- Email: [email protected]
Influence of 5′ sequences on expression of the Tet repressor in Giardia lamblia
Molecular & Biochemical Parasitology 142 (2005) 1–11
Influence of 5 sequences on expression of the Tet repressor in Giardia lamblia Chin-Hung Sun a,∗ , Li-Hsin Su a , Frances D. Gillin b b
a Department of Parasitology, College of Medicine, National Taiwan University, Taipei, 100 Taiwan, ROC Department of Pathology, University of California at San Diego, School of Medicine, San Diego, CA 92103-8416, USA
Received 20 November 2004; received in revised form 1 February 2005; accepted 1 March 2005 Available online 20 April 2005
Abstract Gene expression is poorly understood in Giardia lamblia. Previously we utilized the Escherichia coli tetracycline regulatory elements to develop a giardial-inducible gene expression system. In this study, we tested the hypothesis that regions flanking the tet repressor (tet R) may influence its expression and affect inducibility of the regulatory system. We found that addition of a 6-His tag or nuclear localization signal (NLS) at the N- but not C-terminus of tet R, increased the induction ratios >100-fold. A non-specific sequence also increased the induction ratio. Fusing NLS at the N-terminus, also led to exclusively nuclear tet R localization. Changing the promoter from gdh or ␣-giardin to ␣2-tubulin increased the induction ratio slightly. Tet R expression at both RNA and protein levels correlated with repression efficiency, indicating that coding sequences of the 6-His tag or NLS may contribute to transcriptional activation of the exotic tet R gene in Giardia. In addition, we found that the tet R system mediated gene repression and induction during encystation. Previous studies used an artificial reporter gene. In this study, we were able to induce overexpression of epitope-tagged cyst wall protein 1 (CWP1) in vegetatively growing Giardia trophozoites. Moreover, we could repress or induce expression of exogenous CWP1 in encysting cells. Taken together, our data suggest that expression of tet R in Giardia is complex and can be strongly influenced by additional sequences, especially at its N-terminus. This system provides insights into expression of an alien gene and can be exploited to regulate gene expression and study important functions in G. lamblia. © 2005 Elsevier B.V. All rights reserved. Keywords: Inducible; Tetracycline; Repressor; Giardia
1. Introduction Giardia lamblia, a major cause of waterborne diarrheal disease, is also of basic biological interest as an early diverging eukaryote [1]. Like Entamoeba and Cryptosporidium, it undergoes differentiation from a pathogenic trophozoite form into a resistant infectious cyst form. Giardia is a valuable model for differentiation of such parasites, as its life cycle can be reproduced in vitro [2–4]. Moreover, the Giardia Abbreviations: NLS, nuclear localization signal; tet R, tet repressor; CWP1, cyst wall protein 1 ∗ Corresponding author. Tel.: +886 2 23123456 8262; fax: +886 2 23915294. E-mail address: [email protected] (C.-H. Sun). 0166-6851/$ – see front matter © 2005 Elsevier B.V. All rights reserved. doi:10.1016/j.molbiopara.2005.03.003
Genome Project is very advanced and SAGE analysis of the transcriptome over the life cycle is in progress [5]. However, >60% of the predicted genes have no known function (http://gmod.mbl.edu/perl/site/giardia?page=intro) and regulation of differentiation is poorly understood [6]. Gene knockout in Giardia is not feasible because of its 4N ploidy [7,8]. The ability to repress and induce expression of a transgene may be crucial, especially in the case of a dominant negative mutant or a protein that may be toxic. Tet-inducible systems have proven valuable in many parasites [9,10]. Therefore, we developed an inducible gene expression system in G. lamblia by introducing the Escherichia coli tet repressor-operator system into the stable DNA transfection system we previously developed [11]. In that system, two copies of the tet operator were inserted downstream of the minimal ran promoter,
2
C.-H. Sun et al. / Molecular & Biochemical Parasitology 142 (2005) 1–11
which had been shown to confer transcription initiation and promoter activity in G. lamblia [12]. The gene encoding the tet repressor protein (tet R) was fused with a 6-His tag to permit its localization and expressed under the control of a 52-bp ␣-giardin promoter. This system allows the level of expression of a target gene to be regulated in a reversible manner as it produced a 50-fold induction of luciferase activity upon the addition of tetracycline to inactivate the tet R. The tet R mediates repression of the basal level of the reporter gene expression as well as induction in response to tetracycline [13,14]. A tight repression could result from sufficiently high amounts of the tet R expressed from a strong promoter [14]. In this study, we tested the hypothesis that regions flanking the tet R coding region might affect its expression and could lead to higher induction ratios. Our original constructs contained an N-terminal 6-His tag in order to facilitate immunolocalization and purification. Since tet R did not target exclusively to the nucleus, we also appended a nuclear localization signal (NLS), which was previously shown to function in Giardia. Since neither the NLS nor the 6-His tage is a normal giardial sequence, we asked whether these foreign sequences might influence giardial expression or nuclear targeting of tet R. We also asked if the tet-inducible system could be exploited to regulate expression of a giardial encystation specific gene during vegetative growth and differentiation. 2. Materials and methods 2.1. Giardia culture Trophozoites of G. lamblia isolate WB (ATCC 30957), clone C6, were cultured in modified TYI-S33 medium [15]. Encystation was induced according to our published procedure [16]. 2.2. RNA extraction, Northern blot analysis, and nuclear run on assays Total RNA was extracted from G. lamblia wild type or indicated transfectants using TRIzol reagent (Life Technologies). Standard procedures were used in electrophoresis, blotting and hybridization of total RNA [17]. Total RNA (10 g) was fractionated and transferred to Zeta-Probe blotting membrane (Bio-Rad). Strand-specific probes were labeled using the Prime-It II kit (Stratagene). The membranes were hybridized and washed as described [18]. Hybridization signals were imaged and quantified using a Storm system (Molecular Dynamics). Nuclear run on assays were performed as previously described [19]. RNA was subsequently purified by using TRIzol reagent (Life Technologies). The synthesized RNA was hybridized to a nylon membrane which contained tet R or neo gene coding region. The tet R gene coding region was amplified by PCR using primers TF (TCTAGATTAGATAAAAGTAAA)
and TR (TTAAGACCCACTTTCACATTT) and pUHD151 [20] template. The neo gene coding region was amplified by PCR using primers NEOF (ATGATTGAACAAGATGGATTGCAC) and NEOR (TCAGAAGAACTCGTCAAGAAGGCG) and pRANneo [21] template.
2.3. Plasmid construction The pNLop2-GtetR, pPop2 and pNLop2-GItetR have been described before [11,16]. All constructs were verified by DNA sequencing with BigDye Terminator 3.1 DNA Sequencing kit and the reaction products were analysed on an ABI 3100 DNA Analyser (Applied Biosystems). The coding sequences of NLS of SV40 large T antigen (KKKRKV; 5 -AAGAAGAAGCGCAAGGTG-3 ) and 6-His tag (HHHHHH; 5 -CATCACCATCACCATCAC-3 ) were added to specific constructs by PCR using specific primers. For constructing pNLop2-GtetRX, pNLop2-GtetRCH, pNLop2GtetRNNL, the tet R gene was amplified by PCR on pUHD15-1 [20] template using primer pairs TXF (GGCGCCATGGATTCTAGATTAGATAAAAGTAAA) and TXR (CGGACTCGAGTTAAGACCCACTTTCACATTT), TXF and TCR (CGGACTCGAGTTAGTGATGGTGATGGTGATGAGACCCACTTTCACATTT), TNLF (GGCGTCATGAAGAAGAAGCGCAAGGTGTCTAGATTAGATAAAAGTAAAG) and TXR, respectively. The resulting fragments were digested with NcoI (BspHI for TNLF, TXR PCR product) and XhoI, and ligated in place of NcoI/XhoI-excised tet R in pGtetR [11]. The tet R expression cassettes in the resulting constructs pGtetRX, pGtetRCH, or pGtetRNNL were amplified by PCR using primers GS (CGATGTCGACGACCACAAATAACGCCTTTA) and GC (AATAATCGATGGTACCAGCTGATCGGCGCC). Each of the PCR products was digested by SalI and ClaI, and cloned into KpnI/ClaIdigested pRANneo together with KpnI/XhoI-digested pLop2. This entailed ligating three fragments together. For constructing pNLop2-GtetRCNL, oligonucleotides (NL2F, TAACCCCAAAAAAGAAGAGAAAGGTCGAAA; NL2R, TAATTCGACCTTTCTCTTCTTTTTTGGGGT) containing the coding sequence of the NLS were phosphorylated, annealed, and cloned into the NdeI-digested and phosphatase-treated pNLop2-GtetRX. The C-terminal insertion of the NLS resulted in a disruption of Ile194 in ␣ helix 10 of the tet R [14]. For constructing pN-TtetR, pNLop2-TtetR [11] was digested with KpnI and self-ligated. For constructing pNRLop2-GItetR, the neomycin phosphotransferase (neo) expression cassette in pRANneo was amplified by PCR using NXF (GGCCTCTAGAAATGGGACAGGATCTAAC) and NHR (GGCCAAGCTTATCGATGTAACGAACCGCTAGAAG), digested with XbaI and HindIII, and cloned into pUC18 vector. The neo expression cassette in the resulting construct was digested with KpnI, and ligated in place of the KpnI-excised neo expression cassette in pNLop2GItetR. The clone with the neo expression cassette in the same orientation with the tet R expression cassette was picked.
