Inflammatory cytokines stimulate vascular smooth muscle cells locomotion and growth by enhancing α5β1 integrin expression and function

Atherosclerosis 154 (2001) 377– 385 www.elsevier.com/locate/atherosclerosis

Inflammatory cytokines stimulate vascular smooth muscle cells locomotion and growth by enhancing a5b1 integrin expression and function Giovanni Barillari a,*, Loredana Albonici a, Sandra Incerpi b, Laura Bogetto b, Giuseppa Pistritto a, Antonio Volpi a, Barbara Ensoli c, Vittorio Manzari a a

Department of Experimental Medicine, Uni6ersity ‘Tor Vergata’, 00133 Rome, Italy b Department of Biology, Uni6ersity ‘Tor Vergata’, 00133 Rome, Italy c Istituto Superiore di Sanita`, 00161 Rome, Italy

Received 8 November 1999; received in revised form 29 March 2000; accepted 17 April 2000

Abstract The formation of atherosclerotic lesions requires the migration of vascular smooth muscle cells from the media into the intima of the artery and their proliferation. These events, which are preceded and accompanied by inflammation, are modulated by integrin receptors linking vascular smooth muscle cells to extracellular matrix molecules. Among them, fibronectin induces vascular smooth muscle cells to acquire the phenotype they show in the atherosclerotic plaque. Here we show that amounts of interleukin-1 b, tumor necrosis factor a and interferon-g as possibly released by activated immune cells infiltrating atherosclerotic lesions, upregulate vascular smooth muscle cell expression of the a5b1 integrin, a fibronectin receptor. This improves vascular smooth muscle cell capability of migrating toward soluble or anchored fibronectin and of adhering to immobilized fibronectin. The latter effect, in turn, augments vascular smooth muscle cell proliferative response to mitogens, as suggested by the increase of intracellular pH. Finally, the effects that inflammatory cytokines have on vascular smooth muscle cell locomotion and growth, are specifically blocked by anti-a5b1 antibodies. As fibronectin and a5b1 levels are augmented in vivo in the atherosclerotic plaques, these findings support the use of integrin antagonists as potential adjuvants in atherosclerosis treatment. © 2001 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Atherogenesis; Inflammation; Fibronectin; Integrins; Integrin antagonists

1. Introduction Migration of vascular smooth muscle cells (VSMC) from the media to the intima and proliferation of intimal VSMC are key early events in atherosclerotic lesion development [1]. Although triggered by soluble chemotactic and growth factors, cellular migration and growth are modulated by the interactions occurring between cells and extracellular matrix molecules [2].

Abbre6iations: bFGF, basic fibroblast growth factor; IFN, interferon; IL, interleukin; pHi, intracellular pH; TNF, tumor necrosis factor; VSMC, vascular smooth muscle cells. * Corresponding author. Tel.: + 39-06-72596510; fax: +39-0672596506.

It is of interest that one of the characteristics that accompanies atherosclerotic lesion development is a dramatic change in the composition of the extracellular matrix of the vascular wall. This is expressed by a marked increase in fibronectin, a blood vessel wall component that is necessary for the integrity of the vasculature [3]. The fibronectin increase occurring in atherogenesis is due both to the augmented fibronectin synthesis by vascular cells and to the deposition of soluble, plasmatic fibronectin on damaged endothelial membrane [3,4]. Fibronectin has profounds effects on VSMC physiology. In particular, when normal VSMC are plated on fibronectin they switch from the ‘contractile’, non-proliferative phenotype to the ‘synthetic’, highly proliferative phenotype, which is the same as shown by VSMC

0021-9150/01/$ - see front matter © 2001 Elsevier Science Ireland Ltd. All rights reserved. PII: S0021-9150(00)00506-2

378

G. Barillari et al. / Atherosclerosis 154 (2001) 377–385

in atherosclerotic plaques [3]. In fact, VSMC seeded on fibronectin quickly reach confluence, which is in agreement with the fact that in vivo VSMC proliferate both in the media and in the intima, where immobilized fibronectin is found [3,4]. These findings are consistent with VSMC proliferation occurring in malignant hypertension, where high amounts of plasma fibronectin are deposited in the wall of small arteries [5]. Interestingly, matrixes rich in fibronectin also promote VSMC calcification, a key feature in atherosclerotic lesion development [6]. As for other extracellular matrix molecules, the interactions between fibronectin and the cells are mediated by membrane receptors belonging to the integrin family [2]. Among them, the a5b1 integrin, which is expressed by VSMC both in vitro [7] and in vivo [8], is considered to be the main fibronectin receptor, since it mediates most of fibronectin biological activities. In particular, a5b1 triggering by soluble or anchored fibronectin promotes cellular locomotion [9], while a5b1 binding to immobilized fibronectin induces cellular adhesion and spreading, supporting cell survival and modulating cellular response to growth factors [10,11]. During atherogenesis, VSMC locomotion and growth are preceded and followed by an inflammatory response [1,12,13]. Since integrin expression and function are deeply influenced by inflammatory cytokines [14,15], in this study we examined a5b1 expression and function in VSMC exposed to concentrations of inflammatory cytokines as released by activated immune cells.

