR22), a member of the pattern recognition receptor family, known to function exclusively in fishes. As the frontline sentinels of the immune system, TLRs are known to respond to pathogenic motifs and mediate the activation of adaptive immune parameters. TLR22 forms a dual-sensing system for double stranded (ds) RNA along with TLR3 (Matsuo et al., 2008). Both TLRs act via the same adapter, Toll-IL-1R homology domain-containing adaptor protein 1 (TICAM-1), and has an extracellular as well as intracellular localization (Ding et al., 2018; Matsuo et al., 2008). Matsuo et al., (2008) also suggested divergent pathogen recognition by this TLR that allows it to detect RNA products of varied microbial origin (virus and bacteria) in the surrounding water. Therefore, it serves as a robust detection mechanism for preventing the aggravation of pathogenic infection in fishes. Further, its ubiquitous localization across tissues and its preference for longer sized RNA made it an ideal pick from the TLR family for our study (Oshiumi et al., 2003). Myeloperoxidases were also estimated as a non-specific immune parameter to assess neutrophil activity (Castro et al., 2008). The next targets were immunoglobulins and β2-microglobulin (β2-M). Immunoglobulins are mediators of the humoral response and are constituted by three heavy chain isotypes (IgM, IgD, and IgT/Z) (Mashoof and Criscitiello, 2016). β2-M, on the other hand, is a representative of the major histocompatibility complex (MHC) class I pathway implicated in cell-mediated response. It forms the core of the MHC class I molecule and is known to present processed antigenic peptides to Tlymphocytes and NK cells in mammals (Litwin et al., 1993). In fish, β2M is reported to elicit an anti-bacterial immune response (Chen et al., 2010). Further downstream, the modulation of the immune response is managed by candidate genes like interferon (IFN) - γ and transforming growth factor-β (TGF-β). While IFN- γ is involved in the activation of immune cells like macrophages and NK cells by upregulation of chemokines and transcription factors, TGF-β acts as an immuno-regulator. The immunosuppressive role of TGF-β against the bactericidal response of macrophages is reported in White perch, Morone Americana (Harms et al., 2000). Its regulatory role is best assessed in species like grass carp and red sea bream, where it elicited both positive and negative control on immune response (Cai et al., 2010; Yang et al., 2014). Apart from these, the stress biomarkers such as blood glucose, heat shock protein70 (HSP70) and cortisol could be integrated with the network analysis to understand the associated mechanism in the biological systems. Several studies have been carried out on different teleost species to assess the impact of dietary levan as a supplement on inflammatory

2. Materials and methods 2.1. Levan production, isolation and characterization The bacterial strain of Acetobacter xylinum (NCIM 2526) was procured from National Chemical Laboratory (NCL), Pune for levan production. Levan was isolated, purified and characterized for verification as per the standardized protocol of Srikanth et al. (2015a, 2015b). The molecular weight of the purified sample was determined using high pressure size exclusion chromatography with 1-200 kDa commercial dextrans as calibration standards. The eluted sample was subjected to Potassium ferricyanide (PF) test and HPLC to authenticate the presence of levan monomer units. Characterization of the functional groups and proton carbon fingerprint, FTIR spectroscopy,1H and 13C NMR was accomplished to validate the presence of levan monomer units (Ahmed et al., 2014; Srikanth et al., 2015a, 2015b). 2.2. Experimental animals, feed and design L. rohita fingerlings weighing 4.45 ± 0.48 g were provided by the state fisheries department, (Doranda, Ranchi, Jharkhand, India) for this experiment. The fingerlings were acclimatized to laboratory conditions for 20 days in 1000 L aerated fiber reinforced plastic (FRP) tanks with ad libitum feeding (3% of body weight; twice/day) of practical feed composed of 30% crude protein. Randomized distribution of 150 fingerlings into two groups (n = 3), was carried out before the commencement of the feeding trial. Half of the tank was siphoned on alternate days to avoid the accumulation of uneaten feed and faeces. Control and experimental feed for the trial were prepared as described in our previous study (Gupta et al., 2018) and feed composition is presented in Table 1. The fingerlings were fed twice daily for 60 days at 3.0% of body weight initially and with a consequent increase in their Table 1 Ingredients composition of the experimental diets (g kg−1on dry matter basis) fed to L. rohita fingerlings during the experimental period of 60 days. Ingredients a

Soybean meal Fish meala Groundnut meala Wheat floura Sunflower oila Cod liver oila Vitamin + mineral mixb,⁎ Vitamin Cc Microbial levan Proximate analysis (g kg−1) Crude protein Crude lipid Ash a

Control

Microbial levan (1.25%)

300 100 150 350 40 30 29 1 0 1000

300 100 150 337.5 40 30 29 1 12.5 1000

351.2 78.4 96.6

349.8 77.9 97.3

Procured from local market, Prepared manually and all components from Himedia Ltd., c SD Fine Chemicals Ltd., India. ⁎ Composition of vitamin mineral mix (quantity/250 g starch powder): vitamin A 55,00,00 IU; vitamin D3 11,00,00 IU; vitamin B1 20 mg; vitamin B2 2,00 mg; vitamin E 75 mg; vitamin K 1,00 mg; vitamin B12 0.6 μg; calcium pantothenate 2,50 mg; nicotinamide 1000 mg; pyridoxine 1,00 mg; Mn 2700 mg; I 1,00 mg; Fe 7,50 mg; Cu 2,00 mg; Co 45 mg; Ca 50 g; P 30 g. b

2

Aquaculture 521 (2020) 735020

S.K. Gupta, et al.

Table 2 Gene specific primers, annealing temperature and accession number used for PCR analysis in the study. Gene

Primer sequence

Annealing temp

Reference

TLR22

Forward-5′ TCACCCCATTTCGAGGCTAACAT 3′ Reverse-5′ CGGAGGTAGGTTCGTTTCTTCA 3′ Forward-5′ TCCAGTCCCAAGATTCAGGTG 3′ Reverse-5′ TGGTGAGGTGAAACTGCCAG 3′ Forward-5′ TGTGTTCCTCAACAGACACC 3′ Reverse-5′ TGGAGAAACAGTTGACTCATGTG 3′ Forward-5′ ACGCTTTATTCCCAACCAAA 3′ Reverse-5′ GAAATCCTTGCTCTGCCTCA 3′ Forward-5′ GACTTCGAGCAGGAGATGG 3′ Reverse-5′ CAAGAAGGATGGCTGGAACA 3′

51.6 °C

(Saurabh et al., 2011)

59.7

(Mohanty and Sahoo, 2010)

61.5 °C

(Swain et al., 2015)

60.5 °C

(Hoseinifar et al., 2016)

55.3 °C

(Mohanty and Sahoo, 2010)

β-2 M IFN-γ TGF-β β-actin

Levan

Control

*

48 24 12 6 0

0.2

0.4

0.6

0.8

1

Levan

Myeloperoxidase Time post infection (Hrs)

Time post infection (Hrs)

Total Immunoglubulin

*

48 24

**

12

*

6 0

1.2

Control

0.4 OD at 540 nm

0.8

1.2

ng/dl

Fig. 1. Total immunoglobulin (a) and (b) myeloperoxidase activity after 60 days of feeding trial with microbial levan supplemented and levan non-supplemented (control) group on different time points viz., 6 h, 12 h, 24 h, and 48 h post challenge with Aeromonas hydrophila in Labeo rohita fingerlings. Data represent mean ± SE of three samples. Statistically significant, P value as < 0.05 (denoted as *), P value < .001 (denoted as **) on top of error bars.