C.-H. Sun et al. / Molecular & Biochemical Parasitology 142 (2005) 1–11
To help replace the luciferase gene with a more relevant giardial gene in the subsequent cloning, we needed to use convenient cloning sites. The EcoRI and NcoI sites flanking luciferase gene could not be used because there were additional EcoRI and NcoI sites elsewhere in the vectors. These sites in pNLop2-GILtetR, pNLop2-T2tetR, pNLop2T2tetRNNL were mutated (Fig. 2). During the mutation process, we needed to remove the NcoI site in the neo gene coding region, so the NcoI site in pRANneo was mutated to an AvrII site using PCR-directed mutagenesis to generate pRANneoA. This mutation resulted in a change of His 188 residue to Leu. However, we could not obtain its stable transfectants by G418 selection, indicating that this residue could be important for neo gene function. We finally mutated this NcoI site using primer NEOmF (CTCGTCGTGACCCACGGCGATGCCTGCTTG) and its antisense primer with Quick Change site-directed mutagenesis kit (Stratagene). We did not change any residue of the NEO protein and obtained a good stable transfection system. The EcoRI in the neo expression cassette in pRANneo were also mutated sequentially to generate pRANneoM. To do this, the 5 -flanking region and partial neo gene was amplified by PCR on pRANneo [21] template using primer pairs T7 (AATACGACTCACTATAG) and NEOA (GGCGAAATTTCTGCAGCCCGGGGTGGGCGA). The PCR product was digested with ApoI and XbaI and then ligated into EcoRI/XbaI-digested pRANneo. For constructing pNLop2-GILtetR, the 263-bp 5 -flanking region of ␣-giardin was amplified from genomic DNA with primers GIF (GCGCAAGCTTCTTGCTCAGAAGCGTAAGCCTTG) and GIR (GCGCCCATGGTTTTTAAAACCGAATTGCCATTTTTTGGCGGTATTTTTTGAAGCTC), digested with NcoI and HindIII, and cloned into the NcoI/HindIII-digested pGtetR to replace the gdh promoter. The tet R expression cassette in the resulting plasmid pGILtetR was amplified by PCR using GIS (GGCCGTCGACAAGCTTCTTGCTCAGAAGCGTAAGCCTTG) and GC, digested with SalI and ClaI, and cloned into KpnI/ClaI-digested pRANneoM with KpnI/XhoI-digested pLop2. This entailed ligating three fragments together. For constructing pNLop2-GILtetRNNL, oligonucleotides (NLF, CTAGACCAAAAAAGAAGAGAAAGGTCGAAT; NLR, CTAGATTCGACCTTTCTCTTCTTTTTTGGT) containing coding sequence of NLS were phosphorylated, annealed, and cloned into the XbaI-digested and phosphatase-treated pGILtetR. The tet R expression cassette in the resulting plasmid pGILtetRNNL was amplified by PCR using primers GIS and GC. The PCR product was digested by SalI and ClaI, and cloned into KpnI/ClaI-digested pRANneo with KpnI/XhoI-digested pLop2. This entailed ligating three fragments together. For constructing pNLop2-T2tetR and pNLop2-T2tetRNNL, the tet R gene was amplified by PCR on pUHD15-1 template using primer pairs TBF (GGCGTCATGAATCATCACCATCACCATCACTCTAGATTAGATAAAAGTAAAG) and TXR, TNLF and TXR, digested with BspHI and XhoI, and ligated in place of
3
NcoI/XhoI-excised luciferase gene in pTUB.luc which was a gift from Dr. Steven Singer and Dr. Theodore E. Nash [22]. The tet R expression cassettes in the resulting plasmids were amplified by PCR using primers T5S (GGCGGTCGACCGCAGACGCATGAACGCATG) and GC. Each of the PCR products was digested by SalI and ClaI, and cloned into KpnI/ClaI-digested pRANneoM with KpnI/XhoI-digested pLop2. This entailed ligating three fragments together. For constructing pNW1, the cwp1 gene was amplified from genomic DNA by PCR using primers W1NF (GGCCCCATGGATATGCTCGCTCTCCTTGCTCTTGCA) and W1ER (GGCGAATTCTCAGATGTATCGATACGTATCAGGCGGGGTGAGGCAGTACTC) which encodes an AU1 tag, digested with NcoI and EcoRI, and ligated in place of the NcoI/EcoRI-excised luciferase gene in pNLop2-GILtetR. For constructing pNLop2-GtetRS, the tet R gene was amplified by PCR on pUHD15-1 template using primer pairs TSF (GGCGCCATGGCACTAGAGCTGCATGTCAGGTCTAGATTAGATAAAAGTAAA) and TXR. The resulting fragment was digested with NcoI and XhoI, and ligated in place of NcoI/XhoI-excised tet R in pGtetR. The tet R expression cassette in the resulting construct was amplified by PCR using primers G5C (CGATATCGATGACCACAAATAACGCCTTTA) and GC. The PCR products was digested by ClaI, and cloned into ClaI-digested and phosphatase-treated pNLop2-GtetRX. 2.4. Transfection and luciferase assays Plasmids were transfected into G. lamblia by electroporation and the stable transfectants were established as described [21,23]. In this study, the stable transfectants of pN series plasmids were maintained under 150 g/ml G418 selection, except as specified in Fig. 1B. For the two plasmid system, Giardia cells were first transfected with plasmid pNTtetR and selected in 150 g/ml G418. The stable transfectants were transfected with plasmid pPop2 and then the cells were doubly selected in both 150 g/ml G418 and 54 g/ml puromycin. For induction, tetracycline 10 g/ml was added into the growth medium as described [11]. Luciferase activity of the transfectants was assayed as described [11], but since it was measured with a different instrument, Luminometer TD-20/20 (Turner), values in the two papers are not directly comparable. 2.5. Immunofluorescence and immunoblot assays The stable transfectants were harvested, attached to glass coverslips, and then fixed as described [24]. Cells were reacted with anti-tet R monoclonal antibody (MoBiTec, 1/500 in blocking buffer), and anti-mouse ALEXA 568 (Molecular Probes, 1/500 in blocking buffer) as the detector. The protein was localized on a Zeiss LSM 510 laser scanning confocal microscope. Western blots were probed with anti-tet R monoclonal antibody (MoBiTec, 1/5000) or anti-AU1 monoclonal antibody
4
C.-H. Sun et al. / Molecular & Biochemical Parasitology 142 (2005) 1–11
Fig. 1. N-terminal 6-His tag or NLS increases the induction ratio and immunostaining of the tet R. (A) A series of constructs are illustrated in the left panel and numbered. In all five constructs, the neo gene (open box) is under the control of the 5 - and 3 -flanking regions of the ran (stippled box) gene. The luciferase reporter gene (luc+, open box) is under the control of the 32-bp ran promoter element (arrow, striped box) and 3 -flanking region of the ran gene (dotted box). Two tet operators (black box) are inserted downstream of the ran promoter. The tet R (open box) gene is under the control of the 52-bp gdh (slashed box) promoter and flanked by 3 -flanking region of the gdh gene (slashed box). Constructs 2–5 are the same as construct 1 except that a 6-His tag (small dotted box, constructs 2 and 3) or NLS (black box, constructs 4 and 5) was fused at the N-(constructs 2 and 4) or C-terminus (constructs 3 and 5) of the tet R gene. After stable transfection with these constructs, cells were cultured at an initial density of 5 × 106 cells for 24 h in the absence or presence of 10 g/ml tetracycline and then assayed for luciferase activity. Induction ratio (activity with tetracycline divided by activity without tetracycline) is shown but luciferase activity is not. Results are expressed as the mean of at least three separate experiments performed with two samples for each construct. Localization of tet R in the above transfectants was analyzed by indirect immunofluorescence assay using anti-tet R antibody. The tet R stained in nuclei only (N) or in both nuclei and cytosol of the same cells (N + C) and the percentage of positively stained cells are shown. (B) Increasing G418 concentration increases the induction ratio of tet R in trans in a two plasmid system. In the tet R plasmid pN-TtetR, the tet R gene is driven by ␣-tubulin (α-tub, gray box) promoter under neo selection. In the reporter plasmid pPop2, the pac gene (open box) is under the control of the 5 - and 3 -flanking regions of the gdh (slashed box) gene.
(Berkeley Antibody, 1/5000) and detected with peroxidaseconjugated goat anti-mouse IgG (Pierce, 1/5000) and enhanced chemiluminescence ECL Detection Reagents (Amersham Biosciences RPN2106).
3. Results
2.6. Purification of tet R protein from Giardia
develop an optimal inducible expression system, several constructs were generated by incorporating a luciferase expression cassette as a reporter into a stable transfection vector pRANneo together with the tet R gene with different modifications. These constructs were transfected into G. lamblia and stable episomal transfectants were established under G418 selection. The induction ratio was calculated as luciferase activity in the presence of tetracycline (induction) divided by that in the absence of tetracycline (repression). A higher induction ratio generally reflects a lower or more highly repressed basal level of expression in the absence of tetracycline. Since the tet R mediates repression of basal luciferase expression, its amount and function directly influence the induction ratio [25,26]. Previously we found that pNLop2-GtetR which contains the N-terminally 6-His-
Giardia trophozoites (∼108 cells) carrying plasmid pNLop2-T2tetR (construct 11) were harvested by centrifugation and lysed in 10 ml of buffer A (50 mM sodium phosphate, pH 8.0, 300 mM NaCl, 10% glycerol, 1% Nonidet P40) containing complete protease inhibitor cocktail (Roche). The samples were centrifuged and the supernatant was mixed with 1 ml of a 50% slurry of Ni-NTA superflow (Qiagen). The resin was washed with buffer A containing 20 mM imidazole and eluted with buffer A containing 250 mM imidazole. Protein purity and concentration were estimated by Coomassie blue staining compared with bovine serum albumin. The tet R protein was detected by anti-tet R antibody in Western blot.
3.1. Inducible expression from the tet R with 6-His tag or NLS
C.-H. Sun et al. / Molecular & Biochemical Parasitology 142 (2005) 1–11
tagged tet R under the control of the gdh promoter mediated an induction ratio of ∼9.7 [11]. In our current studies, the same construct measured with a different luciferase assay instrument resulted in a much higher induction ratio, ∼768, possibly because of greater sensitivity (Fig. 1A, construct 2). The luciferase activity is not shown because it was always restored to full activity in the presence of tetracycline in these experiments. We further used this assay system to evaluate the roles of certain flanking sequences on expression of tet R. We had included an N-terminal 6-His tag in our original constructs to facilitate immunolocalization of tet R [11]. Surprisingly, we found that removal of this 6-His coding region from the N-terminus or placement of the 6-His tag at the C-terminus decreased the induction ratio by ∼100 fold (Fig. 1, constructs 1–3). Fusion of the tet R with an NLS from SV40 large T antigen at its N-terminus was previously shown to help tet R target to cell nuclei in G. lamblia [27]. Therefore, we asked whether the nuclear targeting of tet R can improve repression efficiency. As Fig. 1A shows, addition of NLS at the N-terminus of the tet R resulted in a greatly increased induction ratio to ∼1014 (pNLop2-GtetRNNL, construct 4 versus construct 1). However, addition of NLS at the C-terminus of tet R resulted in an induction ratio of only ∼1 (pNLop2-GtetRCNL, construct 5). We further asked whether addition of a different sequence at the N-terminus of the tet R can improve repression efficiency. We fused seven amino acids (ALELHVR) at the N-terminus of the tet R (construct pNLop2-GtetRS, data not shown) and found that the induction ratio was increased to ∼700. The ALELHVR sequence does not occur in the giardial ORF database. The cellular locations of tet R in the transfectants were also examined by immunofluorescence assay. The wild type tet R or tet R with 6-His tag at N- or C-terminus localized to both nuclei and cytosol (Fig. 1A, additional data not shown). The percentage of positively stained cells corresponded qualitatively to the induction ratio (wild type tet R, tet R with 6-His tag at N- or C-terminus, ∼0.1, ∼20, or ∼2%, respectively). The tet R with NLS at its N-terminus localized exclusively to the nuclei and ∼10% of the cells were stained. However, the tet R with the NLS at its C-terminus localized to both nuclei and cytosol and only ∼0.1% cells were stained, similar to wild type tet R. Previously we showed that the copy number of nonregulated (episomal) plasmids could be increased by raising the drug selection pressure [21]. We now asked whether we can increase the tet R expression level by modulating the copy number of the plasmid containing the tet R expression cassette. It was necessary to analyze a system which consists of two separate plasmids, one encodes the tet R under the control of the ␣-tubulin promoter with neomycin selection, and the second contains the luciferase gene driven by the tet operator minimal promoter under independent puromycin selection (pN-TtetR and pPop2, Fig. 1B, construct 6). The
5
induction ratios of this system could be increased ∼3-fold by increasing tet R plasmid levels (by increasing G418 levels from 150 to 1200 g/ml). (Fig. 1B). The idea that this may be due to increase in plasmid level is based on similarity of the tet R plasmid with the pRANneo/GDHluc [21] plasmid for which we directly demonstrated increased copy number with greater G418 concentration [21]. 3.2. Role of the promoter directing tet R gene in optimal induction Tight repression could result from higher amounts of the tet R expressed from a stronger promoter. Previous studies showed that the tet R gene under the control of a 52-bp ␣giardin (GenBank accession no. X52485) promoter resulted in a 50-fold increase upon tetracycline induction (pNLop2GItetR) [11]. In this study, we obtained an induction ratio of ∼544 for the same construct (Fig. 2, construct 7). To improve the tet R gene expression, we modified the promoter driving the tet R gene. We found that elongating the ␣-giardin promoter from 52 to 263 bp resulted in a smaller, but significant (p < 0.05) increase in induction ratio from ∼545 to ∼678 (Fig. 2, constructs 7 and 9). We attempted to increase the tet R expression by reversing the orientation of the pRANneo expression cassette, which was in the same orientation relative to the direction of tet R transcription (pNRLop2GItetR) to avoid any possible anti-sense effect. However, this change did not significantly influence induction ratios (constructs 7 and 8). We also attempted to use the ␣2-tubulin promoter which has been shown previously to be stronger than the gdh promoter to drive the expression of the tet R gene [22]. This resulted in an increase of induction ratio to ∼1153 (pNLop2-T2tetR, construct 11). Addition of an NLS to the tet R at its N-terminus (pNLop2-T2tetRNNL, construct 12) resulted in a further increased induction ratio to ∼1468. The tet R for the pNLop2-T2tetRNNL construct localized exclusively to the nuclei and ∼30% of the cells were stained. However, addition of NLS to tet R with a 6His tag at its N-terminus did not increase the induction ratio but strongly decreased it to ∼76 (pNLop2-GILtetRNNL, construct 10). 3.3. Expression of tet R mRNA and protein in Giardia transfectants To determine whether the role of the 6-His tag or NLS was primarily at the transcriptional or translational level in control of the tet R gene, we analyzed tet R protein expression. In the gdh promoter system, the highest levels of the tet R protein were found for tet R with 6-His tag (construct 2) or NLS (construct 4) at their N-terminus (Fig. 3A, left panel). There was some expression of the tet R with 6-His tag at C-terminus (construct 3). However, expression of wild type tet R (construct 1) or tet R with a C-terminal NLS (construct 5) was not detected. The tet R in the two plasmid system which contains the N-terminal 6-His tag was also expressed
6
C.-H. Sun et al. / Molecular & Biochemical Parasitology 142 (2005) 1–11
Fig. 2. Effect of the promoter directing tet R gene expression on induction ratio. Constructs illustrated as described in Fig. 1 contain the tet R gene driven by the 52-bp ␣-giardin (constructs 7 and 8) or 263-bp ␣-giardin (constructs 9 and 10) or 355-bp ␣2-tubulin (constructs 11 and 12) promoter and fused with 6-His tag (constructs 7, 8, 9 and 11) or NLS (construct 12) or both (construct 10). In construct 9, pNRLop2-GItetR, the neo gene expression cassette is in the reverse orientation. Mutations at two NcoI sites (triangles) and one EcoRI site (diamond) were introduced for easy cloning of a tested gene in some constructs. They did not affect the induction ratios. Stable transfectants of these constructs were treated with tetracycline and assayed as described in Fig. 1.
