- Email: [email protected]
Influence of chemotherapy for lymphoma in canine parvovirus DNA distribution and specific humoral immunity
Comparative Immunology, Microbiology and Infectious Diseases 37 (2014) 313–320
Contents lists available at ScienceDirect
Comparative Immunology, Microbiology and Infectious Diseases journal homepage: www.elsevier.com/locate/cimid
Influence of chemotherapy for lymphoma in canine parvovirus DNA distribution and specific humoral immunity M.A. Elias a,∗ , A. Duarte a , T. Nunes a , A.M. Lourenc¸o a,b , B.S. Braz a , G. Vicente a,b , J. Henriques c , L. Tavares a a Center for Interdisciplinary Research in Animal Health, Faculty of Veterinary Medicine, University of Lisbon, Avenida da Universidade Técnica, 1300-477 Lisbon, Portugal b Faculty of Veterinary Medicine Teaching Hospital, University of Lisbon, Avenida da Universidade Técnica, 1300-477 Lisbon, Portugal c Oncovet, Avenida de Berna, 35, 1050-038 Lisbon, Portugal
a r t i c l e
i n f o
Article history: Received 27 June 2014 Received in revised form 25 September 2014 Accepted 29 September 2014 Keywords: Immunosuppression Canine lymphoma CHOP Canine parvovirus Dog
a b s t r a c t In man, the combination of cancer and its treatment increases patients’ susceptibility to opportunistic infections, due to immune system impairment. In veterinary medicine little information is available concerning this issue. In order to evaluate if a similar dysfunction is induced in small animals undergoing chemotherapy, we assessed the complete blood count, leukocytic, plasma and fecal canine parvovirus (CPV) viral load, and anti-CPV protective antibody titers, in dogs with lymphoma treated with CHOP (cyclophosphamide, doxorubicin, vincristine and prednisolone) protocol, before and during chemotherapy. There was no evidence of decreased immune response, either at admission or after two chemotherapy cycles, indicating that the previously established immunity against CPV was not significantly impaired, supporting the idea that immunosuppression as a result of hematopoietic neoplasms and their treatment in dogs requires further investigation and conclusions cannot be extrapolated from human literature. © 2014 Elsevier Ltd. All rights reserved.
1. Introduction Improving nutrition and vaccination programs in veterinary medicine, as well as the development of new diagnostic and treatment techniques, have increased the life expectancy of our patients. In contrast, there is a greater probability of developing geriatric diseases, such as cancer. Lymphoma is one of the most common cancers in dogs, representing the most frequent hematopoietic cancer in
∗ Corresponding author at: Rua Sofia Carvalho, n◦ 23, 1◦ Esq Poente, 1495-122 Algés, Portugal. Tel.: +351 916 222 425. E-mail addresses: [email protected] (M.A. Elias), [email protected] (A. Duarte), [email protected] (T. Nunes), [email protected] (A.M. Lourenc¸o), [email protected] (B.S. Braz), [email protected] (G. Vicente), [email protected] (J. Henriques), [email protected] (L. Tavares). http://dx.doi.org/10.1016/j.cimid.2014.09.005 0147-9571/© 2014 Elsevier Ltd. All rights reserved.
this species [1]. The incidence of canine non-Hodgkin lymphoma has been increasing over the years, and is now similar to human incidence [1,2]. Eighty percent of dogs with lymphoma develop the multicentric form, which is typically characterized by a generalized painless lymphadenopathy. Chemotherapy is the treatment of choice for systemic malignancies [4]. In general, combination chemotherapy protocols have a higher efficacy than single agent protocols and, regarding lymphoma, the most frequently used in veterinary medicine are modifications of CHOP protocols, a combination of cyclophosphamide (C), doxorubicin (H – hydroxydaunorubicin), vincristine (O – Oncovin® ) and prednisone/prednisolone (P), originally developed for the treatment of human lymphoma. The original protocol induces a complete remission in approximately 60–90% of dogs with median survival times of 6–12 months and is
314
M.A. Elias et al. / Comparative Immunology, Microbiology and Infectious Diseases 37 (2014) 313–320
considered the standard treatment for canine lymphoma [5,6]. Most chemotherapeutic agents and protocols used in veterinary oncology are well tolerated by companion animals, resulting in less than a 5% hospitalization rate for chemotherapy toxicity and less than a 1% mortality rate directly caused by toxicity [7]. However, these drugs may cause chronic or acute side effects, especially in organs with actively dividing cells, like the bone marrow and the gastrointestinal (GI) tract [8]. Cancer and its treatments are well known immunosuppressive factors in human medicine [9,10]. This combination, along with the frequent exposure to risk environments, puts oncological patients at risk of developing severe opportunistic infections, as well as the reactivation of latent or vaccine-preventable agents and a decreased immune response after vaccination [11–14]. Contrary to human medicine, the existing knowledge regarding immunosuppression in tumor-bearing dogs remains scarce and controversial. Moreover, considering that most clinically relevant agents, such as canine parvovirus (CPV) are species specific, it would not be appropriate to extrapolate this information from human literature [15]. Thus, a better understanding of the effect of cancer and its treatment on veterinary patients’ immune system is required. Ultimately, it is important to assess whether these animals retain the ability to mount an adequate immune response against new pathogens or against the reactivation of vaccine-preventable diseases or whether, by contrast, these patients are at the same risk as unvaccinated animals. If properly vaccinated animals are not able to maintain protective antibody (Ab) titers after chemotherapy, it would also be important to prevent the spread of contagious agents and zoonotic infections. CPV is a suitable viral model for this study as its infection can be prevented by vaccination, allowing protective anti-CPV Ab titers to be present at baseline, thus enabling the evaluation of titer variation as a result of chemotherapy. Also, parvoviruses may induce persistent and asymptomatic infections [16] and CPV is able to induce subclinical infections in immune competent adult dogs [17]. To assess the systemic effects of a potentially immunosuppressive cancer such as lymphoma, as well as the effects of chemotherapy on viral humoral immunity, we performed a prospective study in dogs with lymphoma, receiving CHOP-based chemotherapy. These dogs were evaluated regarding CPV DNA distribution and anti-CPV Ab titers. The initial viral load and Ab titers of dogs with lymphoma were compared with those of healthy dogs to determine whether the ongoing cancer would affect their immune status. 2. Materials and methods
vaccinated against canine parvovirus with a valid protocol. Dogs previously submitted to chemotherapy or any immunomodulatory treatments within 2 weeks of CHOP-chemotherapy initiation were excluded. Therefore, 8 client-owned dogs admitted to the Faculty of Veterinary Medicine Teaching Hospital, University of Lisbon and to Oncovet for initial chemotherapeutic treatment of lymphoma were included. All 8 dogs were treated with CHOP protocol [5,6] between April and July 2012. For the control group, 8 age/breed-matched healthy dogs, also correctly vaccinated against CPV, were included. None of the dogs from both groups were vaccinated during the study. In order to profile CPV distribution, a third group of 8 naturally infected, symptomatic dogs were included. The study was approved by the Faculty of Veterinary Medicine, University of Lisbon Ethics and Animal Welfare Committee, and informed owner consent was obtained prior to study enrollment. 2.2. Sample collection Blood and rectal swabs were collected from the lymphoma group prior to CHOP chemotherapy initiation and during the protocol first two cycles (weeks 3, 6 and 9). Blood sampling was part of routine scheduled complete blood count (CBC) before each chemotherapy session. A total of 3 mL of whole blood were collected into EDTAcontaining tubes at each time point; 1 mL was used for complete blood count (CBC) and 2 mL were used to leukocytic and plasma viral load, as well as specific anti-CPV protective Ab titers determination. Rectal swabs were used for fecal CPV viral load evaluation. In the control group, samples were obtained at the same time points. In the CPV group, samples were collected once. All samples were kept at 4 ◦ C and processed within 24 h after collection. 2.3. CPV molecular and serological diagnosis Plasma was obtained from whole blood by centrifugation at 5000 × g/10 min and stored at −80 ◦ C until processing. The cellular portion was homogenized with an erythrocyte lysis buffer (Buffer EL, Qiagen® , Germany) and the white cell pellet was homogenized with 200 L of PBS, according to the manufacturer’s instructions. Rectal swabs were homogenized with 300 L of PBS and stored at −80 ◦ C until DNA extraction. 2.4. DNA extraction and quantification The commercial kit DNeasy Blood & Tissue® (Qiagen® , Germany) was used for total and viral DNA extraction from the plasma and white blood cells, according to the manufacturer’s instructions. After DNA extraction and quantification in a 2000c Nanodrop Spectrophotometer® (Thermo Fisher Scientific), nucleic acid samples were stored at −80 ◦ C.
