- Email: [email protected]
Influence of CYP2C9 and VKORC1 gene polymorphisms on warfarin dosage, over anticoagulation and other adverse outcomes in Indian population
European Journal of Pharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66
Contents lists available at SciVerse ScienceDirect
European Journal of Pharmacology journal homepage: www.elsevier.com/locate/ejphar
Cardiovascular pharmacology
Influence of CYP2C9 and VKORC1 gene polymorphisms on warfarin dosage, over anticoagulation and other adverse outcomes in Indian population Q1
Tejasvita Gaikwad a, Kanjaksha Ghosh a, Bipin Kulkarni a, Vrinda Kulkarni b, Cecil Ross c, Shrimati Shetty a,n a
National Institute of Immunohaematology (ICMR), 13th Floor, KEM Hospital, Parel, Mumbai 400012, India Topiwala National Medical College & B. Y. L. Nair Charitable Hospital, Department of Medicine, Mumbai, India c St Johns Medical Hospital, Bangalore, Karnataka, India b
art ic l e i nf o
a b s t r a c t
Article history: Received 20 December 2012 Received in revised form 28 March 2013 Accepted 9 April 2013
The aim of this study was to determine the frequencies of SNPs in the vitamin K epoxide reductase complex subunit 1 (VKORC1) and cytochrome P450 2C9 (CYP2C9) genes and their effect on warfarin dose requirement, over anticoagulation and other adverse outcomes in Indian population. A total of 145 warfarin treated patients for various clinical conditions were screened for VKORC1 and CYP2C9 gene polymorphisms by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique. We found that homozygous VKORC1-1639 AA and CYP2C9 n3/n3 polymorphisms showed 100% association with risk of over anticoagulation and other adverse events. Carriers of two heterozygous variant genotypes also showed significant association with risk of over anticoagulation and bleeding. Single variant carrier patients were found to require low warfarin dose as compared to wild type (CYP2C9n1/n1 and VKORC1- 1639 GG) patients. The major impact of VKORC1 and CYP2C9 genotypes was observed in the first month of anticoagulation. A drastic variation from other Asian countries was observed in Indian population with regard to the distribution of different VKORC1 -1639 genotypes. Our results suggest that both VKORC1 and CYP2C9 genotypes showed significant impact on warfarin dose requirement, over anticoagulation in the first month of anticoagulation and number of bleeding episodes. The variation in therapeutic dosage of warfarin and the associated adverse events across different populations is due to the wide differences in the frequency of these warfarin sensitive alleles. & 2013 Published by Elsevier B.V.
Keywords: CYP2C9 VKORC1 Warfarin India
1. Introduction Warfarin (Coumadins) is a widely used anticoagulant to prevent thromboembolic disorders. Management of anticoagulation therapy is difficult as there is a wide inter- and intra-individual variability that possibly leads to hemorrhagic or thromboembolic events despite careful dosage monitoring. Dose adjustments are often necessary and are based on measuring the prothrombin time (PT) in blood and calculating the international normalized ratio (INR). A high INR predisposes to a high risk of bleeding, while an INR below the therapeutic target range indicates that the dose of warfarin is insufficient to protect against thromboembolic events (Hirsh et al., 2001; Kearon et al., 2003; Tapson et al., 2005; Wittkowsky, 2004). The pharmacodynamic and pharmacokinetic parameters of warfarin are predominantly influenced by genetic polymorphisms in two genes namely CYP2C9 and VKORC1 (Wadelius et al., 2007).
n
Corresponding author. Tel.: +91 22 24138518; fax: +91 22 24138521. E-mail address: [email protected] (S. Shetty).
Warfarin is a racemic mixture of S-warfarin and R-warfarin, the former being a more active isomer having higher therapeutic effect. Both these enantiomers are metabolized by different cytochrome P450 enzymes. R-Warfarin is mainly metabolized by CYP3A4, CYP1A2 and CYP2C19 and, while S-warfarin is mainly metabolized by CYP2C9. Carriers of the common allelic variants (n2 or n3) of the CYP2C9 are known to be slow metabolizers of warfarin and are associated with a lower warfarin dose requirement accompanied by a greater tendency to experience bleeding complications during warfarin therapy. Vitamin K epoxide reductase involved in the recycling of vitamin K and is encoded by the vitamin K epoxide reductase complex subunit 1 (VKORC1). Warfarin exerts its anticoagulant effect through inhibition of the VKORC1 gene product. VKORC1 -1639 GG carriers require higher warfarin doses than those with GA or AA genotype. Generally, target INR varies in different clinical indications, but the most common therapeutic range is 2.0–3.0. As there is a wide ethnic variation in the distribution of these polymorphisms, the mean warfarin dose requirement also varies with race. Thus Africans and Americans require larger dosage of warfarin as
0014-2999/$ - see front matter & 2013 Published by Elsevier B.V. http://dx.doi.org/10.1016/j.ejphar.2013.04.006
Please cite this article as: Gaikwad, T., et al., Influence of CYP2C9 and VKORC1 gene polymorphisms on warfarin dosage, over anticoagulation and.... Eur J Pharmacol (2013), http://dx.doi.org/10.1016/j.ejphar.2013.04.006i
T. Gaikwad et al. / European Journal of Pharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎
2
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66
compared to Europeans and Asians (Dang et al., 2005; Geisen et al., 2005; Lee et al., 2006; Li et al., 2009; Marsh et al., 2006; Takahashi et al., 2006; Veenstra et al., 2005; Yuan et al., 2005). Within the Asian population, Indian patients have been reported to require higher warfarin dose as compared to Chinese and Malay patients (Lee et al., 2006). In the present study, CYP2C9 and VKORC1 polymorphisms were analyzed in 145 warfarin treated adult Indian patients in relation to the dose of warfarin, over anticoagulation and the number of bleeding episodes. The genotype frequencies have also been compared with the data from other Asian countries.
thromboplastin reagent (Neoplastin CI Plus, Diagnostica Stago, Asnieres, France) using the International Sensitivity Index (ISI). The ISI value in this reagent has been determined against secondary standard (rabbit brain thromboplastin) as per the method recommended by World Health Organization (WHO). The coagulation reaction contained 50 μL of citrated plasma sample which was incubated at 37 1C for 60 s followed by addition of 100 ml of thromboplastin reagent. The cell pellet was preserved at −20 1C for DNA analysis. DNA was extracted from blood samples by standard phenol chloroform method. 2.3. VKORC1 -1639 G/A genotyping
2. Materials and methods 2.1. Patients This study is a prospective analysis of one hundred and forty five patients (age range 19–80 years; mean age 49 years; 93 males, 52 females) who were prescribed warfarin for various clinical conditions. Patients were recruited from King Edward Memorial Hospital, Mumbai; BYL Nair Ch. Hospital, Mumbai and St. John's Hospital, Bangalore. Data was collected from the clinical proforma which was filled for every patient which included INR values, warfarin daily dose, changes in warfarin dose, race, body weight, height, gender, smoking, diet, co-medication (amiodarone, statins, sulfamethoxazole, azole, antifungals, rifampin, phenytoin, carbamazepine), illness, bleeding complications, new thrombotic episodes, surgical procedure, etc. These details were taken during each visit of these patients. Patients needing a medication known to interact with warfarin and patients with abnormal renal or liver function test were excluded from the study. Warfarin initiation and maintenance dose adjustment was blinded to genotype result. After initiation of warfarin, PT- INR (Prothrombin Time-International Normalized Ratio) was tested every 2–4 days. After 2 consecutive therapeutic INR, interval was increased to 2 weeks. After 4 consecutive therapeutic INR, interval was increased to 4 weeks and continued with the same monitoring interval. The minimum follow up period was 6 months and the maximum period was 15 months. The study was approved by the Institutional Ethics Committee of all the participating centers.