2. Materials and methods

2.1. Reagents Human recombinant interleukin (IL)-1 a and b, IL-2, IL-6, tumor necrosis factor (TNF)a and b, interferon (IFN)-g, granulocyte monocyte-colony stimulating factor (GM-CSF), basic fibroblast growth factor (bFGF) and fibronectin (from human plasma) were purchased from Boehringer –Mannheim (Mannheim, Germany). Laminin (from human placenta) and bovine serum albumine (BSA, fraction V) were from Sigma (St. Louis, MO). The monoclonal antibodies directed against the whole a5b1 integrin or the b1 chain were from Chemicon (Temecula, CA).

2.2. Cell culture Three different strains of VSMC derived from human aorta arteria were obtained as previously described [16] and cultured in RPMI 1640, 15% fetal bovine serum, 100 U/ml of penicillin G sodium, 100 mg/ml streptomycin sulphate, 0.25 mg/ml amphotericin (LifeTechnologies Inc., Eragny, France) and 45 mg/ml of bovine

pituitary gland extract (Collaborative Research Inc., Bedford, MA). Peripheral blood mononuclear cells were isolated from normal donors and activated with 2 mg/ml of phytohemagglutinin (PHA, Boehringer, Mannheim) for 12–16 h. Conditioned media were collected 2, 4, 6 and 8 days post-activation and employed to activate VSMC. The concentration of each cytokine in conditioned media of PHA-activated peripheral blood mononuclear cells obtained from different donors was evaluated by ELISA. Commercially available ELISA kits were used for cytokine determination: IL-1 (a and b), IL-2, IL-6, GM-CSF and TNF (a and b) ELISA kits were from R&D. Systems (Minneapolis, MN), IFN-g ELISA kit was from Genzyme (Cambridge, MA). Prior to RNA analysis, immunohistochemistry, pHi determination, and migration, adhesion and growth assays, VSMC were cultured for 12, 24, 48 or 96 h, 6 or 10 days without cytokines, with conditioned media of PHA-activated peripheral blood mononuclear cells diluted 1:4 in growth medium or with human recombinant inflammatory cytokines employed, alone or in combination, at average concentrations as found in the conditioned media.

2.3. Northern blot analysis Total RNA was extracted from VSMC with RNAzol (Life Technologies) and subjected to electrophoresis (10 mg/lane) on 1% agarose, 2.2 M formaldehyde, 0.02 sodium acetate gels. Blots were transfered to hybond-N membrane (Amersham Int., Buckinghamshire, England) and hybridized with rapid hybridization buffer (Amersham) by 32P labeled probes. The a5, b1 and stromelysin-1 [17] probes were polymerase chain reaction (PCR) products obtained from human lymphocytes RNA using an RNA PCR kit (Perkin Elmer, Roche Mol. System, Branchburg, NJ). The sequence of the a5 primers are as follows: 5% AATTTGACAGCAAAGGCTCTCGGC 3% and 5% GTCTGAGCC ATTAAGGATGGTGAC 3% (Gene Bank™ accessory no. X06256). The sequence of the b1 primers are as follows: 5% GTGGAGAATGTATACAAGCAGGGC 3% and 5% TTCCTGAGC TTA GCTGGTGTTG TG 3% (Gene Bank™ accessory no. X07979). The sequence of the stromelysin-1 primers are as follows: 5% TTGCTCAGCCTATCCATTGGATGG 3% and 5% TATCAGCTTCTC CATACAGCC 3% (Gene Bank™ accessory no. J05070). In order to control the loading and transfer of RNAs, these were hybridized to a GAPDH probe. The sequence of GAPDH primers was: 5% TGTTCGTCATGGGTGTGAACCATG 3% and 5% CTG CTTCACCACCTTCTGATGTC 3% (Gene Bank™ accessory no. M33197).

G. Barillari et al. / Atherosclerosis 154 (2001) 377–385

Primers were purchased from Life Technologies. To confirm the identity of PCR bands, these were sequenced. The PCR products were first purified with a Qiaquick PCR purification kit (Qiagen, Chatsworth, CA) and then sequenced using a Termosequenase kit (Amersham, Madison, WI). The a6 oligodeoxynucleotide, corresponding to the sequence 2174 –2213 of the extracellular domain of the a6 chain (Gene Bank™ accessory no. X53586), and the collagenase IV oligodeoxynucleotide, corresponding to the sequence 59 – 99 of the collagenase IV cDNA encoding for the 72 Kd form [17], were purchased from Genset (Paris, France).