2.1. Inclusion criteria 2.5. Viral load detection and quantification Dogs of any breed, gender or age with cytologically or histopathologically confirmed lymphoma were included in the study. Cancer patients should also have been
Leukocytic, plasma and fecal CPV viral load (molecules/L) determination was performed by real
M.A. Elias et al. / Comparative Immunology, Microbiology and Infectious Diseases 37 (2014) 313–320
time or quantitative polymerase chain reaction (qPCR). CPV specific primers and TaqMan® probe were calculated using the Primer designing tool of NCBI (http://www.ncbi. nlm.nih.gov/tools/primer-blast/). Primers and probe were chosen based on the nucleotide sequence of the vp1 gene, available through the GenBank Accession Number AB437433.1, yielding a 99 bp amplicon. The amplification reactions were performed in a final volume of 20 L using TaqMan® Gene Expression 2× Master Mix (Applied Biosystems), 50 ng of template DNA, 0.9 M of both the forward (GGGCCTGGGAACAGTCTTGACC) and reverse (ACCAGAGCGAAGATAAGCAGCGT) primers and 0.25 M of TaqMan® probe (FAM AGAACCAACTAACCCTTCTGACGCCGC TAMRA). The amplification cycle included an initial denaturation step at 95 ◦ C for 10 min, followed by 50 cycles of 15 s at 90 ◦ C and 1 min at 60 ◦ C, in an Applied Biosystems 7300 Real-time thermocycler. A recombinant pGEM plasmid (Promega, Germany), including the targeted CPV region was constructed, sequenced to confirm the fragment specificity and used as positive control. For viral load quantification, a set of tenfold dilutions of the recombinant plasmid, ranging 10−1 –10−6 were used to generate a standard curve with a r2 = 0.997 and a slope of −3.5 to −3.4, with the 7300 System SDS software (Applied Biosystems® ), corresponding to a reaction efficiency of 93–96%. 2.6. Determination of anti-CPV antibody titers Specific anti-CPV protective Ab titers were assessed by semiquantitative ELISA using the TiterCHEK® CDV/CPV Zoetis commercial kit, according to the manufacturer’s instructions. Briefly, development of a blue color in the sample well of equal or higher intensity than the color of the positive control is considered to be positive, corresponding to a CPV hemagglutination-inhibition (HI) titer ≥1:80. Development of a blue color in the sample well of less intensity than the color of the positive control, is considered to be negative (CPV HI titer < 1:80) [18]. 2.7. Statistical analysis Data were analyzed with R statistical program. Data distribution was first assessed by the Shapiro–Wilk test and if not normally distributed, data were logarithmically transformed and the distribution reexamined. If normality was not achieved, the corresponding non-parametric tests were used. Repeated measures analysis of variance (rANOVA) with Tukey’s multiple comparisons test were used to compare mean CBC parameters, as well as leukocytic, plasma and fecal CPV viral load between groups at each time point. Correlations between leukocytic, plasma and fecal CPV viral load were evaluated using the Spearman’s correlation test. Significant differences in CPV viral load before initiation of chemotherapy (T0) between lymphoma and control groups were assessed by the Wilcoxon–Mann–Whitney test. The same analysis was made for CBC parameters, using independent samples T-test for variables normally distributed.
315
Statistical differences between leukocytic, plasma and fecal CPV viral load in the three groups were assessed by ANOVA followed by Tukey’s multiple comparisons test. The association between the three groups and the presence of protective anti-CPV Ab titers (≥1:80) was analyzed using Fisher’s test. For all analyses, values of P ≤ 0.05 were considered significant. 3. Results 3.1. Patient population This study included 24 dogs divided into three experimental groups. The lymphoma group consisted of 5 males and 3 females; 4 German Shepherds, 1 Golden Retriever, 1 Doberman Pincher, 1 Labrador Retriever and 1 Boxer. Dogs in this group were aged between 6 and 11 years old (¯x = 7.9 years). All dogs were considered to have multicentric lymphoma, one also having hepato-esplenic involvement. No further staging was made. Five dogs (RF = 62.5%) underwent a long-CHOP protocol (25 weeks) and 3 (RF = 37.5%) underwent a short-CHOP protocol (19 weeks). The first two cycles are equal in both protocols [5,6]. The only protocol deviations were treatment discontinuation for a week in case of drug toxicity signs such as anorexia, vomiting, diarrhea, lethargy, anemia, neutropenia or thrombocytopenia (n = 1, RF = 12.5%), substitution of doxorubicin for vincristine (n = 1, RF = 12.5%) and treatment with l-asparaginase (400 IU/kg SC) to reinduce remission (n = 2, RF= 25%). Thus, the interval between the first and last sampling ranged between 57 and 64 days (¯x = 59 days). Clinical signs observed during this study corresponded to slight changes that recovered with treatment discontinuation and symptomatic treatment. Seven dogs (RF = 87.5%) had the last vaccination booster for less than 1 year and the other (RF = 12.5%) for more than 3 years. Four dogs (RF = 50%) died after the sampling period, 3 of which (RF = 37.5%) were euthanized due to deteriorating clinical status. The control group consisted of 8 dogs, aged between 3 and 11 years old (¯x = 7.1 years) and included 5 males and 3 females; 4 German Shepherds, 1 Golden Retriever, 1 Doberman Pincher, 1 Labrador Retriever and 1 Boxer. Four dogs (RF = 50%) had the last vaccination booster for less than 1 year, 3 (RF = 37.5%) for less than 2 years and 1 (RF = 12.5%) for less than 3 years. The 8 naturally infected and symptomatic dogs with parvovirus were aged between 2.5 and 10 months old (¯x = 4.4 months). There were 5 Dalmatians, 2 mixed-breeds and 1 Bull Terrier. None of them were vaccinated against CPV and 3 (FR = 37.5%) died from the disease. 3.2. Complete blood count Before chemotherapy initiation, dogs with lymphoma had a significantly lower hematocrit (p < 0.01) than healthy, control dogs. No other CBC parameters were significantly different between the two groups (platelets p = 0.17;
316
M.A. Elias et al. / Comparative Immunology, Microbiology and Infectious Diseases 37 (2014) 313–320
Fig. 1. Comparison of fecal, plasma and leukocytic CPV viral load (log + 1 molecules/L) between groups (control; oncological; parvovirus).
leukocytes p = 0.65; neutrophils p = 0.44; lymphocytes p = 0.72; monocytes p = 0.29). In dogs treated with CHOP, though all CBC parameters analyzed have oscillated during the study, no significant differences were observed at any time points, compared with values before treatment (hematocrit p = 0.24; platelets p = 0.17; leukocytes p = 0.27; neutrophils p = 0.29; lymphocytes p = 0.24; monocytes p = 0.09). Also, no significant differences were found in the way CBC parameters varied over time for the two groups (hematocrit p = 0.86; platelets p = 0.40; leukocytes p = 0.52; neutrophils p = 0.68; lymphocytes p = 0.27; monocytes p = 0.87).
3.4. Anti-CPV antibody titers The detection of anti-CPV Ab was carried out at three time points (T0, T2 and T3). At baseline (T0) all dogs with lymphoma and all healthy dogs exhibited a protective antiCPV Ab titer (≥1:80). During CHOP protocol, only one dog (RF = 12.5%) did not show a protective anti-CPV Ab titer during the whole study, displaying an Ab titer <1:80 on week 6 (T2) but recovering a protective titer by week 9 (T3). The same happened in the control group (RF = 12.5%). None of the naturally infected animals with parvovirus showed a protective anti-CPV Ab titer. Therefore, a significant difference between the parvovirus naturally infected group and the other two groups was found (p < 0.001).
3.3. CPV viral load 4. Discussion In the lymphoma group CPV was detected in the leukocytes, plasma and feces of 6 (RF = 75%), 8 (RF = 100%) and 7 (RF = 87.5%) dogs, respectively, at least once during the study. In the control group CPV was found in the leukocytes of 7 dogs (RF = 87.5%) and in the plasma and feces of all dogs (RF = 100%), at least once during the study. All CPV naturally infected dogs displayed a significantly higher concentration of CPV in the leukocytes, plasma and feces, than dogs with lymphoma or healthy dogs (p < 0.001) (Fig. 1). Leukocytic (p = 0.41), plasma (p = 0.56) and fecal (p = 0.17) CPV viral load were not significantly different between dogs with lymphoma prior to treatment initiation and healthy, control dogs. In the chemotherapy group, all three viral loads oscillated during the study, but no significant differences were observed at any time points, compared with values before treatment (leukocytes p = 0.72; plasma p = 0.98; feces p = 0.82) (Fig. 2). No significant differences were found in the leukocytic CPV viral load variation over time for the two groups (p = 0.41). However, plasma and fecal CPV viral load evolution was significantly different in both groups (p < 0.05). In dogs with lymphoma, no correlations were observed between the three biological samples analyzed. In healthy dogs, moderate correlations were found between leukocytic and plasma CPV viral loads ( = 0.47, p < 0.05), between leukocytic and fecal CPV viral loads ( = 0.66, p < 0.001) and between plasma and fecal CPV viral loads ( = 0.66, p < 0.001) (Fig. 3).
