Influence of postbiotic RG14 and inulin combination on cecal microbiota, organic acid concentration, and cytokine expression in broiler chickens

Influence of postbiotic RG14 and inulin combination on cecal microbiota, organic acid concentration, and cytokine expression in broiler chickens K. Y. Kareem,∗,† T. C. Loh,∗,‡,1 H. L. Foo,§,# S. A. Asmara,∗ and H. Akit∗ ∗

Department of Animal Science, Faculty of Agriculture, Universiti Putra Malaysia; † Department of Animal Resource, University of Salah al- Din, Erbil, Iraq; ‡ Institute of Tropical Agriculture, Universiti Putra Malaysia; § Department of Bioprocess Technology, Faculty of Biotechnology and Biomolecular Sciences, Universiti Putra Malaysia; and # Institute of Bioscience, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor, Malaysia

Key words: postbiotic RG14, inulin, bacteria, cytokine expression, broiler chickens 2016 Poultry Science 0:1–10 http://dx.doi.org/10.3382/ps/pew362

INTRODUCTION

and morphology, modulate the immune responses, offer protection from luminal pathogens, as well as aid digestion and utilization of the nutrients (Rinttil¨ a and Apajalahti, 2013; Sugiharto, 2014). In recent times, several feed additives have been applied to replace the use of antibiotic as growth promoters and the most recent of these additives are prebiotics, probiotics, synbiotics, and postbiotics (Loh et al., 2014; Sugiharto, 2014). Prebiotics (inulin) are non-digestible feed ingredients capable of stimulating the activity and growth of native beneficial bacteria in the gastrointestinal tract and eliminating the pathogenic ones (Alloui et al., 2013). They have shown promise in controlling pathogens such as Escherichia coli and Salmonella and in stimulating the growth of Bifidobacteria and Lactobacilli, thus promoting health and performance of animals (Jung et al., 2008; Boguslawska-Tryk et al., 2012). Inulin has been recognized as a potent substitute for antibiotics (Rebole et al., 2010). Probiotics are defined as live bacteria, which when administered in sufficient amounts, exert

For many decades, the poultry industry has benefited from improved health and performance of birds due to inclusion of sub-therapeutic levels of antibiotics in feeds. However, several countries have prohibited, or are in the process of prohibiting, non-therapeutic uses of antibiotics in poultry (Awad et al., 2009). This is necessitated by the need to prevent the development of antibiotic resistant strains of bacteria that may pose a threat to human health (Ajuwon, 2015). Hence, alternatives to antibiotics are needed in the poultry industry to maintain the gut health and promote the performance of birds. Of the factors that may be responsible for the gut health and performance of chickens, commensal microbiota in the gut seem to have pivotal roles as they may help to direct the development of gut structure  C 2016 Poultry Science Association Inc. Received June 6, 2016. Accepted August 28, 2016. 1 Corresponding author: [email protected]

1

Downloaded from http://ps.oxfordjournals.org/ at Ryerson University on October 8, 2016

cecum total bacteria and Bifidobacteria compared to the NC birds. Diet had no effect on cecum Lactobacilli, Enterococcus and Salmonella. The NC birds had higher (P < 0.05) Enterobacteria and E. coli than other treatments. Concentration of acetic acid was higher in birds fed PC, T1, and T4 compared to the NC birds. However, the concentration of butyric acid, propionic acid, and total VFA did not differ (P > 0.05) among diets. The NC birds had higher (P < 0.05) expression of interferon (IFN) and Lipopolysaccharide-induced tumor necrosis factor-alpha factor (LITAF) gene compared with those fed other diets. The mRNA expression of interluken-6 (IL-6) was up-regulated in birds fed T3 and T4 compared to the NC birds. However, the expression of interluken-8 (IL-8) gene was not influenced by diet. Postbiotic and inulin combinations are potential replacements for antibiotic growth promoters in the poultry industry.

ABSTRACT This study examined the effects of different combinations of inulin and postbiotics RG14 on growth performance, cecal microbiota, volatile fatty acids (VFA), and ileal cytokine expression in broiler chickens. Two-hundred-and sixteen, one-day-old chicks were allocated into 6 treatment groups, namely, a basal diet (negative control, NC), basal diet + neomycin and oxytetracycline (positive control, PC), T1 = basal diet + 0.15% postbiotic RG14 + 1.0% inulin, T2 = basal diet + 0.3% postbiotic RG14 + 1.0% inulin, T3 = basal diet + 0.45% postbiotic RG14 + 1.0% inulin, and T4 = basal diet + 0.6% postbiotic RG14 + 1.0% inulin, and fed for 6 weeks. The results showed that birds fed T1 and T3 diets had higher (P < 0.05) final body weight and total weight gain than NC and PC birds. A lower (P < 0.05) feed conversion ratio was observed in birds fed T1 and T2 compared with those fed the NC diet. Birds fed PC, T1, T2, and T3 had higher (P < 0.05)

2

KAREEM ET AL.

MATERIALS AND METHODS Postbiotics and Inulin The stock culture of Lactobacillus plantarum RG14 was prepared as described by Kareem et al. (2016). The inulin (Frutafit IQ) was provided by Connell Bros. Company (Malaysia) Sdn. Bhd.

Animals and Experimental Design Two-hundred-and-sixteen one-day-old (COBB 500) chicks were purchased from a commercial hatchery. The broiler chicks were allotted into 6 treatment groups. Each group had 6 replicates while each replicate had 6 birds. The treatment groups included basal diet (NC), basal diet + neomycin and oxytetracycline (PC), T1 = basal diet + 0.15% postbiotic RG14 + 1.0% inulin, T2 = basal diet + 0.3% postbiotic RG14 + 1.0% inulin, T3 = basal diet + 0.45% postbiotic RG14 + 1.0% inulin, and T4 = basal diet + 0.6% postbiotic RG14 + 1.0%

inulin. To our knowledge, the 1.0% inulin was chosen based on our previous research (Kareem et al., 2016). Water and feed were offered ad libitum to the birds until 42 d of age. Starter and finisher diets (Tables 1 and 2) were offered from d zero to 21 and d 22 until 42 d of age, respectively. The experimental animals received humane care as outlined and approved by the Institutional Animal Care and Use Committee for the Care and Use of Animals for Scientific Purposes (Research Policy, University Putra Malaysia).

Samples and Data Collection Birds were weighed individually and the body weight (BW), body weight gain (BWG), feed intake (FI), and the feed conversion ratio (FCR) were recorded weekly. At wk 6, 12 broiler chickens were randomly selected from each treatment group and slaughtered for sampling of cecum digesta and ileal tissue.

Quantitative Real-time PCR Sample Preparation. Cecal digesta samples were aseptically collected immediately after slaughter. The cecal digesta were kept frozen at −20◦ C until microbiota analysis.