2.4. Immunocytochemistry VSMC cultured without cytokines, with conditioned media of PHA-activated peripheral blood mononuclear cells or with recombinant inflammatory cytokines for 3–4 days were seeded on eight wells chamber slides (Nunc Inc., Naperville, IL). Cells were then grown under the same experimental conditions described above for additional 48 h, fixed in cold aceton – methanol and incubated overnight at 4°C with the primary antibody (5 mg/ml). This was followed by incubation (20 min at room temperature) with biotinylated anti-mouse antibody (Dako, Gostrup, Denmark), incubation (20 min at room temperature) with avidin – biotin peroxidase complex (Dako), and immersion in 3,3-diaminobenzidine tetrahydrochloride cromogen (Dako). All steps were separate by 5-min washes in phosphate buffered saline (PBS) solution. The percentage of positive cells was evaluated with a light microscope in duplicate samples for each experiment (five fields/slide), following counterstaining with Mayer’s hematoxylin solution (Sigma), as previously reported [18].

2.5. Migration assays Experiments were carried out, in duplicate, in Boyden chambers made of two compartments separated by polycarbonate filters (12 mm pore, Nucleoprobe Inc., Cabin John, MD), as previously reported [18]. VSMC were suspended by trypsinization, washed with trypsin inhibitors, resuspended at 5× 105/ml in serum-free medium containing 0.01% BSA and placed in the upper compartment of the Boyden chambers. Chemotaxis assays were performed by placing fibronectin (30 mg/ml), bFGF (20 ng/ml) or their resuspension buffer (PBS-0.1% BSA), used as negative control, in the lower compartment of the Boyden chamber. Haptotaxis assays were carried out by using filters pre-coated with fibronectin, as previously reported [19]. Both types of assay were performed at 37°C in 5% CO2 for 5 h. After incubation, cells on the

379

upper surface of the filters were mechanically removed, while cells on the lower surface of the filters (migrated cells) were fixed in ethanol, double-stained by toluidine-blue and by hematoxylin –eosin, and quantitated by light microscopy, by counting 5 fields/filter [18].

2.6. Cell adhesion assays Twelve well plates (Falcon, Becton and Dickinsons, Lincoln Park, NJ) were coated overnight at 37°C with serial diluitions of fibronectin or laminin. Plates were then incubated 2 h at room temperature with PBS-1% BSA. VSMC (suspended at 5× 104 per ml in serumfree medium) were added to the wells (in triplicate) and incubated for 1 h at 37°C in a 5% CO2 atmosphere. All steps were separated by 1-min washes in PBS. Adherent cells were fixed with ethanol, stained with ematoxylin –eosin and quantitated by light microscopy, by counting 5 fields/well, as previously reported [18].

2.7. Intracellular pH measurement Cells were suspended by trypsinization, washed with trypsin inhibitors, seeded at 1× 105/well on four well chamber slides (Nunc) coated with 3 mg/cm2 of fibronectin or uncoated. Cells were then incubated 1 h at 37°C in 5% CO2. After incubation, cells were subjected to intracellular pH (pHi) measurement, by using the fluorescent probe 2%. 7% bis (carboxyethyl)-5, (6)carboxyfluorescein tetra-acetoxymethylester (Molecular Probes, Eugene, OR) under continuous magnetic stirring at 37°C in a luminescence spectrometer (model LS-5, Perkin –Elmer), as previously described [20]. The ratio of the 530 nm fluorescence signals obtained at 500 nm (pH-sensitive) and 450 nm (isosbestic) excitation wavelength, using 5 and 10 nm slits, for excitation and emission, respectively, allowed calculation of pHi, independent of cell number and dye concentration [20].

2.8. Cell growth assays Experiments were performed by the cell counting method [16,18]. Briefly, VSMC were plated at 7.5× 103 cells/well in 12 well plates (Falcon) coated with 3 mg/cm2 of fibronectin or uncoated. Cells were then incubated overnight with media without growth supplements. The day after, cells were starved 4 h in serum-free medium and then human recombinant bFGF (10 ng/ml) was added to the wells in medium containing 10% FBS. The bFGF resuspension buffer (PBS-0.1% BSA) was employed as the negative control. Media and bFGF were replaced after 2–3 days and cells were counted after 5–6 days by trypan blue staining (in triplicate), as previously described [16,18].

380

G. Barillari et al. / Atherosclerosis 154 (2001) 377–385

2.9. Blocking experiments Blocking experiments were performed for both cell growth and migration. For the growth assays, VSMC were plated on culture plates; for the migration assays, cells were suspended by trypsinization. In both cases cells were preincubated on rotation in RPMI-0.05% BSA containing anti-a5b1 or anti-b1 monoclonal antibodies (4 mg/ml), for either 2 h at 4°C or 30 min at room temperature. Growth and migration assays were then performed as described above.

