Influence of mRNA determinants on translation initiation in Escherichia coli

J. Mol. Biol. (1991) 218, 83-97

Influence of mRNA Translation Initiation

Determinants on in Escherichia coli

Dieter Hartz, David S. McPheeters’f and Larry Gold$ Department

of Molecular, Cellular and Dwel~~mental University of Colorado, (‘amps Box 347 Boulder, CO 803094.337. I:.S.A.

(Received

Biology

7 Ma?y 1990: accepted 22 October 1990)

We have studied the classic initiation elements of mRNA sequence and structure to bet,ter underst,and their influence on translation initiation rates in Escherichia co&. Changes introduced in the initiation codon, the Shine and Dalgarno sequence, the spacing between those two elements, and in the secondarT structures within initiation domains each change the rate of 30 S ternary complex formatlon. We measured these differences using extension inhibition analysis, a technique we have called “toeprint,ing”. The rate of 30 S initiation complex formation in the absence of initiation factors agrees well with in z%uo translation rates in some instances, although in others a regulatory role of initiation factors in 30 S complex formation is likely. Nucleotides 5’ t,o thr Shine and Dalgarno domain facilit,at~c~ t)ernary complex formation.

involves 1989; Hlasi et al., 1989). The method nothing more than cDNA synthesis by reverse transcriptase on a template mRNA to which a ribosome, toget’her with a tRNA? is bound. Using t,oeprinting we measured initiation complex formation on various mRNAs containing mutations in initiation domains or having different lengths of initiation domains: we compared those data, when possible, wit)h reported in viva translation rates. Tn general. t)oeprinting efficiency is a good indicat,ion of in zjivo t,ranslation efficiency.

1. Introduction Translat#ion initiation eficiency on different messenger RNAs varies considerably ((iold el al., 1981; St,ormo, 1986; Gold & Stormo, 1987: Gold. 1988). The mRNAs from bacteriophage 1 late genes are translated with lOOO-fold different eficiency by Kscherichia coli ribosomes (Ray & Pearson, 1975): diflerent, initiation rates are responsible for such differences (Sampson et (cl., 1988). The Shine and Dalgarno sequence, the initiation codon, the spacing between those t)wo elements, and secondary structures have all been found to be important det)erminants of translation eficiency (Gold & Stormo, 1987; Draper. 1987; Gold, 1988: de Smit & Van Duin, 1990). Direct, comparison of initiation complex formation in vitro with translational yields in vim has been difficult, however, and has yielded only poor agreement (Steitz el al., 1977; Dunn et al.. 1978; Calogero et aE., 1988). The developmentj of the ext,ension inhibition method, called ‘Xoeprinting”, has greatly facilitated the measurement, of initiat,ion complex formation on initiation domains of natural mRNAs (Hartz rf al.. 1988). So far, t.oeprinting data have shown good agreement with in, &jo translation rates (Winter rt nl., 1987: McPheet’ers et nl., 1988; Srharfer et al..

t Present address: Coors Hiotech, 6204 S. (‘ollegr ,4ve, Ft Collins, CO 80525, C.S.A. $ Aut,hor to whom all correspondence should be addressed.

2. Materials

1.ncharged E. c&’ t,RPu’Apf was purc+aned from E. coli tR,NALYs. Boehringer-Mannheim. ,,,A;“. tRh- _A”“‘-1 1 and tRNACy” were purchased from Hubriden RKA. The synthetic anticodon stem and loop fragment, of initiator t,RPljA. called A2dy” (Hartz PI (cl.. 1989). was generated by T7 transcription (Milligan rt al., 1987) using t)hr top strand “pts“ and the bottom st,rand “floop” shown in Table 1. (b) Enzymes

<\-

83 0022%2836/91/050083-15

$03.OOhI

and Methods

(a) tRN.4

AMV-reverse transcriptase and MMLV-reverse transcriptase were obtained from Life Sciences Inc. and Bethesda Research Laboratories, respectively. Phage T7 RNA polymerase was provided by 0. Uhlenbeck. Phage T4 polynucleotide kinase, and T4 DNA ligase were purchased from New England Biolabs Inc. RPu’aseT1 and RNase H were obtained from Boehringer-Mannheim and Promega, respeetivelv. 0 1991 Academic Press Limited

84

1). IlarI;

1.t al. ---.----.-_--

Table 1 Oligo

SrquerlcY

I‘srd for

gggaaacttcatcatcacttaaay c.c.tgttgggtgtaatta(~~~a~tt,g gttgggtaa~gw%ggg agtgatggactttt,tgtaagcaaa gaaga~~gagg~~tttaac’cgpt taatacgactvactatag cttc.gggttatgagc~ccga~~tataptgagtc,gtatt,a gatct~aaggaggattaaaaaaaaaaaaasctpca gt,ttt,tt,ttt,ttt,tt,aatrrt(~(~tt;r ytltct,aaggaggattgtgtgtgtgtgtgtgtgtgrs (,a,c.a(,a~ar~~(,~j(,ar~;lt,c.~t crtta gate a, aagga ak atgva gate a, uaaggagg a, atgca t 13 oligodeoxynucleotides were used to clone p&Cpsdl2 and pSD2-pSD12. For the number of adenosines (a,) and (a,J inserted into each of the constructs, see legends to Pigs 5 and 6.

(r) Initiation

Purified E. coli initiation

factor

IF-3

factor IFS? was a gift from

(‘. (iualerzi.

The 30 S subunits, prepared according to Kenney et al. (1979), were a gift from R. Traut.

oligodeoxynucleotides rbsa and rbst (Table 1) into Bg1IIr&I-digested pBC39. The tacI1 promoter between E’coRIHind111 was subsequently replaced by the phage T7 410 promoter to create pT7A. In similar fashion, plasmid pT7GU was constructed with the oligodeoxynucleotides rbsgtg and rbscac (Table 1). Cloning protocols were adapted from Maniatis et al. (1982). (g) Oligodeoxynucleotides

In zivo RNA from T4 wild-type. z,4PlO, HD263 and zEM72 were prepared according to McPheeters ef al. (1986). Total RNA was harvested 12 min after infection for experiments on rIIB mRNAs, 6 min and 18 min after infection for experiment’s on early and late lysozymr mRNA. respectively, and 18 min after infection for experiments on gene 3X mRNS. In vCc?o ‘.sd” and “81)” mRNAs from plasmids psd2A-psdl2A and pSD2ApSD12A in E. coli I)1210 (Sadler ut al.. 1980) were prepared by L. Green as follows: cells harboring the plasmids were grown at 37°C in t’he presenrr of I mMisopropyl-fl-n-thio-galactoside to A6,,cnm = 0.6. Total RNA was then preparrd according to MrPheet’ers cd al. (1986). In oitro KNAs f’rom the PvuII cut plasmids pRS170. pT7A and pT7GU were synthesized with T7 polymerasr according t’o Lowary et a/. (1986). Thr RXAs wpre purified on a 6O, (w/v) polyacrylamidr gel.

The plasmid pRS170 contains the sequencr from -!!?2 to 107 of gene 32 (Krisch 8: Allrt, 1982) and has been described by Hartz et nl. (1989). To construct plasmids psdSA-psd128 and plasmids pSD2A-pSD12A oligodeoxynucleotides sdZA-sd12A, and SD2A-SD12A (Table 1) were notch

cloned

int,o HyZII.

I’stT-digested

vector

pSC39

I)g I). Barrirk according to Childs et al. (1985). pB(39 was caonstrurted by replacing the Pra2 promoter of pBC2!1 (Childs et 01.. 1985). between ticoR and HindIIT, with the tar11 promoter (which was a gift from H. de Boer). I’lasmid pT7A was construct)ed by inserting a synthetic I)NA fragment. consisting of the csomplementary synthetic, 7 Abbreviation used: IF3, initiation factor 3: AMV, avian myeloblastosis virus: MMLV, mouse mammary t,umor virus.