The DNA samples were amplified using oligonucleotide primers (Sigma, Bangalore, India) in a 96 welled thermal cycler (Applied Biosystems Veriti, Carlsbad, California). Briefly, the protocol was as follows; the PCR mix consisted of a final volume of 25 μl, containing 1.25 μl of 10 pmol each primers, 0.2 μl 25 mM deoxynucleotides triphosphate, 1.5 μl 25 mM MgCl2, 2.5 μl 10 complete buffer (Bioron, Ludwigshafen, Germany), 0.15 μl DFS- Taq DNA pol. (Bioron, Ludwigshafen, Germany) and 2 μl DNA sample. 10 μl of amplified product was used for RFLP analysis using 5 units of Hpa II restriction enzyme (New England Biolabs, Hertfordshire, UK). 2.4. CYP2C9 genotyping The DNA samples were amplified using oligonucleotide primers (Sigma, Bangalore, India) in a 96 welled thermal cycler (Applied Biosystems, Veriti, Carlsbad, California). Briefly, the protocol was as follows; the PCR mix consisted of a final volume of 25 μl containing, 1.0 μl of 10 pmol each primer (Sigma, Bangalore, India), 0.25 μl 25 mM deoxynucleotides triphosphate, 1.5 μl 25 mM MgCl2, 2.5 μl 10 complete buffer (Bioron, Ludwigshafen, Germany), 0.15 μl DFS-Taq DNA polymerase (Bioron, Ludwigshafen, Germany) and 2 μl DNA sample. 10 μl of amplified product was used for RFLP analysis using 5 units of Ava II restriction enzyme (New England Biolabs, Hertfordshire,UK) for CYP2C9n2 and 5 units of Nsi I restriction enzyme (New England Biolabs, Hertfordshire, UK) for CYP2C9n3 genotyping. The PCR program and the primer sequences for both VKORC1 and CYP2C9 genotyping are given in Table 1.
2.2. Blood sampling 2.5. Over anticoagulation and stable anticoagulation After obtaining informed consent, 5 ml of venous blood sample was collected in 3.13% sodium citrate (0.5:4.5 anticoagulant to blood) tube from each patient. The sample was spun at 4000 rpm for 15 min at 4 1C. The platelet poor plasma was used for prothrombin time test. All prothrombin time test measurements were carried out using a four-channel semi automated coagulometer (St Art, Diagnostica Stago, Asnieres, France). Warfarin dose was monitored by assessment of the INR, which corresponds to the prothrombin time ratio corrected for an individual
A patient was said to be over anticoagulated if patient's INR was 44.0. Stable anticoagulation was defined as 2 consecutive inrange INRs, at least 7 days apart, with no dose adjustments. 2.6. Bleeding episodes Patients were considered to have “bleeding episodes” when it required medical attention or attendance at hospital.
Table 1 Primer sequences and PCR protocols. Genotype
Primer sequences
Thermal cycler Program
VKORC11639 G/A CYP2C9n2
FOR:5′CAAGTTCCAGGGATTCATGC-3′ REV:5′CCAAGACGCTAGACCCAATG-3′ FOR:5′TACAAATACAATGAAAATATCATG-3′ REV:5′CTAACAACCAGACTCATAATG-3′ FOR:5AATAATAATATGCACGAGGTCCAGAGATGC3′ REV:5′GATACTATGAATTTGGGACTTC-3′
Initial denaturation: 5 min at 94 1C 30 cycles: 30 s at 94OC, 30 s at 60 1C, 30 s at 68 1C. Terminal extension: 10 min at 68 1C Initial denaturation: 5 min at 94 1C 35 cycles: 1 min at 94 1C, 30 s at 57 1C, 1 min at 72 1C. Terminal extension: 7 min at 72 1C Initial denaturation: 5 min at 94 1C 35 cycles: 1 min at 94 1C, 30 s at 57 1C, 1 min at 72 1C. Terminal Extension: 7 min at 72 1C
CYP2C9n3
Please cite this article as: Gaikwad, T., et al., Influence of CYP2C9 and VKORC1 gene polymorphisms on warfarin dosage, over anticoagulation and.... Eur J Pharmacol (2013), http://dx.doi.org/10.1016/j.ejphar.2013.04.006i
T. Gaikwad et al. / European Journal of Pharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66
2.7. Statistical analysis: Genotype frequencies were estimated by the gene-counting method. Genotypes were tested for deviation from Hardy–Weinberg equilibrium. Statistical analysis for relative risk and p-values were performed with the MedCalc Software Version 12.3.0 (http:// www.medcalc.org/calc/relative_risk.php).
significant effect on warfarin dose requirement, bleeding and risk of over anticoagulation in the first month of warfarin therapy. Neither VKORC1 nor CYP2C9 polymorphisms were significantly associated with these parameters beyond the first month of treatment (Table 4). CYP2C9n3 variant showed a stronger association with reduced warfarin dose and risk of overanticoagulation than CYP2C9n2 variant (Table 3).
4. Discussion
3. Results A total of 145 warfarin treated patients were genotyped for CYP2C9 and VKORC1 polymorphisms using PCR-RFLP method. None of our patients were on any vitamin K supplements. Patient's demographic and clinical data is shown in Table 2. Cerebral venous thrombosis and deep vein thrombosis of upper or lower limb were the main indications for anticoagulation with warfarin. Other cases were pulmonary embolism (6.9%), atrial fibrillation (1.38%), heart valve replacement (10.34%) and other indications (12.41%). The monitoring period of the patients varied between 6 and 15 months. The genotype frequencies are shown in Table 2. To study the effect CYP2C9 and VKORC1 genotype on anticoagulation therapy, the patients were divided into 3 groups. 1. Non carriers (Wild type CYP2C9 and VKORC1). 2. Carriers of 1 variant allele (1 sensitive allele either in CYP2C9 or VKORC1 gene). 3. Carriers of 2 variant alleles (2 sensitive alleles either in CYP2C9 or VKORC1 gene).