2.10. Statistical analysis Continuous variables were compared by the Mann – Whitney U test. The statistical analysis was done with SPSS version 8.5 (SPSS, Chicago).

3. Results

3.1. Inflammatory cytokines increase h5i1 expression in VSMC To assess the effect that concentrations of inflammatory cytokines as released by activated immune cells have on a5b1 expression by VSMC, these were cultured with conditioned media of PHA-activated peripheral blood mononuclear cells for different periods of time. Exposure to conditioned media of activated peripheral blood mononuclear cells increased in VSMC, as compared to the same cells cultured in the absence of conditioned media, a5b1 expression at both the RNA and the protein level. The expression of a5b1 was maximal (+ 100%) after 4–6 days exposure to conditioned media and paralleled with VSMC acquisition of a ‘spindle’ shape (Fig. 1(A, B and D)), a marker of vascular cell activation [21]. Interestingly, the expression of a6, the a chain of one of the laminin receptors [2], was downregulated under the same experimental conditions (Fig. 1(B)). In contrast, a shorter (24 – 48 h) exposure to conditioned media did not significantly affect VSMC phenotype, including cell shape and a5, a6 or b1 gene expression (data not shown). The cytokines contained in the conditioned media and their concentrations were assessed by ELISA. Although conditioned media were obtained from different donors, they all contained IL-1 a and b, IL-2, IL-6, TNF a and b, GM-CSF and IFN-g. These cytokines are considered to be the main mediators of the inflammatory response that precedes and accompanies atherosclerotic lesion development [1]. The concentrations of these cytokines (minimal and maximal values, expressed in ng/ml) in the conditioned media were: IL-1a (0.1 – 1), IL-1b (1–10), IL-2 (0.1 –0.5), IL-6 (10 – 40), TNF a (0.1 – 1), TNF b ( B 0.1), GM-CSF (0.1 – 1), IFN-g (0.1 – 0.2).

To assess the contribution of each cytokine to a5b1 upregulation induced by conditioned media, VSMC were assayed for the expression of this integrin, after being exposed to recombinant inflammatory cytokines, alone or in combination, at concentrations which were the average between minimal and maximal values detected in the conditioned media by ELISA. The combination of IL-1b (5 ng/ml), TNFa (0.5 ng/ml) and IFN-g (0.15 ng/ml) was sufficient to augment in VSMC the expression of both a5 and b1 genes at the levels induced by conditioned media (Fig. 1(C)). Identical results were obtained at the protein level as a5b1 levels were increased by combined IL-1b, TNFa and IFN-g by 88% (Fig. 1(D)). The biological activity of these combined inflammatory cytokines was confirmed by their capability of augmenting in VSMC both collagenase IV and stromelysin-1 gene expression (Fig. 1(C)). In fact, these proteases, which cleave fibronectin from basement membrane or perivascular stroma [17,22], were previously shown to be upregulated by IL-1b, TNFa and IFN-g [23,24].

3.2. Inflammatory cytokines enhance VSMC capability of migrating toward fibronectin The a5b1 integrin mediates cell migration toward fibronectin [9]. As shown in Fig. 2(A), exposure to concentrations of combined IL-1b, TNFa and IFN-g increasing a5b1 expression augmented VSMC capability of migrating toward anchored fibronectin (haptotaxis) by 157% (P= 0.02). Similarly, inflammatory cytokines enhanced VSMC migration toward soluble fibronectin (chemotaxis) by 110% (P=0.03). In addition, antibodies directed against a5b1 blocked fibronectin-induced migration of cytokine-activated VSMC by 77% and of control VSMC by 72% (Fig. 2(B)). This indicated that the increased migratory response to fibronectin shown by cytokine-activated VSMC was mediated by a5b1upregulation. In contrast, as shown in Fig. 2(B) anti- a5b1 antibodies did not affect the migration of cytokine-activated or control VSMC promoted by basic fibroblast growth factor (bFGF). This demonstrated that these antibodies do not aspecifically compromise VSMC migratory properties.

3.3. Inflammatory cytokines enhance the adhesi6e properties of VSMC and augment their responsi6eness to mitogens through an increase of intracellular pH The a5b1 integrin also mediates cellular adhesion and spreading onto immobilized fibronectin [2,10,11]. Consistent with the increase in a5b1 expression, VSMC activated by combined IL-1b, TNFa and IFN-g, as compared to control cells, showed an augmented capa-

G. Barillari et al. / Atherosclerosis 154 (2001) 377–385

bility of adhering to fibronectin, coated at 0.3 mg/cm2 ( + 66%, PB0.001), 3 mg/cm2 ( +56%, P =0.036) and 30 mg/cm2 (+19%, P = 0.003) (Fig. 3(A)). On the contrary, exposure to combined IL-1b, TNFa and IFNg inhibited VSMC attachment to laminin immobilized at 0.3, 3 and 30 mg/cm2 by 31, 33 and 23%, respectively. This was consistent with inflammatory cytokines capability of downregulating a6 expression (Fig. 1(B)). The a5b1 triggering by adhesion to fibronectin gives rise to the elevation of pHi which, in turn, stimulates