Oligodeoxynucleotides were synthesized on an Applied Biosystems model 380A DNA synthesizer and purified by preparative polyacrylamide gel electrophoresis. The sequences and use of the oligodeoxynucleotides are shown in Table 1. (h) Extension

inhibition

Extension inhibition (or toeprinting) was performed essentially as described by Hartz et al. (1988). 32f-labeled primers complementary to the mRNAs of interest (Table 1) were annealed as described by Hartz et ul. (1988). Primer LP134 was used for priming on in vitro transcripts and “sd” and “SD” mRNAs. Toeprinting reactions (10 ~1) were prepared in standard buffer (10 mMTris-acetate (pH 7.4), 60 mM-NH&l, 6 mM-fi-mercaptoethanol, 10 mlrr-Mg-acetate) and contained either crude RNA or 6.7 nM of the in vitro transcripts, along with ribosomes, tRNAs and IF3 as specified in Results. Reactions with all ingredients were prepared on ice and preincubated as indicated in the Figure legends, followed by primer extension with AMV-reverse transcriptase (for crude RNA) or MMLV-reverse transcriptase (for in vitro transcripts). (i) RNnse

H digestion of rIIB mRNAs initiation domain

upstream

from

t/w

We wanted to normalize the expected toeprints on rIIB mRNAs against the reverse transcriptase readthrough products. Because the 5’ ends of rlIB mRNA in wivo are heterogeneous (Guild et al., 1988), we used RNase H to create precise 5’ ends in the rZZB mRNAs upstream from the initiation site. A deoxyoligonucleotide, complementary to the -70 to -47 region of rZZB RNA, was mixed with crude RNA; the DNA-RNA hybrid was then cblraved with RNase H. Reaction mixtures (100~1)

mKNA

and Translation

contained 100 pg of total RNA from T4 wild-type, zAP10, HD263, or zEM72 infected cells, and 2.4 pmol of primer rIIP2 (complementary to bases -70 to -47) of rlZR mRNA in 20 mM-Hepes (pH 8.0), 50 mM-KCl, 1 mMdithiothreitol. The primer was annealed to the rZZB mRNA for 5 min at 60°C and cooled on ice. Reactions were supplemented with 10 mM-MgCl, and 475 units

RNase H. RNA digestion was for 30 min at 37°C. The RNA was purified over a Sephadex G75 spin column. extracted with phenol, precipitated with ethanol and redissolved in @l mM-EDTA.

85

Initiation

5’-

zEM72 zAPlO / / A GAHD2 63 I I I UAAGGAAAAUUAUGUACAAUAUUAUUAAAUG . . .

Figure 1. Mutations in the initiation domain of rlIH. Mutations that alter the initiation codon (zAPlO. HD263) and the Shine and Dalgarno sequence (zEM72) are indicatrd.

(j) Complete digest of pT7GU transcript with RNase T, A 5 ~1 reaction, containing 2.5 pmol of purified transcript in 10 mw-Tris.HCl (pH 7.5), 1 mM-EDTA, 1 unit RNase T,, was incubated for 18 h at 37°C. Resulting fragments were directly 5’ 32P-end-labeled with [y-32P]ATP and polynucleotide kinase using a standard protocol (Maniatis et al., 1982). Labeled fragments were

separated on a 20% (w/v) polyacrylamide gel containing 8 M-urea. (k) Determination, of relative toeprints To quantify the toeprint stop and the 5’ end stops, the autoradiographs of Fig. 2 were scanned on a Hofer GS300 densitometer and the peaks electronically integrated. Relative toeprints (%) were calculated: (toeprint/ toeprint + 5’ ends) x 100. Relative toeprints of Figs 5 and 6 were determined by analyzing the radioactivity distribution on the gels with an AMBIS Systems radioanalytic imaging system and electronically integrating the toeprint signals and the signals from the 5’ ends of the mRNA. Relative toeprints were calculated as above. (I) Ihta prowssin~g of xcanning data of Fig. 12 The lanes of t,hr autoradiograph of Fig. 12 were scanned on a Hofer (%300 densitometer. which was caonnec+ed t)o an IBM personal computer. The absorbance values (1200 dat,a points/lane) were stored and electronically aligned with the absorhanre values from the scaan of the sequencing lane (for examples, see Fig. 13(a) and (b)). Absorbance values from aligned lanes were divided through the absorbance values of aligned lane 3 of Fig. 12 using a computer program written by T. Schneider. The resulting quotients (relative absorbances) w(lre averaged over t,he 4 neighboring positions to smooth the curves (Fig. II).

3. Results To analyze 30 S complex formation on various translation initiation sites we used the extension inhibition technique, also called toeprinting. cDNA synthesis on a templat,e mRNA is terminated when the reverse transcriptase encounters a 30 S ribosomal subunit, plus t’RNA bound on the mRNA. The short cDNA is visualized as a toeprint band on a sequencing gel. The toeprint) usually appears 15 bases downstream from the A of the initiation codon if initiator tRNA is bound in the complex or at + 15 from t’he first base of the cognate codon if elongator tRNA is bound. The toeprint band, when compared to the band of the full length cDNA, is a quantitative measure of ternary complex formation (Hartz et al.. 19X9).

(a) Znitiation

codon

Previously we detected 30 S ternary complexes at the translation initiation site of bacteriophage T4 gene rlIB mRNA using the toeprinting technique (Winter ef al.. 1987; Hartz et al., 1989). We first, analyzed 30 S ternary complex formation on the mutant rZIB initiation sites zAPlO and HD263 (Singer et aZ., 1981; Belin et al., 1979; Fig. 1; zEM72, which contains a mutation in t,he Shine a,nd Dalgarno domain, is discussed below). The initiation codone in zAPI and HD263 are changed to (:liL’ and AUA, respectively. Both mutants are translated with lower efficiency than wild-type rIIB in T4-infected B. coli (Singer et al.. 1981) and also when 1hey were cloned in front of a /nc% reporter (with the mutant rZZB initiation sites providing of the rZIB-ZacZ fusion prot,eins t,ranslation (Shinedling rt nE., 1987a)). Toeprinting data were obtained for increasing 30 S subunit concentration at) high tRNAp” on crude (.)I, I~& RNA. The RNA was prepared from cells infect,ed by T4 rIIB mutant phages as well as wild-type. Precise 5’ ends on rI/R mRNAs (needed to quantify the data) were created as described in Materials and Methods. All rtIB mRNA species yield a toeprint at + 15 from the first base of the initiation codon, indicating that ternary complexes have formed at the initiation sites (Fig. 2). The toeprints increase with higher 30 S concent’ration. HD263 (with an AUA initiation codon) shows two additional reverse transcriptase stops. The first is locabed at + 15 from the first base of the AI’A codon located two bases downstream from the inframe AUA initiation codon, while the second is located at + 15 from the A of the .ArG codon located 14 bases downstream (Figs 1 and 2). The second AUA and the downstream AU(: are not in the rIlB reading frame and should not contribute to rlIB expression in wivo (see Discussion). The relative toeprints (t#oeprint band,‘,‘,’ ends + toeprint band) were determined from t,he autoradiographs and plotted against, the added 30 S subunit concrntrat,ions (Fig. 3). Jnitiat*ion complex formation on the mutant) initiation sites is clearly lower than on the wild-t,ype initiation sit,?. ;1t 1 ~~-30 S subunit concentration relative toeprints reach 85 ‘!. for wildtype, 523:) for zAPlO and 23O;, for HD263. The same-order has been obtained for in VOWtranslat’ion rates of the rITB-1acZ fusion proteins and of rJJ I{ prot,ein from T4-infect,ed ~11s (Shinedling et

HD263

.

WT

.

(b)

(a)

Figure 2. Detection of ternary complexes on (a) wild-type (WT) rZIB, and mutants HD263; (b) zEM72, and zAPi as function of the 30 S subunit concentration. ReacCons contained 1% pg crude RNA from infections with wild-type 01 rlIR mutant T4 bacteriophages. Defined 5’ ends in rIZB mRNAs were created upstream from the initiation domains as outlined in Materials and Methods. Sites of the mutations are marked with arrows in the sequencing lanes. At constant. 10 PM-tRNAy, increasing amounts of 30 S subunits were added at the concentrations (PM) indicated above the lanes. Note that 3 reverse transcriptase stops were obtained from HD263 at + 15 from the AUA initiation codon, at + 15 from a second AUA codon, and at + 15 from a downstream AUG codon (dotted in Fig. 1). Preincubations were for 10 min at 37°C followed by primer extension with AMV-reverse transcriptase for 15 min at 37°C. (~cl..1987u: Singer et al., 1981). The relative toeprint,s of zAPlO are lower than those of rIIR wild-type over the whole range of 30 S concentrations tested and agree well with its lower in IGVO translation

rates (Table 2). Even though the HD263 is about fourfold lower type rZlB, it does not agree well lOO-fold lower in z&o translat’ion IacZ fusion protein or t,he S-fold rIIB from HD263-infected cells 1987a; Singer et al.. 1981).

relative toeprint of than that of wildwith the more than rat,e of the HD263lower expression of (Shinedling rt al..