Tables 3 and 4 show the effect of individual and combined variant alleles on warfarin dose requirement, bleeding episodes and risk of over anticoagulation. Homozygous variants i.e. VKORC1-1639 A/A, CYP2C9n3/n3 and two heterozygous variant carriers (a combination of VKORC1 variant allele combined with either CYP2C9n2 or n3) showed
Table 2 Demographic and clinical data. Total patients ¼145 Demographics Male Age range Sites of thrombosis Cerebral venous thrombosis Lower/upper limb DVT Atrial fibrillation Pulmonary embolism Heart valve replacement Other indications
93 (64%) 19–80 years Number (%) 44 (30.34) 56 (38.62) 2 (1.38) 10 (6.9) 15 (10.34) 18 (12.41)
Genotypes VKORC1 -1639 G/A GG (Wild type) GA AA
111 (76.56) 31 (21.38) 3 (2.06)
CYP2C9n2 and CYP2C9n3 n 1/n1 (Wild type) n 1/n2 n 2/n2 n 1/n3 n 3/n3
105 9 0 27 4
Patients with no warfarin-sensitive allele GG, n1/n1
3
(72.41) (6.20) (0) (18.62) (2.76)
81 (55.87)
The narrow therapeutic range of warfarin and the interindividual variation are the two important factors which necessitate warfain pharmacogenomic studies with an ultimate objective of individualized treatment regimens based on the genotype of the patient. Age, diet (vitamin K content), drugs, and hepatocellular damage are some of the non genetic factors which are known to interact with warfarin. Warfarin related bleeding episodes is one of the major causes of emergency admissions in many countries. Majority of the pharmacogenomic studies have considered the following factors- risk of bleeding in the initiation phase (1–3 months), over anticoagulation, warfarin dosage required to achieve a target INR between 2 and 3, maintenance dose and so on. Several algorithms have been reported for the effective management of anticoagulant phase. In the present study, VKORC1 AA and CYP2C9n3/n3 genotypes were found to be significantly associated with higher risk of over anticoagulation and lower warfarin dose requirement. Carriers of even one variant allele were found to require lower warfarin dose indicating that genotyping of all variants is important to avoid risk of over anticoagulation and to predict correct warfarin dose in these patients. In India, pharmacogenetic guided dosing is not commonly endorsed in routine practice and trial and error method is often pursued by physicians. Carriers of variant alleles of CYP2C9 and VKORC1, often face problems of overanticoagulation/hemorrhage in initial phase of anticoagulation. Genotype guided dosing is thus needed to avoid these adverse outcomes, wherein more than 40% of the patients carry these variant alleles. Diet is another important factor known to affect warfarin dose (Franco et al., 2004; White, 2010). However all our patients were instructed to have warfarin tablets in the morning after breakfast and asked to have a balanced protein diet and restrict intake of green leafy vegetables. This instruction was followed by more than 90% of our patients and might have reduced diet related fluctuation of INR. A recent report by Lund et al. (2012) has shown that, only VKORC1 AA genotype was significantly associated with risk of over anticoagulation during the first month of anticoagulation treatment. In the present study, along with VKORC1 AA genotype, even CYP2C9n3/n3 and carriers of two heterozygous variant genotypes showed significant risk of over anticoagulation in first month of treatment. Hence before initiating the anticoagulation, screening of both genotypes (VKORC1 and CYP2C9) should benefit in avoiding supra therapeutic INRs and its relative risks. Neither VKORC1 nor CYP2C9 polymorphisms were found to be significantly associated with these parameters beyond the first month of treatment (Table 4). This conclusion is consistent with the finding of several earlier reports (Caraco et al., 2008; Lund et al., 2012; Peyvandi et al., 2004). It is very important to determine the allele frequencies of CYP2C9 and VKORC1 genes in different populations in order to assess the usefulness of prior genotyping in warfarin treated patients. Many studies have shown that warfarin dose requirement vary with race. Asian patients require a lower dose as compared to African and Caucasian (Dang et al., 2005; Geisen
Please cite this article as: Gaikwad, T., et al., Influence of CYP2C9 and VKORC1 gene polymorphisms on warfarin dosage, over anticoagulation and.... Eur J Pharmacol (2013), http://dx.doi.org/10.1016/j.ejphar.2013.04.006i
T. Gaikwad et al. / European Journal of Pharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎
4
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66
Table 3 Effect of individual and combined variant alleles on warfarin dose requirement and risk of over anticoagulation. Relative risk for Patients with over antico Patients with bleeding -agulation (INR 44) while problem while on warfain No./ over anti coagulation a on warfarin: No./Total (%) Total (%)
Genotypes (VKORC1-1639+ CYP2C9)
No. of patients (%)
Non carriers GG+n1/n1
81 (55.86) 24/81 (29.63)
p-value
a
95%CI
Stable average daily warfarin dose (mg) 7 0.2
24/81 (29.63)
–
–
–
6.25
One variant carriers 21 (14.48) 10/21 (47.62) GA+n1/n1 GG+n1/n2 6 (4.14) 4/6 (66.66) GG+n1/n3 20 (13.79) 13/20 (65.00) TOTAL 47 (32.41) 27/47 (57.45)
10/21 3/6 10/20 23/47
(47.62) (50.00) (50.00) (48.94)
1.6071 2.2500 2.1938 1.9388
P¼ 0.0969 P¼ 0.0157 P¼ 0.0009 P¼ 0.0018
0.9178–2.8142 1.1654–4.3440 1.3782–3.4919 1.2788–2.9395
3.75 4.4 3.75 3.97
Two variant carriers GA+n1/n3 7 (4.83) GA+n1/n2 3 (2.07) GG+n3/n3 4 (2.76) AA+n1/n1 3 (2.07) TOTAL 17 (11.72)
4/7 3/3 4/4 3/3 14/17
(57.14) (100.0) (100.0) (100.0) (82.35)
2.8929 2.9286 3.0122 2.9286 2.7794
Po 0.0001 Po 0.0001 Po 0.0001 Po 0.0001 Po 0.0001
1.8413–4.5450 1.7814–4.8146 1.9362–4.6863 1.7814–4.8146 1.8606–4.1519
3.0 3.15 3.0 3.10 3.06
a
6/7 3/3 4/4 3/3 16/17
(85.71) (100.0) (100.0) (100.0) (94.12)
Relative risk and p-values were calculated for patients with overanticoagulation (INR 44) while on warfarin; GG+1/1 (non carrier) genotype was used as a control.
Table 4 Effect of genotypes during different time intervals of anticoagulation. Genotype
VKORC1GG+CYP2C9 n1/n1 (wild type)
Days 1–30 (Patients 145)
Days 31–90 (Patients 145)
INR 44 Positive/Total number (%)
INR 44 Positive/Total number (%)
20/81 (24.69)
4/81 (4.93)
One variant carriers VKORC1 GA+CYP2C9 n1/n1 VKORC1GG+CYP2C9 n1/n2 VKORC1GG+CYP2C9 n1/n3
8/21 (38.09) aP ¼0.2011 2/21 (9.52%) bP ¼0.4291 3/6 (50) aP ¼0.1185 1/6 (16.66) bP ¼0.2398 10/20 (50) aP ¼0.0172 3/20 (15) bP ¼0.1237
Two variants carriers VKORC1GA+ CYP2C9 1/3 VKORC1GA+ CYP2C9 n1/n2 VKORC1GG+CYP2C9 n3/n3 VKORC1AA+ CYP2C9 n1/n1
6/7 3/3 4/4 3/3
(85.71) aPo 0.0001 (100) aPo 0.0001 (100) aPo 0.0001 (100) aPo 0.0001
0/7 0/3 0/4 0/3
(0) (0) (0) (0)
b
P ¼0.9282 P ¼0.5565 b P ¼0.6721 b P ¼0.5565 b
a P values were calculated against wild type genotype carrier patients who experienced over anticoagulation in days 1–30. b P values were calculated against wild type genotype carrier patients who experienced over anticoagulation in days 31–90.
Table 5 CYP2C9 genotype distribution in Asian countries.
Country
CYP2C9 n
1/n1
China Indonesia Japan Russia India
784 113 790 94 105
(92.8%) (93.62%) (95.41%) (84.7%) (72.41%)
n
1/n2
– – – 5 (4.5%) 9 (6.21%)
n
2/n3
n
1/n3
– – – 2 (1.38%)
60 9 37 12 25
n
(7.1%) (7.38%) (4.47%) (10.80%) (17.24%)
et al., 2005; Lee et al., 2006; Takahashi et al., 2006; Veenstra et al., 2005; Yuan et al., 2005) but the present study shows that genotype distribution of Indians is markedly different than that of other Asian countries (Tables 5 and 6). We compared the genotype frequencies with that of major ethnic groups in Asia. As shown in Tables 5 and 6, frequency
Number of patients
Reference
845 122 828 111 145
Zhong et al., 2012 Suriapranata et al., 2011 Mushiroda et al., 2006 Vorob’eva et al. (2011) Present study
3/n3
1 (0.1%) – 1 (0.12%) – 4 (2.76%)
of n1/n3 genotypes is much higher in Indians i.e. 17.24%, while in Chinese, Indonesians, Japanese and Russians it was 7.1%, 7.38%, 4.47%, 10.80% respectively. However, the distribution of VKORC1 genotypes was distinctly different in Indians as compared to other ethnic groups in Asia. VKORC1 -1639 GG genotypes found predominant in Indian population i.e. 76.55%, while in Chinese,
Please cite this article as: Gaikwad, T., et al., Influence of CYP2C9 and VKORC1 gene polymorphisms on warfarin dosage, over anticoagulation and.... Eur J Pharmacol (2013), http://dx.doi.org/10.1016/j.ejphar.2013.04.006i
T. Gaikwad et al. / European Journal of Pharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56
5
Table 6 VKORC1 genotype distribution in Asian countries.
