Influence of microwave irradiation on DNA hybridization and polymerase reactions

Tetrahedron Letters xxx (xxxx) xxx

Contents lists available at ScienceDirect

Tetrahedron Letters journal homepage: www.elsevier.com/locate/tetlet

Influence of microwave irradiation on DNA hybridization and polymerase reactions Jinyu Sun 1, Jesse Vanloon, Hongbin Yan ⇑ Department of Chemistry, Brock University, 1812 Sir Isaac Brock Way, St. Catharines, Ontario L2S 3A1, Canada

a r t i c l e

i n f o

Article history: Received 24 July 2019 Revised 13 August 2019 Accepted 17 August 2019 Available online xxxx Keywords: Microwave irradiation DNA hybridization FRET Polymerase chain reaction

a b s t r a c t We report herein that exposure of DNA to microwave irradiation at constant temperature leads to faster strand exchange, as compared with same experiments carried out in a water bath at the same temperature. Furthermore, polymerase chain reactions carried out under microwave irradiation were faster than those in a water bath at the same temperature as well. While the causes of these differences are unclear at this time, this research suggests that microwave irradiation can lead to subtle changes in DNA structural dynamics and functions. Ó 2019 Elsevier Ltd. All rights reserved.

Studies of the ‘‘thermal” versus ‘‘non-thermal” effects of microwave irradiation, and more recently ‘‘microwave-specific effects”, have been at the centre of debates for a number of years, owning to the vastly different observations shown in the literature [1– 15]. This is perhaps not surprising given the wide range of variables implemented in these investigations. In this respect, differences in microwave frequency and power output, biological system under study, temperature measurement, and temperature control all contribute to the outcome of these experiments. The literature is far from settled for the existence of non-thermal effects of microwave, or microwave-specific effects. Work in this lab has been focusing on the potential influence of relatively low power microwave irradiation on biomolecules and biological systems, while the temperature of the system under investigation is maintained relatively constantly through simultaneous cooling. Thus, using a CEM Discovery Coolmate microwave system (Matthews, NC) that allows the cooling of reaction systems through a cooling jacket (Fig. 1), we demonstrated that while trypsin activity is significantly increased under microwave irradiation [16], the activity of a-amylase and alkaline phosphatase is not affected under these conditions [17]. Furthermore, we showed that, while exposure of human prostate PC-3 cancer cells to microwave did not lead to apoptosis nor necrosis at 37 °C, the cell membrane properties were perturbed [18]. In both PC-3 and human breast cancer MCF-7 cells, ⇑ Corresponding author. E-mail address: [email protected] (H. Yan). Current address: School of Materials Science and Engineering, East China University of Science and Technology, Meilong Road 130, Shanghai 200237, PR China. 1

thermocouple Teflon plug

fibre optic temperature probe reaction vessel coolant

microwave coolant

stirring bar

Fig. 1. The CEM Coolmate microwave reactor equipped with cooling, stirring and temperature measurement by a fibre optic temperature probe and thermocouple.

uptake of anticancer drug doxorubicin was significantly enhanced by this microwave irradiation [19]. More recently, we reported that bacterium Escherichia coli growth was slowed by exposure to nonlethal microwave irradiation, accompanied by modified proteomic profiles likely related to metabolism [20]. In the present work, we wish to report the influence of microwave irradiation on DNA hybridization and polymerase catalyzed reactions, while the temperature of the system was controlled through cooling. While a rather large body of literature has investigated potential DNA damages or genotoxicity as a result of microwave irradiation [21–24], which remain a matter of controversy, very little work has investigated the influence of such exposure on nucleic acid hybridization. Contrary to an early report that showed that microwave irradiation has no influence on the melting tempera-

https://doi.org/10.1016/j.tetlet.2019.151060 0040-4039/Ó 2019 Elsevier Ltd. All rights reserved.

Please cite this article as: J. Sun, J. Vanloon and H. Yan, Influence of microwave irradiation on DNA hybridization and polymerase reactions, Tetrahedron Letters, https://doi.org/10.1016/j.tetlet.2019.151060

2

J. Sun et al. / Tetrahedron Letters xxx (xxxx) xxx

Scheme 1. Scrambling experiments. a). Strand exchange between 50 -FAM-21:30 -BHQ1-21 duplex and DS-21, leading to restoration of fluorescence; and b). strand exchange between 50 -FAM-21:DS-20 duplex and 30 -BHQ1-21, leading to fluorescence quench. Table 1 Names, sequences and Tm of the oligonucleotides used in the scrambling experiments. Name

Sequence (50 ?30 )