381

DNA synthesis, modulating the cellular response to growth factors [10]. The pHi of cytokine-activated VSMC seeded on fibronectin-coated plates was therefore measured and compared to that of VSMC grown in the absence of inflammatory cytokines. VSMC seeded on uncoated plates were used as control. The adhesion of untreated VSMC to fibronectin caused a 0.13-unit increase of pHi over the basal value (Fig. 3(B)). This augmented to a 0.43-unit increase in VSMC cultured with combined IL-1b, TNFa and IFN-g (Fig. 3(B)).

Fig. 1. Upregulation of a5, b1 and protease gene expression in VSMC by inflammatory cytokines. In (A) are shown pictures of VSMC cultured 6 days in the absence of cytokines (VSMC, upper panel) or with conditioned media from PHA-activated peripheral blood mononuclear cells (CM-VSMC, lower panel). In (B) and (C) are shown the autoradiographies resulting from the hybridization to 32P-random primed probes of RNAs obtained from VSMC cultured 6 days without cytokines (control, CR), with conditioned media from PHA-activated peripheral blood mononuclear cells (conditioned media, CM) or in the presence of IL-1b, TNFa and IFN-g, combined together at 5, 0.5 and 0.15 ng/ml, respectively (inflammatory cytokines, IC). Probes detected for GADPH a 1.26 kb transcript, for the a5 chain a 4.9 kb transcript, for the a6 chain a 5.6 kb transcript, for the b1 chain a 4.2 kb transcript, for collagenase IV (CO IV) a 2.3 kb transcript and for stromelysin-1 (ST) a 1.8 kb transcript. In (D) is shown the immunohistochemical evaluation of a5b1 expression in VSMC cultured 6 days without cytokines (white bars), with conditioned media from PHA-activated peripheral blood mononuclear cells (grey bars) or in the presence of IL-1b, TNFa and IFN-g (black bars), combined together at 5, 0.5 and 0.15 ng/ml, respectively. Data, from three independent experiments ( 9standard deviations of the mean, S.D.s), are expressed as percentage of a5b1 positive cells.

382

G. Barillari et al. / Atherosclerosis 154 (2001) 377–385

Fig. 2. Increase in VSMC capability of migrating toward fibronectin by inflammatory cytokines upregulating a5b1 expression. VSMC were cultured 6 days without cytokines (white bars) or with combined IL-1b (5 ng/ml), TNFa (0.5 ng/ml) and IFN-g (0.15 ng/ml) (black bars). Migration assays were then carried out in the Boyden chambers as described in Section 2. In (A) cells were induced to migrate toward anchored fibronectin (FN, left panel) or soluble fibronectin (FN, right panel). Data are the average from three experiments ( 9S.D.) and are expressed as number of cells migrated toward fibronectin. This was controlled by the number of cells migrated toward fibronectin resuspension buffer (PBS-0.1% BSA) which was 15 cells/field for both cytokine-treated and control VSMC. In (B) cells were preincubated with anti-a5b1 monoclonal antibodies and then stimulated to migrate toward soluble fibronectin (FN, left panel) or bFGF (right panel). Results refer to the number of migrated cells and are expressed as percentage increase of cell migration as compared to the number of VSMC migrated toward fibronectin or bFGF without being preincubated with anti-a5b1 antibodies. This number was assumed as 100% increase of cell migration.

The pHi increase was associated with an enhanced response to mitogens. In fact, as shown in Fig. 3(C), adhesion to fibronectin augmented the growth response of untreated VSMC to bFGF by 15% (P = 0.001). Noticeably, exposure to combined IL-1b, TNFa and IFN-g increased the response to bFGF of VSMC seeded on fibronectin by 44% (P =0.003). In contrast, treatment with combined inflammatory cytokines slightly inhibited bFGF-induced growth of VSMC seeded on uncoated plates. Finally, anti-a5b1 but not anti-b1 antibodies blocked bFGF-induced proliferation of cytokine-activated VSMC (Fig. 3(D)).