Table 2 ';= 60t h ; 50 al G 2 40 2

/

30 20 IO 0

0.1 o-2 0.3 0.4

0.5

0.6

o-7 0.8

0.9

I-0

30S(m)

Figure 3. Graph of scanning data from Fig. 2. Relative toeprints were calculated and plotted as a function of the added 30 S subunit concentration. wt, wild-type.

fusion proteins. t b-Galactoaidaur WlW.% of rIIB-la&! normalized to wild-type (lOO”~o). as measured at 37’(‘. from Shincdling rt ol. (1987a). $ rIII3 protein synthesized in T4 infwtions, normalized try wild-type (100%). as measured at 3O”C’, from Singer rl rzl. (1981). 9: Iklative toeprints normalized t,o wild-type (lOOn&), at 1 pM30 S subunit,s plus 10 q-t&NAY (from Fig. 3). (1 Only the relative toeprint, from thp in-frame At:A (AllA 1 in Fig. 3) wits counted.

mRNA and Translation

WT

(b) Shine and Dalgarno

5’ er

Figure 4. Temperature sensitivity of ternary complex formation on the AUA codons of HD263. Reactions contained 25 pg of crude RNA from T4 wild-type (WT) infection or 44pg of crude RNA from HD263 infection: I PM-30 8 subunits and 2 PM-tRPU’A,M” were added and after preincubation for 5 min at the indicated temperature primer extensions were performed at the same temperature for 30 min. Toeprinting signals are marked with arrows.

87

Initiation ~YPY,UW~Y

The influence of the Shine and Dalgarno sequence on ternary complex formation was investigated on t)he rlIB mutant zEM72 (Fig. 1). zEM72 is translated with lower efficiency than is wild-type rIIB when cloned in front of lncZ (Shinedling et al., 1987a) or measured as rTIR protein from zEM72infected cells (Singer et al.. 1981). We performed a titration experiment similar to the toeprinting experiments on t,he other rIZB mRNAs. With increasing 30 S subunit concentration. at high tR?iAy”’ concentration, the relative toeprint at’ + 15 from the initiation codon increases (Fig. 2(b)) and reaches 497; at 1 p-w-30 S concentration (Fig. 3). Ternary complex formation with wild-type rZ/R reaches 8596 under identical conditions. The reduced ternary complex formation on zEM72 agrees well with the reduced translation rate of zEM72 (Table 2). zEM72 forms ternary complexes almost as well as zAPlO ab high 30 S concentration but exhibits a decreased ability to form complexes below @2 PM-30 S concentration (Fig. 3). The influence of the Shine and Dalgarno sequence on ternary complex formation was also studied on t)wo sets of mRNAs, called sd and SD, that have as the Shine and Dalgarno sequences either AAGGA or I’AAGGAGG (and which are at) variable distance from an AUG initiation codon). Toeprints obtained on these mRNAs at 1 ~~-30 S subunits and 10 PMtRNA,M”’ are shown in Figures 5(a) and 6(a). Relative toeprints calculated from these data are presented in Figure 7. For each spacing configuration the rela.tive toeprint,s from SD mR,XAs exceed the relative toeprints from sd mR,SAs by severalfold. This agrees well with in tiiz~ t,ranslation rat,es which are at least threefold higher for the SD rnRNAs for each spacing configuration ((:old. l!IXX; Shinrdliny ri (II.. unpublished result,s). (c) Spacing between the Shine und Ikdgarno 8wqueme and thP initiatior/ ro~iort

Translation

f’rorn the

AUA

initiation

codon

in

rf ZB HD263 is highly temperature-sensitive. While wild-type rZ/R is actually translated twice as well at 37 Y’ than at 21 “C, HD263 translation is diminished by more than 1&fold (Shinedling et nE., 1987a). We compared t’ernary complex formation on wildtype and HD263 r//R in toeprinting assays at 30°C. 37°C and 42°C:. Reactions contained crude in uivo RNA from T4 wild-type or T4 HD263-infected cells, 1 p~-30 S subunits and 2 pM-tRNAye’. With increased temperature the toeprint from wild-type rIIB slightly incareases while the toeprints from the two AUA codons in HD263 are drastically diminished (Fig. 4). The toeprint from the downstream A UC: codon, seen in HD263 (see Discussion), increases with temperature and thus serves as an internal control. Initiation complex formation in the absence of initiation factors faithfully mimics the temperature sensitivit,y of HD263 translation in viva.

(‘ompilations of ribosome binding site sequences show an average spacing of seven nu&otides and spachin@of less than five and more than nine to be rare (Storm0 if trl.. 198%). In /:il:o experiments suggest that within the range of tivr to 13 nucleotides there is only a small effect on translation, with spacings of nine nucleotides being optimal (Shepard et nl.. 1982: \;Z’ood rt al., 1984). The influence of the spacing between Shine a.nd Dalgarno sequences and the initiation codon on t’he formation of ternary complexes was invest’igated on the sd mKNAs and the SD mRNAs. Toeprinting reactions contained crude in I*& RXA (including one speck of the mRNAs of Fig. 5(a) or Fig. 6(a), 1 ~~~-30 S subunits. and 10 PM-tRNAy”‘. In anot,her set of experiments. 1 ,uM-IF~ was included in t,hr reactions as well (Fig. 5(b) and Fig. 6(b)). The two torprint stops at + 15 and + 16 from the A of the initiation codon represent ternary complexes with initiator t RXA. They were quantified against’ the 5’ end signal of the mRN.As to calculate t,he relative t>orprints (Fig. 7).

SD

tr

CA,AAGGA A, AJ&CAGGAUCCCGUCGU (a)

(b)

Figure 5. Detection of ternary complexes on sd mRPu’As with variable spacing between Shine and Dalgarno sequencr and initiation

The spacing ranges from 2 to 12 nucleotides. Reactions contained (a) 1 ~~-30 R subunits and and (b) in addition 1 PM-IFS. Toeprints resulting from ternary complexes with tRXAp’ are marked wit,h their position within the sequence of the initiation domain is marked with arrows. The number of adenosines 5’ and 3’ from the Shine and Dalgarno (SD) sequence is variable as indicated by A,, and A,. A,, decsreases successively from 9 As in sd2 mRNA to 3 As in sd8 mRNA and remains constant at 3 As from sd9 mRNA to ~11% mRN’A. A, increases successively from 2 As in sd2 mRNA to 12 As in sd12 mRNA. codon.

10 /au-tRNAp, Below, arrows.

For the sd and SD mRNAs there appears to be a spacing requirement of five bases for sd and three to four bases for SD. respectively. Complexes on mRNAs with shorter spacing are &her not, detectable (for sd) or yield ternary complexes with elongator tRNAs that aontaminat,e the in ZGVORNA (for 8112 and SIB mRNA). The optimum spacing for initiation caomplex formation on sd RNAs is partitioned between t,wo ranges (5 to 7 bases. 10 to 11 bases) in this experiment., which might, reflect two annealing alternatives with the 3’ end of the 16 6 rRNA. For the SD minimum

mRI\;As

the optimal

spacing

is in the range of four

to eight, bases. TF3 exhibits an interesting diRerential effect on ternary complex formation: while relative toeprint,s on mRNAs with a spacing of’ up to

nine bases are improved i)y IFS. t,hey art‘ dimirlished for longer spacings. This IF3 e&St especially changes the spacing requirement, for t#hr sd series and leads to an optimal spacing of seven bases. The optimal range of five to nine base spacing for thfs Sl) series is insensitive to TFB. A c*omparison of rclat,ive toeprints from incubations including IF3 with if/. ui~o translation rates from the sd and SI) series (Shinedling et al., unpublished results) result’s in good agreement, between the dat)a. except for longer spacings. More work should 1)~ aimed al these details. Because most tRNAs (and perhaps all) can serve t,o direct a toeprint, + 15 from the codonn that they recognize (Hartz et al.. 1989), we devised two mRNAs in which a Shine and Dalgarno sequence of

m&VA and Translation

SD

I GtiatioTl

89

VI

CAnUAAGGAGG Ak AUGCAGGAUCCCGUCGU

(b) Figure 6. Detection of ternary complexes on SD mRNAs with variable spacing between Shine and Dalgarno sequence and initiation codon. The spacing ranges from 2 to 12 nucleotides. Reactions contained (a) 1 PM-30 S subunits and are marked 10 /m-tRxA,Me’, and (b) in addition 1 p~-I#‘3 (b). Toeprints resulting from ternary complexes with tRNAp with arrows. Below, their position within the sequence of the initiation domain is marked with arrows. The number of adenosines 5’ and 3’ from the Shine and Dalgarno (SD) sequence is va.riable as indicated by A, and A,. A, decreases successively from 10 As in SD2 mRNA to 0 As in SD12 mRNA. A, increases successively from 2 As in SD2 mRNA to 12 As in SD12 mRNA