Table 3 Impact of dietary levan on HSP-70 in liver, muscle and gill, serum cortisol and blood glucose on different time points viz., 6 h, 12 h, 24 h, and 48 h post challenge with Aeromonas hydrophila in Labeo rohita fingerlings. Parameters

Time points (Hrs.) 6h

12 h

Control HSP70 Liver HSP70 Muscle HSP70 Gill Cortisol Blood glucose

14.26 11.01 17.45 88.41 69.08

± ± ± ± ±

0.65 0.70 1.53 1.82 2.5

24 h

48 h

Levan

Control

Levan

Control

Levan

11.1 ± 0.66* 9.58 ± 0.70 12.83 ± 1.21 81.43 ± 2.92 59.76 ± 1.44*

15.1 ± 1.25 12 ± 0.28 15.1 ± 1.18 89.01 ± 2.03 72.35 ± 2.09

11.1 ± 0.83 10.82 ± 0.86 11.3 ± 0.95 76.51 ± 4.07 63.18 ± 0.85*

29.74 ± 1.48 13.44 ± 0.44 13.2 ± 0.37 119.54 ± 8.82 79.65 ± 0.44

20.02 12.42 10.72 74.57 71.24

± ± ± ± ±

1.22* 0.94* 0.62** 5.14* 0.22**

Control

Levan

27.25 ± 0.08 17.36 ± 1.52 14.36 ± 0.59 125.41 ± 5.73 81.41 ± 2.54

23.39 ± 0.23* 15.3 ± 1.01 12.17 ± 0.88 100.54 ± 4.14* 68.87 ± 2.00*

Values represent mean ± SE of three samples. Statistically significant difference row wise between levan supplemented and non-supplemented control group. P value as < 0.05 (denoted as *) and P value < .001 (denoted as **).

Survival rate %

Control

biomass, the quantity of feed was adjusted after every15 days.

Levan

105 90 75 60 45 30 15 0

Survival rate %

2.3. Challenge study with A. hydrophila

6

12

48 Time (Hrs)

96

At the end of the feeding trial, the fish from the experimental group were intraperitoneally injected with 96 h LD50 dosage (1.8 × 108 CFU mL−1) of A. hydrophila (ATCC 7966, Hi- media, Mumbai, India) using 0.2 mL PBS as vehicle. The control group of fish were injected only with the vehicle. Fish from both groups (n = 3), were sacrificed at 6, 12, 24, 48 and 96 h post-infection followed by collection of blood.

144

Fig. 2. Survival rate % after 60 days of feeding trial with microbial levan supplemented and levan non supplemented (control) group on different time points viz., 6 h, 12 h, 24 h, 48 h, 96 h and 144 h post challenge with Aeromonas hydrophila in Labeo rohita fingerlings.

2.4. Blood and serum sample collection Before the collection of blood, fish were anesthetized with clove oil (50 μ L−1) and subsequently dissected under aseptic conditions to collect the desired tissues (gill, liver, intestine, muscle and kidney). Blood was collected using ethylene diamine tetra-acetate (EDTA) as anticoagulant. Two fish from each replicate were used for blood 3

Aquaculture 521 (2020) 735020

S.K. Gupta, et al.

Intestine

Control *

Fold change expression

10

Levan

*

6 *

2 0

c

12 24 48 Time post infection (Hrs)

Fold change expression

Kidney

Control **

20

8

*

8

*

6 4 2

d

Levan

** **

*

Levan

10

6

16 12

Control

0

96

*

4

12 24 48 Time post infection (Hrs)

Liver Fold change expression

6

Gill 12

*

8

4

b

Fold change expression

a

Control **

18 15

96

Levan

***

*

12 24 48 Time post infection (Hrs)

96

12 9 6 3 0

0 6

12 24 48 Time post infection (Hrs)

6

96

Fig. 3. Expression of TLR22 mRNA in (a) Intestine, (b) gill, (c) kidney, and (d) liver relative to β-actin after 60 days of feeding trial with microbial levan supplemented and levan non supplemented (control) group on different time points viz., 6 h, 12 h, 24 h, 48 h and 96 h post challenge with Aeromonas hydrophila in Labeo rohita fingerlings. Bars represent mean ± SE of three samples. Statistically significant upregulation and downregulation in the expression of mRNA relative to the levan non-supplemented control group. P value as < 0.05 (denoted as *), P value < .001 (denoted as **) and P value < .0001 (denoted as ***).

collection through the caudal vein using a syringe (No. 23) which was previously rinsed with 2.7% (w/v %) EDTA. Serum samples from another two anesthetized fish per replicate were collected without anticoagulant by centrifugation at 3000 ×g for 5 min and stored at −80 °C until further use. The excised tissues were also stored in 1 mL Trizol (Sigma, USA) at −80 °C.

each well was transferred into new 96-well plates. The absorbance was measured at 450 nm in a microplate reader (Quant, Universal microplate spectrophotometer, USA).

2.5. Total immunoglobulin and myeloperoxidase content

HSP70 expression level (EIA kit, catalog no. EKS-700B) in the liver muscle and gill was determined following the manufacturer's instructions (Bioguenix/Enzo Life Science, Mumbai, India). The absorbance was read on the ELISA plate reader (Biotek India Pvt. Ltd.). Cortisol level was determined in the serum of fish from both treatment groups using ELISA. The quantification was performed using commercially available Cortisol EIA kit (Catalog no. 500360), procured from Cayman Chemicals, USA as per the manufacturer's instructions and the absorbance was read in the ELISA plate reader (Biotek India Pvt. Ltd.). Blood glucose level was estimated by the method of Nelson (1944) and Somoyogi (1945). The absorbance was recorded at 540 nm against the blank.

2.6. HSP70, blood glucose and serum cortisol

Total immunoglobulin level was measured and calculated as per the protocol of Siwicki and Anderson (1993) with minor modification. The serum (0.1 mL) was placed in a plastic serum vial and 0.1 mL of 12% PEG (Polyethylene glycol) was added and suspended in deionized water. Incubation was done at room temperature for 2 h under constant mixing, followed by centrifugation at 5000 g for 10 min. The protein concentration in the supernatant was determined by Biuret method using a commercial kit (Merck, Germany). Protein reading from the supernatant was the amount of protein taken out by absorption into the polyethylene glycol. OD measurement was performed at 595 nm. The serum total immunoglobulin concentration was calculated by subtracting the concentration of proteins in the supernatant from the total protein concentration in the serum before precipitation with PEG. The total immunoglobulin level was expressed as unit ng dL−1. Total myeloperoxidase content present in serum was measured according to Quade and Roth (1997) with some modifications. About 15 μL of the serum was diluted with 135 μL of hank's balanced salt solution (HBSS) without Ca2+ or Mg2+ in 96-well plates. The wells were added with 25 μL of 20 mM 3,3′ 5, 5′- tetramethyl benzidine hydrochloride (TMB) (Hi-media) and 25 μL of 5 mM H2O2 (Qualigens) (Both substrates of MPO prepared freshly). The reaction was terminated after 2 min by adding 50 μL of 4 M sulphuric acid (H2SO4). The plate was centrifuged (400 g) for 10 min, and 150 μL of the supernatant from

2.7. Survival rate % To determine the survival rate %, six more tanks (n = 3) with 10 fish/tank were kept in similar conditions to calculate the survival rate % from the bacterial challenge at different time points viz., 6, 12, 24, 48, 96 and 144 h post-infection. The survival rate % was calculated as follows: Survival rate % = 100 x (Nt/N0). where Nt is the number of live fish after specific time points (hrs) and N0 is the number of fish initially present in the tank.