Genomic Cecal DNA Extraction Bacterial quantification was conducted following the method of Navidshad et al. (2012). The DNA was isolated from cecal digesta samples by QIAamp DNA stool kit (Qiagen, Hilden, Germany) following the manufacturer’s procedure. Approximately 200 mg of cecal digesta were transferred into 2 mL of sterile microcentrifuge tube. One mL of InhibitEX Buffer provided in the kit was then added to the cecal sample and thoroughly homogenized using a vortex. The suspension was heated for 5 min at 95◦ C then vortexed for 15 seconds. Samples were centrifuged for one min to pellet stool particles. Thereafter, 15 μL Proteinase K were added into a new 1.5 mL micro-centrifuge tube; 200 μL supernatant and 200 μL buffer AL were added and vortexed for 15 seconds. The solution was incubated at 70◦ C for 10 minutes. Thereafter, the DNA was precipitated by adding 200 μL of ethanol, captured in a QIAamp spin column, washed by 500 μL of AW1 buffers, and followed by buffer AW2. Finally, the DNA was eluted in 50 μL buffer ATE. The extracted DNA was kept at −20◦ C until qPCR analysis.

Analysis of Cecal Bacteria by Quantitative Real-time PCR The populations of total bacteria, Lactobacillus, Enterococcus, Enterobacteria, E. coli, Bifidobacteria, and

Downloaded from http://ps.oxfordjournals.org/ at Ryerson University on October 8, 2016

beneficial effects on the gastrointestinal tract (Howarth and Wang, 2013). Probiotics may modulate the immune system through enhancement of phagocytosis and proliferation of immune cells such as macrophages and monocytes (Novak and Vetvicka, 2009). Moreover, probiotic bacteria have been shown to induce epithelial cell expression of IL-6 and IL-10, which potentiate IgA production through B-cell maturation (Shang et al., 2008). Schultz et al. reported that L. plantarum leads to reduced expression of pro-inflammatory cytokines such as IL-1β , TNF-α, and IFN. In spite of the beneficial effects of probiotics, the major problem with their application is that some probiotics have antibiotic resistance genes, especially those encoded by plasmids that can be transferred between organisms (Marteau and Shanahan, 2003). As a consequence, probiotics might not be used anymore in the near future. As a substitute for probiotics, metabolite products synthesized from probiotics known as postbiotics could be used. Postbiotics have been shown to have many beneficial probiotic effects on growth performances and particularly in the gut health when used as an additive in animal diets (Thanh et al., 2009; Thu et al., 2010; Loh et al., 2014). In spite of the roles of prebiotics and postbiotics on growth performance, intestinal microbial ecology, and cytokine expression in broiler chickens, there is a paucity of information on the possible synergistic effects of the combination of postbiotics and prebiotics on growth performance, gut microbiota, and cytokine expression in broiler chickens. Thus, the objective of this study was to examine the influence of a combination of inulin and postbiotics on growth performance, cecal bacterial population, volatile fatty acids, and ileal cytokine expression in broiler chickens.

3

COMBINATION OF POSTBIOTIC RG14 AND INULIN IN BROILER DIETS Table 1. Compositions and nutrient contents of starter diets. Dietary treatment∗ NC

PC

T1

T2

T3

T4

Yellow Corn Soybean meal Wheat pollard CPO Fish meal (55%) L-Lysine DL-Methionine Monodicalcium phosphate21 Calcium carbonate Choline chloride Salt Mineral premix§ Vitamin premix¶ Antioxidant† Toxin binder‡ Antibiotic postbiotic RG14 Inulin Total Calculated nutrient content (g/kg)∗∗ Crude protein (%) ME1 (MJ/Kg) Crude fiber (%) Arginine (%) Lysine (%)

50.00 29.45 7.41 3.08 7.45 0.10 0.20 1.00 0.70 0.06 0.25 0.10 0.06 0.01 0.14

50.00 29.45 7.40 3.08 7.45 0.10 0.20 1.00 0.70 0.06 0.25 0.10 0.06 0.01 0.14 0.01

50.00 29.43 5.72 3.36 7.60 0.25 0.20 1.00 0.68 0.06 0.25 0.10 0.06 0.01 0.14

50.00 29.56 5.43 3.40 7.58 0.25 0.20 1.00 0.68 0.06 0.25 0.10 0.06 0.01 0.14

50.00 29.63 5.17 3.44 7.58 0.25 0.20 1.00 0.68 0.06 0.25 0.10 0.06 0.01 0.14

50.20 29.72 4.72 3.44 7.58 0.25 0.20 1.00 0.68 0.06 0.25 0.10 0.06 0.01 0.14

0.15 1.00 100

0.30 1.00 100

0.45 1.00 100

0.60 1.00 100

21.93 12.83 3.82 1.44 1.34

21.93 12.83 3.81 1.44 1.34

21.93 12.83 3.80 1.44 1.34

21.93 12.83 3.77 1.44 1.34

100 21.93 12.83 3.95 1.43 1.32

100 21.93 12.83 3.95 1.43 1.32

∗ NC: (basal diet), PC: (basal diet+ neomycin and oxytetracycline), T1: (0.15% RG14+1.0% inulin), T2: (0.3% RG14+1.0% inulin), T3: (0.45% RG14+1.0% inulin), T4: (0.6% RG14+1.0% inulin). § Mineral mix contains Fe 100 mg, Mn 110 mg, Cu 20 mg, Zn 100 mg, I 2 mg, Se 0.2 mg, Co 0.6 mg. ¶ Vitamin premix contains retinol 2 mg, cholicalciferol 0.03 mg, α -tocopherol 0.02 mg, menadione 1.33 mg, cobalamin 0.03 mg, thiamine 0.83 mg, riboflavin 2 mg, folic acid 0.33 mg, biotin 0.03 mg, panthothenic acid 3.75 mg, niacin 23.3 mg, pyridoxine 1.33 mg. † Antioxidant contains butylated hydroxyanisole (BHA). ‡ Toxin binder contains natural hydrated sodium calcium aluminum silicates. 1 Metabolizable energy. ∗∗ The diets were formulated using feed live international software (Thailand).

Salmonella spp. of cecal digesta were analyzed by qPCR. Genomic DNA from cecal digesta was used as templates for PCR amplification. Absolute quantification of cecal bacteria was achieved by using standard curves constructed by amplification of the known amount of target bacteria DNA. The qPCR master mix was prepared on a total volume of 25 μL using R the QuantiNovaTM SYBR Green PCR kit (Cat. no. 208052, Qiagen, Hilden, Germany) consisting of 12.5 μL of 2 × SYBR Green Master Mix, one μL of 10 μM forward primer, one μL of 10 μM reverse primer, 2 μL of DNA samples, and 8.5 μL of RNase-free water for each reaction. Each sample was analyzed with 4 replication reactions. The targeted cecal bacteria groups, primer sequences, annealing temperature, and literature references in this study are detailed in Table 3. The qPCR assay was performed with the BioRad CFX96 real-time PCR system (BioRad, Hercules, California) using optical grade plates as follows: The qPCR cycling conditions comprised an initial denaturation at 94◦ C for 5 min, followed by 40 cycles of denaturation at 94◦ C for 20 s, primer annealing at 55◦ C for total bacteria and Salmonella spp., 58◦ C for Lactobacilli, 60◦ C for Bifidobacteria, E. coli, Enterococcus, and Enterobacteria for 30 s, respectively, and extension at 72◦ C for 20 s (Navidshad et al., 2012).