Tm (°C)a

50 -FAM-21 30 -BHQ1-21 DS-21 DS-20

FAM/TGGTATATCTCCTTCTTAAAG CTTTAAGAAGGAGATATACCA/3BHQ1 CTTTAAGAAGGAGATATACCA CTTTAAGAAGGAGATATACC

46.2 46.2 46.2 44.3

a Tm as calculated by IDT in 50 mM NaCl. DS: displacement strand; BHQ1: black hole quencher-1; FAM: fluorescein.

ture (Tm) of DNA as compared with thermal heating [25], a more recent study by Deiters and co-workers demonstrated that DNA duplexes can be dissociated under microwave irradiation at temperatures below their Tm [26]. In order to further explore the impact of microwave exposure on the dynamic aspect of DNA hybridization, we carried out ‘‘scrambling” experiments under microwave irradiation or heating in a water bath with temperatures carefully controlled, where the exchange of oligonucleotide in hybridization was monitored using

Fig. 2. Changes in fluorescence intensity and temperature profiles in the scrambling experiments. a). Fluorescence intensity rises over time for the exchange between 50 -FAM21:30 -BHQ1-21 duplex and DS-21 when subjected to treatment with microwave (MW) or water bath (HT). Results were compared as folds of increase in fluorescence intensity relative to initial fluorescent intensity; b). temperature profiles of the scrambling experiments as measured by thermocouple; c). fluorescence intensity decreases over time for the exchange between 50 -FAM-21:DS-20 duplex and 30 -BHQ1-21. Results were compared as fractions of fluorescent intensity relative to initial fluorescent intensity; and d). temperature profiles of the scrambling experiments as measured by thermocouple. Strand exchange reactions were carried out in triplicates. *: P < 0.05.

Please cite this article as: J. Sun, J. Vanloon and H. Yan, Influence of microwave irradiation on DNA hybridization and polymerase reactions, Tetrahedron Letters, https://doi.org/10.1016/j.tetlet.2019.151060

J. Sun et al. / Tetrahedron Letters xxx (xxxx) xxx

appropriately labelled FRET (Fluorescent Resonance Energy Transfer) pairs (Scheme 1). The oligonucleotide sequences (Table 1) used in the scrambling experiments have Tm a few degrees above the temperature under which the experiments were carried out (37 or 39 °C), so that the strand exchange takes place on a time-scale that allows for convenient and accurate measurement of fluorescence intensity. In the scrambling experiment between 50 -FAM-21:30 -BHQ1-21 duplex and DS-21 (Scheme 1a), strand exchanges under microwave irradiation at 37 °C were faster than the control experiments carried out in a water bath, either at 37 or 39 °C, as indicated by the faster rises in fluorescence intensity (Fig. 2a). Similar results were observed for strand exchange between 50 -FAM-21:DS-20 duplex and 30 -BHQ1-21 (Scheme 1b), where such exchange was promoted by exposure to microwave irradiation as well (Fig. 2b). The control experiments carried out at 39 °C in a water bath were necessary as a comparison, as it might be argued that the faster exchange rate seen in the presence of microwave irradiation could be attributed to the presence of ‘‘hot spots”. Based on the observation that the exchange rate at 37 °C in the presence of microwave irradiation is faster than the control at 39 °C in a water bath, and that the temperature measured in the microwave-treated mixture did not exceed 38 °C, there is no evidence to support the presence of ‘‘hot spots” as the reason, at least as the sole reason, for the faster strand exchanges. The possibility that strand exchange is promoted by microwave irradiation is, however, in agreement with the previous finding [26] that microwave irradiation appears to lower

Fig. 3. Polymerase-catalyzed reactions. (a). 32-mer template (50 -ATC TAT CTA CTA AAC TAA TAA CTA TCC ACC AA-30 ), 18-mer primer with 50 -FAM labelling (50 -FAM-TT GGT GGA TAG TTA TTA G). Reactions were carried out in the presence of microwave irradiation at ca. 37 °C or in a water bath at ca. 37 °C or slightly higher; (b). Reaction products were analyzed by anion exchange HPLC with a DNAPac 200 column. Trace 1 (black) is a representative profile of the reaction products, with dNPT, template, FAM-primer and extension product eluted at 2.84, 6.07, 7.14 and 7.96 min, respectively, monitored at 260 nm. Trace 2 (red) shows elution of the same mixture, but monitored at 490 nm, showing oligos containing FAM. Trace 3 (blue) is the elution profile of a mixture of the template and primer, monitored at 260 nm.