eight base complementarity (to the 3’ end of 16 K rRNA) was followed either by a series of As (the pT7A transcript: Fig. 8(a)) or hy GUS (the pT7Gt t’ranscript; Fig. 9). Adding a cognate tRSA in toeprinting reactions should allow the translational machinery to choose from a series of cognate codons close t)o the Shine and Dalgarno sequence. The cognate codons selected can be identified hy count*ing 15 nucleotides back from the toeprints. I’sing this stmhegy, tRNALyS was added to toeprinting reactions on the pT7A transcript. Several t’oeprint stops appear, the two main stops being + 15 from the two AAA triplets closest to the Shine and Dalgarno sequence (Fig. 8). This corresponds to a distance of only three to four nucleotides. The same strategy used on the pT7A transcript’ to

st)udy spac>ing bebween the Rhine and Ijalgarno and the chosen cognate codon was sequence also applied on the pT7GU transcript. We added tRN;A”a’-l tRNACYs tRNAM’* A+‘“’ (Hartz t-t al.. to ’ toeprihtihg L&ions including 1989), or tRNApL the pT7GI’ transcript (Fig. 9)? which allowed the translation machinery to select from several cognate codons. The strongest toeprints obtained with tRSAy”, A22~et and tRNA”“’ are not’ at + I5 from the cognate GUG codon but, inst#ead, could be either at + 14 or + 16 from GlJG codons, which have a spacing of five and three nucleotides, respectively, from the Shine and Dalgarno sequence. tRNACys yields a toeprint + 15 from a cognate PGC’ codon, whose distance to the Shine and Dalgarno sequence is six nucleotides. We did not obtain any toeprint from t,RNAi”‘, which is unable to read a GliQ codon.

I). tlnrtz

et al

-2Omer

1

Spacing (bases)

Figure 7. Graph of the t’oeprinting data from Pip. 5 and Fig. 6. Autoradiographs were scanned and relat,ive toeprints calculat,ed and plotted as a function of the spacing between initiation rodon and Shine and Dalgarno SC%ptWX; sd mRN’Xs from Fig. 5(a) (- q -a-): sd mRNAs from Fig. 5(b) including IF3 (-¤n -): SI) tnRKAs from Fig. 6(a) (-O0 -): Sl) mRKAs from Fig. 6(h) including IF3 (- l - l -).

(d)

Akxmdary

structures

The influence upon translation of secondary st’ructures within initiation domains can be enormous (St,ormo, 1986; de Smit &, Van Duin, 1990). In extreme cases secondary structures might’ occlude t,he Shine and Dalgarno sequence and t,he initiation codon and might inhibit translat#ion completely. as in the case of’ early T1 lysozzmr mRNA (McPheeters et (11.. 1986). Lat)e during infection. lysozyme mRNA is transcribed from a different promoter so that the inhibitory secondary structure is not formed. The late mRNA is translationally active. Correspondingly, we obtained no toeprints on lysozyme irr ~:iro RNA from early infection. however. I,ysozymc mRNA from lat,e in infrct,ion, readily forms ternary cbomplexrs (Fig. 10). A few secondary struct*ures have also been proposed to facilitate t,ranslation initiation (Gold et nl.. 1981). One example is the T4 gene 38 initiation site, in which a, very stable secondary structure (Tuerk et al.. 19X8) exists between the Shine and 1Ialgarno sequenctt and the initiation codon. On in GW prepared gene 38 mRNA, ternary complexes with tRNAy” yield a double t*oeprint + 15 and + 16 from the initiation codon (Fig. 11, lane 3). tRSAs, which contaminate the in L%W RNA preparation (Hartz rt al., 1989). yield toeprints 3’ from the init,iator tRNA t,oeprints in the incubation with added 30 H subunits (Fig. 11. lanr 2). Tn the same incubation, toeprints from the initiation codon are faint while codons 5’ from the initiation codon do not produce any toeprints (Fig. 11). This indicates that the secondary st)ructure brings the Shine and

Figure 8. (a) Detection of ternary complexes on the pT7.4 transcript. Toeprinting reactions contained 0.1 PM30 S subunits or 0.1 ~~-30 S subunits and 0..5 pM-tRSALY”. Kelow, the location of the 2 main toeprints within the initiation domain of the pT7A transcript is indic,at,rd with arrows. The toeprints form at + I :7 from the underscorrd codons. I’reinoubation was for IO min at 37 ‘( ’ followed by primer rxtrnsion for 15 min at 37 'C'. Srque~ici~~g lattes are depicted on the left. Note t,he ht+erogrnritv of the sequencing hands above t,hth run of i\s. wtricah ‘is tlur to incorporation of extra As by TT polgmerase during ire vitro t,ranscription. The heterogeneity is not c%ausedby replication since sequencing the plasmid DXA shoned the correct number of As (data not shown). (b) C’ompletr RiVase T, digestion of the pT7A t,ranscript shows t)hat, the fragment c.ont,aining thr run of’ ,\s is heterogeneous in length (arrows). However. t,hc rxprc+rd 2Omrr is thv main producat so that the conclusions ahout. tht, distanccl between the recognized cdon atrcl t hr Shi n(* ;~rd Dalgarno srquenvr should hr valid.

Dalgarno sequence into close proximity with the initiation codon so that elongator tRNAs forrn complexes only on codons with a more favorable (i.e. longer) spacing to the Shine and Ijalgarno sequence. (e) Beyu,ence

requirement 5’ to the Nhiw Dalgarno sequence

and

Stat,istical analyses show translation initiation domains to be non-random from -20 to + 13 (Schneider et al.. 1986). Those nucleotides are also protected against nucleases by init’iation complexes (Steitz, 1975). Thus, there is the potential for other

mKNA and Translation

91

Initiation

i%l23456

‘I u IA

Val /,Met

Cys

SD t t UAAGGAGGAUUGUGUGUGUGUGUGUGUGCA Figure 9. Detection of ternary complexes on the Toeprinting reactions contained pT7G IT transcript. 0.1 y.n-30 S subunits and 05 PM of the tR,KAs above the lanes;. ,I A22:“’ is a synthetic anticodon stem and loop The locations of the toeprinting fragment of tRl\jAy’. stops within t,he initiation domain of the pT7GlT transcript, (below) are marked with arrows. Sequencing lanes are shown at the left.

sequences besides the Shine and Dalgarno and the initiation caodon to make contacts with the ribosome. Sequences 5’ from the Shine and Dalgarno sequence might be crucial for high level expression of bacteriophage T7 gene 70 (Olins & R’angwala, 1989). We examined the sequence requirement 5’ from the initiation codon of the T4 gene 3% ribosome binding site for initiation complex formation. The pRS170 sin vitro transcript (which contains the gene 32 initiation domain) was partially hydrolyzed so that a uniform pattern of bands appeared in primer extension reactions on that RNA. When 30 S subunits and tRNA are added to the partially hydrolyzed RNA. onl? those fragments with sufficient “information“ u-111form 30 S ternary complexes and give toeprints in primer extension reactions. Since a toeprint constit)utes a premature reverse transcriptase st,op. the 5’ ends of those fragments that form 30 S ternary c&omplexrs will be diminished (thev will yield a toeprint hand downstream), while the 5’ends of fragments too short for 30 S ternary complex format)ion will remain unchanged. Thus, the position at’ which bands start to disappear in react ions delineates the minimum toeprinting length for initiation complex formation. Both tRNA”“’ and tRNAi” were used at low and high 30 S alfd t,RNA concentrations (Fig. 12). at some distance upstream from the Clearly, t,oeprinting site hands are diminished in intensity

-

U A x uu : ii ‘A + Figure 10. Inhibition of terna.ry complex formation on early T4 lgsozyme mRPu’A by a secondary structure. Reactions contained either 2 pg crude RNA harvestSed 6 min after T4 infection (lanes 1 to 3), or 2 pg c,rudt=RNA harvested 1X min after T4 infection (lanes 4 to 6). In addition, lanes 2 and 5 contained I pM-:%(j S subunits, lane 3 contained 1 p~-30 S subunits plus 5 FNI-t RKA;“. and lane 6 contained 0.2 PM-30 S subunits plus 5 pM-tRRN;Ap. Preincubations were for 10 min at 37°C’ followed bv primer extension with AMV-reverse transcriptase fi;r 15 min at 37°C. On the right’ the initiation domain of ‘I’4 lysozyme is shown with the secondar! st*ructure indicated. The main transcriptional start) sites from late promoter eP1 are marked by asterisks. The 5’ ends below those start sites are discussed by McPheeters pf 01. (1986). Shine and Dalgarno sequence and initi;ttion ~don are boxed and the toeprint position with init,iator t RNA is marked with an arrow.