Determination of Volatile Fatty Acid The volatile fatty acid (VFA) concentration in the feces was determined using a modified method described by Thanh et al. (2009). One g of feces was measured from each sample and stored at −20◦ C. Following that, one mL of 24% metaphosphoric acid was added, which was diluted in 1.5 M sulphuric acid (BDH Laboratories, Poole, UK). The mixture was stored overnight at room temperature and then centrifuged at 10,000 × g for 20 min at 4◦ C. The supernatant was collected and kept in a 1.5 mL screwcapped vial (Kimble Glass Inc., Rochester, NY). The internal standard 20 mM 4-methyl-valeric acid (Sigma Chemical Co., St. Louis, MO) was consistently added to the supernatant to make up 10 mM and stored at −20◦ C. The separation of VFA was performed on a Quadrex 007 Series (Quadrex Corp., New Haven, CT). A bonded phase fused silica capillary column (15 m, 0.32 mm ID, 0.25 mm film thickness) was used in a chromatograph, 6890 N (Hewlett-Packard, Avondale, PA) equipped with a flame ionization detector. Purified nitrogen was the carrier gas at a flow rate of 60 mL/min. The injector and detector temperature was set at 230◦ C. The column temperature was set at 200◦ C. For identification of sample peaks, the

Downloaded from http://ps.oxfordjournals.org/ at Ryerson University on October 8, 2016

Ingredients

4

KAREEM ET AL. Table 2. Compositions and nutrient contents of finisher diets. Dietary treatment∗ NC

PC

T1

T2

T3

T4

Yellow Corn Soybean meal Wheat pollard CPO Fish meal (55%) L-Lysine DL-Methionine Monodicalcium phosphate21 Calcium carbonate Choline chloride Salt Mineral premix§ Vitamin premix¶ Antioxidant† Toxin binder‡ Antibiotic postbiotic RG14 Inulin Total

54.70 29.10 5.73 3.44 3.58 0.19 0.20 1.24 1.22 0.05 0.25 0.10 0.06 0.01 0.15

54.69 29.10 5.72 3.44 3.58 0.19 0.20 1.24 1.22 0.05 0.25 0.10 0.06 0.01 0.15 0.01

54.70 29.21 3.63 3.77 3.88 0.25 0.20 1.35 1.24 0.06 0.25 0.10 0.06 0.01 0.15

54.69 29.28 3.31 3.82 3.91 0.25 0.20 1.37 1.25 0.06 0.25 0.10 0.06 0.01 0.15

54.80 29.37 2.99 3.83 3.89 0.25 0.20 1.35 1.25 0.06 0.25 0.10 0.06 0.01 0.15

54.85 29.41 2.78 3.85 3.90 0.25 0.20 1.30 1.25 0.06 0.25 0.10 0.06 0.01 0.15

0.15 1.00 100

0.30 1.00 100

0.45 1.00 100

0.60 1.00 100

19.89 12.98 3.73 1.31 1.28

19.89 12.98 3.71 1.32 1.29

19.89 12.98 3.69 1.32 1.29

19.89 12.98 3.68 1.32 1.29

100

Calculated nutrient content (g/kg)∗∗ Crude protein (%) 19.89 12.98 ME1 (MJ/Kg) Crude fiber (%) 3.88 Arginine (%) 1.30 Lysine (%) 1.22

100 19.89 12.98 3.88 1.30 1.25

∗ NC: (basal diet), PC: (basal diet+ neomycin and oxytetracycline), T1: (0.15% RG14+1.0% inulin), T2: (0.3% RG14+1.0% inulin), T3: (0.45% RG14+1.0% inulin), T4: (0.6% RG14+1.0% inulin). § Mineral mix contains Fe 100 mg, Mn 110 mg, Cu 20 mg, Zn 100 mg, I 2 mg, Se 0.2 mg, Co 0.6 mg. ¶ Vitamin premix contains retinol 2 mg, cholicalciferol 0.03 mg, α -tocopherol 0.02 mg, menadione 1.33 mg, cobalamin 0.03 mg, thiamine 0.83 mg, riboflavin 2 mg, folic acid 0.33 mg, biotin 0.03 mg, panthothenic acid 3.75 mg, niacin 23.3 mg, pyridoxine 1.33 mg. † Antioxidant contains BHA. ‡ Toxin binder contains natural hydrated sodium calcium aluminum silicates. 1 Metabolizable energy. ∗∗ The diets were formulated using feed live international software (Thailand).

Table 3. Sequence of primers used targeting total bacteria, Lactobacillus, Bifidobacteria, Enterococcus, Enterobacteria, E.coli, and Salmonella. Target bacteria

Sequence 5 -3

Annealing temperature (◦ C)

References

Total bacteria

F-CGGCAACGAGCGCAACCC R CCATTGTAGCACGTGTGTTAGCC F-CATCCAGTGCAAACCTAAGAG R GATCCGCTTGCCTTCGCA F-GGGTGGTAATGCCGGATG R TAAGCCATGGACTTTCACACC F-CCCTTATTGTTAGTTGCCATCATT R ACTCGTTGTACTTCCCATTGT F-CATTGACGTTACCCGCAGAAGAAGC R CTCTACGAGACTCAAGCTTGC F-GTGTGATATCTACCCGCTTCGC R AGAACGCTTTGTGGTTAATCAGGA F-TCGTCATTCCATTACCTACC R AAACGTTGAAAAACTGAGGA

55

Faseleh Jahromi et al. (2013)

58

Wang et al. (1996)

60

Bartosch et al. (2004)

60

Navidshad et al. (2012)

60

Navidshad et al. (2012)

60

Frahm and Obst (2003)

55

Nam et al. (2005)

Lactobacilli Bifidobacteria Enterococcus Enterobacteria E.coli Salmonella

commercial standards of 20 mM acetic and 10 mM each of propionic, butyric, isobutyric, valeric, isovaleric, and 4-methyl-valeric acids were used as external standards.