4. Discussion Endothelial denudation, a fundamental step of atherogenesis, is followed by an inflammatory reaction which lasts throughout the development of the atherosclerotic plaques [1]. These, in fact, are infiltrated by activated monocytes-macrophages and T cells, which are virtually absent in the wall of normal arteries [1,12,13]. Consequently, the expression of inflammatory

cytokines is high in atherosclerotic lesions, whereas it is absent in normal arteries [1,12,13]. Previous studies indicated that IL-1b, TNFa and IFN-g are among the main mediators of the inflammatory response which occurs once endothelium has been injured [1]. Here we have shown that concentrations of IL-1b, TNFa and IFN-g as produced by activated leukocytes upregulate in VSMC the expression of the fibronectin receptor a5b1 (Fig. 1). The synergistic effect that IL-1, TNF and IFN-g have on VSMC is consistent with previous studies indicating that IFN-g augments TNF receptor levels [25], while TNF and IL-1 upregulate IFN-g receptor expression [26]. The upregulation of a5b1 expression induced in VSMC by inflammatory cytokines resembles what occurrs in vivo during wound healing. In fact, migrating keratinocytes present at the wound margin infiltrated by activated leukocytes express high a5b1 levels as compared to stationary keratinocytes located far from the wound margin [27]. As a consequence, keratinocytes migrate toward fibronectin, which is the main component of the blood clot that first fills a wound,

G. Barillari et al. / Atherosclerosis 154 (2001) 377–385

serving as a provisional matrix [27]. This suggested that, by upregulating a5b1, inflammatory cytokines expressed in atherosclerotic lesions could increase VSMC capability of migrating toward fibronectin deposited on damaged endothelial basement membrane following endothelial denudation. In fact, exposure to combined IL-1b, TNFa and IFN-g augments VSMC capability of migrating toward anchored fibronectin (Fig. 2). These combined inflammatory cytokines also enhance VSMC migration toward soluble fibronectin together with VSMC expression of collagenase IV and stromelysin-1 (Figs. 1 and 2). This suggests that inflammatory cytokines released by activated immune cells infiltrating atherosclerotic lesions may facilitate VSMC locomotion also by promoting the expression of proteases cleaving fibronectin incorporated in endothelial basement membrane and digesting it into chemotactic fragments [9]. As integrin triggering activates metalloprotease produc-

383

tion [22], it is possible that the increased a5b1 expression is responsible also for the augmented protease gene expression. In addition to VSMC migration from the media to the intima, proliferation of intimal VSMC is a key event in atherogenesis [1]. In order to respond to mitogens, vascular cells require an ‘adhesion’ signal given by integrin local clustering [10]. Consistent with a5b1 capability of mediating cellular adhesion to fibronectin, a5b1 upregulation induced by low amounts of combined IL-1b, TNFa and IFN-g also enhances VSMC attachment to immobilized fibronectin (Fig. 3). The differences between cytokine-activated and control VSMC are evident expecially at low concentrations of fibronectin, thus indicating that inflammatory cytokines increase not only the number but also the affinity of a5b1 receptors. It is of interest that combined IL-1b, TNFa and IFN-g decrease VSMC expression of a6

Fig. 3. Increase in VSMC adhesive properties, pHi and responsiveness to bFGF by inflammatory cytokines upregulating a5b1 expression. In (A), (B) and (C) VSMC cells were grown 6 days without cytokines (white bars) or with IL-1b, TNFa and IFN-g, combined together at 5, 0.5 and 0.15 ng/ml, respectively (black bars). In (A) cells were seeded on scalar amounts of fibronectin (FN). Adhesion assays were then performed as described in Section 2. Results are expressed as number of cells attached to immobilized fibronectin. In (B) are shown the pHi values of cells seeded on uncoated or fibronectin-coated chamber slides. In (C) cells were seeded on uncoated plates (left panel) or on fibronectin-coated plates (right panel) and stimulated to proliferate with bFGF. Results are expressed as the number of cells collected 4 days after the addition of bFGF. Data were controlled by the number of cells grown in the absence of bFGF (basal cell growth) which was 16 × 103 cells/well for both cytokine-treated and control VSMC. In (D) VSMC were grown 6 days with combined IL-1b, TNFa and IFN-g, seeded on fibronectin -coated plates and stimulated to proliferate with bFGF in the absence of antibodies (white bars), in the presence of anti-b1 antibodies (4 mg/ml, grey bars), or in the presence of anti-a5b1 antibodies (4 mg/ml, black bars). Data are expressed as percentage increase of VSMC growth in response to bFGF, compared to VSMC basal growth which was given a 0% increase value. For (A), (B), (C) and (D) data are the average from 3 to 6 experiments ( 9S.D.).