Country
VKORC1 -1639 G/A genotype GG
China Indonesia Japan Russia India
13 5 6 47 111
GA (1.5%) (3.80%) (0.73%) (42.3%) (76.55%)
171 52 133 54 31
Number of patients
Reference
845 135 828 111 145
Zhong et al., 2012 Suriapranata et al., 2011 Mushiroda et al., 2006 Vorob’eva et al. (2011) Present study
AA (20.2%) (38.60%) (16.06%) (48.6%) (21.38%)
661 78 689 10 3
Indonesians, Japanese and Russians it was 1.5%, 3.80%, 0.73%, 42.3% respectively. In conclusion, the present study shows a strong association of the polymorphisms in the two genes i.e. VKORC1 and CYP2C9 with the dosage of warfarin and other adverse events. The distribution of the different alleles of these two genes also varies markedly in different populations. Ethical consideration This study was approved by the Institute Ethics Committee. All subjects received full written and oral information on the objectives and the procedure of the study and gave their written informed consent. Acknowledgments Tejasvita Gaikwad has received funds for research from Indian Council of Medical Research (ICMR), Delhi, India. (IRIS cell No. 2011-05540). References Caraco, Y., Blotnick, S., Muszkat, M., 2008. CYP2C9 genotype-guided warfarin prescribing enhances the efficacy and safety of anticoagulation: a prospective randomized controlled study. Clin. Pharmacol. Ther. 83, 460–470. Dang, M.T., Hambleton, J., Kayser, S.R., 2005. The influence of ethnicity on warfarin dosage requirement. Ann. Pharmacother. 39, 1008–1012. Franco, V., Polanczyk, C.A., Clausell, N., Rohde, L.E., 2004. Role of dietary vitamin K intake in chronic oral anticoagulation: prospective evidence from observational and randomized protocols. Am. J. Med. 116, 651–656. Geisen, C., Watzka, M., Sittinger, K., Steffens, M., Daugela, L., Seifried, E., Müller, C.R., Wienker, T.F., Oldenburg, J., 2005. VKORC1 haplotypes and their impact on the inter-individual and inter-ethnical variability of oral anticoagulation. Thromb. Haemostasis 94, 773–779. Hirsh, J., Dalen, J., Anderson, D.R., Poller, L., Bussey, H., Ansell, J., Deykin, D., 2001. Oral anticoagulants: mechanism of action, clinical effectiveness and optimal therapeutic range. Chest 119, 8S–21S. Kearon, C., Ginsberg, J.S., Kovacs, M.J., Anderson, D.R., Wells, P., Julian, J.A., 2003. Comparison of low-intensity warfarin therapy with conventional-intensity warfarin therapy for long-term prevention of recurrent venous thromboembolism. N. Engl. J. Med. 349, 631–639. Lee, S.C., Ng, S.S., Oldenburg, J., Chong, P.Y., Rost, S., Guo, J.Y., Yap, H.L., Rankin, S.C., Khor, H.B., Yeo, T.C., Ng, K.S., Soong, R., Goh, B.C., 2006. Interethnic variability of warfarin maintenance requirement is explained by VKORC1 genotype in an Asian population. Clin. Pharmacol. Ther. 79, 197–205.
(78.2%) (57.60%) (83.21%) (9.1%) (2.06%)
Li, C., Schwarz, U.I., Ritchie, M.D., Roden, D.M., Stein, C.M., Kurnik, D., 2009. Relative contribution of CYP2C9 and VKORC1 genotypes and early INR response to the prediction of warfarin sensitivity during initiation of therapy. Blood 113, 3925–3930. Lund, K., Gaffney, D., Spooner, R., Etherington, A.M., Tansey, P., Tait, R.C., 2012. Polymorphisms in VKORC1 have more impact than CYP2C9 polymorphisms on early warfarin International Normalized Ratio control and bleeding rates. Br. J. Haematol. 158, 256–261. Marsh, S., King, C.R., Porche-Sorbet, R.M., Scott-Horton, T.J., Eby, C.S., 2006. Population variation in VKORC1 haplotype structure. J. Thromb. Haemostasis 4, 473–474. Mushiroda, T., Ohnishi, Y., Saito, S., Takahashi, A., Kikuchi, Y., Saito, S., Shimomura, H., Wanibuchi, Y., Suzuki, T., Kamatani, N., Nakamura, Y., 2006. Association of VKORC1 and CYP2C9 polymorphisms with warfarin dose requirements in Japanese patients. J. Hum. Genet. 51, 249–253. Peyvandi, F., Spreafico, M., Siboni, S.M., Moia, M., Mannucci, P.M., 2004. CYP2C9 genotypes and dose requirements during the induction phase of oral anticoagulant therapy. Clin. Pharmacol. Ther. 75, 198–203. Suriapranata, I.M., Tjong, W.Y., Wang, T., Utama, A., Raharjo, S.B., Yuniadi, Y., Tai, S.S., 2011. Genetic factors associated with patient-specific warfarin dose in ethnic Indonesians. BMC Med. Genet. 12, 80–88. Takahashi, H., Wilkinson, G.R., Nutescu, E.A., Morita, T., Ritchie, M.D., Scordo, M.G., Pengo, V., Barban, M., Padrini, R., Ieiri, I., Otsubo, K., Kashima, T., Kimura, S., Kijima, S., Echizen, H., 2006. Different contributions of polymorphisms in VKORC1 and CYP2C9 to intra- and inter-population differences in maintenance dose of warfarin in Japanese, Caucasians and African-Americans. Pharmacogenet. Genomics 16, 101–110. Tapson, V.F., Hyers, T.M., Waldo, A.L., Ballard, D.J., Becker, R.C., Caprini, J.A., Khetan, R., Wittkowsky, A.K., Colgan, K.J., Shillington, A.C., 2005. Antithrombotic therapy practices in US hospitals in an era of practice guidelines. Arch. Intern. Med. 165, 1458–1464. Vorob'eva, N.M., Panchenko, E.P., Titaeva, E.V., Khasanova, Z.B., Konovalova, N.V., Postnov, A., Kirienko, A.I., 2011. Polymorphisms of genes CYP2C9 and VKORC1 in patients with venous thromboembolic complications in Moscow population: effects on stability of anticoagulant therapy and frequency of haemorrhage. Ter. Arkh. 83, 59–65. Veenstra, D.L., You, J.H., Rieder, M.J., Farin, F.M., Wilkerson, H.W., Blough, D.K., Cheng, G., Rettie, A.E., 2005. Association of Vitamin K epoxide reductase complex 1 (VKORC1) variants with warfarin dose in a Hong Kong Chinese patient population. Pharmacogenet. Genomics 15, 687–691. Wadelius, M., Chen, L.Y., Eriksson, N., Bumpstead, S., Ghori, J., Bentley, D., McGinnis, R., Deloukas, P., 2007. Association of warfarin dose with genes involved in its action and metabolism. Hum. Genet. 121, 23–34. White, P.J., 2010. Patient factors that influence warfarin dose response. J. Pharm. Pract. 23, 194–204. Wittkowsky, A.K., 2004. Effective anticoagulation therapy: defining the gap between clinical studies and clinical practice. Am. J. Manag. Care 10, S297–S306. Yuan, H.Y., Chen, J.J., Lee, M.T., Wung, J.C., Chen, Y.F., Charng, M.J., Lu, M.J., Hung, C.R., Wei, C.Y., Chen, C.H., Wu, J.Y., Chen, Y.T., 2005. A novel functional VKORC1 promoter polymorphism is associated with inter-individual and inter-ethnic differences in warfarin sensitivity. Hum. Mol. Genet. 14, 1745–1751. Zhong, S.L., Yu, X.Y., Liu, Y., Xu, D., Mai, L.P., Tan, H.H., Lin, Q.X., Yang, M., Lin, S.G., 2012. Integrating interacting drugs and genetic variations to improve the predictability of warfarin maintenance dose in Chinese patients. Pharmacogenet. Genomics 22, 176–182.