RNA Isolation and Real-time RT-PCR Immediately after slaughtering the chickens, the ileum samples were quickly excised and snap-frozen in liquid nitrogen and stored at −80◦ C until RNA extrac-

tion. Total RNA was extracted from 30 mg of frozen R Mini Kit (Cat. No. 74104, Qitissue using the RNeasy agen, Hilden, Germany) and DNase digestion was completed during RNA purification using the RNase-Free DNase set (Qiagen, Hilden, Germany) according to the manufacturer’s procedure. Total RNA purity was determined by the 260/280 nm ratio of absorbance readings using NanoDrop ND-1000 UV-Vis Spectrophotometer (NanoDrop Technologies, Wilmington, DE). Purified

Downloaded from http://ps.oxfordjournals.org/ at Ryerson University on October 8, 2016

Ingredients

COMBINATION OF POSTBIOTIC RG14 AND INULIN IN BROILER DIETS

Statistical Analysis The experiment followed a completely randomized design. The data were analyzed using the General Linear Model (PROC GLM) of the Statistical Analysis System, computer software version 9.4 (SAS Institute, Inc., 2014). Means were separated by the Duncan multiple range test at a significance level of P < 0.05. Orthogonal polynomial contrasts were used to test the linear or quadratic nature of the response to incremental concentrations of postbiotic RG14. The statistical model for the experiment is stated below: Yijk = μ + Tij + Eijk where, Yijk = dependent variable; μ = general mean; Tij = effect of dietary treatment; and Eijk = experimental error.

RESULTS Growth Performance Table 4 shows the growth performance characteristics of birds fed diets containing different levels of postbiotic and inulin combination. Birds fed T1 and T3 had higher (P < 0.05) final BW and total BWG than the negative and positive controls. There was no significant difference (P > 0.05) among the treatments for FI. A lower (P < 0.05) FCR was observed in birds fed T1 and T2 compared with those fed the NC diet. The FCR of birds fed NC, positive control, T3, and T4 diets did not differ (P < 0.05).

Microbial Population The influence of dietary postbiotic and inulin combinations on cecal microbiota of broiler chickens is presented in Table 5. Supplementation of postbiotic and inulin combination in the diets increased (P < 0.05) the population of total bacteria. The positive control, T1, T2, and T3 had higher (P < 0.05) total bacteria compared to the negative control. The population of total bacteria in birds fed T4 was similar (P > 0.05) to those fed the negative control diet. The supplementation of postbiotic and inulin combination did not affect the population of Lactobacilli and Enterococcus in the cecum. Birds fed T1 and T2 had a higher (P < 0.05) population of Bifidobacteria compared to those fed negative control and positive control diets. The population of Enterobacteria was lower (P < 0.05) in birds fed positive control, T1, T2, T3, and T4 diets compared with those fed the negative control diet. Birds fed T2 had a lower (P < 0.05) population of Enterobacteria compared with those fed the positive control diet. Birds fed a combination of different levels of postbiotic and inulin significantly decreased (P < 0.05) E. coli in comparison with negative and positive control groups. In addition, birds fed diets with T1 and T4 had a lower (P < 0.05) population of E. coli compared with birds fed T2 and T3. Diet had no effect (P > 0.05) on the population of Salmonella.

Volatile Fatty Acids The effects of feeding different levels of postbiotic and inulin combination on acetic acid, propionic acid, butyric acid, and total VFA in cecal digesta of broiler chickens are presented in Table 6. The acetic acid was significantly (P < 0.05) higher in birds fed positive control, T1, and T4 diests compared to those fed the negative control. However, the concentration of butyric acid, propionic acid, and total VFA did not differ (P > 0.05) among diets.

Downloaded from http://ps.oxfordjournals.org/ at Ryerson University on October 8, 2016

total RNA (one μg) was reverse transcribed using a R reverse transcription kit (Qiagen, Hilden, Quantitect Germany) in accordance with the manufacturer’s recommended procedure. Real-time PCR was performed with the Bio-Rad CFX96 Touch (Bio-Rad Laboratories, Hercules, CA) R using optical grade plates using QuantiNovaTM SYBR Green PCR kit (Cat. no. 208052, Qiagen, Hilden, Germany). The β -actin was used as the reference gene to normalize the tested genes. Real- time RT qPCR analyses were done using QuantiTect Primer Assay (200) IL8 (QT00600446), IL6 (QT00590205), IFN (QT00599928), LITAF (QT00596106), and B-actin (QT00600614). Each reaction (20 μl) contained 10 μl SYBR green PCR mix, one μl cDNA, 2 μl of primer, and 7 μl RNase free water. Target genes were amplified through the following thermo cycling program: 95◦ C for 2 min, 40 PCR cycles at 95◦ C for 5 s, and 60◦ C for 15 seconds. Efficiency of amplification was determined for each primer pair using serial dilutions of cDNA. The cycle numbers at which amplified DNA samples exceeded a computer generated fluorescence threshold level were normalized and compared to determine relative gene expression. Higher cycle number values indicated lower initial concentrations of cDNA, and thus lower levels of mRNA expression. Each sample was run in duplicates, and averaged duplicates were used to assign cycle threshold (CT) values. The ΔCT values were generated by subtracting experimental CT values from the CT values for β -actin targets amplified with each sample. The group with the highest means ΔCT value (lowest gene expression) per amplified gene target was set to zero and the mean ΔCT values of the other groups were set relative to this calibrator (ΔΔCT). The ΔΔCT values were calculated as powers of (2−ΔΔCT ), to account for the exponential doubling of the PCR (Livak and Schmittgen, 2001).

5

6

KAREEM ET AL. Table 4. Effects of different levels of postbiotic and inulin combination on BW, BWG, FI, and FCR on broiler chickens. Dietary treatments1

Initial BW

BW (g)

BWG (g)

FI (g)

FCR (g:g)

48.81 46.86 48.22 47.5 46.81 47.61 0.28 NS NS

2068.82b 2093.86b 2239.54a 2167.82a,b 2234.96a 2105.93b 14.28 NS ∗

2020.46b 2047.36b 2190.29a 2120.11a,b 2188.25a 2058.39b 14.26 NS ∗

3772 3802.61 3877.72 3752.94 3925.39 3882.78 23.51 NS NS

1.89a 1.86a,b 1.77b 1.77b 1.80a,b 1.88a 0.01 NS ∗

NC PC T1 T2 T3 T4 SEM2 Linear3 Quadratic

Means with different superscripts in the same column are differ significantly (P < 0.05). NC: basal diet feed, PC: basal diet feed+ neomycin and oxytetracycline, T1: (0.15% RG14+1.0% inulin), T2: (0.3% RG14+1.0% inulin), T3: (0.45% RG14+1.0% inulin), T4: (0.6% RG14+1.0% inulin). 2 SEM: standard error of the means (pooled). 3 Linear or quadratic response estimated using orthogonal polynomial contrasts (NS: non-significant; ∗ P < 0.05). a,b 1