3

the Tm of DNA duplexes. Taken together, these results support the scenario that DNA hybridization becomes more dynamic under microwave irradiation, facilitating strand exchange. To further explore the possible influence of microwave irradiation on biological processes that involve DNA hybridization, polymerase chain reactions were carried out, where microwave power was kept low, and the system temperature was controlled through cooling. These experiments are therefore quite different in objectives compared with the ones previously reported in the literature where microwave irradiation was used as a heating source to effect fast temperature rises [27–29]. In order to simplify the system, only one primer was used in the reactions, allowing for ‘‘copying”, instead of amplification, of the template (Fig. 3). The reactions were carried out at ca. 37 °C, as this temperature is more biologically relevant, and easier to control in the CEM CoolMate system. The Klenow fragment from E. coli polymerase I, instead of Taq polymerase, was used, as the activity of Taq polymerase is very low at 37 °C [30]. The reaction products were analyzed by anion exchange HPLC. In order to ensure that the Klenow fragment enzyme was deactivated upon completion of reaction, the reaction mixture was basified by addition of aqueous sodium hydroxide. As comparison, the same reactions were also carried out in a water bath, where the reaction temperatures were maintained at either ca. 37 °C or slightly higher. Temperatures of the polymerase-catalyzed reactions in the microwave reactor and water bath were measured in real-time by a thermocouple. In this respect, dNTP, template and primer were first mixed in the PCR buffer and heated, either in the microwave reactor or a water bath. Once the temperature was stabilized (as indicated by the dash line in Fig. 4), the Klenow fragment enzyme was added to initiate the reaction. After 15 min, reactions were quenched by adjusting pH to ca. 11 by addition of an aqueous solution of sodium hydroxide. The temperature of the experiment carried out in a water bath (orange line) stayed quite consistent around 36.6 ± 0.1 °C. While there was some temperature fluctuation in the microwave reaction, the temperature was maintained at 36.6 ± 0.5 °C throughout the reaction. As a comparison, a control experiment was also carried out in a water bath with temperature at 38.1 ± 0.2 °C. Table 2 shows that, while the difference is small, the extend of chain extension, as characterized by the ratio of extension product to the template, under microwave irradiation at 36.6 °C was greater than those under water bath heating both at 36.6 and 38.1 °C, carried out at 1.5 or 2 ml total reaction volume. Interpretation of the microwave-acceleration of polymerase catalyzed

Fig. 4. Temperature of the polymerase-catalyzed reactions as measured by thermocouples.

Please cite this article as: J. Sun, J. Vanloon and H. Yan, Influence of microwave irradiation on DNA hybridization and polymerase reactions, Tetrahedron Letters, https://doi.org/10.1016/j.tetlet.2019.151060

4

J. Sun et al. / Tetrahedron Letters xxx (xxxx) xxx

Table 2 The ratios of extension product to template in the reactions catalyzed by Klenow fragment. The ratios are normalized against that at 36.6 °C in a water bath. Reaction

MW (36.6 °C)

Water bath (36.6 °C)

Water bath (38.1 °C)

[Product]/[Template] (1.5 ml reaction) [Product]/[Template] (2.0 ml reaction)

1.22

1.00

1.12

1.35

1.00

1.30

reactions is not possible at this time, as at least the following aspects must be taken into consideration, while it is very difficult to isolate these parameters. First, it is possible that hybridization affinity of template with primer is altered in the presence of microwave. Second, we previously showed that enzymatic activity can be affected by exposure to microwave irradiation, but in an enzyme-dependent manner. While it is possible that the activity of Klenow fragment can be affected under the experimental conditions, in practice it is very difficult to isolate this possibility from potential difference in DNA hybridization affinity. Last, but not least, the possibility of existence of ‘‘hot spots” caused by microwave irradiation remains as an argument regardless of how careful the temperature control was carried out. Nevertheless, the results from this study point at differences in the rates of DNA strand exchanges and polymerase catalyzed reactions that appear to be specific to microwave irradiation. Finally, to provide a context of the microwave power used in this study, exposure of 2 ml of water to 10 W microwave while cooling was not provided, temperature of water in the reactor rose from 25 to 40 °C over a period of 38 s (Fig. 5). The specific absorption rate (power absorbed per mass of sample) under the experimental conditions is therefore calculated as 1.65 W/g ([(DT  Cp  m)/time]/m, where DT is temperature rise, Cp is specific heat capacity of water, and m is the mass of water). In conclusion, this study demonstrated that DNA hybridization dynamics and polymerase-catalyzed reactions were affected by

Fig. 5. Temperature rise of 2 ml water exposed to 10 W microwave irradiation without cooling.