at a detectable level. In other constructs with ␣-giardin or ␣2tubulin promoters, the expression levels of the tet R protein corresponded to the induction ratio (Fig. 3A, right panel). The molecular weight of the Tet R in the pNLop2-GILtetRNNL transfectants (construct 10) was slightly higher than that of other tet R because of the presence of both 6-His tag and NLS at its N-terminus (Fig. 3A, right panel, last lane). It is possible that the 6-His tag or NLS coding sequences may influence the transcript level of the tet R gene. Northern blot analysis showed that the transcript levels of the tet R were similar to the induction ratios. The ∼0.7-kb tet R transcript was detected in a basal level in the transfectants containing wild type tet R or tet R with a C-terminal NLS (Fig. 3B, constructs 1 and 5). There were comparatively highest levels of tet R transcript in the transfectants containing tet R with 6-His tag or NLS at N-terminus (constructs 2 and 4). There was less tet R transcript in the transfectants containing tet R with a C-terminal 6-His tag (construct 3). Primer extension was also used to determine the location of the 5 end of the tet R transcript in the various constructs. We found that the same transcription start sites were used in the transfectants containing tet R in constructs 1–5, all under the control of the gdh promoter (data not shown). These results indicate that the coding sequences for the 6-His tag or the NLS at
the N-terminus of tet R can increase the transcript levels of the tet R gene but do not change the transcription start sites. These data suggest that the levels of tet R mRNA and protein correlate with each other and with the induction ratios of each construct. We carried out nuclear run-on assays in order to determine whether the increased transcript levels of tet R in the presence of the 6-His tag or NLS is due to an increased rate of transcription initiation, as opposed to an increase in mRNA stability. As shown in Fig. 4, moderately strong signals for tet R were produced by nuclei from the transfectants containing tet R with 6-His tag or NLS at their N-terminus (constructs 2 and 4). The signal from the transfectants containing wild type tet R was reduced (construct 1) and no signal was obtained from wild type nontransfected WB cells (WT). Using neo as a control, similar intensity of signals were produced from these transfectants (constructs 1, 2, and 4) and no signal was produced from wild type nontransfected WB cells. These results clearly demonstrate that the tet R gene with 6-His tag or NLS at N-terminus is up-regulated by an increase in the rate of transcription initiation. The N-terminal 6-His tag in the pNLop2-T2tetR transfectants (construct 11) permitted us to purify tet R which was detected by anti-tet R antibody in Western blot compared
C.-H. Sun et al. / Molecular & Biochemical Parasitology 142 (2005) 1–11
7
Fig. 3. Tet R protein and mRNA expression in transfectants. (A) Cellular proteins from wild type nontransfected WB cells (WT) and stable transfectants from different constructs described in Figs. 1 and 2 were fractionated in a 12% SDS–PAGE for Western blot. The blot was probed by anti-tet R antibody. Equal amounts of proteins loaded were confirmed by SDS–PAGE and Coomassie blue staining (data not shown). In this study, the stable transfectants of pN series plasmids were maintained under 150 g/ml G418 selection. For the two plasmid system pN-tetR + pPop2, the stable transfectants were maintained in both 150 g/ml G418 and 54 g/ml puromycin. (B) Northern blot analysis of tet R transcription in specific transfectants described in Fig. 1 (upper panel). A loading control of hybridization of RNA derived from the same cells to a probe for the endogenous ran gene is shown in the lower panel. (C) Cellular proteins from wild type nontransfected WB cells (WT) and pNLop2-T2tetR transfectants (construct 11) were purified by nickel-affinity chromatography. Purified proteins were visualized by Coomassie staining of a 12% SDS–PAGE gel (left panel). The tet R protein was detected by anti-tet R antibody in Western blot (right panel).
with Coomassie-stained gel of fractions from wild-type Giardia cells (Fig. 3C). This result indicates that overexpressed protein with a 6-His tag can be purified from Giardia transfectants. 3.4. Tet R-inducible luciferase expression during encystation
Fig. 4. Nuclear run-on assays of the tet R gene in nuclei from transfectants. Labeled RNA prepared from nuclear transcription using nuclei from wild type nontransfected WB cells (WT) and stable transfectants from constructs 1, 2, and 4 as indicated, was hybridized to a membrane containing bound DNA from the tet R gene or the neo gene as indicated.
Since all studies were in vegetatively growing trophozoites, we next asked whether the promoter activity in the tet-inducible system can function during encystation by monitoring the construct with the optimal induction ratio, pNLop2-T2tetRNNL (construct 12). Cells were transferred to encystation medium and tetracycline added at 0 time (Fig. 5A). The luciferase activity was detectable at 1.5 h after initiation of encystation, and increased linearly to a peak value at 8 h of encystation. Luciferase activity decreased at subsequent times and was ∼half of the peak value at 24 h
8
C.-H. Sun et al. / Molecular & Biochemical Parasitology 142 (2005) 1–11
3.5. Tet R-inducible system used for regulated cwp1 gene expression
Fig. 5. (A) Induction of luciferase expression during encystation in pNLop2T2tetRNNL (construct 12) transfectants. Trophozoites grown to late log phase were transferred to encystation medium at an initial density of 5 × 105 cells/ml in the absence or presence of 10 g/ml tetracycline and then harvested for luciferase assays at the indicated time points. Induction ratio (circle) was calculated as the luciferase activity in the presence of tetracycline (filled squares) divided by the luciferase activity in the absence of tetracycline (empty squares) at the indicated times of encystation. A result from a representative experiment is shown from three independent experiments. Each point represents the mean ± S.E. of triplicate samples. (B) The expression levels of the tet R during encystation were determined by Western blot analysis using an antibody against tet R. (C) Down-regulation of the endogenous ran gene during encystation. Northern blot analysis of ran transcription using a specific probe. G. lamblia cells were cultured in growth medium (0 h) or 24 h in encystation medium (upper panel). Hybridization of RNA derived from the same cells to a probe for protein disulfide isomerase-1 (pdi-1) gene is shown in the lower panel.
of encystation. Because the luciferase gene was under the control of the ran 32-bp promoter element, we also measured expression of the endogenous ran gene and found that it was down-regulated at 24 h after encystation (Fig. 5C). However, the induction ratio was ∼330 at 8 h after encystation and remained high for the duration of encystation. This suggests that the repression efficiency of tet R is stable during encystation even though the level of luciferase activity driven by the downregulated 32 bp ran promoter-tet operators was lower later in encystation (Fig. 5A). The tet R under the control of the ␣2-tubulin promoter was expressed at high levels throughout encystation as shown by Western blot analysis (Fig. 5B). It is not known whether the plasmid copy number may change during encystation. We also performed excystation of water-resistant cysts harvested after 48 h of encystation and found that the ability to repress and induce luciferase activity was still present after excystation (data not shown).
Because the tet regulatory elements are derived from prokaryotes, they can regulate the expression of a target gene without influencing other endogenous genes or cellular responses [28]. Since most studies utilize a foreign reporter gene, we attempted to express the giardial cwp1 gene in the tet-inducible system. We stably transfected a pNW1 construct in which the cwp1 gene is controlled by the tet-inducible promoter and contains an AU1 epitope tag at its C-terminus (Fig. 6A). We used pNLop2-GILTetR to make pNW1 construct because it was the best derivative of pNLop2-GITetR, which was most active in our previous paper [11]. We intended to know how it works for expression of an encystation specific gene, such as cwp1. The AU1-tagged CWP1 protein, was detected only in the presence of tetracycline in both vegetative and encysting cells (Fig. 6B). The expression level of CWP1 was slightly higher in vegetative cells than in encysting cells. The CWP1 protein also appears to target to structures resembling encystationspecific vesicles (ESV) in both vegetative and encysting cells after tetracycline induction as shown by immunofluorescence assay using the AU1 tag (Fig. 6C). However, tetracycline induction of CWP1 did not lead to cyst production by vegetative cells.
4. Discussion Non-regulated expression of recombinant giardial genes under their own or other giardial promoters has been straightforward [16,23,29–31]. It is also possible to upregulate expression of genes under an encystation promoter, but only during differentiation [16,23,29,30]. The ability to repress and induce expression of transgenes during growth and differentiation is very valuable. We have begun to develop a tet-inducible system for Giardia. This system requires efficient expression of the E. coli tet R protein to bind to the tet operator and prevent transcription of the regulated gene. Giardia has very short 5 and 3 untranslated regions and regulation of transcription and translation are poorly understood. Therefore, we have begun to evaluate some of the influences of flanking sequences on efficiency of tet R expression in Giardia. It has been shown that the prokaryotic tet repressor lacking an NLS can enter the nucleus of an eukaryotic cell [32]. However, we found that the His-tagged tet R targeted to both nuclei and cytosol, indicating that the tet R does not contain a signal sufficient for efficient nuclear targeting in Giardia. Surprisingly, we found that inclusion of either a 6-His tag or the NLS at the N-terminus profoundly affected tet R expression, although only the NLS led to nuclear localization. Addition of an NLS at the N-terminus, but not the C-terminus of the tet R enabled it target to the nuclei exclusively. Staining of the two nuclei was equivalent in a single cell. We also found
C.-H. Sun et al. / Molecular & Biochemical Parasitology 142 (2005) 1–11
9
Fig. 6. Inducible CWP1 protein expression in the tet-inducible expression system. (A) Diagrams of the pNW1 plasmid. The luciferase gene in the construct pNLop2-GILtetR was replaced by the cwp1 coding region with an AU1 tag at its C-terminus to create pNW1. (B) Stable pNW1 transfectants were cultured in growth (veg) or encystation (enc) medium with (+) or without tetracycline (−) and harvested at 24 h and then subjected to Western blot analysis, using anti-AU1 antibody for detection. Coomasie stained total protein loading control is shown below. (C) AU1-tagged CWP1 protein was detected by anti-AU1 antibody in vegetative cells (left panel) and encysting cells (right panel) exposed to tetracycline. No fluorescence was detected in cells not exposed to tetracycline.