\

(Fig. 12. lanes 4 to 7). To accurately determine the position at which bands start to disappear. lanes 3 to 7 of Figure 12 were scanned on a densitometer and aligned wit,h the scan of the sequencing lane

Gene 38

UCUUCCCG A 1 Not used

’

Used

A A A

U * A 4 hlJ * Figure 11. Detection of ternary complexes on 7’4 gene 38 mRNA. In addition to 2 pg crude T4 RNA harvested 18 min aft.er infection (lane I) lane 2 contained 1 PM-30 S subunits and lane 3 vontainrd 1 ~~-30 S subunits plus 5 ~~~-tRNA~“. Lane 4 vont,ainrtl a sequencing reaction including ddTTP (A-lane). On the right t,he init’iation domain of gene 3X is shown with the Shine and Ihlgarno seyuencr and initiation vodon boxed. The secondary structure is indicated. Toeprints obtained with ternaq complexes including tRh’ A?“’ art’ marked with arrows: thr major toeprints without added initiator tRh’A (from mixed tRPIjAs in the mRXA) art’ mark& w&h asterisks.

(A-lane). A comparison of band intensities between lane 4 and lane 3 is shown in Figure 13(a). A similar comparison is depicted in Figure 13(h) between lane 5 and lane 3. A striking reduct’ion of band intensities appears at a specific location 5’ from the initiation codon (the A of the initiation codon is at position 0). To visualize clearly the position at which band intensity decreases, we divided all the data points of t,he scanned lanes 4 t,o 7 by the data points of the scanned lane 3 (the 30 S only lane). As shown in Figure 14(a), band intensity decreases rapidly 5’ t,o position - 11 in the lane with high 30 S and tRNAy” but decreases rapidly only after position -22 in the lane with low 30 S and tRN@“. Position - 11 is located just 5’ t,o the Shine and

1234567

Figure 12. Sequence requirement 5’ to the initiation codon for ternary complex formation on the pRS170 transcript. In addition to partially alkaline hydrolyzed pRSl7O transcript (lane ‘t). reactions contained 09 /lrn30 S subunits (lane 3). 0.2 ~~-30 S subunits plus 0.5 pn~tRNAp (lane 4). 2 ~~-30 S subunits plus 5 pM-tI
Dalgarno seyuence in gene 3%. which strongly suggests t-hat it is necessary for 30 S t,ernar> complex formation. Yet sequences 5’ from the Shine and Dalgarno sequence also contribute to 30 S ternary complex formation as they are necessary to form 30 8 ternary complexes at lower 30 S coneentrat’ion. Similar results were obt’ained for 30 S

,mRKA and Translation

lnitiation

93

High 30 S ?