4

Aquaculture 521 (2020) 735020

S.K. Gupta, et al.

b

a

Gill Control

15 *

12

*

*

*

9 6 3

12 24 48 Time post infection (Hrs)

Levan

*

8

*

6 4 2 0

ND

6

0 6

Control

Levan Fold change expression

Fold Change expression

Intestine

12 24 48 Time post infection (Hrs)

96

96

d

30

Kidney

Control

Levan **

25 *

20

*

15 10 5

Liver Fold change expression

Fold change expression

c

Control

30

*

25

Levan **

20 *

15 10 5

ND

0 6

0 6

12 24 48 Time post infection (Hrs)

96

12 24 48 Time post infection (Hrs)

96

Fig. 4. Expression of β 2-M mRNA in (a) Intestine, (b) gill, (c) kidney, and (d) liver relative to β-actin after 60 days of feeding trial with microbial levan supplemented and levan non-supplemented (control) group on different time points viz., 6 h, 12 h, 24 h, 48 h and 96 h post challenge with Aeromonas hydrophila in Labeo rohita fingerlings. Bars represent mean ± SE of three samples. Statistically significant upregulation and downregulation in the expression of mRNA relative to the levan non-supplemented control group. P value as < 0.05 (denoted 24 as *), P value < .001 (denoted as **) and P value < .0001 (denoted as ***). ND refers to Not detectable.

expression were plotted in a graph.

2.8. RNA extraction and cDNA synthesis RNA was extracted from 100 mg of tissue using Trizol following the manufacturer's protocol. It was checked for quality and quantity on NanoDrop and processed for DNase I (Fermentas, USA) treatment. First strand cDNA synthesis was done using 1 μg of RNA in a 20 μL buffer with 50 μM OligodT (GCC Biotech), 200UμL−1 RNase inhibitor (Thermo Scientific) and 12 mmol L−1 dNTPs (Invitrogen) and stored at −20 °C until further use.

2.11. STRING analysis The genes analyzed for expression levels in our previous study (Gupta et al., 2018) (IL-1β, IL-10, IL-12, TNF-α) were included with the parameters assessed in the present study (glucose, cortisol, myeloperoxidase, immunoglobulin, TLR22, TGF-β, IFN-γ, β-2 M, Hsp70) to predict their functional associations using STRING (Szklarczyk et al., 2018). Since the database curation for mammalian data is extensive and robust, the organism chosen for the network analysis was Mus musculus. Due to the absence of TLR22 in mammals, TLR1 was included for network analysis considering that both these proteins belong to the same TLR sub-family. The genes provided for cortisol from Mus musculus in the STRING database were screened to select the glucocorticoid receptor, Nuclear Receptor Subfamily 3 Group C Member 1 (NR3C1), as a cortisol indicator, while the immunoglobulin receptor Fcgr4 was selected as an indicator for immunoglobulin. Similarly, the selected indicator for glucose was Phosphoenolpyruvate Carboxykinase 1 (PEPCK), the enzyme regulating the rate-limiting step of gluconeogenesis and glycogenolysis. The 13 genes were selected and submitted for prediction of network association based on functional evidence at a medium confidence limit of 0.4. Further, Gene Ontology (GO) Enrichment for Biological Processes was screened manually to enlist immunity-specific processes with a false discovery rate < 0.001.

2.9. Primer design and quantitative PCR Primers for the selected genes (Table 2) were designed using primer 3 plus (2.4.2) from RNA-seq data of rohu available on NCBI. Real time PCR was carried out using SYBR Premix kit (Takara) following the manufacturer's protocol. The gene transcripts were amplified under conditions mentioned by Gupta et al. (2018). The samples were normalized against β-actin as reference and expression level of each gene was derived as per the 2–ΔΔCt method. The size of amplicons was verified by electrophoresis of the PCR product on 2% agarose gel. 2.10. Statistical analysis The significance of variation of mean values of the parameters at different time points was determined using Student's t-test. The variation in the control v/s experimental data obtained from qPCR, total immunoglobulin and myeloperoxidase assays, HSP70, blood glucose and serum cortisol was derived by one-way ANOVA followed by Duncan multiple range tests. The values were considered to be significant at the posteriority of P ≤ .05. All values of n-fold differential 5

Aquaculture 521 (2020) 735020

S.K. Gupta, et al.

a

b

Control

Gill Control

30 25

*

*

20

Levan

Fold change expression

Fold change expression

Intestine

**

15 10 5

30

Levan **

25 20 *

15 10

*

*

5 0

0 6

12

24

48

6

96

Time post infection (Hrs)

c

12 24 48 Time post infection (Hrs)

96

Kidney

30

***

25 20

*** **

*

5 0 6

12 24 48 Time post infection (Hrs)

Control

Liver

*

15 10

Levan Fold change expression

Fold change expression

d

Control

96

35 30 25 20 15 10 5 0

**

*

**

6

Levan

*** *

12 24 48 Time post infection (Hrs)

96

Fig. 5. Expression of IFN-β mRNA in (a) Intestine, (b) gill, (c) kidney, and (d) liver relative to β-actin after 60 days of feeding trial with microbial levan supplemented and levan non-supplemented (control) group on different time points viz., 6 h, 12 h, 24 h, 48 h and 96 h post challenge with Aeromonas hydrophila in Labeo rohita fingerlings. Bars represent mean ± SE of three samples. Statistically significant upregulation and downregulation in the expression of mRNA relative to the levan non-supplemented control group. P value as < 0.05 (denoted as *), P value < .001 (denoted as **) and P value < .0001 (denoted as ***).

3. Results

3.4. Expression analysis of TLR22

3.1. Total immunoglobulin level and myeloperoxidase content

Incorporation of levan in the diet of A. hydrophila infected rohu fingerlings led to significant changes in the expression of TLR22 in the intestine, gill, kidney and liver (Fig. 3). In the intestine, a significant increase in the expression of TLR22 was observed at all time points except at 12 h, with the highest upregulation of 2.58-fold at 48 h (Fig. 3a). There was no significant rise in TLR22 in the gill at early time points but its level peaked to 2.21- fold 48 h (Fig. 3b). In the kidney, a significant increase in TLR22 expression was observed at all time points with a maximum of 2.35-fold and 2.32-fold at 24 h and 48 h, respectively (Fig. 3c). In the liver, a constant increase in TLR22 expression was observed from 6 to 48 h which then declined at 96 h (Fig. 3d).

Total immunoglobulin level content of A. hydrophila infected rohu showed a significant increase at 48 h in the levan-fed group, in comparison to the control (Fig. 1a). Contrary to immunoglobulin results, the significant increase in myeloperoxidase content was maintained at all studied time points except at 24 h (Fig. 1b).

3.2. HSP70, cortisol and blood glucose level Table 3 represents the level of stress biomarkers (HSP70, cortisol, glucose) in experimental and control group of rohu. A remarkable decrease in HSP70 was observed in all the selected tissues with minima at 24 h. Although the cortisol content in the control was similar to that of the levan-fed group up to 12 h, a noticeable decrease was recorded at later time points of 24 and 48 h. Parallel to the cortisol, a significant decline in blood glucose in the levan-fed group was observed at 24 and 48 h.