Please cite this article as: Gaikwad, T., et al., Influence of CYP2C9 and VKORC1 gene polymorphisms on warfarin dosage, over anticoagulation and.... Eur J Pharmacol (2013), http://dx.doi.org/10.1016/j.ejphar.2013.04.006i
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66
Contents lists available at SciVerse ScienceDirect
European Journal of Pharmacology journal homepage: www.elsevier.com/locate/ejphar
Cardiovascular pharmacology
Influence of CYP2C9 and VKORC1 gene polymorphisms on warfarin dosage, over anticoagulation and other adverse outcomes in Indian population Q1
Tejasvita Gaikwad a, Kanjaksha Ghosh a, Bipin Kulkarni a, Vrinda Kulkarni b, Cecil Ross c, Shrimati Shetty a,n a
National Institute of Immunohaematology (ICMR), 13th Floor, KEM Hospital, Parel, Mumbai 400012, India Topiwala National Medical College & B. Y. L. Nair Charitable Hospital, Department of Medicine, Mumbai, India c St Johns Medical Hospital, Bangalore, Karnataka, India b
art ic l e i nf o
a b s t r a c t
Article history: Received 20 December 2012 Received in revised form 28 March 2013 Accepted 9 April 2013
The aim of this study was to determine the frequencies of SNPs in the vitamin K epoxide reductase complex subunit 1 (VKORC1) and cytochrome P450 2C9 (CYP2C9) genes and their effect on warfarin dose requirement, over anticoagulation and other adverse outcomes in Indian population. A total of 145 warfarin treated patients for various clinical conditions were screened for VKORC1 and CYP2C9 gene polymorphisms by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique. We found that homozygous VKORC1-1639 AA and CYP2C9 n3/n3 polymorphisms showed 100% association with risk of over anticoagulation and other adverse events. Carriers of two heterozygous variant genotypes also showed significant association with risk of over anticoagulation and bleeding. Single variant carrier patients were found to require low warfarin dose as compared to wild type (CYP2C9n1/n1 and VKORC1- 1639 GG) patients. The major impact of VKORC1 and CYP2C9 genotypes was observed in the first month of anticoagulation. A drastic variation from other Asian countries was observed in Indian population with regard to the distribution of different VKORC1 -1639 genotypes. Our results suggest that both VKORC1 and CYP2C9 genotypes showed significant impact on warfarin dose requirement, over anticoagulation in the first month of anticoagulation and number of bleeding episodes. The variation in therapeutic dosage of warfarin and the associated adverse events across different populations is due to the wide differences in the frequency of these warfarin sensitive alleles. & 2013 Published by Elsevier B.V.
Keywords: CYP2C9 VKORC1 Warfarin India
1. Introduction Warfarin (Coumadins) is a widely used anticoagulant to prevent thromboembolic disorders. Management of anticoagulation therapy is difficult as there is a wide inter- and intra-individual variability that possibly leads to hemorrhagic or thromboembolic events despite careful dosage monitoring. Dose adjustments are often necessary and are based on measuring the prothrombin time (PT) in blood and calculating the international normalized ratio (INR). A high INR predisposes to a high risk of bleeding, while an INR below the therapeutic target range indicates that the dose of warfarin is insufficient to protect against thromboembolic events (Hirsh et al., 2001; Kearon et al., 2003; Tapson et al., 2005; Wittkowsky, 2004). The pharmacodynamic and pharmacokinetic parameters of warfarin are predominantly influenced by genetic polymorphisms in two genes namely CYP2C9 and VKORC1 (Wadelius et al., 2007).
n
Corresponding author. Tel.: +91 22 24138518; fax: +91 22 24138521. E-mail address: [email protected] (S. Shetty).
Warfarin is a racemic mixture of S-warfarin and R-warfarin, the former being a more active isomer having higher therapeutic effect. Both these enantiomers are metabolized by different cytochrome P450 enzymes. R-Warfarin is mainly metabolized by CYP3A4, CYP1A2 and CYP2C19 and, while S-warfarin is mainly metabolized by CYP2C9. Carriers of the common allelic variants (n2 or n3) of the CYP2C9 are known to be slow metabolizers of warfarin and are associated with a lower warfarin dose requirement accompanied by a greater tendency to experience bleeding complications during warfarin therapy. Vitamin K epoxide reductase involved in the recycling of vitamin K and is encoded by the vitamin K epoxide reductase complex subunit 1 (VKORC1). Warfarin exerts its anticoagulant effect through inhibition of the VKORC1 gene product. VKORC1 -1639 GG carriers require higher warfarin doses than those with GA or AA genotype. Generally, target INR varies in different clinical indications, but the most common therapeutic range is 2.0–3.0. As there is a wide ethnic variation in the distribution of these polymorphisms, the mean warfarin dose requirement also varies with race. Thus Africans and Americans require larger dosage of warfarin as
0014-2999/$ - see front matter & 2013 Published by Elsevier B.V. http://dx.doi.org/10.1016/j.ejphar.2013.04.006
Please cite this article as: Gaikwad, T., et al., Influence of CYP2C9 and VKORC1 gene polymorphisms on warfarin dosage, over anticoagulation and.... Eur J Pharmacol (2013), http://dx.doi.org/10.1016/j.ejphar.2013.04.006i
T. Gaikwad et al. / European Journal of Pharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎
2
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66
compared to Europeans and Asians (Dang et al., 2005; Geisen et al., 2005; Lee et al., 2006; Li et al., 2009; Marsh et al., 2006; Takahashi et al., 2006; Veenstra et al., 2005; Yuan et al., 2005). Within the Asian population, Indian patients have been reported to require higher warfarin dose as compared to Chinese and Malay patients (Lee et al., 2006). In the present study, CYP2C9 and VKORC1 polymorphisms were analyzed in 145 warfarin treated adult Indian patients in relation to the dose of warfarin, over anticoagulation and the number of bleeding episodes. The genotype frequencies have also been compared with the data from other Asian countries.
thromboplastin reagent (Neoplastin CI Plus, Diagnostica Stago, Asnieres, France) using the International Sensitivity Index (ISI). The ISI value in this reagent has been determined against secondary standard (rabbit brain thromboplastin) as per the method recommended by World Health Organization (WHO). The coagulation reaction contained 50 μL of citrated plasma sample which was incubated at 37 1C for 60 s followed by addition of 100 ml of thromboplastin reagent. The cell pellet was preserved at −20 1C for DNA analysis. DNA was extracted from blood samples by standard phenol chloroform method. 2.3. VKORC1 -1639 G/A genotyping
2. Materials and methods 2.1. Patients This study is a prospective analysis of one hundred and forty five patients (age range 19–80 years; mean age 49 years; 93 males, 52 females) who were prescribed warfarin for various clinical conditions. Patients were recruited from King Edward Memorial Hospital, Mumbai; BYL Nair Ch. Hospital, Mumbai and St. John's Hospital, Bangalore. Data was collected from the clinical proforma which was filled for every patient which included INR values, warfarin daily dose, changes in warfarin dose, race, body weight, height, gender, smoking, diet, co-medication (amiodarone, statins, sulfamethoxazole, azole, antifungals, rifampin, phenytoin, carbamazepine), illness, bleeding complications, new thrombotic episodes, surgical procedure, etc. These details were taken during each visit of these patients. Patients needing a medication known to interact with warfarin and patients with abnormal renal or liver function test were excluded from the study. Warfarin initiation and maintenance dose adjustment was blinded to genotype result. After initiation of warfarin, PT- INR (Prothrombin Time-International Normalized Ratio) was tested every 2–4 days. After 2 consecutive therapeutic INR, interval was increased to 2 weeks. After 4 consecutive therapeutic INR, interval was increased to 4 weeks and continued with the same monitoring interval. The minimum follow up period was 6 months and the maximum period was 15 months. The study was approved by the Institutional Ethics Committee of all the participating centers.