In humans, the results obtained over the years regarding chemotherapy treatments show a quantitative and qualitative decrease in immune function, typically higher in the cellular than in the humoral response [19–22]. In veterinary medicine, chemotherapy does not seem to have a significant impact on immune system of tumor bearing dogs. However, the humoral response [23] seems to be the most affected, although a significant impairment of antibody response to revaccination is seldom observed [23,24]. In this context, cases of reactivation and development of some opportunistic infections such as papillomatosis and demodicosis have been reported [25,26]. Despite some differences regarding the characterization of the immune system of tumor-bearing dogs, several studies suggest that the tumor itself may be responsible for the type and degree of immunosuppression seen in these patients [23,24,27]. In our study, platelets, neutrophils, lymphocytes and monocytes were higher in dogs with lymphoma than in healthy dogs, before chemotherapy initiation, without significant differences between groups. Therefore, lymphoma itself only appears to have influenced the hematocrit of dogs with lymphoma, as this was the only significantly different CBC parameter between groups before chemotherapy initiation. This is consistent with a non-regenerative anemia being a common paraneoplastic syndrome of this cancer [3,6]. The fact that we studied a small group of dogs may have precluded the finding of other significant differences at baseline. Also, we have no information concerning lymphoma
M.A. Elias et al. / Comparative Immunology, Microbiology and Infectious Diseases 37 (2014) 313–320
Fig. 2. Leukocytic, plasma and fecal CPV viral load (log + 1) of lymphoma and healthy dogs, during the study.
Fig. 3. Correlation between leukocytic, plasma and fecal CPV viral load (log + 1 molecules/L) in the lymphoma and control groups.
317
318
M.A. Elias et al. / Comparative Immunology, Microbiology and Infectious Diseases 37 (2014) 313–320
staging in our lymphoma group. This paper was based on real cases, where costs were often a problem, and where clinicians choose to start treatment regardless of further classification. In dogs treated with CHOP, no significant differences were observed at any time points, compared with baseline values. Furthermore, no significant differences were found in the CBC parameters variation over time for the two groups. This finding is in accordance with Walter et al., 2006 who found that doxorubicin single-agent chemotherapy and CHOP chemotherapy did not have a significant immunosuppressive effect to induce a sustained decrease in CD4+ and CD8+ cell numbers. A complete evaluation of lymphocyte populations and subsets would provide a clear insight into the dynamics of acquired immunity as a result of lymphoma and its treatment. The oscillations seen in all CBC parameters throughout the study seem to reflect the effects of the various drugs used in CHOP protocol, due to the various degrees of toxicity on rapidly dividing cells. After infection by the oronasal route, CPV replicates in rapidly dividing cells of the lymphoid tissue, particularly lymphocytes and monocytes, allowing CPV to spread into the bloodstream [28,29]. On the other hand, destruction of other rapidly dividing cells, such as enterocytes, allows the virus to be excreted in the feces [30]. CPV was identified in all dogs of both groups (lymphoma-bearing and cancer-free dogs), in at least one type of biological material and in at least one time point. Fluctuations over time were found in all three CPV viral loads, suggesting that there was not a progressive increase or decrease as a result of chemotherapy treatment. Although CPV has been detected in dogs with lymphoma, the presented clinical signs corresponded to slight changes that recovered with administration of appropriate treatment and could, therefore, be attributed to the myelo and GI toxicity of the administrated drugs. All dogs with parvovirus symptomatic natural infection had CPV in leukocytes, plasma and feces. More importantly, DNA quantification was significantly higher than in dogs with lymphoma or healthy dogs, most probably reflecting the difference between animals with clinical disease and carrier animals. In fact, all dogs in both lymphoma and control groups could be considered as CPV carriers. The intermittent excretion of CPV residual amounts observed in the lymphoma group did not seem to endanger immune compromised animals, since these dogs showed no clinical signs suggestive of parvovirus infection. Children with cancer shed influenza virus longer (≥7 days) than immunocompetent individuals (2–5 days), suggesting that they can be a reservoir of the disease and a threat to other hospitalized children at the same location [31]. In our study, this does not seem to be the case, as the fecal CPV viral load found in dogs with lymphoma was lower than in healthy dogs. However, it is worth remembering that we worked with a small group of dogs. The detection of trace amounts of CPV in leukocytes, plasma, and feces of both dogs with lymphoma and healthy dogs most probably reflected the high sensitivity of qPCR [32] and did not seem to represent a biological risk of infection.
Lymphoma itself did not appear to influence plasma, leukocytic and fecal CPV viral load, as no significant differences were found between lymphoma and control groups prior to chemotherapy. In the chemotherapy group, all three viral loads oscillated during the study, but no significant differences were observed at any time points, compared with values before treatment. Moreover, no significant differences were found in leukocytic CPV viral load variation over time for the two groups, suggesting that CHOP protocol does not seem to have influenced the leukocytic viral load. However, plasma and fecal viral load evolution was significantly different in both groups, suggesting a possible effect of chemotherapy in these parameters. The existence of a viral load peak at weak 3 (T1) in the control group is responsible for this significant difference (Fig. 2). The peak found in leukocytic and fecal viral loads is due to a single animal. In contrast, the peak found in plasma viral load is due to 4 dogs. Although all studied animals had high outdoor access, exposure to possible sources of CPV infection was more difficult to control in animals of the control group. It should also be noted that the small sample size may have prevented the blurring of these outliers influence in p values. Therefore, results regarding the chemotherapy influence in plasma and fecal CPV viral loads should be interpreted with caution. The correlations found between the three viral loads in healthy animals appear to reflect the dynamics of CPV infection. The fact that no correlations were observed between the three viral loads in dogs with lymphoma, suggests that chemotherapy could be responsible for a dynamics imbalance in carrier animals. In humans, most studies support the hypothesis that chemotherapeutic agents decrease Ab titers against common viruses [11,13,14,33,34]. However, the clinical significance of these findings in veterinary patients is still unknown. In animals undergoing chemotherapy for various malignancies, 14% had a decrease, 52% maintained and 33% had an increase in anti-CPV Ab titers. The percentage of dogs with lymphoma with protective Ab titers also decreased at the end of treatment [15]. In the present study, lymphoma itself did not seem to influence anti-CPV Ab titers, as all the animals (100%) in both groups (lymphoma-bearing and cancer-free dogs) had a protective titer prior to chemotherapy, in agreement with Henry et al., 2001. This finding is in accordance with the fact that all 16 dogs received correct anti-CPV vaccination, earlier on their lives. Only 1 dog undergoing CHOP protocol and 1 healthy dog did not maintain a protective anti-CPV Ab titer during the whole study. However, a protective titer was recovered by weak 9 (T3). These results suggest that chemotherapy did not influence anti-CPV Ab titers, as no differences were found between both groups. On the other hand, the fact that those two dogs regained a protective titer, none being vaccinated during the study, suggests CPV exposure, with maintenance of the ability to respond to this contact with a secondary immune response. Despite CPV detection in the plasma and feces of these two dogs with Ab titer <1:80, neither showed clinical or laboratory signs suggestive of parvovirus infection at that time point. Not only the mentioned decreases were temporary, as a decreased or
M.A. Elias et al. / Comparative Immunology, Microbiology and Infectious Diseases 37 (2014) 313–320
absent Ab titer in a vaccinated or previously exposed dog does not mean he is unprotected. The presence of other defense mechanisms such as cellular immunity should not be forgotten and the significance of decreased Ab below protective titers should not be overestimated [34]. None of the animals with CPV natural infection showed a protective anti-CPV Ab titer. This was not surprising since none of them were vaccinated and the ELISA test detected IgGs. Our results are consistent with most studies [15,23] where the administration of cytotoxic drugs resulted in anti-CPV Ab titers variations, but where the previously acquired immunity through vaccination or natural exposure does not appear to be significantly affected by such treatment and where the ability to mount a secondary humoral immune response is maintained. Our data suggests that lymphoma itself only appears to have influenced the hematocrit. The CHOP protocol could have influenced CPV plasma and fecal viral load, but not leukocytic viral load, nor anti-CPV protective Ab titers, or CBC. CPV location and load profile in animals undergoing chemotherapy could be considered similar to that of healthy animals. This is further reinforced by the significant difference found between CPV viral load of both lymphoma and healthy groups and the group of dogs with parvovirus clinical and molecular diagnosis. The seemingly random and negligible quantifications found in the former two groups do not seem to represent a biological hazard for these animals, since anti-CPV Ab titers were maintained above protective level in 87.5% of the dogs in both groups. In this context, Ab titration during chemotherapy treatment would have an important informative value. Therefore, the clinical and laboratory signs presented by some dogs with lymphoma, that could be the result of a CPV infection, were probably caused by the toxic effects of the administered drugs. The fact that we have not found a significant change in the number of leukocytes and their populations as a result of chemotherapy could be the result of the adopted schedule. Harvests were done before each chemotherapy session, at which time most values could have fully recovered. Thus, contrary to what would be expected, there was no evidence of a decrease in immune response either at admission, or after two chemotherapy cycles.