3.5. Expression analysis of β-2 M Significant upregulation in the expression of β-2 M was observed in the intestine, gill, kidney and liver of A. hydrophila challenged, levanfed L. rohita fingerlings (Fig. 4). The highest upregulation of 1.6-fold was noticed at 48 h in the intestine (Fig. 4a). β-2 M expression in the gills was found to be significantly upregulated at later time points of 48 and 96 h (Fig. 4b). The fold change expression of β-2 M was maximal at 24 h in the kidney which was maintained at later time points as well (Fig. 4c). In the liver, the fold change expression of β-2 M increased gradually from 12 h to reach a maximum of 1.6-fold at 96 h (Fig. 4d).

3.3. Survival rate % Survival rate % of levan and experimental group decreased with a consequent increase in time interval post-challenge at various time points. Although survival rate % was higher in the levan fed group on all the time points compared to the control, however, the maximum decrease of survival rate% in both group was noticed at 24 h postchallenge (Fig. 2.)

3.6. Expression analysis of IFN-γ Substantial increase in the expression of IFN-γ has been demonstrated in various immune organs of A. hydrophila aggravated L. rohita fingerlings at different time intervals (Fig. 5). The expression of IFN-γ in 6

Aquaculture 521 (2020) 735020

S.K. Gupta, et al.

Control

50 ***

40 30 20

***

**

*

*

10 0 6

c

12 24 48 Time post infection (Hrs)

Control

Kidney Fold change expression

b

Levan

30 25 20 15 10 5 0

**

*

30

Levan *

** ***

20 10

6 d

**

12 24 48 Time post infection (Hrs)

Control

Gill

40

0

Levan

*

6

96

*

96

12 24 48 Time post infection (Hrs)

Liver Fold change expression

Fold change expression

Intestine

Fold change expression

a

40 35 30 25 20 15 10 5 0

Control

Levan **

*** *

6

96

**

*

12 24 48 Time post infection (Hrs)

96

Fig. 6. Expression of TGF-β mRNA in (a) Intestine, (b) gill, (c) kidney, and (d) liver relative to β-actin after 60 days of feeding trial with microbial levan supplemented and levan non-supplemented (control) group on different time points viz., 6 h, 12 h, 24 h, 48 h and 96 h post challenge with Aeromonas hydrophila in Labeo rohita fingerlings. Bars represent mean ± SE of three samples. Statistically significant upregulation and downregulation in the expression of mRNA relative to the levan non-supplemented control group. P value as < 0.05 (denoted as *), P value < .001 (denoted as **) and P value < .0001 (denoted as ***).

pathways. There was considerable representation of processes (positive regulation of adaptive immune response based on somatic recombination of immune receptors built from immunoglobulin superfamily domains, positive regulation of MHC class II biosynthetic process, positive regulation of T cell-mediated cytotoxicity, positive regulation of T cell cytokine production, positive regulation of lymphocyte-mediated immunity) from adaptive immune pathway, as well in this dataset (Fig. 8).

the intestine increased gradually across early time points and became significantly enhanced 24 h onwards (Fig. 5a). Similar to the intestine, the highest fold change expression of 2.3 was noticed in the gill at the last time point of the experiment (96 h) (Fig. 5b). In the kidney and liver, the maximum upregulation of IFN-γ mRNA was achieved at 6 h and 24 h, respectively (Fig. 5c, d). 3.7. Expression analysis of TGF-β

4. Discussion TGF-β expression analysis displayed significant downregulation in the pathogen challenged rohu, post-feeding with levan diet (Fig. 6). The highest downregulation in TGF-β mRNA of 2.6-fold was observed as early as 6 h (Fig. 6a). Similar to the expression data in the intestine, the fold change expression of TGF-β mRNA in the gill, kidney and liver was found to be minimal at the earliest time points of 6 h (Fig. 6b, c & 6d). The significant decrease of 2.6-fold expression change in TGF-β was noticed in the gill at12h (Fig. 6b), whereas in the kidney and liver, the maximum of 2.3-fold and 2.5 fold was noticed at 48 h (Fig. 6c & 6d).

Among the various prebiotics employed in aquaculture, microbial levan has emerged as a promising candidate owing to its role in the improvement of growth, immunity and intestinal microbiota (Gupta et al., 2008; Hoseinifar et al., 2015; Huang et al., 2015). Recent findings on use of microbial levan, have shown significant upregulation in the transcription of pro-inflammatory cytokines (IL-1β, TNF-α and IL12p40) and downregulation of regulatory cytokine (IL-10) in the intestine, gill, kidney and liver of pathogen-challenged L. rohita fingerlings (Gupta et al., 2018). The present study diminishes the gap in existing knowledge by providing insight into the molecular response of microbial levan-supplemented diet on mRNA expression of selective stress and immune parameters. Several dietary supplements such as lipopolysaccharide,(LPS), peptidoglycan (PGN) and β-glucans contain PAMPs (Pathogen Associated Molecular Patterns) which are used to felicitate immunomodulatory action in fish (Vallejos-Vidal et al., 2016). Due to the ability of β (2 → 1) fructans to activate TLR, our first pick as an immune biomarker for assessing the impact of levan -supplemented diet was TLR22 (Abreu, 2010; Cambi and Figdor, 2003). Our observation of time-dependent change in the expression pattern of TLR22 in multiple organs of pathogen challenged L. rohita suggests that TLR22 upregulation was ubiquitous 24 h onwards. Nevertheless, its expression in both liver and kidney was significantly upregulated at later time points of 24,

3.8. STRING analysis Network prediction using STRING analysis showed that all the 13 genes shared an association at a significant PPI enrichment p-value of 1.0e-16 (Fig. 7). This suggests their contribution to a shared function. The edges of the interaction network were corroborated with evidence from curated databases, experimental determination, text-mining and co-expression. GO enrichment for Biological Process, Cellular Component and Molecular Function included 370, 12 and 9 elements, respectively (Supplementary Tables 1–3). Screening of GO enrichment dataset for Biological Process demonstrated a total of 61 immune-specific processes at a false discovery rate < 0.001 (Supplementary Table 4). Cytokine-related processes were maximally represented in this dataset apart from cell proliferation, differentiation and signaling 7

Aquaculture 521 (2020) 735020

S.K. Gupta, et al.