The DNA samples were amplified using oligonucleotide primers (Sigma, Bangalore, India) in a 96 welled thermal cycler (Applied Biosystems Veriti, Carlsbad, California). Briefly, the protocol was as follows; the PCR mix consisted of a final volume of 25 μl, containing 1.25 μl of 10 pmol each primers, 0.2 μl 25 mM deoxynucleotides triphosphate, 1.5 μl 25 mM MgCl2, 2.5 μl 10 complete buffer (Bioron, Ludwigshafen, Germany), 0.15 μl DFS- Taq DNA pol. (Bioron, Ludwigshafen, Germany) and 2 μl DNA sample. 10 μl of amplified product was used for RFLP analysis using 5 units of Hpa II restriction enzyme (New England Biolabs, Hertfordshire, UK). 2.4. CYP2C9 genotyping The DNA samples were amplified using oligonucleotide primers (Sigma, Bangalore, India) in a 96 welled thermal cycler (Applied Biosystems, Veriti, Carlsbad, California). Briefly, the protocol was as follows; the PCR mix consisted of a final volume of 25 μl containing, 1.0 μl of 10 pmol each primer (Sigma, Bangalore, India), 0.25 μl 25 mM deoxynucleotides triphosphate, 1.5 μl 25 mM MgCl2, 2.5 μl 10 complete buffer (Bioron, Ludwigshafen, Germany), 0.15 μl DFS-Taq DNA polymerase (Bioron, Ludwigshafen, Germany) and 2 μl DNA sample. 10 μl of amplified product was used for RFLP analysis using 5 units of Ava II restriction enzyme (New England Biolabs, Hertfordshire,UK) for CYP2C9n2 and 5 units of Nsi I restriction enzyme (New England Biolabs, Hertfordshire, UK) for CYP2C9n3 genotyping. The PCR program and the primer sequences for both VKORC1 and CYP2C9 genotyping are given in Table 1.
2.2. Blood sampling 2.5. Over anticoagulation and stable anticoagulation After obtaining informed consent, 5 ml of venous blood sample was collected in 3.13% sodium citrate (0.5:4.5 anticoagulant to blood) tube from each patient. The sample was spun at 4000 rpm for 15 min at 4 1C. The platelet poor plasma was used for prothrombin time test. All prothrombin time test measurements were carried out using a four-channel semi automated coagulometer (St Art, Diagnostica Stago, Asnieres, France). Warfarin dose was monitored by assessment of the INR, which corresponds to the prothrombin time ratio corrected for an individual
A patient was said to be over anticoagulated if patient's INR was 44.0. Stable anticoagulation was defined as 2 consecutive inrange INRs, at least 7 days apart, with no dose adjustments. 2.6. Bleeding episodes Patients were considered to have “bleeding episodes” when it required medical attention or attendance at hospital.
Table 1 Primer sequences and PCR protocols. Genotype
Primer sequences
Thermal cycler Program
VKORC11639 G/A CYP2C9n2
FOR:5′CAAGTTCCAGGGATTCATGC-3′ REV:5′CCAAGACGCTAGACCCAATG-3′ FOR:5′TACAAATACAATGAAAATATCATG-3′ REV:5′CTAACAACCAGACTCATAATG-3′ FOR:5AATAATAATATGCACGAGGTCCAGAGATGC3′ REV:5′GATACTATGAATTTGGGACTTC-3′
Initial denaturation: 5 min at 94 1C 30 cycles: 30 s at 94OC, 30 s at 60 1C, 30 s at 68 1C. Terminal extension: 10 min at 68 1C Initial denaturation: 5 min at 94 1C 35 cycles: 1 min at 94 1C, 30 s at 57 1C, 1 min at 72 1C. Terminal extension: 7 min at 72 1C Initial denaturation: 5 min at 94 1C 35 cycles: 1 min at 94 1C, 30 s at 57 1C, 1 min at 72 1C. Terminal Extension: 7 min at 72 1C
CYP2C9n3
Please cite this article as: Gaikwad, T., et al., Influence of CYP2C9 and VKORC1 gene polymorphisms on warfarin dosage, over anticoagulation and.... Eur J Pharmacol (2013), http://dx.doi.org/10.1016/j.ejphar.2013.04.006i
T. Gaikwad et al. / European Journal of Pharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66
2.7. Statistical analysis: Genotype frequencies were estimated by the gene-counting method. Genotypes were tested for deviation from Hardy–Weinberg equilibrium. Statistical analysis for relative risk and p-values were performed with the MedCalc Software Version 12.3.0 (http:// www.medcalc.org/calc/relative_risk.php).
significant effect on warfarin dose requirement, bleeding and risk of over anticoagulation in the first month of warfarin therapy. Neither VKORC1 nor CYP2C9 polymorphisms were significantly associated with these parameters beyond the first month of treatment (Table 4). CYP2C9n3 variant showed a stronger association with reduced warfarin dose and risk of overanticoagulation than CYP2C9n2 variant (Table 3).
4. Discussion
3. Results A total of 145 warfarin treated patients were genotyped for CYP2C9 and VKORC1 polymorphisms using PCR-RFLP method. None of our patients were on any vitamin K supplements. Patient's demographic and clinical data is shown in Table 2. Cerebral venous thrombosis and deep vein thrombosis of upper or lower limb were the main indications for anticoagulation with warfarin. Other cases were pulmonary embolism (6.9%), atrial fibrillation (1.38%), heart valve replacement (10.34%) and other indications (12.41%). The monitoring period of the patients varied between 6 and 15 months. The genotype frequencies are shown in Table 2. To study the effect CYP2C9 and VKORC1 genotype on anticoagulation therapy, the patients were divided into 3 groups. 1. Non carriers (Wild type CYP2C9 and VKORC1). 2. Carriers of 1 variant allele (1 sensitive allele either in CYP2C9 or VKORC1 gene). 3. Carriers of 2 variant alleles (2 sensitive alleles either in CYP2C9 or VKORC1 gene).