that the tet R with addition of an N-terminal 6-His tag led to immunostaining in a higher percentage of cells than the tet R with N-terminal NLS. However, only the N-terminal NLS produced exclusively nuclear targeting. Moreover, the induction ratio for the tet R with N-terminal NLS was higher than that for the 6-His-tagged tet R. This could be due to the presence of more nuclear targeted tet R. Surprisingly, we found that tet R with either an N-terminal 6-His tag or NLS (constructs 2 and 4) was highly expressed and actively repressed the target gene. However, the “wild type” tet R (construct 1) lacking such motifs displayed very poor repression efficiency, as it was expressed at very low levels. The increased mRNA levels suggested that the coding sequence of 6-His tag or NLS may contribute to the transcriptional activation of the tet R gene. Interestingly, a construct (construct 10) with both an NLS and 6 His tag at its N-terminus had ∼9-fold lower induction ratio. It has been shown that sequences located downstream of start codon contain signals for transcriptional regulation [33]. The compact Giardia genome and very short 5 -untranslated regions of most genes analyzed [1,12,22,34] may indicate that efficient expression of certain alien genes in Giardia may need additional sequences. Since the tet R was from E. coli, it may not contain regulatory sequences for effective transcription in Giardia within its coding region. The coding sequence of the 6-His tag or NLS may contain sequences for transcriptional activation of tet R by chance. Since addition of unrelated seven amino acids (ALELHVR) at the N-terminus of the tet R also improved repression efficiency (construct pNLop2-GtetRS), it is also possible that addition of many different sequences at 5 of the coding region of the tet R
gene helps better binding of RNA polymerases. However, the tet R with NLS at its C-terminus displayed the lowest repression efficiency and was expressed at an undetectable level, indicating that the coding sequence of NLS must be at the N-terminus to function in transcriptional activation of tet R. Although the repression efficiency of tet R with a 6-His tag at its C-terminus was as low as wild type tet R (Fig. 1, constructs 1 and 3), it showed higher protein and mRNA levels than wild type tet R (Fig. 3A, constructs 1 and 3). This could result from reducing the function of tet R, because the position of insertion of the 6-His tag at the C-terminus was close to ␣ helix 10 which participates in the formation of homodimer and inducer binding [14,35]. The coding sequence of the NLS or 6-His tag contains several AAG or CATCAC repeats. As demonstrated in nuclear run on assays, the tet R gene with these sequences at its N-terminus is up-regulated due to an increase in the rate of transcription initiation. Further analyses of Giardia transcription factors may help to understand the significance of such sequences in transcriptional regulation. We attempted to establish a tet-inducible system which efficiently shuts off the gene under study. Different promoters placed upstream of the tet R gene influenced the repression efficiency [11]. In this study, three promoters used to drive the tet R with N-terminal 6-His tag were compared. The induction ratios for these three constructs could be an indicator for promoter activity and they were ranked as: ␣2-tubulin > gdh > ␣-giardin. This was consistent with the results of promoter activity identified before that showed: ␣2-tubulin > gdh > ␦-giardin [22], although ␣-giardin was not determined.
10
C.-H. Sun et al. / Molecular & Biochemical Parasitology 142 (2005) 1–11
The tet R protein was expressed at only a moderate level in the two plasmid system. This could be due to the difficulty of maintenance of the components of the two plasmid in the same Giardia cells. In addition, transfectants with two plasmids grow more slowly than trophozoites carrying one plasmid, probably because of the double selection (data not shown). However, this system enabled us to show that raising the expression of tet R by increasing plasmid copy number did lead to higher induction ratios (Fig. 1B). We also demonstrated that it is possible to purify a sufficient amount of 6-His-tagged tet R for biochemical study. Similar approach could be used to purify other proteins of interest. The tet-inducible system is more specific than endogenous-inducible systems, such as encystation-induced gene promoters, which may have pleiotropic effects on Giardia. Moreover, encystation promoters are inactive during vegetative growth and active only during differentiation. We were able to overexpress CWP1 protein in vegetatively growing trophozoites using our tet-inducible system. The overexpressed CWP1 was not cytotoxic, possibly because it was sequestered in a secretory pathway. However, our system allows more effective regulation of gene expression to overcome potential cytotoxicity of an overexpressed gene product. The overexpressed CWP1 did not increase cyst formation. This is likely due to the need for other cyst wall proteins and pathways for cyst formation. The tet R also repressed recombinant CWP 1 expression during encystation. Our tet-inducible system combined with epitope tagging system provides a useful tool for study of gene function in G. lamblia. These studies have revealed strong influences of an exogenous N-terminal NLS or artificial 6-His sequence on the expression of an important prokaryotic repressor protein in Giardia. Further studies are needed to elucidate the mechanisms of these effects.
Acknowledgments This work was supported by grant from the National Science Council (NSC 92-2314-B-002-354) in Taiwan and NIH grants AI42488, AI51687, GM61896, and DK35108 to Frances D. Gillin. This work was supported in part by Department of Medical Research in NTUH.
Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.molbiopara. 2005.03.003.
References [1] Adam RD. Biology of Giardia lamblia. Clin Microbiol Rev 2001;14:447–75.
[2] Gillin FD, Reiner DS, Gault MJ, et al. Encystation and expression of cyst antigens by Giardia lamblia in vitro. Science 1987;235:1040–3. [3] Gillin FD, Reiner DS, McCaffery JM. Cell biology of the primitive eukaryote Giardia lamblia. Annu Rev Microbiol 1996;50:679–705. [4] Eichinger D. Encystation in parasitic protozoa. Curr Opin Microbiol 2001;4:421–6. [5] McArthur AG, Morrison HG, Nixon JE, et al. The Giardia genome project database. FEMS Microbiol Lett 2000;189:271–3. [6] Svard SG, Hagblom P, Palm JE. Giardia lamblia—a model organism for eukaryotic cell differentiation. FEMS Microbiol Lett 2003;218:3–7. [7] Hou G, Le Blancq SM, E Y, Zhu H, Lee MG. Structure of a frequently rearranged rRNA-encoding chromosome in Giardia lamblia. Nucleic Acids Res 1995;23:3310–7. [8] Bernander R, Palm JE, Svard SG. Genome ploidy in different stages of the Giardia lamblia life cycle. Cell Microbiol 2001;1:55–62. [9] Wirtz E, Clayton C. Inducible gene expression in Trypanosomes mediated by a prokaryotic repressor. Science 1995;268:1179–82. [10] Hamann L, Bub H, Tannich E. Tetracycline-controlled gene expression in Entamoeba histolytica. Mol Biochem Parasitol 1997;84:83–91. [11] Sun CH, Tai JH. Development of a tetracycline controlled gene expression system in the parasitic protozoan Giardia lamblia. Mol Biochem Parasitol 2000;105:51–60. [12] Sun CH, Tai JH. Identification and characterization of a ran gene promoter in the primitive protozoan pathogen Giardia lamblia. J Biol Chem 1999;274:19699–706. [13] Meier I, Wray LV, Hillen W. Differential regulation of the Tn10encoded tetracycline resistance genes tetA and tetR by the tandem tet operators O1 and O2. EMBO J 1988;7:567–72. [14] Hillen W, Berens C. Mechanisms underlying expression of Tn10 encoded tetracycline resistance. Annu Rev Microbiol 1994;48:345–69. [15] Keister DB. Axenic culture of Giardia lamblia in TYI-S-33 medium supplemented with bile. Trans R Soc Trop Med Hyg 1983;77:487–8. [16] Sun C-H, McCaffery JM, Reiner DS, Gillin FD. Mining the Giardia lamblia genome for new cyst wall proteins. J Biol Chem 2003;278:21701–8. [17] Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor: Cold Spring Harbor Laboratory Press; 1989. [18] Knodler LA, Svard SG, Silberman JD, Davids BJ, Gillin FD. Developmental gene regulation in Giardia lamblia: first evidence for an encystation-specific promoter and differential 5 mRNA processing. Mol Microbiol 1999;34:327–40. [19] Seshadri V, McArthur AG, Sogin ML, Adam RD. Giardia lamblia RNA polymerase II: amanitin-resistant transcription. J Biol Chem 2003;278:27804–10. [20] Gossen M, Bonin AL, Bujard H. Control of gene activity in higher eukaryotic cells by prokaryotic regulatory elements. Trends Biochem Sci 1993;18:471–5. [21] Sun CH, Chou CF, Tai JH. Stable DNA transfection of the primitive protozoan pathogen Giardia lamblia. Mol Biochem Parasitol 1998;92:123–32. [22] Elmendorf HG, Singer SM, Pierce J, Cowan J, Nash TE. Initiator and upstream elements in the alpha2-tubulin promoter of Giardia lamblia. Mol Biochem Parasitol 2001;113:157–69. [23] Sun CH, Palm D, McArthur AG, Svard SG, Gillin FD. A novel Mybrelated protein involved in transcriptional activation of encystation genes in Giardia lamblia. Mol Microbiol 2002;46:971–84. [24] Abel ES, Davids BJ, Robles LD, Loflin CE, Gillin FD, Chakrabarti R. Possible roles of protein kinase A in cell motility and excystation of the early diverging eukaryote Giardia lamblia. J Biol Chem 2001;276:10320–9. [25] Bertrand KP, Postle K, Wray Jr LV, Reznikoff WS. Construction of a single-copy promoter vector and its use in analysis of regulation of the transposon Tn10 tetracycline resistance determinant. J Bacteriol 1984;158:910–9.
C.-H. Sun et al. / Molecular & Biochemical Parasitology 142 (2005) 1–11 [26] Ramakrishnan G, Vines RR, Mann BJ, Petri WA. A tetracyclineinducible gene expression system in Entamoeba histolytica. Mol Biochem Parasitol 1997;84:93–100. [27] Elmendorf HG, Singer SM, Nash TE. Targeting of proteins to the nuclei of Giardia lamblia. Mol Biochem Parasitol 2000;106:315–9. [28] Gossen M, Bujard H. Tight control of gene expression in mammalian cells by tetracycline-responsive promoters. Proc Natl Acad Sci USA 1992;89:5547–51. [29] Touz MC, Nores MJ, Slavin I, et al. The activity of a developmentally regulated cysteine proteinase is required for cyst wall formation in the primitive eukaryote Giardia lamblia. J Biol Chem 2002;277:8474–81. [30] Marti M, Li Y, Schraner EM, Wild P, Kohler P, Hehl AB. The secretory apparatus of an ancient eukaryote: protein sorting to separate export pathways occurs before formation of transient Golgi-like compartments. Mol Biol Cell 2003;14:1433–47.
11
[31] Touz MC, Kulakova L, Nash TE. Adaptor protein complex 1 mediates the transport of lysosomal proteins from a Golgi-like organelle to peripheral vacuoles in the primitive eukaryote Giardia lamblia. Mol Biol Cell 2004;15:3053–60. [32] Kim HJ, Gatz C, Hillen W, Jones TR. Tetracycline repressorregulated gene repression in recombinant human cytomegalovirus. J Virol 1995;69:2565–73. [33] Dorsett D. Distant liaisons: long-range enhancer-promoter interactions in Drosophila. Curr Opin Genet Dev 1999;9:505–14. [34] Yee J, Mowatt MR, Dennis PP, Nash TE. Transcriptional analysis of the glutamate dehydrogenase gene in the primitive eukaryote, Giardia lamblia. Identification of a primordial gene promoter. J Biol Chem 2000;275:11432–9. [35] Orth P, Schnappinger D, Hillen W, Saenger W, Hinrichs W. Structural basis of gene regulation by the tetracycline inducible Tet repressor–operator system. Nat Struct Biol 2000;7:215–9.