5. Conclusion Although immune responses after vaccination were not assessed in this study, our data suggests that previously established immunity by CPV vaccination was not significantly compromised by CHOP protocol, potentially mirroring the humoral competence toward theoretically more dangerous and/or clinically relevant viruses, such as canine distemper virus and rabies virus. In general, our results support the view that, contrary to what happens in human medicine, immunosuppression as a direct consequence of hematopoietic malignancies and/or its treatments in dogs remains unclear and will continue to benefit from further investigation.
319
Conflict of interest Zoetis Portugal supplied the ELISA kits used in this study. Zoetis Portugal did not interfere with the study design, collection, analysis, interpretation of data or in the decision to submit the manuscript for publication. None of the authors has any financial or personal relationships that could influence the content of the manuscript. There are no conflicts of interest. Acknowledgments This work was supported by the Center for Interdisciplinary Research in Animal Health of the University of Lisbon’s Faculty of Veterinary Medicine as part of an Integrated Master degree in Veterinary Medicine. We wish to acknowledge Zoetis who provided the TiterCHEK® CDV/CPV kits, and the Republican National Guard whose dogs were included in the healthy control group. References [1] Vail DM, MacEwen EG. Spontaneously occurring tumors of companion animals as models for human cancer. Cancer Invest 2000;18:781–92. [2] Marconato L, Gelain ME, Comazzi S. The dog as a possible animal model for human non-Hodgkin lymphoma: a review. Hematol Oncol 2013;31:1–9. [3] Vail D. Tumours of the haemopoietic system. In: Dobson JM, Duncan B, Lascelles X, editors. BSAVA manual of canine and feline oncology. 3rd ed. British Small Animal Veterinary Association; 2011. p. 285–303. [4] Dobson JM. Introduction: cancer in cats and dogs. In: Dobson JM, Duncan B, Lascelles X, editors. BSAVA manual of canine and feline oncology. 3rd ed. British Small Animal Veterinary Association; 2011. p. 1–5. [5] Chun R. Lymphoma: which chemotherapy protocol and why? Top Companion Anim Med 2009;24:157–62. [6] Vail DM, Young KM. Canine lymphoma and lymphoid leukemia. In: Withrow SJ, MacEwen EG, editors. Withrow and MacEwen’s small animal clinical oncology. 4th ed. St. Louis, MO: Saunders Elsevier; 2007. p. 699–733. [7] Chun R, Garrett LD, Vail DM. Chapter 11 – Cancer chemotherapy. In: Withrow SJ, Vail DM, editors. Withrow and MacEwen’s small animal clinical oncology. 4th ed. St. Louis: W.B. Saunders; 2007. p. 163–92. [8] Lana SE, Dobson JM. Principles of chemotherapy. In: Dobson JM, Duncan B, Lascelles X, editors. BSAVA manual of canine and feline oncology. 3rd ed. British Small Animal Veterinary Association; 2011. p. 60–79. [9] Hao NB, Lu MH, Fan YH, Cao YL, Zhang ZR, Yang SM. Macrophages in tumor microenvironments and the progression of tumors. Clin Dev Immunol 2012;2012:1–11. [10] Sherger M, Kisseberth W, London C, Olivo-Marston S, Papenfuss T. Identification of myeloid derived suppressor cells in the peripheral blood of tumor bearing dogs. BMC Vet Res 2012;8:209. [11] Ek T, Mellander L, Hahn-Zoric M, Abrahamsson J. Intensive treatment for childhood acute lymphoblastic leukemia reduces immune responses to diphtheria, tetanus, and Haemophilus influenzae type b. J Pediatr Hematol Oncol 2004;26:727–34. [12] Gopalan V, Nair R, Pillai S, Oberholzer T. Genital herpes zoster as a consequence of cancer chemotherapy-induced immunosuppression: report of a case. J Infect Chemother 2012;18:955–7. [13] Nilsson A, De Milito A, Engstrom P, Nordin M, Narita M, Grillner L, et al. Current chemotherapy protocols for childhood acute lymphoblastic leukemia induce loss of humoral immunity to viral vaccination antigens. Pediatrics 2002;109:e91. [14] Zignol M, Peracchi M, Tridello G, Pillon M, Fregonese F, D’Elia R, et al. Assessment of humoral immunity to poliomyelitis, tetanus, hepatitis B, measles, rubella, and mumps in children after chemotherapy. Cancer 2004;101:635–41. [15] Henry CJ, McCaw DL, Brock KV, Stoker AM, Tyler JW, Tate DJ, et al. Association between cancer chemotherapy and canine distemper
320
[16]
[17]
[18]
[19]
[20]
[21] [22] [23]
[24]
[25]
M.A. Elias et al. / Comparative Immunology, Microbiology and Infectious Diseases 37 (2014) 313–320 virus, canine parvovirus, and rabies virus antibody titers in tumorbearing dogs. J Am Vet Med Assoc 2001;219:1238–41. Berns K, Parrish CR. Parvoviridae. In: Fields BN, Knipe DM, Howley PM, editors. Fields virology. Philadelphia: Wolters Kluwer Health/Lippincott Williams & Wilkins; 2007. Decaro N, Campolo M, Desario C, Elia G, Martella V, Lorusso E, et al. Maternally-derived antibodies in pups and protection from canine parvovirus infection. Biologicals 2005;33:261–7. Litster AL, Pressler B, Volpe A, Dubovi E. Accuracy of a point-of-care ELISA test kit for predicting the presence of protective canine parvovirus and canine distemper virus antibody concentrations in dogs. Vet J 2012;193:363–6. Komada Y, Zhang S-L, Zhou Y-W, Hanada M, Shibata T, Azuma E, et al. Cellular immunosuppression in children with acute lymphoblastic leukemia: effect of consolidation chemotherapy. Cancer Immunol Immunother 1992;35:271–6. Mackall C, Fleisher T, Brown M, Magrath I, Shad A, Horowitz M, et al. Lymphocyte depletion during treatment with intensive chemotherapy for cancer. Blood 1994;84:2221–8. Mackall CL. T-cell immunodeficiency following cytotoxic antineoplastic therapy: a review. Stem Cells 2000;18:10–8. Rasmussen L, Arvin A. Chemotherapy-induced immunosuppression. Environ Health Perspect 1982;43:21–5. Walter CU, Biller BJ, Lana SE, Bachand AM, Dow SW. Effects of chemotherapy on immune responses in dogs with cancer. J Vet Intern Med 2006;20:342–7. Winnicka A, Jagielski D, Hoffmann-Jagielska M, Lechowski R. Cytometric evaluation of peripheral blood lymphocytes in dogs with lymphoma during chemotherapy. J Vet Med A Physiol Pathol Clin Med 2002;49:303–6. Lucroy MD, Hill FI, Moore PF, Madewell BR. Cutaneous papillomatosis in a dog with malignant lymphoma following long-term chemotherapy. J Vet Diagn Investig 1998;10:369–71.
[26] Sundberg JP, Smith EK, Herron AJ, Jenson AB, Burk RD, Van Ranst M. Involvement of canine oral papillomavirus in generalized oral and cutaneous verrucosis in a Chinese Shar Pei Dog. Vet Pathol Online 1994;31:183–7. [27] Weiden PL, Storb R, Kolb H-J, Ochs HD, Graham TC, Tsoi M-S, et al. Immune reactivity in dogs with spontaneous malignancy. J Natl Cancer Inst 1974;53:1049–56. [28] Meunier PC, Cooper BJ, Appel MJG, Lanieu ME, Slauson DO. Pathogenesis of canine parvovirus enteritis: sequential virus distribution and passive immunization studies. Vet Pathol Online 1985;22: 617–24. [29] Stann SE, DiGiacomo RF, Giddens Jr WE, Evermann JF. Clinical and pathologic features of parvoviral diarrhea in pound-source dogs. J Am Vet Med Assoc 1984;185:651–5. [30] Pollock RV. Experimental canine parvovirus infection in dogs. Cornell Vet 1982;72:103–19. [31] Täger FM, Zolezzi RP, Folatre BI, Navarrete CM, Rojas PJ. Infec˜ ciones por virus respiratorios en ninos con leucemia linfoblástica aguda y neutropenia febril: Estudio prospectivo. Rev Chil Infectol 2006;23:118–23. [32] Decaro N, Elia G, Martella V, Desario C, Campolo M, Trani LD, et al. A real-time PCR assay for rapid detection and quantitation of canine parvovirus type 2 in the feces of dogs. Vet Microbiol 2005;105: 19–28. [33] Alanko S, Pelliniemi TT, Salmi TT. Recovery of blood Blymphocytes and serum immunoglobulins after chemotherapy for childhood acute lymphoblastic leukemia. Cancer 1992;69: 1481–6. [34] Reinhardt D, Houliara K, Pekrun A, Lakomek M, Krone B. Impact of conventional chemotherapy on levels of antibodies against vaccinepreventable diseases in children treated for cancer. Scand J Infect Dis 2003;35:851–7.