Dietary treatments1 NC PC T1 T2 T3 T4 SEM2 Linear3 Quadratic

Total bacteria

Lactobacillus

c

9.40 9.73a,b 9.89a,b 9.85a,b 9.96a 9.64b,c 0.04 ∗ ∗∗

8.26 8.27 8.38 8.26 8.21 8.17 0.03 NS NS

Bifidobacteria c

5.46 5.55c 6.16a,b 6.38a 5.79b,c 5.73c 0.06 ∗ ∗∗

Enterococcus 7.22 7.44 8.14 7.95 8.66 7.13 0.18 NS ∗

Enterobacteria a

6.23 5.33c,d 5.65b,c 5.74b 5.26d 5.42b,c,d 0.06 ∗∗ NS

E. coli 7.23a 7.22a 5.73c 6.48b 6.34b 5.22d 0.10 ∗∗ NS

Means with different superscripts in the same column differ significantly (P < 0.05). NC: basal diet feed, PC: basal diet feed+ neomycin and oxytetracycline, T1: (0.15% RG14+1.0% inulin), T2: (0.3% RG14+1.0% inulin), T3: (0.45% RG14+1.0% inulin), T4: (0.6% RG14+1.0% nulin). 2 SEM: standard error of the means (pooled). 3 Linear or quadratic response estimated using orthogonal polynomial contrasts (NS: non-significant; ∗ P < 0.05; ∗∗ P < 0.01). a,b,c,d 1

Table 6. Cecal digesta VFA (mM) in broiler chickens fed with different levels of postbiotic and inulin. Dietary treatments1

Acetic

Propionic

Butyric

Total

NC PC T1 T2 T3 T4 SEM2 Linear3 Quadratic

53.74b 62.25a 64.04a 57.71a,b 56.16a,b 62.96a 1.59 0.33 0.61

22.41 25.45 25.15 20.88 19.61 21.63 0.76 0.09 0.58

3.88 4.23 3.78 2.98 4.26 2.69 0.24 0.17 0.6

80.02 91.93 92.96 81.57 80.02 87.28 2.26 0.97 0.56

a,b Means with different superscripts in the same column are differ significantly (P < 0.05). 1 NC: basal diet feed, PC: basal diet feed+ neomycin and oxytetracycline, T1: (0.15% RG14+1.0% inulin), T2: (0.3% RG14+1.0% inulin), T3: (0.45% RG14+1.0% inulin), T4: (0.6% RG14+1.0% inulin). 2 SEM: standard error of the means (pooled). 3 Linear or quadratic response estimated using orthogonal polynomial contrasts (NS: non-significant; ∗ P < 0.05).

Ileal mRNA Expression The influence of different levels of postbiotic and inulin combination on cytokine expression in broiler chickens is shown in Figure 1. The inflammatory cy-

tokines LITAF, IL-8, and IFN had similar trends of expression. The mRNA of interleukins LITAF and IFN were significantly (P < 0.05) down-regulated in birds fed positive control and a combination of postbiotic and inulin. The mRNA expression of IL-6 was up-regulated in birds fed a combination of postbiotic and inulin. Birds fed T3 and T4 increased (P < 0.05) the expression of IL-6 gene compared to those fed the control diets. Conversely, the negative control birds had higher (P < 0.05) expression of IFN and LITAF gene compared with those fed other diets. The expression of IL-8 gene was not influenced (P > 0.05) by diet.

DISCUSSION Growth Performance Dietary supplementation of a combination of inulin and postbiotics improved growth performance and feed efficiency in broiler chickens. This observation could be attributed to the organic acids, bacteriocins, hydrogen peroxide, and vitamins produced by the postbiotics and inulin that help to modulate gut health (Ibrahim and Desouky, 2009). Moreover, it was observed in a

Downloaded from http://ps.oxfordjournals.org/ at Ryerson University on October 8, 2016

Table 5. Effect of different levels of postbiotic and inulin combination on cecal microbial population (log10 of copy number/g DNA extract) of broiler chickens.

COMBINATION OF POSTBIOTIC RG14 AND INULIN IN BROILER DIETS

7

Figure 1. Effect of different levels of postbiotic and inulin on expression of IL-6, IL-8, IFN, and LITAF in the ileal tissue. Treatments: 1 NC: basal diet feed, PC: basal diet feed+ neomycin and oxytetracycline, T1: (0.15% RG14+1.0% inulin), T2: (0.3% RG14+1.0% inulin), T3: (0.45% RG14+1.0% inulin), T4: (0.6% RG14+1.0% inulin). Bars with no common letter differ significantly (P < 0.05).

Microbial Population The current study highlights the effects of postbiotic and inulin combination on the intestinal microbiota of broilers. Postbiotic and inulin combination increased the population of total bacteria and beneficial bacteria and decreased the population of pathogenic bacteria in the cecal digesta of broiler chickens. This observation

could be due to the increased production of acetic acid, which decreases gut pH thereby modulating gut microbiota. The current observations corroborate those of Kim et al. (2011) who observed that feeding 0.25% FOS and 0.05% MOS increased the diversity and populations of total bacteria and Lactobacilli, and decreased the populations of E. coli and C. perfringens in the ileum of broilers. In addition, Chen et al. (2014) confirmed that the extract of palm kernel expeller (PKE) contained a mixture of monosaccharides (including mannose) and oligosaccharides (mainly mannobiose), which can modulate gut microbiota, particularly reducing pathogenic bacteria, such as E. coli, in rats. Choe et al. (2012) also reported that the inclusion of 0.6% liquid metabolite combinations, produced from three L. plantarum strains, increased the fecal lactic acid bacteria population, and reduced the fecal pH and Enterobacteria population in laying hens. In contrast, Suo et al. (2015) observed that xylo-oligosaccharides supplementation did not influence cecal microbiota, lactic acid bacteria, Bifidobacterium, E. coli, or Salmonella in broiler chickens. In addition, Rezaei et al. (2015) observed that the supplementation of oligosaccharides extract from palm kernel expeller (OligoPKE) did alter the microbiota of the cecal digesta in broiler chickens.

Volatile Fatty Acids The VFA, which are comprised of acetic, propionic, isobutyric, butyric, isovaleric, and valeric acids, are absorbed mostly in the large intestine and provide energy to the host (Franklin et al., 2002). The results of this study showed that the supplementation of different levels of postbiotic and inulin combinations increased the concentration of acetic acid compared with the control diets while the level of butyric acid, propionic acid, and total VFA were not affected. This finding partly supports that of Mookiah et al. (2014) who reported that probiotic, prebiotic, and symbiotic increased the concentration of acetic acid, propionic acid, butyric acid,

Downloaded from http://ps.oxfordjournals.org/ at Ryerson University on October 8, 2016

companion in vitro trial that postbiotics produced by L. plantarum showed an inhibitory effect against various pathogens (Kareem et al., 2014). In addition, prebiotics (oligosaccharides) promote intestinal acidity by enhancing lactic acid concentration and reducing the activity of harmful bacteria in the intestine (Al-Ghazzewi and Tester, 2012; Khan et al., 2012). Loh et al. (2006) and Samanta et al. (2013) reported that prebiotics and inulin reduced the population of pathogenic bacteria by synthesizing VFA. This observation is in tandem with the reports of earlier studies in which improvement in body weight gain was observed when probiotic, prebiotic, symbiotic, and postbiotic were supplemented in broiler diets (Thannh et al., 2009; Liu et al., 2012; Izadi et al., 2013; Mookiah et al., 2014). A significant increase in BW and feed efficiency was observed in piglets fed diets supplemented with metabolites produced by L. plantarum compared with those fed control diets; however, feed intake was not affected (Thu et al., 2011). Similarly, supplementation of 1% inulin improved the total BW and BWG but had no effect on FI in broiler chickens (Nabizadeh, 2012). In addition, Awad et al. (2009) and Houshmand et al. (2011) reported that simultaneous supplementation of probiotic and prebiotic preparations improved feed efficiency in broiler chickens. Contrarily, probiotic, prebiotic, or their combination did not affect feed efficiency in broiler chickens (Rudriguez et al., 2012; Sohail et al., 2012). Similarly, Ortiz et al. (2009), Alzueta et al. (2010) found that dietary inulin had no effect on BWG, FI, or FCR of broiler chickens.