Influence of 5 sequences on expression of the Tet repressor in Giardia lamblia Chin-Hung Sun a,∗ , Li-Hsin Su a , Frances D. Gillin b b
a Department of Parasitology, College of Medicine, National Taiwan University, Taipei, 100 Taiwan, ROC Department of Pathology, University of California at San Diego, School of Medicine, San Diego, CA 92103-8416, USA
Received 20 November 2004; received in revised form 1 February 2005; accepted 1 March 2005 Available online 20 April 2005
Abstract Gene expression is poorly understood in Giardia lamblia. Previously we utilized the Escherichia coli tetracycline regulatory elements to develop a giardial-inducible gene expression system. In this study, we tested the hypothesis that regions flanking the tet repressor (tet R) may influence its expression and affect inducibility of the regulatory system. We found that addition of a 6-His tag or nuclear localization signal (NLS) at the N- but not C-terminus of tet R, increased the induction ratios >100-fold. A non-specific sequence also increased the induction ratio. Fusing NLS at the N-terminus, also led to exclusively nuclear tet R localization. Changing the promoter from gdh or ␣-giardin to ␣2-tubulin increased the induction ratio slightly. Tet R expression at both RNA and protein levels correlated with repression efficiency, indicating that coding sequences of the 6-His tag or NLS may contribute to transcriptional activation of the exotic tet R gene in Giardia. In addition, we found that the tet R system mediated gene repression and induction during encystation. Previous studies used an artificial reporter gene. In this study, we were able to induce overexpression of epitope-tagged cyst wall protein 1 (CWP1) in vegetatively growing Giardia trophozoites. Moreover, we could repress or induce expression of exogenous CWP1 in encysting cells. Taken together, our data suggest that expression of tet R in Giardia is complex and can be strongly influenced by additional sequences, especially at its N-terminus. This system provides insights into expression of an alien gene and can be exploited to regulate gene expression and study important functions in G. lamblia. © 2005 Elsevier B.V. All rights reserved. Keywords: Inducible; Tetracycline; Repressor; Giardia
1. Introduction Giardia lamblia, a major cause of waterborne diarrheal disease, is also of basic biological interest as an early diverging eukaryote [1]. Like Entamoeba and Cryptosporidium, it undergoes differentiation from a pathogenic trophozoite form into a resistant infectious cyst form. Giardia is a valuable model for differentiation of such parasites, as its life cycle can be reproduced in vitro [2–4]. Moreover, the Giardia Abbreviations: NLS, nuclear localization signal; tet R, tet repressor; CWP1, cyst wall protein 1 ∗ Corresponding author. Tel.: +886 2 23123456 8262; fax: +886 2 23915294. E-mail address: [email protected] (C.-H. Sun). 0166-6851/$ – see front matter © 2005 Elsevier B.V. All rights reserved. doi:10.1016/j.molbiopara.2005.03.003
Genome Project is very advanced and SAGE analysis of the transcriptome over the life cycle is in progress [5]. However, >60% of the predicted genes have no known function (http://gmod.mbl.edu/perl/site/giardia?page=intro) and regulation of differentiation is poorly understood [6]. Gene knockout in Giardia is not feasible because of its 4N ploidy [7,8]. The ability to repress and induce expression of a transgene may be crucial, especially in the case of a dominant negative mutant or a protein that may be toxic. Tet-inducible systems have proven valuable in many parasites [9,10]. Therefore, we developed an inducible gene expression system in G. lamblia by introducing the Escherichia coli tet repressor-operator system into the stable DNA transfection system we previously developed [11]. In that system, two copies of the tet operator were inserted downstream of the minimal ran promoter,
2
C.-H. Sun et al. / Molecular & Biochemical Parasitology 142 (2005) 1–11
which had been shown to confer transcription initiation and promoter activity in G. lamblia [12]. The gene encoding the tet repressor protein (tet R) was fused with a 6-His tag to permit its localization and expressed under the control of a 52-bp ␣-giardin promoter. This system allows the level of expression of a target gene to be regulated in a reversible manner as it produced a 50-fold induction of luciferase activity upon the addition of tetracycline to inactivate the tet R. The tet R mediates repression of the basal level of the reporter gene expression as well as induction in response to tetracycline [13,14]. A tight repression could result from sufficiently high amounts of the tet R expressed from a strong promoter [14]. In this study, we tested the hypothesis that regions flanking the tet R coding region might affect its expression and could lead to higher induction ratios. Our original constructs contained an N-terminal 6-His tag in order to facilitate immunolocalization and purification. Since tet R did not target exclusively to the nucleus, we also appended a nuclear localization signal (NLS), which was previously shown to function in Giardia. Since neither the NLS nor the 6-His tage is a normal giardial sequence, we asked whether these foreign sequences might influence giardial expression or nuclear targeting of tet R. We also asked if the tet-inducible system could be exploited to regulate expression of a giardial encystation specific gene during vegetative growth and differentiation. 2. Materials and methods 2.1. Giardia culture Trophozoites of G. lamblia isolate WB (ATCC 30957), clone C6, were cultured in modified TYI-S33 medium [15]. Encystation was induced according to our published procedure [16]. 2.2. RNA extraction, Northern blot analysis, and nuclear run on assays Total RNA was extracted from G. lamblia wild type or indicated transfectants using TRIzol reagent (Life Technologies). Standard procedures were used in electrophoresis, blotting and hybridization of total RNA [17]. Total RNA (10 g) was fractionated and transferred to Zeta-Probe blotting membrane (Bio-Rad). Strand-specific probes were labeled using the Prime-It II kit (Stratagene). The membranes were hybridized and washed as described [18]. Hybridization signals were imaged and quantified using a Storm system (Molecular Dynamics). Nuclear run on assays were performed as previously described [19]. RNA was subsequently purified by using TRIzol reagent (Life Technologies). The synthesized RNA was hybridized to a nylon membrane which contained tet R or neo gene coding region. The tet R gene coding region was amplified by PCR using primers TF (TCTAGATTAGATAAAAGTAAA)
and TR (TTAAGACCCACTTTCACATTT) and pUHD151 [20] template. The neo gene coding region was amplified by PCR using primers NEOF (ATGATTGAACAAGATGGATTGCAC) and NEOR (TCAGAAGAACTCGTCAAGAAGGCG) and pRANneo [21] template.
2.3. Plasmid construction The pNLop2-GtetR, pPop2 and pNLop2-GItetR have been described before [11,16]. All constructs were verified by DNA sequencing with BigDye Terminator 3.1 DNA Sequencing kit and the reaction products were analysed on an ABI 3100 DNA Analyser (Applied Biosystems). The coding sequences of NLS of SV40 large T antigen (KKKRKV; 5 -AAGAAGAAGCGCAAGGTG-3 ) and 6-His tag (HHHHHH; 5 -CATCACCATCACCATCAC-3 ) were added to specific constructs by PCR using specific primers. For constructing pNLop2-GtetRX, pNLop2-GtetRCH, pNLop2GtetRNNL, the tet R gene was amplified by PCR on pUHD15-1 [20] template using primer pairs TXF (GGCGCCATGGATTCTAGATTAGATAAAAGTAAA) and TXR (CGGACTCGAGTTAAGACCCACTTTCACATTT), TXF and TCR (CGGACTCGAGTTAGTGATGGTGATGGTGATGAGACCCACTTTCACATTT), TNLF (GGCGTCATGAAGAAGAAGCGCAAGGTGTCTAGATTAGATAAAAGTAAAG) and TXR, respectively. The resulting fragments were digested with NcoI (BspHI for TNLF, TXR PCR product) and XhoI, and ligated in place of NcoI/XhoI-excised tet R in pGtetR [11]. The tet R expression cassettes in the resulting constructs pGtetRX, pGtetRCH, or pGtetRNNL were amplified by PCR using primers GS (CGATGTCGACGACCACAAATAACGCCTTTA) and GC (AATAATCGATGGTACCAGCTGATCGGCGCC). Each of the PCR products was digested by SalI and ClaI, and cloned into KpnI/ClaIdigested pRANneo together with KpnI/XhoI-digested pLop2. This entailed ligating three fragments together. For constructing pNLop2-GtetRCNL, oligonucleotides (NL2F, TAACCCCAAAAAAGAAGAGAAAGGTCGAAA; NL2R, TAATTCGACCTTTCTCTTCTTTTTTGGGGT) containing the coding sequence of the NLS were phosphorylated, annealed, and cloned into the NdeI-digested and phosphatase-treated pNLop2-GtetRX. The C-terminal insertion of the NLS resulted in a disruption of Ile194 in ␣ helix 10 of the tet R [14]. For constructing pN-TtetR, pNLop2-TtetR [11] was digested with KpnI and self-ligated. For constructing pNRLop2-GItetR, the neomycin phosphotransferase (neo) expression cassette in pRANneo was amplified by PCR using NXF (GGCCTCTAGAAATGGGACAGGATCTAAC) and NHR (GGCCAAGCTTATCGATGTAACGAACCGCTAGAAG), digested with XbaI and HindIII, and cloned into pUC18 vector. The neo expression cassette in the resulting construct was digested with KpnI, and ligated in place of the KpnI-excised neo expression cassette in pNLop2GItetR. The clone with the neo expression cassette in the same orientation with the tet R expression cassette was picked.