d

:-

~~~~~~;

I,;

-7o’-50

-30

-10

0

).

I

I:

IO

20

30

40

IO

20

30

40

Position 1.11.I.I

I #

-70

-so

8.I

-30

_I

I-I

-10

(a)

t

0

IO

20

30

46

Position (0)

-70

-50

-30

-10 0 Position (b)

Figure

-70

++::::I. -50

I: -30

I: -10

I : I : : 0 IO 20

30

rt 40

Position ib)

Figure 13. Denskometric

scans of lanes of Fig. 12. Lane 3 (upper line) is c-ompared to (a) lane 4 (lower line), or (11) lane 5 (lower line). The position of the signals with respect t.o the sequence of the mRKA is indicat.ed betow.

ternar) complexes formed (Fig. 14(h)). t Rn’ACyS and shown).

with the tRNA2” tRNAPh’ (data not

4. Discussion Extension inhibition or toeprinting has been used previously to study 30 6 ternary complex formation on a variet,y of natural mRNAs (Hartz et al., 1989). Here we used toeprinting to investigate system-

14. Division

of signals (absorhancv) from scanned lanes of Fig. 1%. (a) Lane 4/larw 3 (continuous line). lane 5/lane 3 (dotted line); (b) lane G/lane 3 (continuous line). lane 7/lane 3 (dotted line). The quotients (relative absorbance) are plotted against the position on the mRNA. IVut,e the drop of the signals at different positions 5’ from the initiation codon. ?‘hr positions are also indicated in the sequence of Fig. 12

atically how changes within parts of the initiation domain affect ternary complex formation and to compare those data with in vivo translation rates. Generally, toeprinting data obtained in the absence of initiation factors agree well with in ZVIVOtranslation rates. However, ternary complex formation on an initiation domain with an AUA initiation codon or on initiation domains with variable spacing between initiation codon and Shine and Dalgarno sequence does not agree as well with in vivo transiation rates. Initiation factors might be involved in the modulation of initiation complex formation.

I II the ternary complex th(l init,iat,ion codon. usually AI:G, is base-paired with t)he anticodon of the initiator tRNA. which is bound in the 30 S P site. The base-pairing step is part. of a rearrangement, of a pret’ernary c*omplex. in which both mRNA and tR?;A are bound to t>he 30 6 subunit, but the t)RNA is not base-paired with the initiation c~don ((iualerzi & Pon. 1981). A weaker basepairing with an altered initiation codon should lead to less t.ernary complex formation and/or less trrnarv complex stability. rIZH zAPI with a (:I‘(; initiation codon and HD263 w&h an AlTA initiat>ion codon showed a reduction of the relat,ive toeprint. at high t,RNA concentration, to 62 Y. and 27 si, of witdtype sIlK. The unusual P site wobble rules ((:old. 1988) allow efficient in viva translation initiation on a (ilJ(i: codon (850,) of wild-type for zAPlO), but) not an ACA codon (0.8 9, of wild-type rl I B expression). The very low level expression from an AI’A initiation codon is probably not solely a ~~~t~sequettccof the diminished ternary complex formation, which is st)ilt appreciably high in the absence of initiation factors. InitiatLn complex formation on an XI’A initiation codon might be decreased by initiation f&or IF3. This hypothesis is reasonable since TF3 is involved in the checking of t,hr c~otlon-attticodon intJeractiott (Rerkhout rt al.. 1986) and c>xcludes initiator tRNA from an AUI: and AllA ittiliat’ion codon (Hartz rt nl., 1990; T. Hottingsworth. unpublished results). Furt,hermore. TF3 catalyzrs the rearrangement step of the preternary complex. part of which is t’hr codon-anticodon bane-pairing (Wint~ermeyrr & Gualerzi, 1983). TF3 might, only have a minor efft‘ci, on a G ITG initiation (*odor1since initiator tRNA is not excluded frotn a GITG initiat.ion (sodon by TF3 (Hartz rf trl.. 1990). Ternary complex formation on zAPlO, in t.hc absence of initiation factors. is towered about as much as zAPI translation. The t,emperature sensitivit’y of HD263 translation from the AUA initiation codon in tliuo is mimicked by toeprinting analysis of ternary complex formation on HD263 mRXA. The decreased base-pairing of t)he codon-anticodon interaction might lead to the destabilizat,ion of ternary complexes at elevated temperatures. If transtat’ion initiation in /%lo is set>sitivc to the stabitit,y of ternary complexes (i.e. 70 S initiation complex formation or the first elongation st)ep is stower t’han the off-rate of the tRh’A in the 30 S initiation cbomplex). elevated temperatures rates. transtat’ion lead to lowered might Temperature-sensit,ive translation is also observed wit,h r1113 237. which contains an AU: initiat’ion codon (Shinedling et al., 1987a). The temperature sensitivity of ternarv complex formatsion is observed in t,he absence of initiation fact’ors. We not’e the t,oeprint from the downstream AUG. which is st,rongest, on HD263 mRNA (Fig. 2). That AI:G can be placed in the rlIH reading fratne 1)~ the rI/B deletion FC6 (Pribnow rt al., 1981). Interestingly, FC‘6 is partially suppressed in lCW) by

of the trrrc~ init)iat ion (.odott. ‘1’4 destruction P53 FC’6 (but probably not T1 H t)%fi3. F( ‘6) is leaky for growt’h OII a tatnbda IysogtJtt (Kittz N: I~renner, 1975; and data not) st~owtt); t’53 caotttaitts a deletion of the I’ of the t,rutl initiat,iott c~ttion. Tttesc~ da,ta. which are not quantita,tivc. suggest that att inefficient hunt for an initiation codon (‘a,n OCYWI’ some 20 nucleotidrs away from a Shittcs and Dalgarno sequence. but ottI\, if no kint%ic~att> favored initiation codon is available at a IIIOW appropriate distancr. (h)

Shim

and

Dalgarno

srquum

The Shine and Dalgarno sequence serves to tether ribosomes near the translation initiation site by base-pairing with t,he 3’ rnd of the I6 S rRNA (Shine & Ijalgarno, 1971; Hui & de Boer, 1987). This interaction can take place in t,he absence of tRSA and initiation factors (Backendorf rt tsl.. 1980: Calogero et al.. 1988: Laughrea dz Tam, 1989: Hart,z et al., 1991). Ribosome-mRNA binary complexes can serve as intermediates of ternary complex formation (Gualerzi et al., 1977; Van Dieijen et al., 1978; Van Duin et al., 1980; Hartz et al., 1991). Diminishing the c~omplemcntarity of the Shine and Dalgarno sequence to t,he 16 S rRNA changes the binding affinity of the 30 S subunit to thr ribosomts binding sit’e (C’alogero rf al., 1988). Consequently. we find a drcrcase in the 30 S t’ernarg complex formation and/or sta,bility with r1113 zEM72 mutatiott. whose Shine and Dalgarno sequence is changed f’rom I’AAGGA to I’AAG. The decrease in trrnar? complex formation is higher at low 30 S c*oncrntration (Fig. 3). The weakened interaction of this mutant, RXA with the 30 S subunit’ (via the Shine and Dalgarno sequence) might decrease its ability t,o compete effectively for 30 S subunits with other mRNAs when t’he 30 S voncent’ration is titniting (Lodish. 197-C, 1976). However, t’ernary c.otnplex formation on shorter Shine and Dalgarno sequences is always lower. even at high 30 S c,onct,nt,rat~iotts. such as on the sd mRNAs w&h art XAGGA Shine and Dalgarno sequence as compared to Sl) tnRNAs with a ~~AAGGAGG Shine and Dalgarno sequence. The differences in ternary complex formation occur in the complete absence of initiation factors, whic*lt agrees with t,he finding that init’iatiott fac%ors do not play a subst,antiat role in t)hc binding of’ 30 S sub unit,s to mKNA ((‘a~togcro rt r/l.. 1988).

The rearrangement step of a preternary csomplex to form a t,ernary complex can he envisioned as the hunt of a 30 S subunit,. tethered at the Shine and Dalgarno sequence. for an initiation c*odon t.hai. will base-pair t’o the initiator tRNA in the 30 S F’ sitv. The spacer RNA between thr Shine and Dalgarno sequence and the initiation codon in such a model is nothing more than a hinge region on the mRNA that allows the initiation codon t’o collide with thr anticodon of the tR,NA. The length of t,hat hinge in