8

KAREEM ET AL.

and total VFA in ceca digesta of broiler chickens compared with the control diet. Similarly, Loh et al. (2013) reported that different levels of metabolite combination produced by L. plantarum increased the concentration of acetic acid compared with the control diet in post-weaned piglets. In poultry, extensive strict anaerobic activities including formation of short chain fatty acids occur in the ceca of birds fed a variety of diets (Saengkerdsub et al., 2007). It has been reported that some microorganisms in the gastrointestinal tract of various animal species including poultry have the potential to hydrolyze and ferment dietary fiber into oligosaccharides and other low molecular weight carbohydrates (Sunvold et al., 1995; Dunkley et al., 2007). In the intestine, prebiotics are fermented by beneficial bacteria to produce short chain fatty acids (Al-Sheraji et al., 2013).

Cytokine Expression Decreased incidence of disease may be related to changes in immune regulation through cytokine secretion. Although changes in the immune system have been demonstrated, the exact mechanism of immunomodulation remains unknown. Commensal bacteria fed as isolated strains also can have varying effects ranging from anti-inflammatory to pro-inflammatory (Foligne et al., 2007). Furthermore, a balance of gut microbiota constitutes an efficient barrier against pathogen colonization; moreover, it produces metabolic substrates (e.g., vitamins and short chain fatty acids) and stimulates the immune system in a non-inflammatory manner. Thus, there is evidence of correlation between the composition of the colonizing microbiota and variations in immunity (O’Hara and Shanahan, 2006). Feeding a dietary combination of postbiotic and inulin increased ileal cytokine IL-6 expression, except at the highest level of combination (0.6% postbiotic+ 1% inulin) when IL-6 cytokine expression rebounded. This could be due to high concentrations of Lactobacillus and Befidobacterium to induce anti-inflammatory cytokine expression. On the other hand, lower cytokine expression for pro-inflammatory cytokine could result from a decreased pathogens load. Lactic acid, the predominant end product of Lactobacillus fermentation, acts as an antimicrobial by inhibiting the growth of pH-sensitive, gram-negative bacteria, which include pathogenic species such as E. coli O157:H7 (Momose et al., 2008). The current finding is consistent with the findings of Hosono et al. (2003) who reported that ex vivo culture of immune cells isolated from Peyer’s patches of fructo-oligosaccharide-fed mice resulted in increased concentrations of total IgA, IL-5, IL-6, and IL-10 compared to mice without supplementation. The mRNA of interleukins LITAF and IFN were significantly down-regulated in birds fed the positive control and combinations of postbiotic and inulin. This observation could be due to the increase in the population

CONCLUSION Supplementation of combinations of postbiotic and inulin in the diet of broiler chickens improved growth performance, population of total bacteria and beneficial bacteria, reduced the population of Enterobacteria and E. coli, and increased acetic acid concentration with associated alterations in ileal cytokine expression. Treatments with 0.15% and 0.45% RG14 displayed the best results, especially in terms of growth performance, cecal total bacteria, and cytokine expression. Economically, postbiotic RG14 supplementation, 0.15% + 1.0% inulin is preferred to be used as an optimal level. Postbiotic and inulin combinations are potential replacements for AGP in the poultry industry.

ACKNOWLEDGEMENTS The Long-Term Research Grant Scheme (LRGS) from Ministry of Education Malaysia has supported this project.

REFERENCES Ajuwon, K. M. 2015. Toward a better understanding of mechanisms of probiotics and prebiotics action in poultry species. J. Appl. Poult. Res. 14, doi: 10.3382/japr/pfv074. Al-Ghazzewi, F. H., and R. F. Tester. 2012. Efficacy of cellulase and mannanase hydrolysates of konjac glucomannan to promote the growth of lactic acid bacteria. J. Sci. Food Agric. 92:2394–2396. ´ atkiewicz. 2013. The usefulAlloui, M. N., W. Szczurek, and S. Swi  ness of prebiotics and probiotics in modern poultry nutrition: A review. Ann. Anim. Sci. 13:17–32. Al-Sheraji, S. H., A. Ismail, M. Y. Manap, S. Mustafa, R. M. Yusof, and F. A. Hassan. 2013. Prebiotics as functional foods: A review. J. Funct. Food. 5:1542–1553. Alzueta, C., M. L. Rodriguez, L. T. Ortiz, A. Rebole, and J. Trevino. 2010. Effects of inulin on growth performance, nutrient digestibility and metabolisable energy in broiler chickens. Brit. Poult. Sci. 51:393–398. Awad, W. A., K. Ghareeb, S. Abdel-Raheem, and J. B¨ ohm. 2009. Effects of dietary inclusion of probiotic and synbiotic on growth

Downloaded from http://ps.oxfordjournals.org/ at Ryerson University on October 8, 2016

of Bifidobacterium in birds fed combinations of inulin and postbiotics. These observations corroborate those of Herfel et al. (2011) who reported that lower level poly-dextrose as a substitute for oligosaccharide supplementation, increase in Lactobacillus-associated lactic acid, and other antimicrobials were able to competitively exclude pathogenic bacteria, decreasing the need for inflammatory response-driven cytokine production. In young pigs, a lack of overall intestinal microbial diversity, but increased Lactobacilli, is associated with decreases in expression of IFN inducible genes and IL-8 (Mulder et al., 2009). To our knowledge, there is no report on the changes in cytokine expression as influenced by dietary postbiotic and inulin combinations. The reduced expression of inflammatory cytokines in broiler chickens fed different levels of postbiotic RG14 and inulin combinations was accompanied by increased cecal lactobacilli, bifidobacterium, and acetic acid concentrations.