C.-H. Sun et al. / Molecular & Biochemical Parasitology 142 (2005) 1–11
To help replace the luciferase gene with a more relevant giardial gene in the subsequent cloning, we needed to use convenient cloning sites. The EcoRI and NcoI sites flanking luciferase gene could not be used because there were additional EcoRI and NcoI sites elsewhere in the vectors. These sites in pNLop2-GILtetR, pNLop2-T2tetR, pNLop2T2tetRNNL were mutated (Fig. 2). During the mutation process, we needed to remove the NcoI site in the neo gene coding region, so the NcoI site in pRANneo was mutated to an AvrII site using PCR-directed mutagenesis to generate pRANneoA. This mutation resulted in a change of His 188 residue to Leu. However, we could not obtain its stable transfectants by G418 selection, indicating that this residue could be important for neo gene function. We finally mutated this NcoI site using primer NEOmF (CTCGTCGTGACCCACGGCGATGCCTGCTTG) and its antisense primer with Quick Change site-directed mutagenesis kit (Stratagene). We did not change any residue of the NEO protein and obtained a good stable transfection system. The EcoRI in the neo expression cassette in pRANneo were also mutated sequentially to generate pRANneoM. To do this, the 5 -flanking region and partial neo gene was amplified by PCR on pRANneo [21] template using primer pairs T7 (AATACGACTCACTATAG) and NEOA (GGCGAAATTTCTGCAGCCCGGGGTGGGCGA). The PCR product was digested with ApoI and XbaI and then ligated into EcoRI/XbaI-digested pRANneo. For constructing pNLop2-GILtetR, the 263-bp 5 -flanking region of ␣-giardin was amplified from genomic DNA with primers GIF (GCGCAAGCTTCTTGCTCAGAAGCGTAAGCCTTG) and GIR (GCGCCCATGGTTTTTAAAACCGAATTGCCATTTTTTGGCGGTATTTTTTGAAGCTC), digested with NcoI and HindIII, and cloned into the NcoI/HindIII-digested pGtetR to replace the gdh promoter. The tet R expression cassette in the resulting plasmid pGILtetR was amplified by PCR using GIS (GGCCGTCGACAAGCTTCTTGCTCAGAAGCGTAAGCCTTG) and GC, digested with SalI and ClaI, and cloned into KpnI/ClaI-digested pRANneoM with KpnI/XhoI-digested pLop2. This entailed ligating three fragments together. For constructing pNLop2-GILtetRNNL, oligonucleotides (NLF, CTAGACCAAAAAAGAAGAGAAAGGTCGAAT; NLR, CTAGATTCGACCTTTCTCTTCTTTTTTGGT) containing coding sequence of NLS were phosphorylated, annealed, and cloned into the XbaI-digested and phosphatase-treated pGILtetR. The tet R expression cassette in the resulting plasmid pGILtetRNNL was amplified by PCR using primers GIS and GC. The PCR product was digested by SalI and ClaI, and cloned into KpnI/ClaI-digested pRANneo with KpnI/XhoI-digested pLop2. This entailed ligating three fragments together. For constructing pNLop2-T2tetR and pNLop2-T2tetRNNL, the tet R gene was amplified by PCR on pUHD15-1 template using primer pairs TBF (GGCGTCATGAATCATCACCATCACCATCACTCTAGATTAGATAAAAGTAAAG) and TXR, TNLF and TXR, digested with BspHI and XhoI, and ligated in place of
3
NcoI/XhoI-excised luciferase gene in pTUB.luc which was a gift from Dr. Steven Singer and Dr. Theodore E. Nash [22]. The tet R expression cassettes in the resulting plasmids were amplified by PCR using primers T5S (GGCGGTCGACCGCAGACGCATGAACGCATG) and GC. Each of the PCR products was digested by SalI and ClaI, and cloned into KpnI/ClaI-digested pRANneoM with KpnI/XhoI-digested pLop2. This entailed ligating three fragments together. For constructing pNW1, the cwp1 gene was amplified from genomic DNA by PCR using primers W1NF (GGCCCCATGGATATGCTCGCTCTCCTTGCTCTTGCA) and W1ER (GGCGAATTCTCAGATGTATCGATACGTATCAGGCGGGGTGAGGCAGTACTC) which encodes an AU1 tag, digested with NcoI and EcoRI, and ligated in place of the NcoI/EcoRI-excised luciferase gene in pNLop2-GILtetR. For constructing pNLop2-GtetRS, the tet R gene was amplified by PCR on pUHD15-1 template using primer pairs TSF (GGCGCCATGGCACTAGAGCTGCATGTCAGGTCTAGATTAGATAAAAGTAAA) and TXR. The resulting fragment was digested with NcoI and XhoI, and ligated in place of NcoI/XhoI-excised tet R in pGtetR. The tet R expression cassette in the resulting construct was amplified by PCR using primers G5C (CGATATCGATGACCACAAATAACGCCTTTA) and GC. The PCR products was digested by ClaI, and cloned into ClaI-digested and phosphatase-treated pNLop2-GtetRX. 2.4. Transfection and luciferase assays Plasmids were transfected into G. lamblia by electroporation and the stable transfectants were established as described [21,23]. In this study, the stable transfectants of pN series plasmids were maintained under 150 g/ml G418 selection, except as specified in Fig. 1B. For the two plasmid system, Giardia cells were first transfected with plasmid pNTtetR and selected in 150 g/ml G418. The stable transfectants were transfected with plasmid pPop2 and then the cells were doubly selected in both 150 g/ml G418 and 54 g/ml puromycin. For induction, tetracycline 10 g/ml was added into the growth medium as described [11]. Luciferase activity of the transfectants was assayed as described [11], but since it was measured with a different instrument, Luminometer TD-20/20 (Turner), values in the two papers are not directly comparable. 2.5. Immunofluorescence and immunoblot assays The stable transfectants were harvested, attached to glass coverslips, and then fixed as described [24]. Cells were reacted with anti-tet R monoclonal antibody (MoBiTec, 1/500 in blocking buffer), and anti-mouse ALEXA 568 (Molecular Probes, 1/500 in blocking buffer) as the detector. The protein was localized on a Zeiss LSM 510 laser scanning confocal microscope. Western blots were probed with anti-tet R monoclonal antibody (MoBiTec, 1/5000) or anti-AU1 monoclonal antibody
4
C.-H. Sun et al. / Molecular & Biochemical Parasitology 142 (2005) 1–11
Fig. 1. N-terminal 6-His tag or NLS increases the induction ratio and immunostaining of the tet R. (A) A series of constructs are illustrated in the left panel and numbered. In all five constructs, the neo gene (open box) is under the control of the 5 - and 3 -flanking regions of the ran (stippled box) gene. The luciferase reporter gene (luc+, open box) is under the control of the 32-bp ran promoter element (arrow, striped box) and 3 -flanking region of the ran gene (dotted box). Two tet operators (black box) are inserted downstream of the ran promoter. The tet R (open box) gene is under the control of the 52-bp gdh (slashed box) promoter and flanked by 3 -flanking region of the gdh gene (slashed box). Constructs 2–5 are the same as construct 1 except that a 6-His tag (small dotted box, constructs 2 and 3) or NLS (black box, constructs 4 and 5) was fused at the N-(constructs 2 and 4) or C-terminus (constructs 3 and 5) of the tet R gene. After stable transfection with these constructs, cells were cultured at an initial density of 5 × 106 cells for 24 h in the absence or presence of 10 g/ml tetracycline and then assayed for luciferase activity. Induction ratio (activity with tetracycline divided by activity without tetracycline) is shown but luciferase activity is not. Results are expressed as the mean of at least three separate experiments performed with two samples for each construct. Localization of tet R in the above transfectants was analyzed by indirect immunofluorescence assay using anti-tet R antibody. The tet R stained in nuclei only (N) or in both nuclei and cytosol of the same cells (N + C) and the percentage of positively stained cells are shown. (B) Increasing G418 concentration increases the induction ratio of tet R in trans in a two plasmid system. In the tet R plasmid pN-TtetR, the tet R gene is driven by ␣-tubulin (α-tub, gray box) promoter under neo selection. In the reporter plasmid pPop2, the pac gene (open box) is under the control of the 5 - and 3 -flanking regions of the gdh (slashed box) gene.
(Berkeley Antibody, 1/5000) and detected with peroxidaseconjugated goat anti-mouse IgG (Pierce, 1/5000) and enhanced chemiluminescence ECL Detection Reagents (Amersham Biosciences RPN2106).
3. Results
2.6. Purification of tet R protein from Giardia
develop an optimal inducible expression system, several constructs were generated by incorporating a luciferase expression cassette as a reporter into a stable transfection vector pRANneo together with the tet R gene with different modifications. These constructs were transfected into G. lamblia and stable episomal transfectants were established under G418 selection. The induction ratio was calculated as luciferase activity in the presence of tetracycline (induction) divided by that in the absence of tetracycline (repression). A higher induction ratio generally reflects a lower or more highly repressed basal level of expression in the absence of tetracycline. Since the tet R mediates repression of basal luciferase expression, its amount and function directly influence the induction ratio [25,26]. Previously we found that pNLop2-GtetR which contains the N-terminally 6-His-
Giardia trophozoites (∼108 cells) carrying plasmid pNLop2-T2tetR (construct 11) were harvested by centrifugation and lysed in 10 ml of buffer A (50 mM sodium phosphate, pH 8.0, 300 mM NaCl, 10% glycerol, 1% Nonidet P40) containing complete protease inhibitor cocktail (Roche). The samples were centrifuged and the supernatant was mixed with 1 ml of a 50% slurry of Ni-NTA superflow (Qiagen). The resin was washed with buffer A containing 20 mM imidazole and eluted with buffer A containing 250 mM imidazole. Protein purity and concentration were estimated by Coomassie blue staining compared with bovine serum albumin. The tet R protein was detected by anti-tet R antibody in Western blot.
3.1. Inducible expression from the tet R with 6-His tag or NLS
C.-H. Sun et al. / Molecular & Biochemical Parasitology 142 (2005) 1–11
tagged tet R under the control of the gdh promoter mediated an induction ratio of ∼9.7 [11]. In our current studies, the same construct measured with a different luciferase assay instrument resulted in a much higher induction ratio, ∼768, possibly because of greater sensitivity (Fig. 1A, construct 2). The luciferase activity is not shown because it was always restored to full activity in the presence of tetracycline in these experiments. We further used this assay system to evaluate the roles of certain flanking sequences on expression of tet R. We had included an N-terminal 6-His tag in our original constructs to facilitate immunolocalization of tet R [11]. Surprisingly, we found that removal of this 6-His coding region from the N-terminus or placement of the 6-His tag at the C-terminus decreased the induction ratio by ∼100 fold (Fig. 1, constructs 1–3). Fusion of the tet R with an NLS from SV40 large T antigen at its N-terminus was previously shown to help tet R target to cell nuclei in G. lamblia [27]. Therefore, we asked whether the nuclear targeting of tet R can improve repression efficiency. As Fig. 1A shows, addition of NLS at the N-terminus of the tet R resulted in a greatly increased induction ratio to ∼1014 (pNLop2-GtetRNNL, construct 4 versus construct 1). However, addition of NLS at the C-terminus of tet R resulted in an induction ratio of only ∼1 (pNLop2-GtetRCNL, construct 5). We further asked whether addition of a different sequence at the N-terminus of the tet R can improve repression efficiency. We fused seven amino acids (ALELHVR) at the N-terminus of the tet R (construct pNLop2-GtetRS, data not shown) and found that the induction ratio was increased to ∼700. The ALELHVR sequence does not occur in the giardial ORF database. The cellular locations of tet R in the transfectants were also examined by immunofluorescence assay. The wild type tet R or tet R with 6-His tag at N- or C-terminus localized to both nuclei and cytosol (Fig. 1A, additional data not shown). The percentage of positively stained cells corresponded qualitatively to the induction ratio (wild type tet R, tet R with 6-His tag at N- or C-terminus, ∼0.1, ∼20, or ∼2%, respectively). The tet R with NLS at its N-terminus localized exclusively to the nuclei and ∼10% of the cells were stained. However, the tet R with the NLS at its C-terminus localized to both nuclei and cytosol and only ∼0.1% cells were stained, similar to wild type tet R. Previously we showed that the copy number of nonregulated (episomal) plasmids could be increased by raising the drug selection pressure [21]. We now asked whether we can increase the tet R expression level by modulating the copy number of the plasmid containing the tet R expression cassette. It was necessary to analyze a system which consists of two separate plasmids, one encodes the tet R under the control of the ␣-tubulin promoter with neomycin selection, and the second contains the luciferase gene driven by the tet operator minimal promoter under independent puromycin selection (pN-TtetR and pPop2, Fig. 1B, construct 6). The
5
induction ratios of this system could be increased ∼3-fold by increasing tet R plasmid levels (by increasing G418 levels from 150 to 1200 g/ml). (Fig. 1B). The idea that this may be due to increase in plasmid level is based on similarity of the tet R plasmid with the pRANneo/GDHluc [21] plasmid for which we directly demonstrated increased copy number with greater G418 concentration [21]. 3.2. Role of the promoter directing tet R gene in optimal induction Tight repression could result from higher amounts of the tet R expressed from a stronger promoter. Previous studies showed that the tet R gene under the control of a 52-bp ␣giardin (GenBank accession no. X52485) promoter resulted in a 50-fold increase upon tetracycline induction (pNLop2GItetR) [11]. In this study, we obtained an induction ratio of ∼544 for the same construct (Fig. 2, construct 7). To improve the tet R gene expression, we modified the promoter driving the tet R gene. We found that elongating the ␣-giardin promoter from 52 to 263 bp resulted in a smaller, but significant (p < 0.05) increase in induction ratio from ∼545 to ∼678 (Fig. 2, constructs 7 and 9). We attempted to increase the tet R expression by reversing the orientation of the pRANneo expression cassette, which was in the same orientation relative to the direction of tet R transcription (pNRLop2GItetR) to avoid any possible anti-sense effect. However, this change did not significantly influence induction ratios (constructs 7 and 8). We also attempted to use the ␣2-tubulin promoter which has been shown previously to be stronger than the gdh promoter to drive the expression of the tet R gene [22]. This resulted in an increase of induction ratio to ∼1153 (pNLop2-T2tetR, construct 11). Addition of an NLS to the tet R at its N-terminus (pNLop2-T2tetRNNL, construct 12) resulted in a further increased induction ratio to ∼1468. The tet R for the pNLop2-T2tetRNNL construct localized exclusively to the nuclei and ∼30% of the cells were stained. However, addition of NLS to tet R with a 6His tag at its N-terminus did not increase the induction ratio but strongly decreased it to ∼76 (pNLop2-GILtetRNNL, construct 10). 3.3. Expression of tet R mRNA and protein in Giardia transfectants To determine whether the role of the 6-His tag or NLS was primarily at the transcriptional or translational level in control of the tet R gene, we analyzed tet R protein expression. In the gdh promoter system, the highest levels of the tet R protein were found for tet R with 6-His tag (construct 2) or NLS (construct 4) at their N-terminus (Fig. 3A, left panel). There was some expression of the tet R with 6-His tag at C-terminus (construct 3). However, expression of wild type tet R (construct 1) or tet R with a C-terminal NLS (construct 5) was not detected. The tet R in the two plasmid system which contains the N-terminal 6-His tag was also expressed
6
C.-H. Sun et al. / Molecular & Biochemical Parasitology 142 (2005) 1–11
Fig. 2. Effect of the promoter directing tet R gene expression on induction ratio. Constructs illustrated as described in Fig. 1 contain the tet R gene driven by the 52-bp ␣-giardin (constructs 7 and 8) or 263-bp ␣-giardin (constructs 9 and 10) or 355-bp ␣2-tubulin (constructs 11 and 12) promoter and fused with 6-His tag (constructs 7, 8, 9 and 11) or NLS (construct 12) or both (construct 10). In construct 9, pNRLop2-GItetR, the neo gene expression cassette is in the reverse orientation. Mutations at two NcoI sites (triangles) and one EcoRI site (diamond) were introduced for easy cloning of a tested gene in some constructs. They did not affect the induction ratios. Stable transfectants of these constructs were treated with tetracycline and assayed as described in Fig. 1.