Increased expression of IFN-γ was observed in the intestine, gill and kidney of levan-fed rohu 24 h onwards. This is in consistent to the findings on impact of prebiotic on IFN-γ expression in Atlantic cod, Gadus morhua (Lokesh et al., 2012); greater amberjack, Seriola dumerili (Fernández-Montero et al., 2019); common carp, Cyprinus carpio (Biswas et al., 2012) and sutchi cat fish, Pangasianodon hypophthalmus (Prabu et al., 2016). Another immune marker, β-2 M, also exhibited a remarkable increase in the intestine and liver, exhibiting a corollary observation from studies on pathogen-challenged rohu (Saurabh et al., 2011), grass carp, Ctenopharyngodon idella (Chang et al., 2005) and Atlantic salmon (Jørgensen et al., 2006). Besides, total immunoglobulin and myeloperoxidase content of serum in levan-fed rohu were significantly enhanced with a gradual increase from 6 h to its peak at 24 h post-infection. The extensive functions of immunoglobulins in defense-related activities such as limiting the dispersal of infectious agents, killing of microbes and other potential pathogens, and restoration of the healthy state (Kumar and Singh, 2019) are well established. Inulin-fed leopard grouper, Mycteroperca rosacea, has also been shown to exhibit enhanced lysozyme activity, IgM level and myeloperoxidase activity (ReyesBecerril et al., 2014). The enhanced level of both IgM and myeloperoxidase content suggested that levan incorporation in infected rohu might have triggered the activation of phagocytic cell population which in turn produced the antibody response. Therefore, the coherence of the existing literature with the present findings clearly suggest the ability of microbial levan to activate the immune system at dietary supplementation of 12.5 g kg−1. The increased expression of TLR22, IFN-γ, and β-2 M in this study indicates that the levan-fed infected rohu possessed enhanced immunity, which may help with the recognition and resistance to pathogens (Zhang et al., 2018). This advocates that prebiotic levan might promote the growth of probiotics, thus bearing potential for augmenting host health by upregulation of various proinflammatory and regulatory genes in the lymphoid organs. Therefore, incorporation of levan in the diet might help in combating pathogenic outbreaks of A. hydrophila resulting in higher survival rate%. Known for its immune-modulatory role, TGF-β inhibits B and T-cell propagation and differentiation, antagonizes pro-inflammatory cytokines (IL-1 β, TNF-α, and IFN-γ), and blocks the expression of IL-1 β and IL-12 receptors (Devi et al., 2019). The relative TGF-β mRNA expression was downregulated in all the lymphoid organs of levan-fed infected rohu in this experiment. Maximum downregulation was observed in the intestine during early time points. Being a regulatory anti-inflammatory cytokine, its decreased expression might be contributing to upregulated expression levels of other pro-inflammatory genes in this study. Torrecillas et al. (2014) have also reported attenuation of TGFβ expression in the posterior gut of European sea bass, Dicentrarchus labrax juveniles fed with prebiotic mannan-oligosaccharides diet. Contrary to this, Qin et al. (2014) have reported upregulated expression of TGFβ in the intestine of tilapia fed with chito-oligosaccharides supplemented diet. In conjunction with this, Devi et al. (2019) also reported the downregulation of TGF-β gene in the HK leucocytes of L. rohita fed with prebiotic, galactooligosaccharides (GOS) supplemented diet. This inconsistency of results is interesting as it points towards the specific impact of prebiotic and their dose on regulation of immunomodulation parameters. Thus, modulation of the above immune responsive genes in the levan-fed infected rohu might be playing a significant role in combatting A. hydrophila pathogenesis and survival rate %. The stress biomarkers such as blood glucose, heat shock protein70 (HSP70) and cortisol are critical indices to measure the stress level in the biological systems (Kumar et al., 2017). In the present investigation, the elevated level of HSP70 in the control group was noticed at all-time points, however with supplementation of microbial levan, HSP70 levels in the muscle, gill and liver declined. The role of levan towards downregulating HSP70 may be attributed to cytokine-mediated modulation. In line with our findings, a significant reduction in the mRNA

Fig. 7. Evidence of interaction network among the 13 selected genes generated by STRING analysis. The colored edges on the figure indicate the source of evidence for interaction: Blue edges - interaction derived from curated databases; Pink edges - experimentally determined interaction; Green edges – interaction derived from text mining; Black edges - interaction derived from coexpression. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

48 and 96 h post-challenge. Our finding is consistent with studies conducted on euryhaline teleost Asian sea bass, Lates calcarifer (Paria et al., 2018) and barbel chub, Squaliobarbus curriculus (Wang et al., 2017), where enhanced TLR22 expression was reported in the kidney and liver in response to bacterial and viral infections, respectively. Time-dependent upregulation of intestinal TLR22 in Ya-fish, Schizothorax prenanti has been reported in response to diet supplemented with 1.6% (g kg−1) konjac oligosaccharide (KOS) (Chen et al. (2019). Synbiotic (Pediococcus acidilactici and short-chain fructooligosaccharides) diet supplementation has shown to increase TLR3 expression in the intestine of Atlantic salmon, Salmo salar (Abid et al., 2013). Since TLR22 and TLR3 are known to share the same ligand (dsRNA) (Sahoo et al., 2015), it suggests that microbe-derived prebiotics present nucleic acid MAMPs to the host TLR network for boosting immunity. It is speculated that activation of TLR22 could trigger its signaling pathway for transcription of downstream genes resulting in secretion of pro-inflammatory cytokines (IL-1β, TNF-α), which is in agreement with our previous study (Gupta et al., 2018). The major biological activity of type II IFNs (IFN γ) seems to be immunomodulatory (Zhou et al., 2007). IFN-γ is implicated in removal of intracellular pathogens by stimulating macrophage-mediated phagocytosis, macrophage secretion of pro-inflammatory cytokines, and antimicrobial oxygen radicals (Schoenborn and Wilson, 2007). 8

Aquaculture 521 (2020) 735020

S.K. Gupta, et al.

Fig. 8. Observed gene count of manually screen immune-47 specific processes from GO- enrichment data of Biological Processes generated from STRING analysis for interaction evidence.

Increased expression of mRNA mediated pro-inflammatory cytokines TLR22, β-2 M, IFN-γ, and downregulation of anti-inflammation regulatory cytokine TGF-β was observed due to dietary supplementation of microbial levan at 1.25% in the intestine, gill, kidney and liver of A. hydrophila infected L. rohita fingerlings. This finding on the modulation of immune responsive gene and stress parameters garners robust evidence on advocating the usage of microbial levan as a dietary prebiotic supplement in aquaculture practices. Supplementary data to this article can be found online at https:// doi.org/10.1016/j.aquaculture.2020.735020.

level of HSP70 was noticed in tilapia and rainbow trout fed with prebiotics (Yarahmadi et al., 2014; Standen et al., 2016). HSPs are involved in amending confirmation and assembly of vital proteins which is essential for the regulation of the level of a transcript, in our case which may be the immune markers. Cortisol is a corticosteroid that is highly conserved among the vertebrates and is essential for coordinating energy dynamics for maintenance of homeostasis under stress therefore, it could be considered as a biomarker for functional alterations in the hypothalamic-pituitary-internal axis (Weyts et al., 1999). In our study, cortisol level was elevated in the group fed on control diet at all time-points post-bacterial challenge, however, the level of cortisol was reduced with the application of levan 12.5 g kg−1 in the diet. The mechanism underlying the decline of cortisol level is not clear; however, it is tempting to postulate that cortisol may reach the receptors in the target cells containing microsomal 11β-hydroxysteroid dehydrogenase which reversibly deactivates it to cortisone (Buckingham, 2006; Fink, 2010). We found that the level of blood glucose in infected rohu was higher in fish fed on control diet on various time points. The blood glucose and cortisol level are interdependent and enhanced level may be attributed to excess glycogenolysis, gluconeogenesis and enhanced secretion of catecholamine (Iwama et al., 1999). Significant improvement in A. hydrophila challenged rohu fed on the experimental diet indicates the stress ameliorating property of levan (Gupta et al., 2014). Thus, it clearly describes why fish in the levan fed group possessed a higher survival rate% following bacterial infection. STRING analysis strongly suggests the close association of the 13 selected parameters from the two-part of study (Gupta et al., 2018). The immune-specific processes screened from GO enrichment dataset of Biological process shows a strong network of processes from both innate and adaptive pathways which further corroborates our experimental finding on the effect of microbial levan supplemented diet on the immunity of L. rohita fingerlings. This analysis also paves the way for designing further studies to explore the molecular basis of immunoprotective action of microbial levan.