mRNA and Translation turn should influence the probability of such a collision and therefore should influence the speed of ternary complex formation. A minimal spacing would thus be the shortest spacer RNA that allows codon-anticodon base-pairing from a tethered Shine and Dalgarno sequence. We find a required spacing of three t’o four nucleotides from a I’AAGGAGG Shine and Dalgarno sequence (Fig. 5(a)) and of five nucleotides from an AAGGA Shine and Dalgarno sequence (Fig. 6(a)) to obtain ternary complexes. Practically the same minimal spacings were obtained for 6n L&O translation from those two Shine and Dalgarno sequences (Shinedling et al., unpublished results). Optimum spacing for ternary complex forma.tion shows a broad distribution over a spacing range rather than a distinct optimal spacing. Again, this is reminiscent of in oivo translation data. Peculiarly. the optimal spacing for ternary complex formation from the AAGGA Shine and Dalgarno sequence is partitioned between two spacing ranges (5 to 7, 10 to 11 nucleotides), but such part,it,ioning is not observed for in V~VOtranslation rates. One reason might be that initiation factors change the spacing requirement for 30 S ternary complex formation; for example, IF3 increases ternary complex formation at shorter (4 to 9 nucleotide) spacings, but diminishes ternary complex formation at longer spacings (Fig. 7). This influence of TF3 makes the agreement between relative toeprints and in vivo translation rates better for short spacings, but worse for long spacings. An influence of initiation factors on the spacing requirement is reasonable since they catalyze the rearrangement step (Wintermeyer &, Guaterzi, 1983), which in turn is dependent upon spacing. On the pT7A and pT7GU transcripts, which harbor the UAAGGAGG Shine and Dalgarno sequence of the SD mRNAs, ternary complexes were obtained primarily from cognate codons with a spacing of only three to six nucleotides from the Shine and Dalgarno sequence. Even though strong toeprints from codons with spacings of four to six nucleotides were expected, it surprised us that no toeprints from more distant codons were seen. WC expec%ed a distribution of toeprints t,hat reflected t,he same optimal spacing seen for t’he expression from the sd and SD mRNAs in viva (Gold, 1988) and the relat,ive toeprints for t’hose same mRNAs in oitro (Fig. 7). The toeprints from pT7A and pT7GlJ transcripts show the minimal spacings rather than t,he optimal spacings. These data might arise through the continuous att’empt of reverse transcriptase to elongate the cDN.4 at the 3’ OH adjacent, to the edge of the ribosome. Such elongation must be unidirectional. Thus, the distribution of toeprints might be narrowed by “slippage” between the anticodon of the bound tRNA and the repeated sequences in the mRNA. Slippage might be similar to the process of slipped mispairing during replication. which leads to frame-shift mutations. Slipped mispairing can occur at runs of a single nucleotide (Pribnou; et al.. 1981: Shinedling et al., 1987b), an

Initiation

95

event, similar to what probably happens on the pT7A transcript’. Slipped mispairing can also occur on repeated dinucleotides (Miller, 19X.5). an event similar to what probably happens on the pT7GU transczript. Slipped mispairing can also occur on a repeating tetranucleotide (Farabaugh & Miller, 1978). suggest,ing that slippage on a repeating GU is a possible event for a bound tRNA t’hat is held rigidly in t)he ribosomal P site. In any event. toeprmting probably selects against, the longer spacings when a tRNA is presented with a choice of codons, in a way that does not reflect upon the optimal spa.cing for translation. (d) Th,e ir@ue,nce of secondwy stru~ctures Secondary structures within the initiation domain have large effects on the accessibility: of the initiation codon for base-pairing with the initiator tRNA and of the Shine and Dalgarno sequence for base-pairing with the 3’ end of 16 S rRNA (de Smit & Van Duin. 1990). It has been argued that even weak structures can have big effects (Gold, 1988). Both the Shine and Dalgarno sequence and initiation codon are occluded by a secondary structure within the initiation region of early lysozyme mRNA (McPheeters et al., 1986). In agreement with in vivo translation data we could not detect any ternar.y complex formation on early lysozyme mRNA. The secondary structure is not found in late transcribed lysozyme RNA, which is translated. We detected ternary complex formation on late lysozyme mRNA. Secondary structures that control ternary complex formation and thereby translation have also been described for bacteriophage 2 S gene (Hlasi et aE., 1989). A secondary structure between initiation codon and Shine and Dalgarno sequence could also change the spacing between both of these elements as postulated for bacteriophage T4 gene 38 (Gold et al., 1981). Toeprinting on gene 38 mRNA supports the idea that the hairpin brings the Shine and Dalgarno sequence and initiation codon into close proximity. The accommodation of a hairpin between the Shine and Dalgarno sequence and the initiation codon on the 30 S subunit led to a specific model for the arrangement of the mRNA initiation domain on the 30 S subunit (Gold, 1988). can

(e) Additional

contacts required for terenry complex formation

As discussed above, the Shine and Delgarno sequemse is an important det’erminant of ternary complex formation. On partially alkaline hydrolyzed fragments of gene 38 in vitro mRNA we find the Shine and Dalgarno to be absolutely necessary for 30 S ternary complex formation. Yet. the Shine and Dalgarno sequence is not, suflicient for efficient complex formation. At, lowered 30 S and tRNA concentrations about 1 I nucleotides 5’ from t,he Shine and Datgarno sequence are needed. Tt is likely that the sequence 5’ from the Shine and Dalgarno sequence provides additional contacts to the 30 S

96

I). lttrrtz

subunit, either to t,he 16 S rRX;A or to some ribosomal protein. Data from both nuclease protection studies (Seitz, 1975) and statistical analyses of translation init’iat,ion sites (Schneider it er“ (Olins & Rangwala, 1989). Int~crestingl~, the sequence - 11 to - 2% (I’CAAA I’l’AA) of gene 32 mRNA, which is reyuired for ternary complex formation at low 30 S subunit and t RXA conc:ent’rat’iollx. is highly homologous (7 out of 9 hases) to Epsilon (liI~AA(11’1’1:A). E:psilori-like sequences rnight t)hus increase t’he binding affinity of the 30 S subunits to initiation domains. Suc+h wquenres c:ould also increase the local concentration of the Shine and Dalgarno sequence, cblose to the 3’ end of 16 S rRN.4. This is analogous to the role of the Shine and Dalgarno sequence in raising t’he Io~al wncentration of an initiat’ion &on. &we to the antiwdon of‘ a b0unt-l initiator ((!alogrro et ~1.. I !K%) \Yr t,hank IL. Traut for providing 30 S ribosomxl subunits and (‘. Gualerzi for supplying IF3. Wr also thank I). Karrick for the con&u&ion of plasmids psdZpsdl :‘A and pS1)2A-pSDl2A. I,. Green for the prepar”tion of sd and SD in viva mRNAs. and ‘I’. Schnridrr for his help with the data processing of the sc%nrtning data. This work was supported by i%lH research grant GM28685 We also thank the W. M. Keck Foundation fot their generous support of RPU’A science on t,he Boulder Campus.

References Hackendorf, C., Overbeek, G. I’., Van Boom, J. H., Van der Marel, G., Veeneman, G. & Van Duin, J. (1980). Role of 16 S RXA in ribosome messenger recognition. h’ur. J. Biochem. 110, 599-604. Brlin. D., Hedgepeth. J ., Seizer. 0. B. 8: Epstein. R. H. (1979). Temperature-sensit,ive mutation in the initiation codon of the r/lB gene of barteriophagr 76. 700-704. T4. l’ror. Nat. Amd. Sci., 1 ‘.S.d Berkhout. K.. Van der Laken, (:. *J. 8r Van Knippenberg. 1’. H. (1986). Formylmethionyl-tRNA binding to 30 S ribosomrs programmed with homopolynuc~lrot,ides and the effect, of translational initiatiott fiLetor 3. Uiochim. Biophys. Acta. 866, 144-153. Bingham. A. H. A. & Busby. S. ,J. I$:. (1987). Translation of ynlli: and vo-ordination of galactosr operon expression in Esclr~richl:a coli: effrvts of insertions and deletions in the non-translated leader sfyuf~ttw. .Wol. Microhiol. 1. I 17-l 24. Nasi. LT.. Nam. K., Hartz. I).. Gold. I,. Xr Young, R. (1989). Dual translational initiation sites control function of lambda R gene. EMRO J. 8. 3501 ~3.510. (‘alogrro. R. A.. I’ott. (‘. L.. (lanonaco. M. .4. & Cualerzi. (‘. 0. (1988). Selection of the mR?r;A translational initiation region by !Cscherickia coli ribosomes. I’roc.. iVat. Arnd. Sri., l:.S.A 85. 6467-6431.

rt al

(‘hilds.

.I.. \‘wllanwha. Stormo. (i.. (:old.

tk

Ji.. I,..

J&wric.k. I).. Sc~hnc~iclrr. ‘I’. I) T,t+nvr. >I. B (‘;tr.uthc~r.~. 51 (I 985). Itibosotnr bitrditrg sc’,~,,t’trcY’s sit,r id func.tion. In Sr~w~~cf- Spw~ficit!g if/ 7’r,rnsc,~i~,/ir,rt end Tmnslntion ((‘altwtlar. R. k (:old. I, tds). pp. :Nl 350, A2lan R. 1,iss. Kew \.ork. bit. IV. H. L+ Yan J)uitr. .J. (l!I!N)). (‘ontrol of provaryotic transl~tiotid ittit,iation by secondary structure. l’rogr. Nucl. Acid KPS. Nol.

nrRlV.\

Biol. 38, l--35. Draper. I). E. (l!)Xi). Translational sotnal proteins in I
Dunn. .J. .I.. Kuzash-l’ollert. Mulations of synthesis Sri.. /‘.S.d.

rt~gulatiotr of riljoIn 7’rotr.slrrtionrrI

coli. (Ilan.

.J.. tvl.).

Jbp. I N

E. & Studier. B. LV. (i!a78).

of’ hact(~riopttagc TS that of the gent’ 0.3 protrin. 7.5, 2741 “74.5.

a&4 /‘t-w.

init,iatiott A’ut. .-IcYI~.

Farab;tugh.