Contents lists available at ScienceDirect
Comparative Immunology, Microbiology and Infectious Diseases journal homepage: www.elsevier.com/locate/cimid
Influence of chemotherapy for lymphoma in canine parvovirus DNA distribution and specific humoral immunity M.A. Elias a,∗ , A. Duarte a , T. Nunes a , A.M. Lourenc¸o a,b , B.S. Braz a , G. Vicente a,b , J. Henriques c , L. Tavares a a Center for Interdisciplinary Research in Animal Health, Faculty of Veterinary Medicine, University of Lisbon, Avenida da Universidade Técnica, 1300-477 Lisbon, Portugal b Faculty of Veterinary Medicine Teaching Hospital, University of Lisbon, Avenida da Universidade Técnica, 1300-477 Lisbon, Portugal c Oncovet, Avenida de Berna, 35, 1050-038 Lisbon, Portugal
a r t i c l e
i n f o
Article history: Received 27 June 2014 Received in revised form 25 September 2014 Accepted 29 September 2014 Keywords: Immunosuppression Canine lymphoma CHOP Canine parvovirus Dog
a b s t r a c t In man, the combination of cancer and its treatment increases patients’ susceptibility to opportunistic infections, due to immune system impairment. In veterinary medicine little information is available concerning this issue. In order to evaluate if a similar dysfunction is induced in small animals undergoing chemotherapy, we assessed the complete blood count, leukocytic, plasma and fecal canine parvovirus (CPV) viral load, and anti-CPV protective antibody titers, in dogs with lymphoma treated with CHOP (cyclophosphamide, doxorubicin, vincristine and prednisolone) protocol, before and during chemotherapy. There was no evidence of decreased immune response, either at admission or after two chemotherapy cycles, indicating that the previously established immunity against CPV was not significantly impaired, supporting the idea that immunosuppression as a result of hematopoietic neoplasms and their treatment in dogs requires further investigation and conclusions cannot be extrapolated from human literature. © 2014 Elsevier Ltd. All rights reserved.
1. Introduction Improving nutrition and vaccination programs in veterinary medicine, as well as the development of new diagnostic and treatment techniques, have increased the life expectancy of our patients. In contrast, there is a greater probability of developing geriatric diseases, such as cancer. Lymphoma is one of the most common cancers in dogs, representing the most frequent hematopoietic cancer in
∗ Corresponding author at: Rua Sofia Carvalho, n◦ 23, 1◦ Esq Poente, 1495-122 Algés, Portugal. Tel.: +351 916 222 425. E-mail addresses: [email protected] (M.A. Elias), [email protected] (A. Duarte), [email protected] (T. Nunes), [email protected] (A.M. Lourenc¸o), [email protected] (B.S. Braz), [email protected] (G. Vicente), [email protected] (J. Henriques), [email protected] (L. Tavares). http://dx.doi.org/10.1016/j.cimid.2014.09.005 0147-9571/© 2014 Elsevier Ltd. All rights reserved.
this species [1]. The incidence of canine non-Hodgkin lymphoma has been increasing over the years, and is now similar to human incidence [1,2]. Eighty percent of dogs with lymphoma develop the multicentric form, which is typically characterized by a generalized painless lymphadenopathy. Chemotherapy is the treatment of choice for systemic malignancies [4]. In general, combination chemotherapy protocols have a higher efficacy than single agent protocols and, regarding lymphoma, the most frequently used in veterinary medicine are modifications of CHOP protocols, a combination of cyclophosphamide (C), doxorubicin (H – hydroxydaunorubicin), vincristine (O – Oncovin® ) and prednisone/prednisolone (P), originally developed for the treatment of human lymphoma. The original protocol induces a complete remission in approximately 60–90% of dogs with median survival times of 6–12 months and is
314
M.A. Elias et al. / Comparative Immunology, Microbiology and Infectious Diseases 37 (2014) 313–320
considered the standard treatment for canine lymphoma [5,6]. Most chemotherapeutic agents and protocols used in veterinary oncology are well tolerated by companion animals, resulting in less than a 5% hospitalization rate for chemotherapy toxicity and less than a 1% mortality rate directly caused by toxicity [7]. However, these drugs may cause chronic or acute side effects, especially in organs with actively dividing cells, like the bone marrow and the gastrointestinal (GI) tract [8]. Cancer and its treatments are well known immunosuppressive factors in human medicine [9,10]. This combination, along with the frequent exposure to risk environments, puts oncological patients at risk of developing severe opportunistic infections, as well as the reactivation of latent or vaccine-preventable agents and a decreased immune response after vaccination [11–14]. Contrary to human medicine, the existing knowledge regarding immunosuppression in tumor-bearing dogs remains scarce and controversial. Moreover, considering that most clinically relevant agents, such as canine parvovirus (CPV) are species specific, it would not be appropriate to extrapolate this information from human literature [15]. Thus, a better understanding of the effect of cancer and its treatment on veterinary patients’ immune system is required. Ultimately, it is important to assess whether these animals retain the ability to mount an adequate immune response against new pathogens or against the reactivation of vaccine-preventable diseases or whether, by contrast, these patients are at the same risk as unvaccinated animals. If properly vaccinated animals are not able to maintain protective antibody (Ab) titers after chemotherapy, it would also be important to prevent the spread of contagious agents and zoonotic infections. CPV is a suitable viral model for this study as its infection can be prevented by vaccination, allowing protective anti-CPV Ab titers to be present at baseline, thus enabling the evaluation of titer variation as a result of chemotherapy. Also, parvoviruses may induce persistent and asymptomatic infections [16] and CPV is able to induce subclinical infections in immune competent adult dogs [17]. To assess the systemic effects of a potentially immunosuppressive cancer such as lymphoma, as well as the effects of chemotherapy on viral humoral immunity, we performed a prospective study in dogs with lymphoma, receiving CHOP-based chemotherapy. These dogs were evaluated regarding CPV DNA distribution and anti-CPV Ab titers. The initial viral load and Ab titers of dogs with lymphoma were compared with those of healthy dogs to determine whether the ongoing cancer would affect their immune status. 2. Materials and methods
vaccinated against canine parvovirus with a valid protocol. Dogs previously submitted to chemotherapy or any immunomodulatory treatments within 2 weeks of CHOP-chemotherapy initiation were excluded. Therefore, 8 client-owned dogs admitted to the Faculty of Veterinary Medicine Teaching Hospital, University of Lisbon and to Oncovet for initial chemotherapeutic treatment of lymphoma were included. All 8 dogs were treated with CHOP protocol [5,6] between April and July 2012. For the control group, 8 age/breed-matched healthy dogs, also correctly vaccinated against CPV, were included. None of the dogs from both groups were vaccinated during the study. In order to profile CPV distribution, a third group of 8 naturally infected, symptomatic dogs were included. The study was approved by the Faculty of Veterinary Medicine, University of Lisbon Ethics and Animal Welfare Committee, and informed owner consent was obtained prior to study enrollment. 2.2. Sample collection Blood and rectal swabs were collected from the lymphoma group prior to CHOP chemotherapy initiation and during the protocol first two cycles (weeks 3, 6 and 9). Blood sampling was part of routine scheduled complete blood count (CBC) before each chemotherapy session. A total of 3 mL of whole blood were collected into EDTAcontaining tubes at each time point; 1 mL was used for complete blood count (CBC) and 2 mL were used to leukocytic and plasma viral load, as well as specific anti-CPV protective Ab titers determination. Rectal swabs were used for fecal CPV viral load evaluation. In the control group, samples were obtained at the same time points. In the CPV group, samples were collected once. All samples were kept at 4 ◦ C and processed within 24 h after collection. 2.3. CPV molecular and serological diagnosis Plasma was obtained from whole blood by centrifugation at 5000 × g/10 min and stored at −80 ◦ C until processing. The cellular portion was homogenized with an erythrocyte lysis buffer (Buffer EL, Qiagen® , Germany) and the white cell pellet was homogenized with 200 L of PBS, according to the manufacturer’s instructions. Rectal swabs were homogenized with 300 L of PBS and stored at −80 ◦ C until DNA extraction. 2.4. DNA extraction and quantification The commercial kit DNeasy Blood & Tissue® (Qiagen® , Germany) was used for total and viral DNA extraction from the plasma and white blood cells, according to the manufacturer’s instructions. After DNA extraction and quantification in a 2000c Nanodrop Spectrophotometer® (Thermo Fisher Scientific), nucleic acid samples were stored at −80 ◦ C.