exposure to microwave irradiation, while temperature of the systems was maintained through cooling. While this difference is small, future work is warranted to elucidate the mechanism of the influence of microwave irradiation on these systems, and its potential impact on the genetic information flow in biological systems. Acknowledgments The authors thank Natural Science and Engineering Research Council of Canada for funding this work. One of us (JS) thanks a fellowship from the Chinese Scholarship Council (201806745035). Appendix A. Supplementary data Experimental procedures for this work are available in the Supplementary Material. Supplementary data to this article can be found online at https://doi.org/10.1016/j.tetlet.2019.151060. References [1] N. Kuhnert, Angew. Chem. Int. Ed. 41 (2002) 1863–1866. [2] A. de la Hoz, Á. Díaz-Ortiz, A. Moreno, Chem. Soc. Rev. 34 (2005) 164–178. [3] G.B. Dudley, A.E. Stiegman, M.R. Rosana, Angew. Chem. Int. Ed. 52 (2013) 7918–7923. [4] B. Gutmann, A.M. Schwan, B. Reichart, C. Gspan, F. Hofer, C.O. Kappe, Angew. Chem. Int. Ed. 50 (2011) 7636–7640. [5] C.O. Kappe, Angew. Chem. Int. Ed. 52 (2013) 7924–7928. [6] C.O. Kappe, B. Pieber, D. Dallinger, Angew. Chem. Int. Ed. 52 (2013) 1088–1094. [7] I. Belyaev, Electromagn. Biol. Med. 24 (2005) 375–403. [8] A. Shazman, S. Mizrahi, U. Cogan, E. Shimoni, Food Chem. 103 (2007) 444–453. [9] L. Giuliani, M. Soffritti (Eds.), Non-thermal Effects and Mechanisms of Interaction between Electromagnetic Fields and Living Matter, Ramazzini Institute Eur. J. Oncol. Library, 2010. [10] I. Belyaev, in: Electromagnetic Fields in Biology and Medicine, CRC Press, New York, 2015, pp. 49–67. [11] G.B. Dudley, R. Richert, A.E. Stiegman, Chem. Sci. 6 (2015) 2144–2152. [12] C.P. Kabb, R.N. Carmean, B.S. Sumerlin, Chem. Sci. 6 (2015) 5662–5669. [13] M.A. Herrero, J.M. Kremsner, C.O. Kappe, J. Org. Chem. 73 (2008) 36–47. [14] S. Hayden, M. Damm, C.O. Kappe, Macromol. Chem. Phys. 214 (2013) 423–434. [15] C.O. Kappe, Chem. Soc. Rev. 42 (2013) 4977–4990. [16] S.A. Mazinani, B. DeLong, H. Yan, Tetrahedron Lett. 56 (2015) 5804–5807. [17] S.A. Mazinani, H. Yan, Tetrahedron Lett. 57 (2016) 1589–1591. [18] S.A. Mazinani, F. Moradi, J.A. Stuart, H. Yan, ChemistrySelect 2 (2017) 7983– 7986. [19] S.A. Mazinani, J.A. Stuart, H. Yan, RSC Adv. 8 (2018) 31465–31470. [20] S.A. Mazinani, N. Noaman, M.R. Pergande, S.M. Cologna, J. Coorssen, H. Yan, RSC Adv. 9 (2019) 11810–11817. [21] J.-L. Sagripanti, M.L. Swicord, Int. J. Radiat. Biol. Relat. Stud. Phys. Chem. Med. 50 (1986) 47–50. [22] V. Garaj-Vrhovac, D. Horvat, Z. Koren, Mutat. Res. 243 (1990) 87–93. [23] H. Lai, N.P. Singh, Bioelectromagnetics 16 (1995) 207–210. [24] D. Brusick, R. Albertini, D. McRee, D. Peterson, G. Williams, P. Hanawalt, J. Preston, Environ. Mol. Mutagen. 32 (1998) 1–16. [25] P.E. Hamrick, Radiat. Res. 56 (1973) 400–404. [26] W.F. Edwards, D.D. Young, A. Deiters, Org. Biomol. Chem. 7 (2009) 2506–2508. [27] C. Fermér, P. Nilsson, M. Larhed, Eur. J. Pharm. Sci. 18 (2003) 129–132. [28] A. Kempitiya, D.A. Borca-Tasciuc, H.S. Mohamed, M.M. Hella, App. Phys. Lett. 94 (2009) 064106. [29] D.J. Marchiarullo, A.H. Sklavounos, K. Oh, B.L. Poe, N. Scott Barker, J.P. Landers, Lab Chip 13 (2013) 3417–3425. [30] F.C. Lawyer, S. Stoffel, R.K. Saiki, S.-Y. Chang, P.A. Landre, R.D. Abramson, D.H. Gelfand, Genome Res. 2 (1993) 275–287.

Please cite this article as: J. Sun, J. Vanloon and H. Yan, Influence of microwave irradiation on DNA hybridization and polymerase reactions, Tetrahedron Letters, https://doi.org/10.1016/j.tetlet.2019.151060