Tables 3 and 4 show the effect of individual and combined variant alleles on warfarin dose requirement, bleeding episodes and risk of over anticoagulation. Homozygous variants i.e. VKORC1-1639 A/A, CYP2C9n3/n3 and two heterozygous variant carriers (a combination of VKORC1 variant allele combined with either CYP2C9n2 or n3) showed
Table 2 Demographic and clinical data. Total patients ¼145 Demographics Male Age range Sites of thrombosis Cerebral venous thrombosis Lower/upper limb DVT Atrial fibrillation Pulmonary embolism Heart valve replacement Other indications
93 (64%) 19–80 years Number (%) 44 (30.34) 56 (38.62) 2 (1.38) 10 (6.9) 15 (10.34) 18 (12.41)
Genotypes VKORC1 -1639 G/A GG (Wild type) GA AA
111 (76.56) 31 (21.38) 3 (2.06)
CYP2C9n2 and CYP2C9n3 n 1/n1 (Wild type) n 1/n2 n 2/n2 n 1/n3 n 3/n3
105 9 0 27 4
Patients with no warfarin-sensitive allele GG, n1/n1
3
(72.41) (6.20) (0) (18.62) (2.76)
81 (55.87)
The narrow therapeutic range of warfarin and the interindividual variation are the two important factors which necessitate warfain pharmacogenomic studies with an ultimate objective of individualized treatment regimens based on the genotype of the patient. Age, diet (vitamin K content), drugs, and hepatocellular damage are some of the non genetic factors which are known to interact with warfarin. Warfarin related bleeding episodes is one of the major causes of emergency admissions in many countries. Majority of the pharmacogenomic studies have considered the following factors- risk of bleeding in the initiation phase (1–3 months), over anticoagulation, warfarin dosage required to achieve a target INR between 2 and 3, maintenance dose and so on. Several algorithms have been reported for the effective management of anticoagulant phase. In the present study, VKORC1 AA and CYP2C9n3/n3 genotypes were found to be significantly associated with higher risk of over anticoagulation and lower warfarin dose requirement. Carriers of even one variant allele were found to require lower warfarin dose indicating that genotyping of all variants is important to avoid risk of over anticoagulation and to predict correct warfarin dose in these patients. In India, pharmacogenetic guided dosing is not commonly endorsed in routine practice and trial and error method is often pursued by physicians. Carriers of variant alleles of CYP2C9 and VKORC1, often face problems of overanticoagulation/hemorrhage in initial phase of anticoagulation. Genotype guided dosing is thus needed to avoid these adverse outcomes, wherein more than 40% of the patients carry these variant alleles. Diet is another important factor known to affect warfarin dose (Franco et al., 2004; White, 2010). However all our patients were instructed to have warfarin tablets in the morning after breakfast and asked to have a balanced protein diet and restrict intake of green leafy vegetables. This instruction was followed by more than 90% of our patients and might have reduced diet related fluctuation of INR. A recent report by Lund et al. (2012) has shown that, only VKORC1 AA genotype was significantly associated with risk of over anticoagulation during the first month of anticoagulation treatment. In the present study, along with VKORC1 AA genotype, even CYP2C9n3/n3 and carriers of two heterozygous variant genotypes showed significant risk of over anticoagulation in first month of treatment. Hence before initiating the anticoagulation, screening of both genotypes (VKORC1 and CYP2C9) should benefit in avoiding supra therapeutic INRs and its relative risks. Neither VKORC1 nor CYP2C9 polymorphisms were found to be significantly associated with these parameters beyond the first month of treatment (Table 4). This conclusion is consistent with the finding of several earlier reports (Caraco et al., 2008; Lund et al., 2012; Peyvandi et al., 2004). It is very important to determine the allele frequencies of CYP2C9 and VKORC1 genes in different populations in order to assess the usefulness of prior genotyping in warfarin treated patients. Many studies have shown that warfarin dose requirement vary with race. Asian patients require a lower dose as compared to African and Caucasian (Dang et al., 2005; Geisen
Please cite this article as: Gaikwad, T., et al., Influence of CYP2C9 and VKORC1 gene polymorphisms on warfarin dosage, over anticoagulation and.... Eur J Pharmacol (2013), http://dx.doi.org/10.1016/j.ejphar.2013.04.006i
T. Gaikwad et al. / European Journal of Pharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎
4
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66
Table 3 Effect of individual and combined variant alleles on warfarin dose requirement and risk of over anticoagulation. Relative risk for Patients with over antico Patients with bleeding -agulation (INR 44) while problem while on warfain No./ over anti coagulation a on warfarin: No./Total (%) Total (%)
Genotypes (VKORC1-1639+ CYP2C9)
No. of patients (%)
Non carriers GG+n1/n1
81 (55.86) 24/81 (29.63)
p-value
a
95%CI
Stable average daily warfarin dose (mg) 7 0.2
24/81 (29.63)
–
–
–
6.25
One variant carriers 21 (14.48) 10/21 (47.62) GA+n1/n1 GG+n1/n2 6 (4.14) 4/6 (66.66) GG+n1/n3 20 (13.79) 13/20 (65.00) TOTAL 47 (32.41) 27/47 (57.45)
10/21 3/6 10/20 23/47
(47.62) (50.00) (50.00) (48.94)
1.6071 2.2500 2.1938 1.9388
P¼ 0.0969 P¼ 0.0157 P¼ 0.0009 P¼ 0.0018
0.9178–2.8142 1.1654–4.3440 1.3782–3.4919 1.2788–2.9395
3.75 4.4 3.75 3.97
Two variant carriers GA+n1/n3 7 (4.83) GA+n1/n2 3 (2.07) GG+n3/n3 4 (2.76) AA+n1/n1 3 (2.07) TOTAL 17 (11.72)
4/7 3/3 4/4 3/3 14/17
(57.14) (100.0) (100.0) (100.0) (82.35)
2.8929 2.9286 3.0122 2.9286 2.7794
Po 0.0001 Po 0.0001 Po 0.0001 Po 0.0001 Po 0.0001
1.8413–4.5450 1.7814–4.8146 1.9362–4.6863 1.7814–4.8146 1.8606–4.1519
3.0 3.15 3.0 3.10 3.06
a
6/7 3/3 4/4 3/3 16/17
(85.71) (100.0) (100.0) (100.0) (94.12)
Relative risk and p-values were calculated for patients with overanticoagulation (INR 44) while on warfarin; GG+1/1 (non carrier) genotype was used as a control.
Table 4 Effect of genotypes during different time intervals of anticoagulation. Genotype
VKORC1GG+CYP2C9 n1/n1 (wild type)
Days 1–30 (Patients 145)
Days 31–90 (Patients 145)
INR 44 Positive/Total number (%)
INR 44 Positive/Total number (%)
20/81 (24.69)
4/81 (4.93)
One variant carriers VKORC1 GA+CYP2C9 n1/n1 VKORC1GG+CYP2C9 n1/n2 VKORC1GG+CYP2C9 n1/n3
8/21 (38.09) aP ¼0.2011 2/21 (9.52%) bP ¼0.4291 3/6 (50) aP ¼0.1185 1/6 (16.66) bP ¼0.2398 10/20 (50) aP ¼0.0172 3/20 (15) bP ¼0.1237
Two variants carriers VKORC1GA+ CYP2C9 1/3 VKORC1GA+ CYP2C9 n1/n2 VKORC1GG+CYP2C9 n3/n3 VKORC1AA+ CYP2C9 n1/n1
6/7 3/3 4/4 3/3
(85.71) aPo 0.0001 (100) aPo 0.0001 (100) aPo 0.0001 (100) aPo 0.0001
0/7 0/3 0/4 0/3
(0) (0) (0) (0)
b
P ¼0.9282 P ¼0.5565 b P ¼0.6721 b P ¼0.5565 b
a P values were calculated against wild type genotype carrier patients who experienced over anticoagulation in days 1–30. b P values were calculated against wild type genotype carrier patients who experienced over anticoagulation in days 31–90.
Table 5 CYP2C9 genotype distribution in Asian countries.
Country
CYP2C9 n
1/n1
China Indonesia Japan Russia India
784 113 790 94 105
(92.8%) (93.62%) (95.41%) (84.7%) (72.41%)
n
1/n2
– – – 5 (4.5%) 9 (6.21%)
n
2/n3
n
1/n3
– – – 2 (1.38%)
60 9 37 12 25
n
(7.1%) (7.38%) (4.47%) (10.80%) (17.24%)
et al., 2005; Lee et al., 2006; Takahashi et al., 2006; Veenstra et al., 2005; Yuan et al., 2005) but the present study shows that genotype distribution of Indians is markedly different than that of other Asian countries (Tables 5 and 6). We compared the genotype frequencies with that of major ethnic groups in Asia. As shown in Tables 5 and 6, frequency
Number of patients
Reference
845 122 828 111 145
Zhong et al., 2012 Suriapranata et al., 2011 Mushiroda et al., 2006 Vorob’eva et al. (2011) Present study
3/n3
1 (0.1%) – 1 (0.12%) – 4 (2.76%)
of n1/n3 genotypes is much higher in Indians i.e. 17.24%, while in Chinese, Indonesians, Japanese and Russians it was 7.1%, 7.38%, 4.47%, 10.80% respectively. However, the distribution of VKORC1 genotypes was distinctly different in Indians as compared to other ethnic groups in Asia. VKORC1 -1639 GG genotypes found predominant in Indian population i.e. 76.55%, while in Chinese,
Please cite this article as: Gaikwad, T., et al., Influence of CYP2C9 and VKORC1 gene polymorphisms on warfarin dosage, over anticoagulation and.... Eur J Pharmacol (2013), http://dx.doi.org/10.1016/j.ejphar.2013.04.006i
T. Gaikwad et al. / European Journal of Pharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56
5
Table 6 VKORC1 genotype distribution in Asian countries.