Declaration of Competing Interest Authors declare no conflict of interest. Acknowledgments The research was supported by the Institutional Fund (Project codeIXX12206) of ICAR-Indian Institute of Agricultural Biotechnology, Ranchi. Authors are indebted to the staff of the school of molecular diagnostics and prophylactics of IIAB for their research cooperation and technical assistance. References Abid, A., Davies, S.J., Waines, P., Emery, M., Castex, M., Gioacchini, G., Carnevali, O., Bickerdike, R., Romero, J., Merri, D.L., 2013. Fish & Shell Fish Immunology Dietary Synbiotic Application Modulates Atlantic Salmon (Salmo salar) Intestinal Microbial Communities and Intestinal Immunity. https://doi.org/10.1016/j.fsi.2013.09.039. Abreu, M.T., 2010. Toll-like receptor signalling in the intestinal epithelium: how bacterial recognition shapes intestinal function. Nat. Rev. Immunol. 10, 131–143. https://doi. org/10.1038/nri2707. Ahmed, K.B.A., Kalla, D., Uppuluri, K.B., Anbazhagan, V., 2014. Green synthesis of silver and gold nanoparticles employing levan, a biopolymer from Acetobacter xylinum NCIM 2526, as a reducing agent and capping agent. Carbohydr. Polym. 112, 539–545. Bindels, L.B., Delzenne, N.M., Cani, P.D., Walter, J., 2015. Opinion: towards a more comprehensive concept for prebiotics. Nat. Rev. Gastroenterol. Hepatol. 12, 303–310. https://doi.org/10.1038/nrgastro.2015.47. Biswas, G., Korenaga, H., Takayama, H., Kono, T., Shimokawa, H., Sakai, M., 2012. Cytokine responses in the common carp, Cyprinus carpio L. treated with baker’s yeast extract. Aquaculture 356–357, 169–175. https://doi.org/10.1016/j.aquaculture. 2012.05.019. Buckingham, J.C., 2006. Glucocorticoids: exemplars of multi-tasking. Brit J Pharmacol

5. Conclusion Overall, the results of the present investigation demonstrate the health-promoting and anti-stress character of dietary microbial levan. 9

Aquaculture 521 (2020) 735020

S.K. Gupta, et al.

Iwama, G.K., Mathilakath, M., Vijayan, M.M., Forsyth, R.B., AcKerman, P.A., 1999. Heat shock proteins and physiological stress in fish. Am. Zool. 39, 901–909. Jørgensen, S.M., Lyng-Syvertsen, B., Lukacs, M., Grimholt, U., Gjøen, T., 2006. Expression of MHC class I pathway genes in response to infectious salmon anaemia virus in Atlantic salmon (Salmo salar L.) cells. Fish Shellfish Immunol. 21, 548–560. https:// doi.org/10.1016/j.fsi.2006.03.004. Jose Meseguer, R.C., 2011. Current knowledge in Synbiotic use for fish aquaculture: a review. J. Aquac. Res. Dev. s1, 1–7. https://doi.org/10.4172/2155-9546.s1-008. Kumar, N., Singh, N.P., 2019. Effect of dietary selenium on immuno-biochemical plasticity and resistance against Aeromonas veronii biovar sobria in fish reared under multiple stressors. Fish Shellfish Immunol. 84, 38–47. https://doi.org/10.1016/j.fsi. 2018.09.065. Kumar, N., Krishnani, K.K., Kumar, P., Jha, A.K., Gupta, S.K., Singh, N.P., 2017. Dietary zinc promotes immuno-biochemical plasticity and protects fish against multiple stresses. Fish Shellfish Immunol. 62, 184–194. https://doi.org/10.1016/j.fsi.2017. 01.017. Litwin, B.V., Gumperz, J., Parham, P., Phillips, J.H., Lanier, L.L., 1993. Joseph H. Phillips,* and Lewis L. Lanier* 178. Lokesh, J., Fernandes, J.M.O., Korsnes, K., Bergh, Ø., Brinchmann, M.F., Kiron, V., 2012. Transcriptional regulation of cytokines in the intestine of Atlantic cod fed yeast derived mannan oligosaccharide or β-Glucan and challenged with Vibrio anguillarum. Fish Shellfish Immunol. 33, 626–631. https://doi.org/10.1016/j.fsi.2012.06.017. Mashoof, S., Criscitiello, M., 2016. Fish Immunoglobulins. Biology (Basel). 5, 45. https:// doi.org/10.3390/biology5040045. Matsuo, A., Oshiumi, H., Tsujita, T., Mitani, H., Kasai, H., Yoshimizu, M., Matsumoto, M., Seya, T., 2008. Teleost TLR22 recognizes RNA duplex to induce IFN and protect cells from Birnaviruses. J. Immunol. 181, 3474–3485. https://doi.org/10.4049/jimmunol. 181.5.3474. Mohanty, B.R., Sahoo, P.K., 2010. Immune responses and expression profiles of some immune-related genes in Indian major carp, Labeo rohita to Edwardsiella tarda infection. Fish Shellfish Immunol. 28, 613–621. https://doi.org/10.1016/j.fsi.2009.12. 025. Nelson, N., 1944. A photometric adaptation of the Somogyi method for the determination of glucose. J. Biol. Chem 153, 375–380. Öner, E.T., Hernández, L., Combie, J., 2016. Review of Levan polysaccharide: from a century of past experiences to future prospects. Biotechnol. Adv. 34, 827–844. https://doi.org/10.1016/j.biotechadv.2016.05.002. Oshiumi, H., Tsujita, T., Shida, K., Matsumoto, M., Seya, T., Ikeo, K., 2003. Prediction of the prototype of the human toll-like receptor gene family from the pufferfish, Fugu rubripes, genome. Immunogenetics 54, 791–800. https://doi.org/10.1007/s00251002-0519-8. Paria, A., Makesh, M., Chaudhari, A., Purushothaman, C.S., Rajendran, K.V., 2018. Tolllike receptor (TLR) 22, a non-mammalian TLR in Asian seabass, Lates calcarifer : characterisation, ontogeny and inductive expression upon exposure with bacteria and ligands. Dev. Comp. Immunol. 81, 180–186. https://doi.org/10.1016/j.dci.2017.11. 021. Prabu, D.L., Sahu, N.P., Pal, A.K., Dasgupta, S., Narendra, A., 2016. Immunomodulation and interferon gamma gene expression in sutchi cat fish, Pangasianodon hypophthalmus: effect of dietary fucoidan rich seaweed extract (FRSE) on pre and post challenge period. Aquac. Res. 47, 199–218. https://doi.org/10.1111/are.12482. Qin, C., Zhang, Y., Liu, W., Xu, L., Yang, Y., Zhou, Z., 2014. Effects of chito-oligosaccharides supplementation on growth performance, intestinal cytokine expression, autochthonous gut bacteria and disease resistance in hybrid tilapia Oreochromis niloticus ♀×Oreochromis aureus ♂. Fish Shellfish Immunol. 40, 267–274. https://doi. org/10.1016/j.fsi.2014.07.010. Quade, M.J., Roth, J.A., 1997. A rapid, direct assay to measure degranulation of bovine neutrophil primary granules. Vet. Immunol. Immunopathol. 58, 239–248. https:// doi.org/10.1016/S0165-2427(97)00048-2. Rairakhwada, D., Pal, A.K., Bhathena, Z.P., Sahu, N.P., Jha, A., Mukherjee, S.C., 2007. Dietary microbial levan enhances cellular non-specific immunity and survival of common carp (Cyprinus carpio) juveniles. Fish Shellfish Immunol. 22, 477–486. https://doi.org/10.1016/j.fsi.2006.06.005. Reyes-Becerril, M., Ascencio, F., Gracia-Lopez, V., Macias, M.E., Roa, M.C., Esteban, M.Á., 2014. Single or combined effects of Lactobacillus sakei and inulin on growth, nonspecific immunity and IgM expression in leopard grouper (Mycteroperca rosacea). Fish Physiol. Biochem. 40, 1169–1180. https://doi.org/10.1007/s10695-014-9913-z. Sahoo, B.R., Dikhit, M.R., Bhoi, G.K., Maharana, J., Lenka, S.K., Dubey, P.K., Tiwari, D.K., 2015. Understanding the distinguishable structural and functional features in zebrafish TLR3 and TLR22, and their binding modes with fish dsRNA viruses: an exploratory structural model analysis. Amino Acids 47, 381–400. https://doi.org/10. 1007/s00726-014-1872-2. Saurabh, S., Mohanty, B.R., Sahoo, P.K., 2011. Expression of immune-related genes in rohu Labeo rohita (Hamilton) by experimental freshwater lice Argulus siamensis (Wilson) infection. Vet. Parasitol. 175, 119–128. https://doi.org/10.1016/j.vetpar. 2010.10.001. Schoenborn, J.R., Wilson, C.B., 2007. Regulation of interferon-γ during innate and adaptive immune responses. Adv. Immunol. 96, 41–101. https://doi.org/10.1016/ S0065-2776(07)96002-2. Siwicki, A.K., Anderson, D.P., 1993. An easy spectrophotometric assay for determining total protein and immunoglobulin levels in fish sera: correlation to fish health. Tech Fish Immunol 3, 23–30. Srikanth, R., Siddartha, G., Reddy, C.H.S., Harish, B.S., Ramaiah, M.J., Uppuluri, K.B., 2015a. Antioxidant and anti-inflammatory levan produced from Acetobacterxylinum NCIM2526 and its statistical optimization. Carbohydr. Poly. 123, 8–16. Srikanth, R., Reddy, C.H.S.S.S., Siddartha, G., Ramaiah, M.J., Uppuluri, K.B., 2015b. Review on production, characterization and applications of microbial levan.