at a detectable level. In other constructs with ␣-giardin or ␣2tubulin promoters, the expression levels of the tet R protein corresponded to the induction ratio (Fig. 3A, right panel). The molecular weight of the Tet R in the pNLop2-GILtetRNNL transfectants (construct 10) was slightly higher than that of other tet R because of the presence of both 6-His tag and NLS at its N-terminus (Fig. 3A, right panel, last lane). It is possible that the 6-His tag or NLS coding sequences may influence the transcript level of the tet R gene. Northern blot analysis showed that the transcript levels of the tet R were similar to the induction ratios. The ∼0.7-kb tet R transcript was detected in a basal level in the transfectants containing wild type tet R or tet R with a C-terminal NLS (Fig. 3B, constructs 1 and 5). There were comparatively highest levels of tet R transcript in the transfectants containing tet R with 6-His tag or NLS at N-terminus (constructs 2 and 4). There was less tet R transcript in the transfectants containing tet R with a C-terminal 6-His tag (construct 3). Primer extension was also used to determine the location of the 5 end of the tet R transcript in the various constructs. We found that the same transcription start sites were used in the transfectants containing tet R in constructs 1–5, all under the control of the gdh promoter (data not shown). These results indicate that the coding sequences for the 6-His tag or the NLS at
the N-terminus of tet R can increase the transcript levels of the tet R gene but do not change the transcription start sites. These data suggest that the levels of tet R mRNA and protein correlate with each other and with the induction ratios of each construct. We carried out nuclear run-on assays in order to determine whether the increased transcript levels of tet R in the presence of the 6-His tag or NLS is due to an increased rate of transcription initiation, as opposed to an increase in mRNA stability. As shown in Fig. 4, moderately strong signals for tet R were produced by nuclei from the transfectants containing tet R with 6-His tag or NLS at their N-terminus (constructs 2 and 4). The signal from the transfectants containing wild type tet R was reduced (construct 1) and no signal was obtained from wild type nontransfected WB cells (WT). Using neo as a control, similar intensity of signals were produced from these transfectants (constructs 1, 2, and 4) and no signal was produced from wild type nontransfected WB cells. These results clearly demonstrate that the tet R gene with 6-His tag or NLS at N-terminus is up-regulated by an increase in the rate of transcription initiation. The N-terminal 6-His tag in the pNLop2-T2tetR transfectants (construct 11) permitted us to purify tet R which was detected by anti-tet R antibody in Western blot compared
C.-H. Sun et al. / Molecular & Biochemical Parasitology 142 (2005) 1–11
7
Fig. 3. Tet R protein and mRNA expression in transfectants. (A) Cellular proteins from wild type nontransfected WB cells (WT) and stable transfectants from different constructs described in Figs. 1 and 2 were fractionated in a 12% SDS–PAGE for Western blot. The blot was probed by anti-tet R antibody. Equal amounts of proteins loaded were confirmed by SDS–PAGE and Coomassie blue staining (data not shown). In this study, the stable transfectants of pN series plasmids were maintained under 150 g/ml G418 selection. For the two plasmid system pN-tetR + pPop2, the stable transfectants were maintained in both 150 g/ml G418 and 54 g/ml puromycin. (B) Northern blot analysis of tet R transcription in specific transfectants described in Fig. 1 (upper panel). A loading control of hybridization of RNA derived from the same cells to a probe for the endogenous ran gene is shown in the lower panel. (C) Cellular proteins from wild type nontransfected WB cells (WT) and pNLop2-T2tetR transfectants (construct 11) were purified by nickel-affinity chromatography. Purified proteins were visualized by Coomassie staining of a 12% SDS–PAGE gel (left panel). The tet R protein was detected by anti-tet R antibody in Western blot (right panel).
with Coomassie-stained gel of fractions from wild-type Giardia cells (Fig. 3C). This result indicates that overexpressed protein with a 6-His tag can be purified from Giardia transfectants. 3.4. Tet R-inducible luciferase expression during encystation
Fig. 4. Nuclear run-on assays of the tet R gene in nuclei from transfectants. Labeled RNA prepared from nuclear transcription using nuclei from wild type nontransfected WB cells (WT) and stable transfectants from constructs 1, 2, and 4 as indicated, was hybridized to a membrane containing bound DNA from the tet R gene or the neo gene as indicated.
Since all studies were in vegetatively growing trophozoites, we next asked whether the promoter activity in the tet-inducible system can function during encystation by monitoring the construct with the optimal induction ratio, pNLop2-T2tetRNNL (construct 12). Cells were transferred to encystation medium and tetracycline added at 0 time (Fig. 5A). The luciferase activity was detectable at 1.5 h after initiation of encystation, and increased linearly to a peak value at 8 h of encystation. Luciferase activity decreased at subsequent times and was ∼half of the peak value at 24 h
8
C.-H. Sun et al. / Molecular & Biochemical Parasitology 142 (2005) 1–11
3.5. Tet R-inducible system used for regulated cwp1 gene expression
Fig. 5. (A) Induction of luciferase expression during encystation in pNLop2T2tetRNNL (construct 12) transfectants. Trophozoites grown to late log phase were transferred to encystation medium at an initial density of 5 × 105 cells/ml in the absence or presence of 10 g/ml tetracycline and then harvested for luciferase assays at the indicated time points. Induction ratio (circle) was calculated as the luciferase activity in the presence of tetracycline (filled squares) divided by the luciferase activity in the absence of tetracycline (empty squares) at the indicated times of encystation. A result from a representative experiment is shown from three independent experiments. Each point represents the mean ± S.E. of triplicate samples. (B) The expression levels of the tet R during encystation were determined by Western blot analysis using an antibody against tet R. (C) Down-regulation of the endogenous ran gene during encystation. Northern blot analysis of ran transcription using a specific probe. G. lamblia cells were cultured in growth medium (0 h) or 24 h in encystation medium (upper panel). Hybridization of RNA derived from the same cells to a probe for protein disulfide isomerase-1 (pdi-1) gene is shown in the lower panel.
of encystation. Because the luciferase gene was under the control of the ran 32-bp promoter element, we also measured expression of the endogenous ran gene and found that it was down-regulated at 24 h after encystation (Fig. 5C). However, the induction ratio was ∼330 at 8 h after encystation and remained high for the duration of encystation. This suggests that the repression efficiency of tet R is stable during encystation even though the level of luciferase activity driven by the downregulated 32 bp ran promoter-tet operators was lower later in encystation (Fig. 5A). The tet R under the control of the ␣2-tubulin promoter was expressed at high levels throughout encystation as shown by Western blot analysis (Fig. 5B). It is not known whether the plasmid copy number may change during encystation. We also performed excystation of water-resistant cysts harvested after 48 h of encystation and found that the ability to repress and induce luciferase activity was still present after excystation (data not shown).
Because the tet regulatory elements are derived from prokaryotes, they can regulate the expression of a target gene without influencing other endogenous genes or cellular responses [28]. Since most studies utilize a foreign reporter gene, we attempted to express the giardial cwp1 gene in the tet-inducible system. We stably transfected a pNW1 construct in which the cwp1 gene is controlled by the tet-inducible promoter and contains an AU1 epitope tag at its C-terminus (Fig. 6A). We used pNLop2-GILTetR to make pNW1 construct because it was the best derivative of pNLop2-GITetR, which was most active in our previous paper [11]. We intended to know how it works for expression of an encystation specific gene, such as cwp1. The AU1-tagged CWP1 protein, was detected only in the presence of tetracycline in both vegetative and encysting cells (Fig. 6B). The expression level of CWP1 was slightly higher in vegetative cells than in encysting cells. The CWP1 protein also appears to target to structures resembling encystationspecific vesicles (ESV) in both vegetative and encysting cells after tetracycline induction as shown by immunofluorescence assay using the AU1 tag (Fig. 6C). However, tetracycline induction of CWP1 did not lead to cyst production by vegetative cells.
4. Discussion Non-regulated expression of recombinant giardial genes under their own or other giardial promoters has been straightforward [16,23,29–31]. It is also possible to upregulate expression of genes under an encystation promoter, but only during differentiation [16,23,29,30]. The ability to repress and induce expression of transgenes during growth and differentiation is very valuable. We have begun to develop a tet-inducible system for Giardia. This system requires efficient expression of the E. coli tet R protein to bind to the tet operator and prevent transcription of the regulated gene. Giardia has very short 5 and 3 untranslated regions and regulation of transcription and translation are poorly understood. Therefore, we have begun to evaluate some of the influences of flanking sequences on efficiency of tet R expression in Giardia. It has been shown that the prokaryotic tet repressor lacking an NLS can enter the nucleus of an eukaryotic cell [32]. However, we found that the His-tagged tet R targeted to both nuclei and cytosol, indicating that the tet R does not contain a signal sufficient for efficient nuclear targeting in Giardia. Surprisingly, we found that inclusion of either a 6-His tag or the NLS at the N-terminus profoundly affected tet R expression, although only the NLS led to nuclear localization. Addition of an NLS at the N-terminus, but not the C-terminus of the tet R enabled it target to the nuclei exclusively. Staining of the two nuclei was equivalent in a single cell. We also found
C.-H. Sun et al. / Molecular & Biochemical Parasitology 142 (2005) 1–11
9
Fig. 6. Inducible CWP1 protein expression in the tet-inducible expression system. (A) Diagrams of the pNW1 plasmid. The luciferase gene in the construct pNLop2-GILtetR was replaced by the cwp1 coding region with an AU1 tag at its C-terminus to create pNW1. (B) Stable pNW1 transfectants were cultured in growth (veg) or encystation (enc) medium with (+) or without tetracycline (−) and harvested at 24 h and then subjected to Western blot analysis, using anti-AU1 antibody for detection. Coomasie stained total protein loading control is shown below. (C) AU1-tagged CWP1 protein was detected by anti-AU1 antibody in vegetative cells (left panel) and encysting cells (right panel) exposed to tetracycline. No fluorescence was detected in cells not exposed to tetracycline.