2.1. Inclusion criteria 2.5. Viral load detection and quantification Dogs of any breed, gender or age with cytologically or histopathologically confirmed lymphoma were included in the study. Cancer patients should also have been
Leukocytic, plasma and fecal CPV viral load (molecules/L) determination was performed by real
M.A. Elias et al. / Comparative Immunology, Microbiology and Infectious Diseases 37 (2014) 313–320
time or quantitative polymerase chain reaction (qPCR). CPV specific primers and TaqMan® probe were calculated using the Primer designing tool of NCBI (http://www.ncbi. nlm.nih.gov/tools/primer-blast/). Primers and probe were chosen based on the nucleotide sequence of the vp1 gene, available through the GenBank Accession Number AB437433.1, yielding a 99 bp amplicon. The amplification reactions were performed in a final volume of 20 L using TaqMan® Gene Expression 2× Master Mix (Applied Biosystems), 50 ng of template DNA, 0.9 M of both the forward (GGGCCTGGGAACAGTCTTGACC) and reverse (ACCAGAGCGAAGATAAGCAGCGT) primers and 0.25 M of TaqMan® probe (FAM AGAACCAACTAACCCTTCTGACGCCGC TAMRA). The amplification cycle included an initial denaturation step at 95 ◦ C for 10 min, followed by 50 cycles of 15 s at 90 ◦ C and 1 min at 60 ◦ C, in an Applied Biosystems 7300 Real-time thermocycler. A recombinant pGEM plasmid (Promega, Germany), including the targeted CPV region was constructed, sequenced to confirm the fragment specificity and used as positive control. For viral load quantification, a set of tenfold dilutions of the recombinant plasmid, ranging 10−1 –10−6 were used to generate a standard curve with a r2 = 0.997 and a slope of −3.5 to −3.4, with the 7300 System SDS software (Applied Biosystems® ), corresponding to a reaction efficiency of 93–96%. 2.6. Determination of anti-CPV antibody titers Specific anti-CPV protective Ab titers were assessed by semiquantitative ELISA using the TiterCHEK® CDV/CPV Zoetis commercial kit, according to the manufacturer’s instructions. Briefly, development of a blue color in the sample well of equal or higher intensity than the color of the positive control is considered to be positive, corresponding to a CPV hemagglutination-inhibition (HI) titer ≥1:80. Development of a blue color in the sample well of less intensity than the color of the positive control, is considered to be negative (CPV HI titer < 1:80) [18]. 2.7. Statistical analysis Data were analyzed with R statistical program. Data distribution was first assessed by the Shapiro–Wilk test and if not normally distributed, data were logarithmically transformed and the distribution reexamined. If normality was not achieved, the corresponding non-parametric tests were used. Repeated measures analysis of variance (rANOVA) with Tukey’s multiple comparisons test were used to compare mean CBC parameters, as well as leukocytic, plasma and fecal CPV viral load between groups at each time point. Correlations between leukocytic, plasma and fecal CPV viral load were evaluated using the Spearman’s correlation test. Significant differences in CPV viral load before initiation of chemotherapy (T0) between lymphoma and control groups were assessed by the Wilcoxon–Mann–Whitney test. The same analysis was made for CBC parameters, using independent samples T-test for variables normally distributed.
315
Statistical differences between leukocytic, plasma and fecal CPV viral load in the three groups were assessed by ANOVA followed by Tukey’s multiple comparisons test. The association between the three groups and the presence of protective anti-CPV Ab titers (≥1:80) was analyzed using Fisher’s test. For all analyses, values of P ≤ 0.05 were considered significant. 3. Results 3.1. Patient population This study included 24 dogs divided into three experimental groups. The lymphoma group consisted of 5 males and 3 females; 4 German Shepherds, 1 Golden Retriever, 1 Doberman Pincher, 1 Labrador Retriever and 1 Boxer. Dogs in this group were aged between 6 and 11 years old (¯x = 7.9 years). All dogs were considered to have multicentric lymphoma, one also having hepato-esplenic involvement. No further staging was made. Five dogs (RF = 62.5%) underwent a long-CHOP protocol (25 weeks) and 3 (RF = 37.5%) underwent a short-CHOP protocol (19 weeks). The first two cycles are equal in both protocols [5,6]. The only protocol deviations were treatment discontinuation for a week in case of drug toxicity signs such as anorexia, vomiting, diarrhea, lethargy, anemia, neutropenia or thrombocytopenia (n = 1, RF = 12.5%), substitution of doxorubicin for vincristine (n = 1, RF = 12.5%) and treatment with l-asparaginase (400 IU/kg SC) to reinduce remission (n = 2, RF= 25%). Thus, the interval between the first and last sampling ranged between 57 and 64 days (¯x = 59 days). Clinical signs observed during this study corresponded to slight changes that recovered with treatment discontinuation and symptomatic treatment. Seven dogs (RF = 87.5%) had the last vaccination booster for less than 1 year and the other (RF = 12.5%) for more than 3 years. Four dogs (RF = 50%) died after the sampling period, 3 of which (RF = 37.5%) were euthanized due to deteriorating clinical status. The control group consisted of 8 dogs, aged between 3 and 11 years old (¯x = 7.1 years) and included 5 males and 3 females; 4 German Shepherds, 1 Golden Retriever, 1 Doberman Pincher, 1 Labrador Retriever and 1 Boxer. Four dogs (RF = 50%) had the last vaccination booster for less than 1 year, 3 (RF = 37.5%) for less than 2 years and 1 (RF = 12.5%) for less than 3 years. The 8 naturally infected and symptomatic dogs with parvovirus were aged between 2.5 and 10 months old (¯x = 4.4 months). There were 5 Dalmatians, 2 mixed-breeds and 1 Bull Terrier. None of them were vaccinated against CPV and 3 (FR = 37.5%) died from the disease. 3.2. Complete blood count Before chemotherapy initiation, dogs with lymphoma had a significantly lower hematocrit (p < 0.01) than healthy, control dogs. No other CBC parameters were significantly different between the two groups (platelets p = 0.17;
316
M.A. Elias et al. / Comparative Immunology, Microbiology and Infectious Diseases 37 (2014) 313–320
Fig. 1. Comparison of fecal, plasma and leukocytic CPV viral load (log + 1 molecules/L) between groups (control; oncological; parvovirus).
leukocytes p = 0.65; neutrophils p = 0.44; lymphocytes p = 0.72; monocytes p = 0.29). In dogs treated with CHOP, though all CBC parameters analyzed have oscillated during the study, no significant differences were observed at any time points, compared with values before treatment (hematocrit p = 0.24; platelets p = 0.17; leukocytes p = 0.27; neutrophils p = 0.29; lymphocytes p = 0.24; monocytes p = 0.09). Also, no significant differences were found in the way CBC parameters varied over time for the two groups (hematocrit p = 0.86; platelets p = 0.40; leukocytes p = 0.52; neutrophils p = 0.68; lymphocytes p = 0.27; monocytes p = 0.87).
3.4. Anti-CPV antibody titers The detection of anti-CPV Ab was carried out at three time points (T0, T2 and T3). At baseline (T0) all dogs with lymphoma and all healthy dogs exhibited a protective antiCPV Ab titer (≥1:80). During CHOP protocol, only one dog (RF = 12.5%) did not show a protective anti-CPV Ab titer during the whole study, displaying an Ab titer <1:80 on week 6 (T2) but recovering a protective titer by week 9 (T3). The same happened in the control group (RF = 12.5%). None of the naturally infected animals with parvovirus showed a protective anti-CPV Ab titer. Therefore, a significant difference between the parvovirus naturally infected group and the other two groups was found (p < 0.001).
3.3. CPV viral load 4. Discussion In the lymphoma group CPV was detected in the leukocytes, plasma and feces of 6 (RF = 75%), 8 (RF = 100%) and 7 (RF = 87.5%) dogs, respectively, at least once during the study. In the control group CPV was found in the leukocytes of 7 dogs (RF = 87.5%) and in the plasma and feces of all dogs (RF = 100%), at least once during the study. All CPV naturally infected dogs displayed a significantly higher concentration of CPV in the leukocytes, plasma and feces, than dogs with lymphoma or healthy dogs (p < 0.001) (Fig. 1). Leukocytic (p = 0.41), plasma (p = 0.56) and fecal (p = 0.17) CPV viral load were not significantly different between dogs with lymphoma prior to treatment initiation and healthy, control dogs. In the chemotherapy group, all three viral loads oscillated during the study, but no significant differences were observed at any time points, compared with values before treatment (leukocytes p = 0.72; plasma p = 0.98; feces p = 0.82) (Fig. 2). No significant differences were found in the leukocytic CPV viral load variation over time for the two groups (p = 0.41). However, plasma and fecal CPV viral load evolution was significantly different in both groups (p < 0.05). In dogs with lymphoma, no correlations were observed between the three biological samples analyzed. In healthy dogs, moderate correlations were found between leukocytic and plasma CPV viral loads ( = 0.47, p < 0.05), between leukocytic and fecal CPV viral loads ( = 0.66, p < 0.001) and between plasma and fecal CPV viral loads ( = 0.66, p < 0.001) (Fig. 3).