147 (1), 258–268. Cai, Z., Gao, C., Li, L., Xing, K., 2010. Bipolar properties of red seabream (Pagrus major) transforming growth factor-β in induction of the leucocytes migration. Fish Shellfish Immunol. 28, 695–700. https://doi.org/10.1016/j.fsi.2010.01.011. Cambi, A., Figdor, C.G., 2003. Dual function of C-type lectin-like receptors in the immune system. Curr. Opin. Cell Biol. 15, 539–546. https://doi.org/10.1016/j.ceb.2003.08. 004. Castro, R., Piazzon, M.C., Noya, M., Leiro, J.M., Lamas, J., 2008. Isolation and molecular cloning of a fish myeloperoxidase. Mol. Immunol. 45, 428–437. https://doi.org/10. 1016/j.molimm.2007.05.028. Cerezuela, R., Meseguer, J., Esteban, M.Á., 2013. Effects of dietary inulin, Bacillus subtilis and microalgae on intestinal gene expression in gilthead seabream (Sparus aurata L.). Fish Shellfish Immunol. 34, 843–848. https://doi.org/10.1016/j.fsi.2012.12.026. Chang, M.X., Nie, P., Liu, G.Y., Song, Y., Gao, Q., 2005. Identification of immune genes in grass carp Ctenopharyngodon idella in response to infection of the parasitic copepod Sinergasilus major. Parasitol. Res. 96, 224–229. https://doi.org/10.1007/s00436005-1340-8. Chen, W., Jia, Z., Zhang, T., Zhang, N., Lin, C., Gao, F., Wang, L., Li, X., Jiang, Y., Li, X., Gao, G.F., Xia, C., 2010. MHC class I presentation and regulation by IFN in bony fish determined by molecular analysis of the class I locus in grass carp. J. Immunol. 185, 2209–2221. https://doi.org/10.4049/jimmunol.1000347. Chen, M., Wu, Y., Yan, Q., Zhao, J., Feng, L., He, M., Lv, Z., 2019. Effects of dietary konjac oligosaccharide supplementation on serum immune parameters and intestinal immunity of Schizothorax prenanti. Fish. Sci. 85, 157–165. https://doi.org/10.1007/ s12562-018-1252-z. Dawood, M.A.O., Koshio, S., Esteban, M.Á., 2018. Beneficial roles of feed additives as immunostimulants in aquaculture: a review. Rev. Aquac. 10, 950–974. https://doi. org/10.1111/raq.12209. Devi, G., Harikrishnan, R., Paray, B.A., Al-Sadoon, M.K., Hoseinifar, S.H., Balasundaram, C., 2019. Effect of symbiotic supplemented diet on innate-adaptive immune response, cytokine gene regulation and antioxidant property in Labeo rohita against Aeromonas hydrophila. Fish Shellfish Immunol. 89, 687–700. https://doi.org/10.1016/j.fsi.2019. 04.036. Ding, X., Liang, Y., Peng, W., Li, R., Lin, H., Zhang, Y., Lu, D., 2018. Intracellular TLR22 acts as an inflammation equalizer via suppression of NF-κB and selective activation of MAPK pathway in fish. In: Fish and Shellfish Immunology. Elsevier Ltd. https://doi. org/10.1016/j.fsi.2017.11.042. Fernández-Montero, Á., Torrecillas, S., Izquierdo, M., Caballero, M.J., Milne, D.J., Secombes, C.J., Sweetman, J., Da Silva, P., Acosta, F., Montero, D., 2019. Increased parasite resistance of greater amberjack (Seriola dumerili Risso 1810) juveniles fed a cMOS supplemented diet is associated with upregulation of a discrete set of immune genes in mucosal tissues. Fish Shellfish Immunol. 86, 35–45. https://doi.org/10. 1016/j.fsi.2018.10.034. Fink, G., 2010. Stress science: neuroendocrinology. Elselvier Inc., Oxford. Gupta, S.K., Pal, A.K., Sahu, N.P., Dalvi, R., Kumar, V., Mukherjee, S.C., 2008. Microbial Levan in the diet of Labeo rohita Hamilton juveniles: effect on non-specific immunity and histopathological changes after challenge with Aeromonas hydrophila. J. Fish Dis. 31, 649–657. https://doi.org/10.1111/j.1365-2761.2008.00939.x. Gupta, S.K., Pal, A.K., Sahu, N.P., Dalvi, R.S., Akhtar, M.S., Jha, A.K., Baruah, K., 2010. Dietary microbial Levan enhances tolerance of Labeo rohita (Hamilton) juveniles to thermal stress. Aquaculture 306, 398–402. https://doi.org/10.1016/j.aquaculture. 2010.06.008. Gupta, S.K., Pal, A.K., Sahu, N.P., Jha, A.K., Akhtar, M.S., Mandal, S.C., Das, P., Prusty, A.K., 2013. Supplementation of microbial Levan in the diet of Cyprinus carpio fry (Linnaeus, 1758) exposed to sublethal toxicity of fipronil: effect on growth and metabolic responses. Fish Physiol. Biochem. 39, 1513–1524. https://doi.org/10.1007/ s10695-013-9805-7. Gupta, S.K., Pal, A.K., Sahu, N.P., Saharan, N., Mandal, S.C., Prakash, C., Akhtar, M.S., Prusty, A.K., 2014. Dietary microbial levan ameliorates stress and augments immunity in Cyprinus carpio fry (Linnaeus, 1758) exposed to sublethal toxicity of fipronil. Aquac. Res. 45, 893–906. https://doi.org/10.1111/are.12030. Gupta, S.K., Pal, A.K., Sahu, N.P., Jha, A.K., Kumar, S., 2015. Effects of dietary microbial Levan on growth performance, RNA/DNA ratio and some physio-biochemical responses of Labeo rohita (Hamilton) juveniles. Aquac. Nutr. 21, 892–903. https://doi. org/10.1111/anu.12216. Gupta, S.K., Sarkar, B., Bhattacharjee, S., Kumar, N., Naskar, S., Uppuluri, K.B., 2018. Modulation of cytokine expression by dietary Levan in the pathogen aggravated rohu, Labeo rohita fingerlings. Aquaculture 495, 496–505. https://doi.org/10.1016/j. aquaculture.2018.06.025. Harms, C.A., Kennedy-Stoskopf, S., Horne, W.A., Fuller, F.J., Tompkins, W.A.F., 2000. Cloning and sequencing hybrid striped bass (Morone saxatilis x M. chrysops) transforming growth factor-β (TGF-β), and development of a reverse transcription quantitative competitive polymerase chain reaction (RT-qcPCR) assay to measure TGF-β mRNA of teleo. Fish Shellfish Immunol. 10, 61–85. https://doi.org/10.1006/fsim. 1999.0230. Hoseinifar, S.H., Esteban, M., Cuesta, A., Sun, Y.Z., 2015. Prebiotics and fish immune response: a review of current knowledge and future perspectives. Rev. Fish. Sci. Aquac. 23, 315–328. https://doi.org/10.1080/23308249.2015.1052365. Hoseinifar, S.H., Dadar, M., Khalili, M., Cerezuela, R., Esteban, M.Á., 2016. Effect of dietary supplementation of palm fruit extracts on the transcriptomes of growth, antioxidant enzyme and immune-related genes in common carp (Cyprinus carpio) fingerlings. Aquac. Res. 48, 3684–3692. https://doi.org/10.1111/are.13192. Huang, M.Y., Chang, C.I., Chang, C.C., Tseng, L.W., Pan, C.L., 2015. Effects of dietary Levan on growth performance, nonspecific immunity, pathogen resistance and body composition of orange-spotted grouper (Epinephelus coioides H.). Aquac. Res. 46, 2752–2767. https://doi.org/10.1111/are.12430.