Country
VKORC1 -1639 G/A genotype GG
China Indonesia Japan Russia India
13 5 6 47 111
GA (1.5%) (3.80%) (0.73%) (42.3%) (76.55%)
171 52 133 54 31
Number of patients
Reference
845 135 828 111 145
Zhong et al., 2012 Suriapranata et al., 2011 Mushiroda et al., 2006 Vorob’eva et al. (2011) Present study
AA (20.2%) (38.60%) (16.06%) (48.6%) (21.38%)
661 78 689 10 3
Indonesians, Japanese and Russians it was 1.5%, 3.80%, 0.73%, 42.3% respectively. In conclusion, the present study shows a strong association of the polymorphisms in the two genes i.e. VKORC1 and CYP2C9 with the dosage of warfarin and other adverse events. The distribution of the different alleles of these two genes also varies markedly in different populations. Ethical consideration This study was approved by the Institute Ethics Committee. All subjects received full written and oral information on the objectives and the procedure of the study and gave their written informed consent. Acknowledgments Tejasvita Gaikwad has received funds for research from Indian Council of Medical Research (ICMR), Delhi, India. (IRIS cell No. 2011-05540). References Caraco, Y., Blotnick, S., Muszkat, M., 2008. CYP2C9 genotype-guided warfarin prescribing enhances the efficacy and safety of anticoagulation: a prospective randomized controlled study. Clin. Pharmacol. Ther. 83, 460–470. Dang, M.T., Hambleton, J., Kayser, S.R., 2005. The influence of ethnicity on warfarin dosage requirement. Ann. Pharmacother. 39, 1008–1012. Franco, V., Polanczyk, C.A., Clausell, N., Rohde, L.E., 2004. Role of dietary vitamin K intake in chronic oral anticoagulation: prospective evidence from observational and randomized protocols. Am. J. Med. 116, 651–656. Geisen, C., Watzka, M., Sittinger, K., Steffens, M., Daugela, L., Seifried, E., Müller, C.R., Wienker, T.F., Oldenburg, J., 2005. VKORC1 haplotypes and their impact on the inter-individual and inter-ethnical variability of oral anticoagulation. Thromb. Haemostasis 94, 773–779. Hirsh, J., Dalen, J., Anderson, D.R., Poller, L., Bussey, H., Ansell, J., Deykin, D., 2001. Oral anticoagulants: mechanism of action, clinical effectiveness and optimal therapeutic range. Chest 119, 8S–21S. Kearon, C., Ginsberg, J.S., Kovacs, M.J., Anderson, D.R., Wells, P., Julian, J.A., 2003. Comparison of low-intensity warfarin therapy with conventional-intensity warfarin therapy for long-term prevention of recurrent venous thromboembolism. N. Engl. J. Med. 349, 631–639. Lee, S.C., Ng, S.S., Oldenburg, J., Chong, P.Y., Rost, S., Guo, J.Y., Yap, H.L., Rankin, S.C., Khor, H.B., Yeo, T.C., Ng, K.S., Soong, R., Goh, B.C., 2006. Interethnic variability of warfarin maintenance requirement is explained by VKORC1 genotype in an Asian population. Clin. Pharmacol. Ther. 79, 197–205.
(78.2%) (57.60%) (83.21%) (9.1%) (2.06%)
Li, C., Schwarz, U.I., Ritchie, M.D., Roden, D.M., Stein, C.M., Kurnik, D., 2009. Relative contribution of CYP2C9 and VKORC1 genotypes and early INR response to the prediction of warfarin sensitivity during initiation of therapy. Blood 113, 3925–3930. Lund, K., Gaffney, D., Spooner, R., Etherington, A.M., Tansey, P., Tait, R.C., 2012. Polymorphisms in VKORC1 have more impact than CYP2C9 polymorphisms on early warfarin International Normalized Ratio control and bleeding rates. Br. J. Haematol. 158, 256–261. Marsh, S., King, C.R., Porche-Sorbet, R.M., Scott-Horton, T.J., Eby, C.S., 2006. Population variation in VKORC1 haplotype structure. J. Thromb. Haemostasis 4, 473–474. Mushiroda, T., Ohnishi, Y., Saito, S., Takahashi, A., Kikuchi, Y., Saito, S., Shimomura, H., Wanibuchi, Y., Suzuki, T., Kamatani, N., Nakamura, Y., 2006. Association of VKORC1 and CYP2C9 polymorphisms with warfarin dose requirements in Japanese patients. J. Hum. Genet. 51, 249–253. Peyvandi, F., Spreafico, M., Siboni, S.M., Moia, M., Mannucci, P.M., 2004. CYP2C9 genotypes and dose requirements during the induction phase of oral anticoagulant therapy. Clin. Pharmacol. Ther. 75, 198–203. Suriapranata, I.M., Tjong, W.Y., Wang, T., Utama, A., Raharjo, S.B., Yuniadi, Y., Tai, S.S., 2011. Genetic factors associated with patient-specific warfarin dose in ethnic Indonesians. BMC Med. Genet. 12, 80–88. Takahashi, H., Wilkinson, G.R., Nutescu, E.A., Morita, T., Ritchie, M.D., Scordo, M.G., Pengo, V., Barban, M., Padrini, R., Ieiri, I., Otsubo, K., Kashima, T., Kimura, S., Kijima, S., Echizen, H., 2006. Different contributions of polymorphisms in VKORC1 and CYP2C9 to intra- and inter-population differences in maintenance dose of warfarin in Japanese, Caucasians and African-Americans. Pharmacogenet. Genomics 16, 101–110. Tapson, V.F., Hyers, T.M., Waldo, A.L., Ballard, D.J., Becker, R.C., Caprini, J.A., Khetan, R., Wittkowsky, A.K., Colgan, K.J., Shillington, A.C., 2005. Antithrombotic therapy practices in US hospitals in an era of practice guidelines. Arch. Intern. Med. 165, 1458–1464. Vorob'eva, N.M., Panchenko, E.P., Titaeva, E.V., Khasanova, Z.B., Konovalova, N.V., Postnov, A., Kirienko, A.I., 2011. Polymorphisms of genes CYP2C9 and VKORC1 in patients with venous thromboembolic complications in Moscow population: effects on stability of anticoagulant therapy and frequency of haemorrhage. Ter. Arkh. 83, 59–65. Veenstra, D.L., You, J.H., Rieder, M.J., Farin, F.M., Wilkerson, H.W., Blough, D.K., Cheng, G., Rettie, A.E., 2005. Association of Vitamin K epoxide reductase complex 1 (VKORC1) variants with warfarin dose in a Hong Kong Chinese patient population. Pharmacogenet. Genomics 15, 687–691. Wadelius, M., Chen, L.Y., Eriksson, N., Bumpstead, S., Ghori, J., Bentley, D., McGinnis, R., Deloukas, P., 2007. Association of warfarin dose with genes involved in its action and metabolism. Hum. Genet. 121, 23–34. White, P.J., 2010. Patient factors that influence warfarin dose response. J. Pharm. Pract. 23, 194–204. Wittkowsky, A.K., 2004. Effective anticoagulation therapy: defining the gap between clinical studies and clinical practice. Am. J. Manag. Care 10, S297–S306. Yuan, H.Y., Chen, J.J., Lee, M.T., Wung, J.C., Chen, Y.F., Charng, M.J., Lu, M.J., Hung, C.R., Wei, C.Y., Chen, C.H., Wu, J.Y., Chen, Y.T., 2005. A novel functional VKORC1 promoter polymorphism is associated with inter-individual and inter-ethnic differences in warfarin sensitivity. Hum. Mol. Genet. 14, 1745–1751. Zhong, S.L., Yu, X.Y., Liu, Y., Xu, D., Mai, L.P., Tan, H.H., Lin, Q.X., Yang, M., Lin, S.G., 2012. Integrating interacting drugs and genetic variations to improve the predictability of warfarin maintenance dose in Chinese patients. Pharmacogenet. Genomics 22, 176–182.
Please cite this article as: Gaikwad, T., et al., Influence of CYP2C9 and VKORC1 gene polymorphisms on warfarin dosage, over anticoagulation and.... Eur J Pharmacol (2013), http://dx.doi.org/10.1016/j.ejphar.2013.04.006i