COMBINATION OF POSTBIOTIC RG14 AND INULIN IN BROILER DIETS

Kareem, K. Y., T. C. Loh, H. L. Foo, H. Akit, and S. A. Asmara. 2016. Effects of dietary postbiotic and inulin on growth performance, IGF-I and GHR mRNA expression, faecal microbiota and volatile fatty acids in broilers. BMC Vet. Res. 12:163. Khan, A. R., M. S. Yousaf, H. Rehman, H. Zaneb, T. N. Pasha, N. Fatima, and M. Afzal. 2012. Response of maternally isolated rock pigeons (Columba livia domestica) to different dietary concentrations of mannan-oligosaccharide. Poult. Sci. 91:1598–1603. Kim, G. B., Y. Seo, C. Kim, and I. Paik. 2011. Effect of dietary prebiotic supplementation on the performance, intestinal microflora, and immune response of broilers. Poult. Sci. 90:75–82. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. Methods. 25:402–408. Loh, G., M. Eberhard, R. M. Brunner, U. Hennig, S. Kuhla, B. Kleessen, and C. C. Metges. 2006. Inulin alters the intestinal microbiota and short-chain fatty acid concentrations in growing pigs regardless of their basal diet. J. Nutr. 136:1198–1202. Loh, T. C., T. V. Thu, H. L. Foo, and M. H. Bejo. 2013. Effects of different levels of metabolite combination produced by Lactobacillus plantarum on growth performance, diarrhoea, gut environment and digestibility of postweaning piglets. J. Appl. Anim. Res. 41:200–207. Loh, T. C., D. W. Choe, H. L. Foo, A. Q. Sazili, and M. H. Bejo. 2014. Effects of feeding different postbiotic metabolite combinations produced by Lactobacillus plantarum strains on egg quality and production performance, faecal parameters and plasma cholesterol in laying hens. BMC Vet. Res. 10:149. Liu, X., H. Yan, L. Lv, Q. Xu, C. Yin, K. Zhang, P. Wang, and J. Hu. 2012. Growth performance and meat quality of broiler chickens supplemented with Bacillus licheniformis in drinking water. Asian-Australas. J. Anim. Sci. 25:682–689. Marteau, P., and F. Shanahan. 2003. Basic aspects and pharmacology of probiotics: an overview of pharmacokinetics, mechanisms of action and side-effects. Best Pract. & Res. Cl. Ga. 17:725–740. Momose, Y., K. Hirayama, and K. Itoh. 2008. Effect of organic acids on inhibition of escherichia coli O157:H7 colonization in gnotobiotic mice associated with infant intestinal microbiota. Antonie van Leeuwenhoek. 93:141–149. Mookiah, S., C. C. Sieo, K. Ramasamy, N. Abdullah, and Y. W. Ho. 2014. Effects of dietary prebiotics, probiotic and synbiotics on performance, caecal bacterial populations and caecal fermentation concentrations of broiler chickens. J. Sci. Food Agri. 94:341–348. Mulder, I. E., B. Schmidt, C. R. Stokes, M. Lewis, M. Bailey, R. I. Aminov, J. I. Prosser, B. P. Gill, J. R. Pluske, and D. Mayer. 2009. Environmentally-acquired bacteria influence microbial diversity and natural innate immune responses at gut surfaces. BMC Biol. 7:79. Nabizadeh, A. 2012. The effect of inulin on broiler chicken intestinal microflora, gut morphology, and performance. J. Anim. Feed Sci. 21:725–734. Nam, H. M., V. Srinivasan, B. E. Gillespie, S. E. Murinda, and S. P. Oliver. 2005. Application of SYBR green realtime PCR assay for specific detection of Salmonella spp. in dairy farm environmental samples. Int. J. Food Microbiol. 102:161–171. Navidshad, B., J. B. Liang, and M. F. Jahromi. 2012. Correlation coefficients between different methods of expressing bacterial quantification using real time PCR. Int. J. Mol. Sci. 13:2119–2132. Novak, M., and V. Vetvicka. 2009. Glucans as biological response modifiers. Endocr. Metab. Immune Disord. Drug Targets. 9:67–75. O’Hara, A. M., and F. Shanahan. 2006. The gut flora as a forgotten organ. EMBO Rep. 7:688–693. Ortiz, L., M. Rodriguez, C. Alzueta, A. Rebole, and J. Trevino. 2009. Effect of inulin on growth performance, intestinal tract sizes, mineral retention and tibial bone mineralisation in broiler chickens. Brit. Poult. Sci. 50:325–332. Rebol´e, A., L. Ortiz, M. L. Rodr´ıguez, C. Alzueta, J. Trevi˜ no, and S. Velasco. 2010. Effects of inulin and enzyme complex, individually or in combination, on growth performance, intestinal microflora,

Downloaded from http://ps.oxfordjournals.org/ at Ryerson University on October 8, 2016

performance, organ weights, and intestinal histomorphology of broiler chickens. Poult. Sci. 88:49–56. Bartosch, S., A. Fite, G. T. Macfarlane, and M. E. McMurdo. 2004. Characterization of bacterial communities in feces from healthy elderly volunteers and hospitalized elderly patients by using realtime PCR and effects of antibiotic treatment on the fecal microbiota. Appl. Environ. Microbiol. 70:3575–3581. Boguslawska-Tryk, M., A. Piotrowska, and K. Burlikowska. 2012. Dietary fructans and their potential beneficial influence on health and performance parametrs in broiler chickens. J. Cent. Eur. Agric. 13:272–291. Chen, W. L., J. B. Liang, M. F. Jahromi, N. Abdullah, Y. W. Ho, and V. Tufarelli. 2014. Enzyme treatment enhances release of prebiotic oligosaccharides from palm kernel expeller. BioResources. 10:196–209. Choe, D., T. Loh, H. Foo, M. Hair-Bejo, and Q. Awis. 2012. Egg production, faecal pH and microbial population, small intestine morphology, and plasma and yolk cholesterol in laying hens given liquid metabolites produced by Lactobacillus plantarum strains. Brit. Poult. Sci. 53:106–115. Dunkley, K. D., C. S. Dunkley, N. L. Njongmeta, T. R. Callaway, M. E. Hume, L. F. Kubena, D. J. Nisbet, and S. C. Ricke. 2007. Comparison of in vitro fermentation and molecular microbial profiles of high-fiber feed substrates (HFFS) incubated with chicken cecal inocula. Poult. Sci. 86:801–810. Faseleh Jahromi, M., J. B. Liang, R. Mohamad, Y. M. Goh, P. Shokryazdan, and Y. W. Ho. 2013. Lovastatin-enriched rice straw enhances biomass quality and suppresses ruminal methanogenesis. BioMed. Res. Int. 2013:1–13. Foligne, B., S. Nutten, C. Grangette, V. Dennin, D. Goudercourt, S. Poiret, J. Dewulf, D. Brassart, A. Mercenier, and B. Pot. 2007. Correlation between in vitro and in vivo immunomodulatory properties of lactic acid bacteria. World J. Gastroentero. 13:236–243. Frahm, E., and U. Obst. 2003. Application of the fluorogenic probe technique (TaqMan PCR) to the detection of Enterococcus spp. and Escherichia coli in water samples. J. Microbiol. Methods. 52:123–131. Franklin, M. A., A. G. Mathew, J. R. Vickers, and R. A. Clift. 2002. Characterization of microbial populations and volatile fatty acid concentrations in the jejunum, ileum, and cecum of pigs weaned at 17 vs 24 days of age. J. Animal Sci. 80:2904–2910. Herfel, T. M., S. K. Jacobi, X. Lin, V. Fellner, D. C. Walker, Z. E. Jouni, and J. Odle. 2011. Polydextrose enrichment of infant formula demonstrates prebiotic characteristics by altering intestinal microbiota, organic acid concentrations, and cytokine expression in suckling piglets. J. Nutr. 141:2139–2145. Houshmand, M., K. Azhar, I. Zulkifli, M. H. Bejo, A. Meimandipour, and A. Kamyab. 2011. Effects of non-antibiotic feed additives on performance, tibial dyschondroplasia incidence and tibia characteristics of broilers fed low-calcium diets. J. Anim. Physiol. Anim. Nutr. 95:351–358. Howarth, G. S., and H. Wang. 2013. Role of endogenous microbiota, probiotics and their biological products in human health. Nutrients. 5:58–81. Hosono, A., A. Ozawa, R. Kato, Y. Ohnishi, Y. Nakanishi, T. Kimura, and R. Nakamura. 2003. Dietary fructooligosaccharides induce immunoregulation of intestinal IgA secretion by murine Peyer’s patch cells. Biosci. Biotechnol. Biochem. 67:758–764. Ibrahim, S. M., and S. G. Desouky. 2009. Effect of antimicrobial metabolites produced by lactic acid bacteria (Lab) on quality aspects of frozen tilapia (Oreochromis niloticus) fillets. J. Fish Marine Sci. 1:40–45. Izadi, H., J. Arshami, A. Golian, and M. R. Raji. 2013. Effects of chicory root powder on growth performance and histomorphometry of jejunum in broiler chicks, Veterinary Research Forum. Faculty of Veterinary Medicine, Urmia Univ. Urmia, Iran. Jung, S., R. Houde, B. Baurhoo, X. Zhao, and B. Lee. 2008. Effects of galacto-oligosaccharides and a Bifidobacteria lactis-based probiotic strain on the growth performance and fecal microflora of broiler chickens. Poult. Sci. 87:1694–1699. Kareem, K. Y, F. H. Ling, L. T. Chwen, O. M. Foong, and S. A. Asmara. 2014. Inhibitory activity of postbiotic produced by strains of Lactobacillus plantarum using reconstituted media supplemented with inulin. Gut Pathog. 6:23.