10

Aquaculture 521 (2020) 735020

S.K. Gupta, et al.

Reciprocal interaction between fish TGF-β1 and IL-1β is responsible for restraining IL-1β signaling activity in grass carp head kidney leukocytes. Dev. Comp. Immunol. 47, 197–204. https://doi.org/10.1016/j.dci.2014.07.023. Yarahmadi, P., Kolangi Miandare, H., Farahmand, H., Mirvaghefi, A., Hoseinifar, S.H., 2014. Dietary fermentable fiber upregulated immune related genes expression, increased innate immune response and resistance of rainbow trout (Oncorhynchus mykiss) against Aeromonas hydrophila. Fish Shellfish Immunol. 41, 326–331. https:// doi.org/10.1016/j.fsi.2014.09.007. Yarahmadi, P., Ghafari Farsani, H., Khazaei, A., Khodadadi, M., Rashidiyan, G., Jalali, M.A., 2016. Protective effects of the prebiotic on the immunological indicators of rainbow trout (Oncorhynchus mykiss) infected with Aeromonas hydrophila. Fish Shellfish Immunol. 54, 589–597. https://doi.org/10.1016/j.fsi.2016.05.010. Zduńczyk, Z., Pareek, C., 2009. Application of nutrigenomics tools in animal feeding and nutritional research. J. Anim. Feed Sci. 18, 3–16. https://doi.org/10.22358/jafs/ 66361/2009. Zhang, D.X., Kang, Y.H., Chen, L., Siddiqui, S.A., Wang, C.F., Qian, A.D., Shan, X.F., 2018. Oral immunization with recombinant Lactobacillus casei expressing OmpAI confers protection against Aeromonas veronii challenge in common carp, Cyprinus carpio. In: Fish and Shellfish Immunology. Elsevier Ltd. https://doi.org/10.1016/j.fsi.2017.10. 043. Zhou, Z., Nielsen, A.L., Hamming, O.J., Hartmann, R., Ank, N., Paludan, S.R., 2007. Type III interferon (IFN) induces a type I IFN-like response in a restricted subset of cells through signaling pathways involving both the Jak-STAT pathway and the mitogenactivated protein kinases. J. Virol. 81, 7749–7758. https://doi.org/10.1128/JVI. 02438-06.

Carbohydr. Polym. 120, 102–114. Standen, B.T., Peggs, D.L., Rawling, M.D., Foey, A., Davies, S.J., Santos, G.A., Merrifield, D.L., 2016. Dietary administration of a commercial mixed-species probiotic improves growth performance and modulates the intestinal immunity of tilapia, Oreochromis niloticus. Fish Shellfish Immunol. 49, 427–435. https://doi.org/10.1016/j.fsi.2015. 11.037. Somoyogi, M., 1945. A new reagent for the determination of sugars. J. Biol. Chem 160, 61–68. Swain, B., Basu, M., Lenka, S.S., Das, S., Jayasankar, P., Samanta, M., 2015. Characterization and inductive expression analysis of interferon gamma-related gene in the Indian major carp, Rohu (Labeo rohita). DNA Cell Biol. 34, 367–378. https:// doi.org/10.1089/dna.2014.2656. Torrecillas, S., Montero, D., Izquierdo, M., 2014. Improved health and growth of fish fed mannan oligosaccharides: potential mode of action. Fish Shellfish Immunol. 36, 525–544. https://doi.org/10.1016/j.fsi.2013.12.029. Vallejos-Vidal, E., Reyes-López, F., Teles, M., MacKenzie, S., 2016. The response of fish to immunostimulant diets. Fish Shellfish Immunol. 56, 34–69. https://doi.org/10.1016/ j.fsi.2016.06.028. Wang, W., Sun, J., Liu, C., Xue, Z., 2017. Application of immunostimulants in aquaculture: current knowledge and future perspectives. Aquac. Res. 48, 1–23. https:// doi.org/10.1111/are.13161. Weyts, F.A.A., Cohen, N., Flik, G., Verburg-van Kemenade, B.M.L., 1999. Interactions between the immune system and the hypothalamo-pituitary-interrenal axis in fish. Fish Shellfish Immunol. 9, 1–20. https://doi.org/10.1006/fsim.1998.0170. Yang, X., Wei, H., Qin, L., Zhang, S., Wang, X., Zhang, A., Du, L., Zhou, H., 2014.

11