I’. .I. & Miller. .I. H, (1!)78). (:thnetic. st.uditls of thr lot rrprwsor. \‘JT. Ott thr ruolc~cular natttrc* of spontantwus hotsJ)ots tt1 f he Incl gcbne of /~‘w//rrirhitr co/i. .I. Yol. Bid. 126. X17-863. (1988). I’ost-tralisc~riJ)tiorral tqulator~/~iochf,n,, 57. mec*hanisnls in K. coli. .I ttnn. Urc

odd.

r,.

I90~23:~. I,. X: Stormo. (:. (l!M). Tti~ndati0nal initiatiotl. In hkherichio mli rrnd S~~ltttmnrllrr typhitttttriuttt (Xridhartlt. F. C’.. Ingraham. .I. I,.. I,o\z-. K. I<.. Magwanik. R _ Schawht~rr. 31. R- I’mhargvr. H. I<., rds). vol. 2. pp. 13OP 1307. Anirric3n Sovichty for Micwhiology. Washit@on. IN’. (:old 1 I j l’ribno~4, I).. Schneider, ‘I’.. Shintdling. S.. Singt>r. 1S.S. & Stortno. (: (I!#]). Translational initiation in proc*aryotw. .4 1Lr0,. Hrv. .Wirrohio/. 35. (Md.

x5- 403. Gualrrzi, (‘. & 1’011.(‘. I,. (1981). t’rotritt

I)iosyntjhrsis in mrchanistn of 30 S itrit iation c*ontplr~ format,ion in Exchrichio co/i. I tI Slrcxlurffl .4 sprta of’ Rrcogn itiott ff ttd .A swuthly itr Wiologicrrl ~~~21u~rontO[~f.tIIP.s (J%alazt)atr. I,.. Sussrnan. .I. I,.. ‘I’raul). Iv. & \‘onath. ,\.. P~H). 1)~). X05-8%6. hlnharr. bl. Iss. ptwwyotic~

c.ells:

Rrhovot Gualrrzi. C’.. Risultw kinetic, analysis

(:. Ki l’on. of thtl

(‘. I,. (1977).

Initial

ratt,

tnec.hanism of initiatiott c~omplrx formation and the role of initiation fac%ot IF-S. Iliochetttistry, 16. 1684- 1689. Guild. 1v.. (iaylr. hl.. Swrent~y. R.. Hollitr~s~~ot~t~t, ‘I’.. MotlrfT.

activation tjhv mot:1

‘I’. 8 (:oltl. I,. (19X8). ‘fratlsc.riJ)tiotral of hwtrriophagr ‘1’1 middlf~ J~t~omotc~rs Jxott~in. .J. .llol. Jliol. 199. 241 2%.

I)?

Hartz, D.. McPheeters, 1). S.. Traut, R. & Gold, 1,. (1988). Extension inhibition analysis of translation initiation complexes. Methods Enzymol. 164, 419-425. Il,artz, D., McPheeters, D. S. & Gold. I,. (1989). Selection of the initiator tRNA by Eschcrichia di initiation factors. Genes Uewel. 3. 1899-1912. Hartz, I)., Binkley, ,J.. Hollingsworth, T. & Cold, I,. (1990). Domains of initiator tRPiA and initiation codon crucial for initiator tRXA selection b> Escherichia coli IF3. Genes Devel. 4, 1790 1800. Hartz. D.. McPheeters, I>. S.. Green, I,. 62Gold. 1,. (3991). Detection of Escherichia coli ribosome binding at translation initiation sites in the absence of tRNA. J. Mol. Biol. 218. 99-105. Hui. A. & de Boer. H. A.. (1987). Specialized ribosome system: preferential translation of a single mR?JA species by a subpopulation of mutated ribosomcs in Escherichia 4762-4766.

coli.

Proc.

LVat. Acad,

Sci..

I :.$‘.A

84.

mRNA

and Translation

Katz,

E. R. & Brenner, S. (1975). Genetic map of the beginning of the rIZB cistron of bacteriophage T4. Mol. Gen. Genet. 143, 101-104. Kenney. ,J. W., Fanning. T. G.. Lambert. ,I. M. & Traut. 1~. It. (1979). The subunit interphase of the Rsch,erichin coli ribosome. Crosslinking of 30 S protein S9 to J)rot)eins of the 50 S subunit. .I. Mol. Hiol. 135. l5l-170. Krisch, H. & Allet, B. (1982). PJucleotide sequences involved in bacteriophage T4 gene 32 translational self-regulation. Proc. Nat. Acad. Sci.. C.S.A. 79. 4937-494 1. Laughrea, M. & Tam, J. (1989). Ribosomal protein Sl and initiation factor IF3 do not promote t,he ribosomal binding of w 19-nucleotide long mDNA and mRNA models. Biochem. Cell Biol. 67, 812-817. Lodixh. H. F. (l!J74). Model for the regulation of mRNA translation applied to haemoglohin synt,hrsis. LVnturr (London),

25 1, 385-388.

Lodish, H. F. (1976). Translational control of protein synthesis. Annu. Rev. Kochem. 45. SF)-SP. J,owary. P.. Sampson, ,J.. Milligan, ,J.. Groebe. D. & Ilhlenbrck. 0. c‘. (1986). A better way to make RX.4 for physical studies. In Structure and Dynamics of RX.3 (van Knippenbrrg. P. H. & Hilhers. C’. LV.. eds). pp. 6%76, Plenuln Press, New York. Mania&. T.. Fritach. E. F. & Sambrook. *J. (1982). Molrcular (‘loninq: .4 Laboratory Manual, Cold Spring Harbor Laboratory Press. (‘old Spring Harbor. ?u’f,w York. McPheeters, I>. S.. Christensen, A., Young, E. T.. Stormo, G & Gold. L. (1986). Translational regulation of expression of the bacteriophage T4 lysozyme gene. Nucl. Acids Res. 14, 5813-5826. McPhertrrs, I). S., Stormo. (:. D. & Gold, I,. (1988). The autogenous regulator\7 sit)e on t)he bacteriophage T4 gene 52 messenger RkA. J. Mol. Biol. 201. 517-535. Miller. .I. H (19X.5). Mutagenic specificity of ultraviolet light. J. .Vol. Sol. 182. 45-68. Mill&an. .J. F.. (irorbe, I). R.. Witherell. G. W. & I’hl~~nbec~k. 0. (‘. (1987). Oligoribonucleotide synthesis using ‘1‘7 RNA polymerase and synt,hetic. I)NA templates. I%&. Arids Res. 15, 8783-8798. Olins. I’. 0. & Rangwala. S. H. (1989). A novel sequencr element derived from I)actrriophage Ti mRlVA acts as an rnhanc,ctr of t)ranslation of the 1acZ gene in fhdtrrichin di. ,J. Rioi. (‘hem. 264, l6973- 16976. I’ribnow. I).. Sipurdson. I). (‘.. (iold. L.. Singer. R. S.. Napoli. (‘.. Krosius. ,I.. I)ull, T. -1. & Noller, H. ( 1981). rll cistrons of bacteriophage T4. DNA sequence around the intercistronic dividr and positions of grnrtica landmarks. .J. Xol. Biol. 149. SRi-A76

Ra?.

I’. IX. B Pearson, M. L. (1975). Functional inactivation of bacteriophage 1 morphogenetic genr m Rh-A. Saturr (London), 253, 647-650. Sadlrr. .J. R., Tccklrnburg, M. & Betz, J. (1980). Plasmids containing many tandem copies of a synthetic lactose operator. Grnr. 8, 279%:X)0. Sampson. 1,. I,.. Hendrix. R). W.. Huang. IV. M. & (‘asjrns. S. R. ( 1988). Translation initiation cont)rols the relative rates of expression of the bacteriophage 1 Iatc grnt’s. /‘/WC. ,l’nt. :Icfld. sci.. I’.,S..1_ 85, 5439m 5443. Schaefer. E. M.. Hartz. I)., Gold, 1,. bz Simoni. R. I). ( 1!)89). Ribosomr binding sites and REz4 processing sitrs in the transcript of the uric operon of Eacherichio co/i. .I. Barfuriol. 171. 3901-3908. Ed&d

by I’.

Initiation

97

S(*hnrider. 7’. J).. Stormo, (:. I). K- (:old. 1,. (l!J86). Tnfnrmation content of binding sites on nucleotidr st~qurncrs. J. Mol. Biol. 188. 41.5-131. Shcpard, H. M.. Y&&on, E. & (~oeddel. I). (l!W). Increased synthesis in E. roli of tibroblnst and leukocyte interferons through ait,erations in ribosomc) binding sites. IjNA. 1. I%.!-131. Shine. ,I. & Dalgarno. 1,. (1974). The 3’-terminal sequence of’ ltkch~erichia coli 16s ribosomal RNA: caomplemrntarity to nonsense triplets and ribosomr binding sites. I’ror. Sat. Acad. Sri., I’.S.A. 71. 1342 1346. Shinedling. S., (iayle. M.. Pribnow. I). Kr (:old. I,. (1987~). Mutat,ions affecting translat,ion of thr I)acteriophagr TI rJIB gene cloned in Eachrrirhin voli. Mol. f/e,,. &net.

207.

?P4-%Z.

Shinetiling. S.. Singer. K. S.. Gaylr, >I.. f’rihnow. I’.. .J;trvis. E.. Edgar, B. & Gold. I,. (19X7/~). Sequences and studies of bacteriophage 7’4 r/I mut,ants. .J. Mol. 195. J’il-180. Biol. Singer, K. S.. (iold. I,.. Shinedling. S. ‘I’.. (‘olkitt. M.. Hunter. I,. R.. Pribnow. D. 8r r\‘rlson. >I. A. (1981). Analysis ir/ r?i,.oof translat,ional mutants of t,he rJIH c*ist,ron of l,ac+eriophage T1. ./. .llo/. Hiol. 149. 4 G432. St,eit,z. ,J. A. (1!)75). Ribosomr recognition of initiator regions in the RN,4 bact,eriophage genomta. In ZZN4 P/Laps (Zinder, N. I).. rd.). pp. 319-352, (‘old Spring Harbor Laboratory Press, Cold Spring Harbor. NY. Stclitz. .J. A.. Wahba. A. .I.. Laughrea, SI. & Moore. I’. (I X7). Differential requirrmrnts for polyprptide cshain initiat,ion complex formation at th(s three hactrriophapt~ RI7 init,iator region<. .Yu~/ .-lrif/s /Irs. 4. l-15. Storms. (:. I). (1986). Translation initiation. Tn Mo.rimizing Gene Eqpression (Reznikoff. \V. & (iold, I,.. eds). pp. 195-224, Butterworth. Rost,oir. Storms. (:. I).. Schneider, T. I). xi (:oltl, I,. (1982). (“haractrrization of translational initiation sites in E. coli. ,Vucl. Acid.3 RPS. 10. 2971-1996. Tuerk. C.. Gauss, P., Thermes, (‘., (:rorbta. D. R., Gayle. M.. Guild. N., Rtormo. (i.. J)‘.\ubentonCarafa, Y., Uhlenbeck, 0. (1.. Tinoco, I., ,Jr. Brady, E. h-. & Gold, L. (1988). CUUCGG hairpins: extraordinarily stable RXA secondary structures associated with various biochemical processes. Prof. ivat. Acad. Sri., U.S.A. 85, 1364- 1368. Van Dieijen, G.. Zipori, P.. Lran Prooijrn. W. & Van J)uin, .J. (1978). Involvemrnt oi‘ ribosomal protein Sl in the assembly of the initiat,ion complex. Eur.

J.

Biochem.

90.

,571.-580.

Van Duin. .I.. Overbeek. G. I’. & I
.Vnl.

Arnd.

Sci..

1 :.S.A.

84,

78%

78%.

Il’intermeyer.

1V. & Gualerzi. (‘. (1983). Effect of Ir:sc.hrrichicl co/i initiation factors 011 the kineticas of .\‘-.~c~I’hr-tR,?jAPhe binding to 30 S ribosomal subunits. :I fuorescrner stop~~e~l-flo~~~ study. Ricvhrnt

isfry,

22.

690-691.

U’ooti, i‘. I<.. 130s~.M. A.. Pate], T. I’. & h:mtag,rr, .I. S. (19X-C). The influence of messenger RXA srcondar) structure on rxpression of an immurroglobulin hoav! c.hain in E.srhmirhin co/i. .Vur/. =Irir/.u IZrs. 12. 3!X+7m :wio. van

Ilipyl