In humans, the results obtained over the years regarding chemotherapy treatments show a quantitative and qualitative decrease in immune function, typically higher in the cellular than in the humoral response [19–22]. In veterinary medicine, chemotherapy does not seem to have a significant impact on immune system of tumor bearing dogs. However, the humoral response [23] seems to be the most affected, although a significant impairment of antibody response to revaccination is seldom observed [23,24]. In this context, cases of reactivation and development of some opportunistic infections such as papillomatosis and demodicosis have been reported [25,26]. Despite some differences regarding the characterization of the immune system of tumor-bearing dogs, several studies suggest that the tumor itself may be responsible for the type and degree of immunosuppression seen in these patients [23,24,27]. In our study, platelets, neutrophils, lymphocytes and monocytes were higher in dogs with lymphoma than in healthy dogs, before chemotherapy initiation, without significant differences between groups. Therefore, lymphoma itself only appears to have influenced the hematocrit of dogs with lymphoma, as this was the only significantly different CBC parameter between groups before chemotherapy initiation. This is consistent with a non-regenerative anemia being a common paraneoplastic syndrome of this cancer [3,6]. The fact that we studied a small group of dogs may have precluded the finding of other significant differences at baseline. Also, we have no information concerning lymphoma
M.A. Elias et al. / Comparative Immunology, Microbiology and Infectious Diseases 37 (2014) 313–320
Fig. 2. Leukocytic, plasma and fecal CPV viral load (log + 1) of lymphoma and healthy dogs, during the study.
Fig. 3. Correlation between leukocytic, plasma and fecal CPV viral load (log + 1 molecules/L) in the lymphoma and control groups.
317
318
M.A. Elias et al. / Comparative Immunology, Microbiology and Infectious Diseases 37 (2014) 313–320
staging in our lymphoma group. This paper was based on real cases, where costs were often a problem, and where clinicians choose to start treatment regardless of further classification. In dogs treated with CHOP, no significant differences were observed at any time points, compared with baseline values. Furthermore, no significant differences were found in the CBC parameters variation over time for the two groups. This finding is in accordance with Walter et al., 2006 who found that doxorubicin single-agent chemotherapy and CHOP chemotherapy did not have a significant immunosuppressive effect to induce a sustained decrease in CD4+ and CD8+ cell numbers. A complete evaluation of lymphocyte populations and subsets would provide a clear insight into the dynamics of acquired immunity as a result of lymphoma and its treatment. The oscillations seen in all CBC parameters throughout the study seem to reflect the effects of the various drugs used in CHOP protocol, due to the various degrees of toxicity on rapidly dividing cells. After infection by the oronasal route, CPV replicates in rapidly dividing cells of the lymphoid tissue, particularly lymphocytes and monocytes, allowing CPV to spread into the bloodstream [28,29]. On the other hand, destruction of other rapidly dividing cells, such as enterocytes, allows the virus to be excreted in the feces [30]. CPV was identified in all dogs of both groups (lymphoma-bearing and cancer-free dogs), in at least one type of biological material and in at least one time point. Fluctuations over time were found in all three CPV viral loads, suggesting that there was not a progressive increase or decrease as a result of chemotherapy treatment. Although CPV has been detected in dogs with lymphoma, the presented clinical signs corresponded to slight changes that recovered with administration of appropriate treatment and could, therefore, be attributed to the myelo and GI toxicity of the administrated drugs. All dogs with parvovirus symptomatic natural infection had CPV in leukocytes, plasma and feces. More importantly, DNA quantification was significantly higher than in dogs with lymphoma or healthy dogs, most probably reflecting the difference between animals with clinical disease and carrier animals. In fact, all dogs in both lymphoma and control groups could be considered as CPV carriers. The intermittent excretion of CPV residual amounts observed in the lymphoma group did not seem to endanger immune compromised animals, since these dogs showed no clinical signs suggestive of parvovirus infection. Children with cancer shed influenza virus longer (≥7 days) than immunocompetent individuals (2–5 days), suggesting that they can be a reservoir of the disease and a threat to other hospitalized children at the same location [31]. In our study, this does not seem to be the case, as the fecal CPV viral load found in dogs with lymphoma was lower than in healthy dogs. However, it is worth remembering that we worked with a small group of dogs. The detection of trace amounts of CPV in leukocytes, plasma, and feces of both dogs with lymphoma and healthy dogs most probably reflected the high sensitivity of qPCR [32] and did not seem to represent a biological risk of infection.
Lymphoma itself did not appear to influence plasma, leukocytic and fecal CPV viral load, as no significant differences were found between lymphoma and control groups prior to chemotherapy. In the chemotherapy group, all three viral loads oscillated during the study, but no significant differences were observed at any time points, compared with values before treatment. Moreover, no significant differences were found in leukocytic CPV viral load variation over time for the two groups, suggesting that CHOP protocol does not seem to have influenced the leukocytic viral load. However, plasma and fecal viral load evolution was significantly different in both groups, suggesting a possible effect of chemotherapy in these parameters. The existence of a viral load peak at weak 3 (T1) in the control group is responsible for this significant difference (Fig. 2). The peak found in leukocytic and fecal viral loads is due to a single animal. In contrast, the peak found in plasma viral load is due to 4 dogs. Although all studied animals had high outdoor access, exposure to possible sources of CPV infection was more difficult to control in animals of the control group. It should also be noted that the small sample size may have prevented the blurring of these outliers influence in p values. Therefore, results regarding the chemotherapy influence in plasma and fecal CPV viral loads should be interpreted with caution. The correlations found between the three viral loads in healthy animals appear to reflect the dynamics of CPV infection. The fact that no correlations were observed between the three viral loads in dogs with lymphoma, suggests that chemotherapy could be responsible for a dynamics imbalance in carrier animals. In humans, most studies support the hypothesis that chemotherapeutic agents decrease Ab titers against common viruses [11,13,14,33,34]. However, the clinical significance of these findings in veterinary patients is still unknown. In animals undergoing chemotherapy for various malignancies, 14% had a decrease, 52% maintained and 33% had an increase in anti-CPV Ab titers. The percentage of dogs with lymphoma with protective Ab titers also decreased at the end of treatment [15]. In the present study, lymphoma itself did not seem to influence anti-CPV Ab titers, as all the animals (100%) in both groups (lymphoma-bearing and cancer-free dogs) had a protective titer prior to chemotherapy, in agreement with Henry et al., 2001. This finding is in accordance with the fact that all 16 dogs received correct anti-CPV vaccination, earlier on their lives. Only 1 dog undergoing CHOP protocol and 1 healthy dog did not maintain a protective anti-CPV Ab titer during the whole study. However, a protective titer was recovered by weak 9 (T3). These results suggest that chemotherapy did not influence anti-CPV Ab titers, as no differences were found between both groups. On the other hand, the fact that those two dogs regained a protective titer, none being vaccinated during the study, suggests CPV exposure, with maintenance of the ability to respond to this contact with a secondary immune response. Despite CPV detection in the plasma and feces of these two dogs with Ab titer <1:80, neither showed clinical or laboratory signs suggestive of parvovirus infection at that time point. Not only the mentioned decreases were temporary, as a decreased or
M.A. Elias et al. / Comparative Immunology, Microbiology and Infectious Diseases 37 (2014) 313–320
absent Ab titer in a vaccinated or previously exposed dog does not mean he is unprotected. The presence of other defense mechanisms such as cellular immunity should not be forgotten and the significance of decreased Ab below protective titers should not be overestimated [34]. None of the animals with CPV natural infection showed a protective anti-CPV Ab titer. This was not surprising since none of them were vaccinated and the ELISA test detected IgGs. Our results are consistent with most studies [15,23] where the administration of cytotoxic drugs resulted in anti-CPV Ab titers variations, but where the previously acquired immunity through vaccination or natural exposure does not appear to be significantly affected by such treatment and where the ability to mount a secondary humoral immune response is maintained. Our data suggests that lymphoma itself only appears to have influenced the hematocrit. The CHOP protocol could have influenced CPV plasma and fecal viral load, but not leukocytic viral load, nor anti-CPV protective Ab titers, or CBC. CPV location and load profile in animals undergoing chemotherapy could be considered similar to that of healthy animals. This is further reinforced by the significant difference found between CPV viral load of both lymphoma and healthy groups and the group of dogs with parvovirus clinical and molecular diagnosis. The seemingly random and negligible quantifications found in the former two groups do not seem to represent a biological hazard for these animals, since anti-CPV Ab titers were maintained above protective level in 87.5% of the dogs in both groups. In this context, Ab titration during chemotherapy treatment would have an important informative value. Therefore, the clinical and laboratory signs presented by some dogs with lymphoma, that could be the result of a CPV infection, were probably caused by the toxic effects of the administered drugs. The fact that we have not found a significant change in the number of leukocytes and their populations as a result of chemotherapy could be the result of the adopted schedule. Harvests were done before each chemotherapy session, at which time most values could have fully recovered. Thus, contrary to what would be expected, there was no evidence of a decrease in immune response either at admission, or after two chemotherapy cycles.