384

G. Barillari et al. / Atherosclerosis 154 (2001) 377–385

(Fig. 1), the a chain of a receptor for laminin [2]. Adhesion experiments confirm that cytokine-activated VSMC preferentially bind fibronectin rather than laminin. Since laminin, a major component of blood vessel extracellular matrix, induces VSMC to adopt a differentiated, non proliferative phenotype, while fibronectin promotes VSMC expression of a proliferative phenotype [3], a5 and a6 modulation by combined IL-1b, TNFa and IFN-g is like to play an important role in atherogenesis. Concentrations of recombinant TNFa or IFN-g much higher (up to 100-fold more) than the ones we employed in this study were found to induce cytoskeleton modifications leading to endothelial cell shedding and apoptosis: this is due to alteration of integrin function, although integrin expression results are still to be upregulated [15]. Indeed, when we cultured VSMC with high concentrations of inflammatory cytokines, we observed some VSMC detachment (data not shown). Thus, since cell shedding is the first step of cell locomotion [9], inflammatory cytokines could modify VSMC phenotype from adhesive to invasive, depending on their concentrations in blood vessel wall. These may be varied by the binding of immune cells to receptors expressed by activated endothelial cells [21] or by the capability of blood vessel extracellular matrix components, including fibronectin, of sequestering inflammatory cytokines [28]. Previous studies indicated that cellular adhesion onto immobilized fibronectin elevates the pHi in a dose-dependent fashion as fibronectin coating densities are raised [10]. Here we have shown that when cytokine-activated VSMC and control VSMC are seeded on fibronectin immobilized at the same density, the former, which adhere and spread on fibronectin better than the latter, show a higher pHi (Fig. 3). By elevating pHi, a5b1-mediated adhesion to fibronectin may allow VSMC cycle progression together with local growth factors, as found for other cell types [10,11]. In fact, spreading onto fibronectin enhances VSMC growth induced by bFGF (Fig. 3), a strong VSMC mitogen, which is thought to play an important role in atherogenesis [29]. In particular, bFGF is produced by immune cells, which adhere to denudated endothelial basement membrane [13], and by endothelial cells upon their activation by inflammatory cytokines [18]. In agreement with pHi results, the enhancement of bFGF mitogenic effect by adhesion onto fibronectin is particularly evident in cytokine-activated VSMC. In contrast, pretreatment with inflammatory cytokines slightly inhibits the proliferative response to bFGF of VSMC seeded onto uncoated plates. This is consistent with inflammatory cytokines capability of downregulating bFGF receptor expression [30] and confirms that inflammatory cytokines augment VSMC proliferative response to bFGF through an ‘adhesion

effect’. In fact, competitors of a5b1-mediated cellular adhesion such as anti-a5b1 antibodies, block bFGF-induced proliferation of cytokine-activated VSMC. On the contrary, antibodies directed against the b1 chain have no effect, consistent with the fact that they are not capable of blocking VSMC adhesion to fibronectin (Fig. 3 and data not shown). In conclusion, we have shown here that concentrations of IL-1b, TNFa and IFN-g as possibly released by immune cells infiltrating atherosclerotic lesions enhance VSMC locomotion and growth mediated by the a5b1-fibronectin interaction. These data suggest an additional pathogenetic link between atherosclerosis and inflammation. Since fibronectin and a5b1 levels are increased in atherosclerotic arteries [3,8], these results also support the use of integrin antagonists as potential adjuvants in the therapy of atherosclerotic diseases. Acknowledgements This work was supported by grants from Istituto Superiore di Sanita` and the Ministry of Research, Rome, Italy. We thank Mr Lionello Ruggeri for technical assistance. References [1] Ross R. The pathogenesis of atherosclerosis: a perspective for the 1990s. Nature 1993;362:801– 9. [2] Hynes RO. Integrins: versatility, modulation and signaling in cell adhesion. Cell 1992;69:11– 25. [3] Thyberg J, Blomgren K, Ray J, Tran PK, Hedin U. Phenotypic modulation of smooth muscle cells after arterial injury is associated with changes in the distribution of laminin and fibronectin. J Histochem Cytochem 1997;45:837– 46. [4] Thyberg J, Hultgardht-Nilsson A. Fibronectin and the basement membrane components laminin and collagen type III influence the phenotypic properties of subcultured rat aortic smooth muscle cells differently. Cell Tissue Res 1994;276:263– 71. [5] Giese J, Renin D. Angiotensin and hypertensive vascular damage: a review. Am J Med 1973;55:315– 23. [6] Watson KE, Parhami F, Shin V, Demer LL. Fibronectin and collagen I matrixes promote calcification of vascular cells in vitro, whereas collagen IV matrix is inhibitory. Arterioscl Thromb Vasc Biol 1998;18:1964– 71. [7] Liaw L, Skinner MP, Raines EW, et al. The adhesive and migratory effect of osteopontin are mediated via distinct cell surface integrins. J Clin Invest 1995;95:713– 24. [8] Hillis GS, Mlynski RA, Simpson JG, MacLeod AM. The expression of b1 integrins in human coronary arthery. Basic Res Cardiol 1998;93:295– 302. [9] Zetter BR, Brightman SE. Cell motility and the extracellular matrix. Curr Op Cell Biol 1990;2:850– 6. [10] Ingber DE, Prusty D, Frangioni JV, Cragoe EJ, Lechene C, Schwartz M. Control of intracellular pH and growth by fibronectin in capillary endothelial cells. J Cell Biol 1990;110:1803– 11. [11] Zhang Z, Vouri K, Reed JC, Rouslahti E. The a5b1 integrin supports survival of cells on fibronectin and up-regulates bcl-2 expression. Proc Natl Acad Sci USA 1995;92:6161– 5.