9

10

KAREEM ET AL. mixture on growth performance of broilers sub-jected to chronic heat stress. Poult. Sci. 91:2235–2240. Sugiharto, S. 2014. Role of nutraceuticals in gut health and growth performance of poultry. J. Saudi Soc. Agric. Sci. doi:10.1016/j.jssas.2014.06.001. Sunvold, G. D., H. S. Hussein, J. C. Fahey, Jr., N. R. Merchen, and G. A. Reinhart. 1995. In vitro fermentation of cellulose, beet pulp, citrus pulp, and citrus pectin using fecal inoculum from cats, dogs, horses, humans, and pigs and ruminal fluid from cattle. J. Anim. Sci. 73:3639–3648. Suo, H. Q., L. U. Lin, G. H. Xu, X. I. Lin, X. G. Chen, R. R. Xia, and X. G. Luo. 2015. Effectiveness of dietary xylo-oligosaccharides for broilers fed a conventional corn-soybean meal diet. J. Integr. Agri. 14:2050–2057. Thanh, N., T. C. Loh, H. L. Foo, M. Hair-Bejo, and B. Azhar. 2009. Effects of feeding metabolite combinations produced by Lactobacillus plantarum on growth performance, faecal microbial population, small intestine villus height and faecal volatile fatty acids in broilers. Brit. Poult. Sci. 50:298–306. Thu, T., L. T. Chwen, H. L. Foo, Y. Halimatun, and M. Bejo. 2010. Effects of metabolite combinations produced by Lactobacillus plantarum on plasma cholesterol and fatty acids in piglets. Am. J. Anim. Vet. Sci. 5:233–236. Thu, T., T. C. Loh, H. Foo, H. Yaakub, and M. Bejo. 2011. Effects of liquid metabolite combinations produced by Lactobacillus plantarum on growth performance, faeces characteristics, intestinal morphology and diarrhoea incidence in postweaning piglets. Trop. Anim. Health Pro. 43:69–75. Wang, R. F., W. W. Cao, and C. E. Cerniglia. 1996. PCR detection and quantitation of predominant anaerobic bacteria in human and animal fecal samples. Appl. Environ. Microbiol. 62:1242–1247.

Downloaded from http://ps.oxfordjournals.org/ at Ryerson University on October 8, 2016

cecal fermentation characteristics, and jejunal histomorphology in broiler chickens fed a wheat-and barley-based diet. Poult. Sci. 89:276–286. Rezaei, S., M. F. Jahromi, J. B. Liang, I. Zulkifli, A. S. Farjam, V. Laudadio, and V. Tufarelli. 2015. Effect of oligosaccharides extract from palm kernel expeller on growth performance, gut microbiota and immune response in broiler chickens. Poult. Sci. 94:2414–2420. Rinttil¨ a, T., and J. Apajalahti. 2013. Intestinal microbiota and metabolites—Implications for broiler chicken health and performance1. J. Appl. Poult. Res. 22:647–658. Rodriguez, M. L., A. Rebole, S. Velasco, L. T. Ortiz, J. Tre-vino, and C. Alzueta. 2012. Wheat- and barley-based diets with or without additives influence broiler chicken perfor-mance, nutrient digestibility and intestinal microflora. J. Sci. Food Agric. 92:184–190. Saengkerdsub, S., R. C. Anderson, H. H. Wilkinson, W. K. Kim, D. J. Nisbet, and S. C. Ricke. 2007. Identification and quantification of methanogenic archaea in adult chicken ceca. Appl. Env. Microb. 73:353–356. Samanta, A. K., N. Jayapal, S. Senani, A. P. Kolte, and M. Sridhar. 2013. Prebiotic inulin: Useful dietary adjuncts to manipulate the livestock gut microflora. Braz. J. Microbiol. 44:1–14. R User’s Guide Version 9.4. SAS SAS Institute Inc. 2014. SAS/STAT Institute Inc, Cary, North Carolina, USA. Shang, L., M. Fukata, N. Thirunarayanan, A. P. Martin, P. Arnaboldi, D. Maussang, C. Berin, J. C. Unkeless, L. Mayer, and M. T. Abreu. 2008. Toll-like receptor signaling in small intestinal epithelium promotes B-cell recruitment and IgA production in lamina propria. Gastroenterol. 135:529–538. Sohail, M. U., M. E. Hume, J. A. Byrd, D. J. Nisbet, A. Ijaz, A. Sohail, M. Z. Shabbir, and H. Rehman. 2012. Effect of supplementation of prebiotic mannan-oligosaccharides and probiotic