5. Conclusion Although immune responses after vaccination were not assessed in this study, our data suggests that previously established immunity by CPV vaccination was not significantly compromised by CHOP protocol, potentially mirroring the humoral competence toward theoretically more dangerous and/or clinically relevant viruses, such as canine distemper virus and rabies virus. In general, our results support the view that, contrary to what happens in human medicine, immunosuppression as a direct consequence of hematopoietic malignancies and/or its treatments in dogs remains unclear and will continue to benefit from further investigation.
319
Conflict of interest Zoetis Portugal supplied the ELISA kits used in this study. Zoetis Portugal did not interfere with the study design, collection, analysis, interpretation of data or in the decision to submit the manuscript for publication. None of the authors has any financial or personal relationships that could influence the content of the manuscript. There are no conflicts of interest. Acknowledgments This work was supported by the Center for Interdisciplinary Research in Animal Health of the University of Lisbon’s Faculty of Veterinary Medicine as part of an Integrated Master degree in Veterinary Medicine. We wish to acknowledge Zoetis who provided the TiterCHEK® CDV/CPV kits, and the Republican National Guard whose dogs were included in the healthy control group. References [1] Vail DM, MacEwen EG. Spontaneously occurring tumors of companion animals as models for human cancer. Cancer Invest 2000;18:781–92. [2] Marconato L, Gelain ME, Comazzi S. The dog as a possible animal model for human non-Hodgkin lymphoma: a review. Hematol Oncol 2013;31:1–9. [3] Vail D. Tumours of the haemopoietic system. In: Dobson JM, Duncan B, Lascelles X, editors. BSAVA manual of canine and feline oncology. 3rd ed. British Small Animal Veterinary Association; 2011. p. 285–303. [4] Dobson JM. Introduction: cancer in cats and dogs. In: Dobson JM, Duncan B, Lascelles X, editors. BSAVA manual of canine and feline oncology. 3rd ed. British Small Animal Veterinary Association; 2011. p. 1–5. [5] Chun R. Lymphoma: which chemotherapy protocol and why? Top Companion Anim Med 2009;24:157–62. [6] Vail DM, Young KM. Canine lymphoma and lymphoid leukemia. In: Withrow SJ, MacEwen EG, editors. Withrow and MacEwen’s small animal clinical oncology. 4th ed. St. Louis, MO: Saunders Elsevier; 2007. p. 699–733. [7] Chun R, Garrett LD, Vail DM. Chapter 11 – Cancer chemotherapy. In: Withrow SJ, Vail DM, editors. Withrow and MacEwen’s small animal clinical oncology. 4th ed. St. Louis: W.B. Saunders; 2007. p. 163–92. [8] Lana SE, Dobson JM. Principles of chemotherapy. In: Dobson JM, Duncan B, Lascelles X, editors. BSAVA manual of canine and feline oncology. 3rd ed. British Small Animal Veterinary Association; 2011. p. 60–79. [9] Hao NB, Lu MH, Fan YH, Cao YL, Zhang ZR, Yang SM. Macrophages in tumor microenvironments and the progression of tumors. Clin Dev Immunol 2012;2012:1–11. [10] Sherger M, Kisseberth W, London C, Olivo-Marston S, Papenfuss T. Identification of myeloid derived suppressor cells in the peripheral blood of tumor bearing dogs. BMC Vet Res 2012;8:209. [11] Ek T, Mellander L, Hahn-Zoric M, Abrahamsson J. Intensive treatment for childhood acute lymphoblastic leukemia reduces immune responses to diphtheria, tetanus, and Haemophilus influenzae type b. J Pediatr Hematol Oncol 2004;26:727–34. [12] Gopalan V, Nair R, Pillai S, Oberholzer T. Genital herpes zoster as a consequence of cancer chemotherapy-induced immunosuppression: report of a case. J Infect Chemother 2012;18:955–7. [13] Nilsson A, De Milito A, Engstrom P, Nordin M, Narita M, Grillner L, et al. Current chemotherapy protocols for childhood acute lymphoblastic leukemia induce loss of humoral immunity to viral vaccination antigens. Pediatrics 2002;109:e91. [14] Zignol M, Peracchi M, Tridello G, Pillon M, Fregonese F, D’Elia R, et al. Assessment of humoral immunity to poliomyelitis, tetanus, hepatitis B, measles, rubella, and mumps in children after chemotherapy. Cancer 2004;101:635–41. [15] Henry CJ, McCaw DL, Brock KV, Stoker AM, Tyler JW, Tate DJ, et al. Association between cancer chemotherapy and canine distemper
320
[16]
[17]
[18]
[19]
[20]
[21] [22] [23]
[24]
[25]
M.A. Elias et al. / Comparative Immunology, Microbiology and Infectious Diseases 37 (2014) 313–320 virus, canine parvovirus, and rabies virus antibody titers in tumorbearing dogs. J Am Vet Med Assoc 2001;219:1238–41. Berns K, Parrish CR. Parvoviridae. In: Fields BN, Knipe DM, Howley PM, editors. Fields virology. Philadelphia: Wolters Kluwer Health/Lippincott Williams & Wilkins; 2007. Decaro N, Campolo M, Desario C, Elia G, Martella V, Lorusso E, et al. Maternally-derived antibodies in pups and protection from canine parvovirus infection. Biologicals 2005;33:261–7. Litster AL, Pressler B, Volpe A, Dubovi E. Accuracy of a point-of-care ELISA test kit for predicting the presence of protective canine parvovirus and canine distemper virus antibody concentrations in dogs. Vet J 2012;193:363–6. Komada Y, Zhang S-L, Zhou Y-W, Hanada M, Shibata T, Azuma E, et al. Cellular immunosuppression in children with acute lymphoblastic leukemia: effect of consolidation chemotherapy. Cancer Immunol Immunother 1992;35:271–6. Mackall C, Fleisher T, Brown M, Magrath I, Shad A, Horowitz M, et al. Lymphocyte depletion during treatment with intensive chemotherapy for cancer. Blood 1994;84:2221–8. Mackall CL. T-cell immunodeficiency following cytotoxic antineoplastic therapy: a review. Stem Cells 2000;18:10–8. Rasmussen L, Arvin A. Chemotherapy-induced immunosuppression. Environ Health Perspect 1982;43:21–5. Walter CU, Biller BJ, Lana SE, Bachand AM, Dow SW. Effects of chemotherapy on immune responses in dogs with cancer. J Vet Intern Med 2006;20:342–7. Winnicka A, Jagielski D, Hoffmann-Jagielska M, Lechowski R. Cytometric evaluation of peripheral blood lymphocytes in dogs with lymphoma during chemotherapy. J Vet Med A Physiol Pathol Clin Med 2002;49:303–6. Lucroy MD, Hill FI, Moore PF, Madewell BR. Cutaneous papillomatosis in a dog with malignant lymphoma following long-term chemotherapy. J Vet Diagn Investig 1998;10:369–71.
[26] Sundberg JP, Smith EK, Herron AJ, Jenson AB, Burk RD, Van Ranst M. Involvement of canine oral papillomavirus in generalized oral and cutaneous verrucosis in a Chinese Shar Pei Dog. Vet Pathol Online 1994;31:183–7. [27] Weiden PL, Storb R, Kolb H-J, Ochs HD, Graham TC, Tsoi M-S, et al. Immune reactivity in dogs with spontaneous malignancy. J Natl Cancer Inst 1974;53:1049–56. [28] Meunier PC, Cooper BJ, Appel MJG, Lanieu ME, Slauson DO. Pathogenesis of canine parvovirus enteritis: sequential virus distribution and passive immunization studies. Vet Pathol Online 1985;22: 617–24. [29] Stann SE, DiGiacomo RF, Giddens Jr WE, Evermann JF. Clinical and pathologic features of parvoviral diarrhea in pound-source dogs. J Am Vet Med Assoc 1984;185:651–5. [30] Pollock RV. Experimental canine parvovirus infection in dogs. Cornell Vet 1982;72:103–19. [31] Täger FM, Zolezzi RP, Folatre BI, Navarrete CM, Rojas PJ. Infec˜ ciones por virus respiratorios en ninos con leucemia linfoblástica aguda y neutropenia febril: Estudio prospectivo. Rev Chil Infectol 2006;23:118–23. [32] Decaro N, Elia G, Martella V, Desario C, Campolo M, Trani LD, et al. A real-time PCR assay for rapid detection and quantitation of canine parvovirus type 2 in the feces of dogs. Vet Microbiol 2005;105: 19–28. [33] Alanko S, Pelliniemi TT, Salmi TT. Recovery of blood Blymphocytes and serum immunoglobulins after chemotherapy for childhood acute lymphoblastic leukemia. Cancer 1992;69: 1481–6. [34] Reinhardt D, Houliara K, Pekrun A, Lakomek M, Krone B. Impact of conventional chemotherapy on levels of antibodies against vaccinepreventable diseases in children treated for cancer. Scand J Infect Dis 2003;35:851–7.