that the tet R with addition of an N-terminal 6-His tag led to immunostaining in a higher percentage of cells than the tet R with N-terminal NLS. However, only the N-terminal NLS produced exclusively nuclear targeting. Moreover, the induction ratio for the tet R with N-terminal NLS was higher than that for the 6-His-tagged tet R. This could be due to the presence of more nuclear targeted tet R. Surprisingly, we found that tet R with either an N-terminal 6-His tag or NLS (constructs 2 and 4) was highly expressed and actively repressed the target gene. However, the “wild type” tet R (construct 1) lacking such motifs displayed very poor repression efficiency, as it was expressed at very low levels. The increased mRNA levels suggested that the coding sequence of 6-His tag or NLS may contribute to the transcriptional activation of the tet R gene. Interestingly, a construct (construct 10) with both an NLS and 6 His tag at its N-terminus had ∼9-fold lower induction ratio. It has been shown that sequences located downstream of start codon contain signals for transcriptional regulation [33]. The compact Giardia genome and very short 5 -untranslated regions of most genes analyzed [1,12,22,34] may indicate that efficient expression of certain alien genes in Giardia may need additional sequences. Since the tet R was from E. coli, it may not contain regulatory sequences for effective transcription in Giardia within its coding region. The coding sequence of the 6-His tag or NLS may contain sequences for transcriptional activation of tet R by chance. Since addition of unrelated seven amino acids (ALELHVR) at the N-terminus of the tet R also improved repression efficiency (construct pNLop2-GtetRS), it is also possible that addition of many different sequences at 5 of the coding region of the tet R
gene helps better binding of RNA polymerases. However, the tet R with NLS at its C-terminus displayed the lowest repression efficiency and was expressed at an undetectable level, indicating that the coding sequence of NLS must be at the N-terminus to function in transcriptional activation of tet R. Although the repression efficiency of tet R with a 6-His tag at its C-terminus was as low as wild type tet R (Fig. 1, constructs 1 and 3), it showed higher protein and mRNA levels than wild type tet R (Fig. 3A, constructs 1 and 3). This could result from reducing the function of tet R, because the position of insertion of the 6-His tag at the C-terminus was close to ␣ helix 10 which participates in the formation of homodimer and inducer binding [14,35]. The coding sequence of the NLS or 6-His tag contains several AAG or CATCAC repeats. As demonstrated in nuclear run on assays, the tet R gene with these sequences at its N-terminus is up-regulated due to an increase in the rate of transcription initiation. Further analyses of Giardia transcription factors may help to understand the significance of such sequences in transcriptional regulation. We attempted to establish a tet-inducible system which efficiently shuts off the gene under study. Different promoters placed upstream of the tet R gene influenced the repression efficiency [11]. In this study, three promoters used to drive the tet R with N-terminal 6-His tag were compared. The induction ratios for these three constructs could be an indicator for promoter activity and they were ranked as: ␣2-tubulin > gdh > ␣-giardin. This was consistent with the results of promoter activity identified before that showed: ␣2-tubulin > gdh > ␦-giardin [22], although ␣-giardin was not determined.
10
C.-H. Sun et al. / Molecular & Biochemical Parasitology 142 (2005) 1–11
The tet R protein was expressed at only a moderate level in the two plasmid system. This could be due to the difficulty of maintenance of the components of the two plasmid in the same Giardia cells. In addition, transfectants with two plasmids grow more slowly than trophozoites carrying one plasmid, probably because of the double selection (data not shown). However, this system enabled us to show that raising the expression of tet R by increasing plasmid copy number did lead to higher induction ratios (Fig. 1B). We also demonstrated that it is possible to purify a sufficient amount of 6-His-tagged tet R for biochemical study. Similar approach could be used to purify other proteins of interest. The tet-inducible system is more specific than endogenous-inducible systems, such as encystation-induced gene promoters, which may have pleiotropic effects on Giardia. Moreover, encystation promoters are inactive during vegetative growth and active only during differentiation. We were able to overexpress CWP1 protein in vegetatively growing trophozoites using our tet-inducible system. The overexpressed CWP1 was not cytotoxic, possibly because it was sequestered in a secretory pathway. However, our system allows more effective regulation of gene expression to overcome potential cytotoxicity of an overexpressed gene product. The overexpressed CWP1 did not increase cyst formation. This is likely due to the need for other cyst wall proteins and pathways for cyst formation. The tet R also repressed recombinant CWP 1 expression during encystation. Our tet-inducible system combined with epitope tagging system provides a useful tool for study of gene function in G. lamblia. These studies have revealed strong influences of an exogenous N-terminal NLS or artificial 6-His sequence on the expression of an important prokaryotic repressor protein in Giardia. Further studies are needed to elucidate the mechanisms of these effects.
Acknowledgments This work was supported by grant from the National Science Council (NSC 92-2314-B-002-354) in Taiwan and NIH grants AI42488, AI51687, GM61896, and DK35108 to Frances D. Gillin. This work was supported in part by Department of Medical Research in NTUH.
Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.molbiopara. 2005.03.003.
References [1] Adam RD. Biology of Giardia lamblia. Clin Microbiol Rev 2001;14:447–75.
[2] Gillin FD, Reiner DS, Gault MJ, et al. Encystation and expression of cyst antigens by Giardia lamblia in vitro. Science 1987;235:1040–3. [3] Gillin FD, Reiner DS, McCaffery JM. Cell biology of the primitive eukaryote Giardia lamblia. Annu Rev Microbiol 1996;50:679–705. [4] Eichinger D. Encystation in parasitic protozoa. Curr Opin Microbiol 2001;4:421–6. [5] McArthur AG, Morrison HG, Nixon JE, et al. The Giardia genome project database. FEMS Microbiol Lett 2000;189:271–3. [6] Svard SG, Hagblom P, Palm JE. Giardia lamblia—a model organism for eukaryotic cell differentiation. FEMS Microbiol Lett 2003;218:3–7. [7] Hou G, Le Blancq SM, E Y, Zhu H, Lee MG. Structure of a frequently rearranged rRNA-encoding chromosome in Giardia lamblia. Nucleic Acids Res 1995;23:3310–7. [8] Bernander R, Palm JE, Svard SG. Genome ploidy in different stages of the Giardia lamblia life cycle. Cell Microbiol 2001;1:55–62. [9] Wirtz E, Clayton C. Inducible gene expression in Trypanosomes mediated by a prokaryotic repressor. Science 1995;268:1179–82. [10] Hamann L, Bub H, Tannich E. Tetracycline-controlled gene expression in Entamoeba histolytica. Mol Biochem Parasitol 1997;84:83–91. [11] Sun CH, Tai JH. Development of a tetracycline controlled gene expression system in the parasitic protozoan Giardia lamblia. Mol Biochem Parasitol 2000;105:51–60. [12] Sun CH, Tai JH. Identification and characterization of a ran gene promoter in the primitive protozoan pathogen Giardia lamblia. J Biol Chem 1999;274:19699–706. [13] Meier I, Wray LV, Hillen W. Differential regulation of the Tn10encoded tetracycline resistance genes tetA and tetR by the tandem tet operators O1 and O2. EMBO J 1988;7:567–72. [14] Hillen W, Berens C. Mechanisms underlying expression of Tn10 encoded tetracycline resistance. Annu Rev Microbiol 1994;48:345–69. [15] Keister DB. Axenic culture of Giardia lamblia in TYI-S-33 medium supplemented with bile. Trans R Soc Trop Med Hyg 1983;77:487–8. [16] Sun C-H, McCaffery JM, Reiner DS, Gillin FD. Mining the Giardia lamblia genome for new cyst wall proteins. J Biol Chem 2003;278:21701–8. [17] Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor: Cold Spring Harbor Laboratory Press; 1989. [18] Knodler LA, Svard SG, Silberman JD, Davids BJ, Gillin FD. Developmental gene regulation in Giardia lamblia: first evidence for an encystation-specific promoter and differential 5 mRNA processing. Mol Microbiol 1999;34:327–40. [19] Seshadri V, McArthur AG, Sogin ML, Adam RD. Giardia lamblia RNA polymerase II: amanitin-resistant transcription. J Biol Chem 2003;278:27804–10. [20] Gossen M, Bonin AL, Bujard H. Control of gene activity in higher eukaryotic cells by prokaryotic regulatory elements. Trends Biochem Sci 1993;18:471–5. [21] Sun CH, Chou CF, Tai JH. Stable DNA transfection of the primitive protozoan pathogen Giardia lamblia. Mol Biochem Parasitol 1998;92:123–32. [22] Elmendorf HG, Singer SM, Pierce J, Cowan J, Nash TE. Initiator and upstream elements in the alpha2-tubulin promoter of Giardia lamblia. Mol Biochem Parasitol 2001;113:157–69. [23] Sun CH, Palm D, McArthur AG, Svard SG, Gillin FD. A novel Mybrelated protein involved in transcriptional activation of encystation genes in Giardia lamblia. Mol Microbiol 2002;46:971–84. [24] Abel ES, Davids BJ, Robles LD, Loflin CE, Gillin FD, Chakrabarti R. Possible roles of protein kinase A in cell motility and excystation of the early diverging eukaryote Giardia lamblia. J Biol Chem 2001;276:10320–9. [25] Bertrand KP, Postle K, Wray Jr LV, Reznikoff WS. Construction of a single-copy promoter vector and its use in analysis of regulation of the transposon Tn10 tetracycline resistance determinant. J Bacteriol 1984;158:910–9.
C.-H. Sun et al. / Molecular & Biochemical Parasitology 142 (2005) 1–11 [26] Ramakrishnan G, Vines RR, Mann BJ, Petri WA. A tetracyclineinducible gene expression system in Entamoeba histolytica. Mol Biochem Parasitol 1997;84:93–100. [27] Elmendorf HG, Singer SM, Nash TE. Targeting of proteins to the nuclei of Giardia lamblia. Mol Biochem Parasitol 2000;106:315–9. [28] Gossen M, Bujard H. Tight control of gene expression in mammalian cells by tetracycline-responsive promoters. Proc Natl Acad Sci USA 1992;89:5547–51. [29] Touz MC, Nores MJ, Slavin I, et al. The activity of a developmentally regulated cysteine proteinase is required for cyst wall formation in the primitive eukaryote Giardia lamblia. J Biol Chem 2002;277:8474–81. [30] Marti M, Li Y, Schraner EM, Wild P, Kohler P, Hehl AB. The secretory apparatus of an ancient eukaryote: protein sorting to separate export pathways occurs before formation of transient Golgi-like compartments. Mol Biol Cell 2003;14:1433–47.
11
[31] Touz MC, Kulakova L, Nash TE. Adaptor protein complex 1 mediates the transport of lysosomal proteins from a Golgi-like organelle to peripheral vacuoles in the primitive eukaryote Giardia lamblia. Mol Biol Cell 2004;15:3053–60. [32] Kim HJ, Gatz C, Hillen W, Jones TR. Tetracycline repressorregulated gene repression in recombinant human cytomegalovirus. J Virol 1995;69:2565–73. [33] Dorsett D. Distant liaisons: long-range enhancer-promoter interactions in Drosophila. Curr Opin Genet Dev 1999;9:505–14. [34] Yee J, Mowatt MR, Dennis PP, Nash TE. Transcriptional analysis of the glutamate dehydrogenase gene in the primitive eukaryote, Giardia lamblia. Identification of a primordial gene promoter. J Biol Chem 2000;275:11432–9. [35] Orth P, Schnappinger D, Hillen W, Saenger W, Hinrichs W. Structural basis of gene regulation by the tetracycline inducible Tet repressor–operator system. Nat Struct Biol 2000;7:215–9.