G. Barillari et al. / Atherosclerosis 154 (2001) 377–385 [12] Jonasson L, Holm J, Skalli O, Bondjers G, Hansson GK. Regional accumulation of T cells, macrophages and smooth muscle cells in human atherosclerotic plaque. Arteriosclerosis 1986;6:131– 8. [13] Blotnick S, Peoples GE, Freeman MR, Eberlein TJ, Klagsbrun M. T-lymphocytes synthesize and export heparin-binding epidermal growth factor-like growth factor and basic fibroblast growth factor, mitogens for vascular cells and fibroblasts: differential production and release by CD4+ and CD8+ T cells. Proc Natl Acad Sci USA 1994;91:2890–4. [14] Santala P, Heino J. Regulation of integrin-type cell adhesion receptors by cytokines. J Biol Chem 1991;266:23505–9. [15] Ruegg C, Ylmaz A, Bieler G, Bamat J, Chaubert P, Lejeune FJ. Evidence for the involvement of endothelial cell integrin avb3 in the disruption of the tumor vasculature induced by TNF and IFN-g. Nature Med 1998;4:408–14. [16] Barillari G, Buonaguro L, Fiorelli V, et al. Effects of cytokines from activated immune cells on vascular cell growth and HIV-1 gene expression: implication for AIDS-Kaposi’s sarcoma pathogenesis. J Immunol 1992;149:3727–34. [17] Muller D, Quantin B, Gesnel MC, Millon-Cotard R, Abecassis J, Breathnach R, et al. The collagenase gene family in humans consists of at least four members. Biochem J 1988;253:187– 92. [18] Barillari G, Sgadari C, Palladino C, et al. Inflammatory cytokines synergize with the HIV-1 Tat protein to promote angiogenesis and Kaposi’s sarcoma via induction of bFGF and the avb3 integrin that are required for Tat activity. J Immunol 1999;163:123– 8. [19] McCarthy JB, Furcht LT. Laminin and fibronectin promote the haptotactic migration of B16 mouse melanoma cells in vitro. J Cell Biol 1984;98:1474–80. [20] Incerpi S, Baldini P, Bellucci V, Zannetti A, Luly P. Modulation of the Na+/H+ antiport by insulin: interplay between protein kinase C, tyrosin kinase and protein phosphatases. J Cell Physiol 1994;159:205– 12.

.

385

[21] Pober JS, Cotran RS. The role of endothelial cells in inflammation. Transplantation 1990;50:537– 44. [22] Werb Z, Tremble PM, Behrendtsen O, Crowley E, Damsky CH. Signal transduction through the fibronectin receptor induces collagenase and stromelysin gene expression. J Cell Biol 1989;109:877– 89. [23] Firestein GS, Paine MM. Stromelysin and tissue inhibitor of metalloproteases gene expression in rheumatoid arthritis synovium. Am J Pathol 1992;140:1309– 14. [24] Hanemaaijer R, Koolwijk P, le Clercq L, de Vree WJ, van Hinsbergh VW. Regulation of matrix metalloprotease expression in human vein and microvascular endothelial cells. Effects of TNFa, IL-1 and phorbol ester. Biochem J 1993;296:803–9. [25] Pandita R, Poiesik E, Aggarwal BB. Interferon-g induces cell surface expression of both types of tumor necrosis factor receptors. FEBS Lett 1992;312:87– 90. [26] Krakauer T, Oppenheim JJ. Interleukin-1 and tumor necrosis factor alpha each upregulate both the expression of interferongamma and enhance interferon-gamma-induced HLA-DR expression on human monocytes and a human monocytic cell line. J Immunol 1993;150:1205– 10. [27] Gailit J, Clark RAF. Wound repair in the context of extracellular matrix. Curr Op Cell Biol 1994;6:717– 25. [28] Alon R, Cahalon L, Hershkoviz R, et al. TNFa binds to the N-terminal domain of fibronectin and augments the b1-integrin mediated adhesion of CD+ T lymphocytes to the glycoprotein. J Immunol 1994;152:1304– 13. [29] Lindner V, Olson NE, Clowes AW, Reidy MA. Inhibition of smooth muscle cell proliferation in injured rat arteries. Interaction of heparin with basic fibroblast growth factor. J Clin Invest 1992;90:2044– 9. [30] Cozzolino F, Torcia M, Aldinucci D, Ziche M, Almerigogna F, Bani D, Stern DA. Interleukin-1 is an autocrine regulator of endothelial cell growth. Proc Natl Acad Sci USA 1991;87:6487– 91.