- Email: [email protected]
Influences of chlorpyrifos on antioxidant enzyme activities of Nilaparvata lugens
Ecotoxicology and Environmental Safety 98 (2013) 187–190
Contents lists available at ScienceDirect
Ecotoxicology and Environmental Safety journal homepage: www.elsevier.com/locate/ecoenv
Influences of chlorpyrifos on antioxidant enzyme activities of Nilaparvata lugens Shanfeng Ling n, Hong Zhang Bioengineering College, Jingchu University of Technology, Jingmen, Hubei 448000, PR China
art ic l e i nf o
a b s t r a c t
Article history: Received 16 May 2013 Received in revised form 29 August 2013 Accepted 30 August 2013 Available online 21 September 2013
The brown planthoppers (Nilaparvata lugens, BPH) resistant to chlorpyrifos were selected in laboratory for eight generations. In the full course, the successive changes of activities of SOD, CAT and POD were analyzed. The analyses revealed that increasing of LD50 value was parallel to increasing of SOD, CAT, and POD, all of which increased gradually generation by generation. qRT-PCR showed that CAT was not directly involved in chlorpyrifos detoxification, but could be transcriptionally induced by chlorpyrifos. The results showed that the change of CAT activity was high correlated with chlorpyrifos toxicity in the full course, indicating that CAT played very important role in BPH antioxidant defense. It was suggested that the significant induction of CAT activity could contribute to enhancing antioxidant capacity in BPH and its population growth. CAT as an oxidative stress biomarker was recommended. & 2013 Elsevier Inc. All rights reserved.
Keywords: Chlorpyrifos Nilaparvata lugens Antioxidant enzyme activities CAT induction qRT-PCR
1. Introduction Reactive oxygen species (ROS), including superoxide anion radical (O2 ), hydroxyl radical (OH) and hydrogen peroxide (H2O2), are generated during normal aerobic metabolism (Fridovich, 1978) and are increased under the stress of the insecticides (Velki et al., 2011). ROS are considered to cause oxidative damage of biological macromolecules such as DNA, lipids and proteins, leading to the damage of insect tissues and the diseases (Fridovich, 1978). Insect antioxidant enzymes include superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD). CAT reduces H2O2 to water and oxygen, and POD can decompose H2O2. That means POD reduces H2O2 to water. The substrate specificity of catalases and peroxidase for hydrogen peroxide has been recognized for some time, and Theorell has suggested the term hydroperoxidases for this class of enzymes (Theorell, 1951). Oxidative stress is induced in both acute and chronic intoxication with organophosphate compounds (OP) in experimental animals, which is manifested by changes in the activities of antioxidant enzymes (Anna, 2010). Induction of oxidative stress by organophosphate exposition has been reported as the main mechanism of OP toxicity (Thomaz et al., 2009). The malathion treatment results in a significant increase of CAT activity in the firebug Pyrrhocoris apterus's body (Velki et al., 2011).One of the effects of chemical (dietary penicillin) is to increase oxidative stress on midgut tissues of Galleria mellonella (Buyukguzeli and Kalender, 2007). However, relatively few investigations have defined the CAT and POD alterations of brown
planthoppers (BPH) after insecticide exposure. Little was known about what responses in BPH might account for the occurrence of the resistance. The current literature survey has revealed that intoxication with OP implicates not only AChE inhibition and the resulting consequences, but also the induction of oxidative stress (Anna, 2010). OP insecticides exert their biological effects via generation of ROS. SOD catalyzes the dismutation of superoxide radicals to H2O2 and oxygen, and it seems to be the main response to OP insecticide pro-oxidant exposure. H2O2 initiates signaling responses that include enzyme activation, gene expression, cell apoptosis and cellular damage (Thomaz et al., 2009). Hence, SOD, CAT and POD appear to be of great importance for OP insecticide in Nilaparvata lugens. We hypothesize that the activities of enzymes (SOD, CAT, and POD) have dynamic changes and the elevated enzyme activities form a mutually supportive defense complex against ROS. The increase in protective enzymes activities signals the enhancement of antioxidant capacity and can serve as bioindicators of OP toxicity. In this study, we investigated the changes of SOD, CAT and POD activities in BPH under chlorpyrifos-selected conditions. Based on the results from enzymes analysis, we hope to demonstrate the remarkable enzymes effects in response to pesticide stress.
2. Materials and methods 2.1. Insecticide
Abbreviations: ROS, reactive oxygen species; CAT, catalase; SOD, superoxide dismutase; POD, peroxidase; BPH, brown planthopper n Corresponding author. Fax: þ 86 20 841 122 97. E-mail addresses: [email protected], [email protected] (S. Ling). 0147-6513/$ - see front matter & 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.ecoenv.2013.08.023
Chlorpyrifos, a widely used organophosphorus insecticide, was used against the rice planthopper during the maximum tillering and heading stages of rice. The insecticide was used in bioassays at the proper application concentrations.
188
S. Ling, H. Zhang / Ecotoxicology and Environmental Safety 98 (2013) 187–190
2.2. Insects
2.6. The protein assay
The susceptible (S) strain of BPH has been maintained for 2 years in the laboratory of Jingmen Academy of Agricultural Science and the State Key Laboratory for Biocontrol without any exposure to insecticides. S strain is used as control population without chlorpyrifos applied in this strain. The field population (F), originally collected from paddy fields in Qingyuan City (Guangdong, China), was reared on susceptible rice variety TN1 at 20–32 1C in meshed cages. F strain was used as a starting population for chlorpyrifos resistance selection and named as Go. The resistance selection was carried out in consecutive eight generations (G1–G8).
The total protein content of the enzyme solution was determined by the Bradford method (Bradford, 1976) using bovine serum albumin as the standard.
2.3. Bioassay The bioassay followed the microtopical application technique reported by Ling et al. (2011) with modifications. Three-day-old macropterous female adults (unmated) were used as test insect in this study. Insecticides were dissolved at a series of concentrations in acetone. After anesthetization with carbon dioxide, a 0.2 ml droplet of insecticide dissolved in acetone was applied to the dorsal side of the thorax with a hand microapplicator (Burkard Manufacturing Co. Ltd., Rickmansworth, UK). About 30 insects were treated at each concentration, and each treatment was repeated three times. The controls used acetone instead of the insecticide solution. The treated insects were reared on seedlings cultured in the rearing box (37 37 35 cm3) without soil at 2771 1C with a 16 h:8 h light:dark photoperiod. Mortality was recorded 24 h after the treatment. LD50 values of both the susceptible strain and resistant strain, were determined by probit analysis. The LD50 value of the susceptible strain was 3.52 10 4 mg. The LD50 values of resistant strains were 4.12 10 4 mg, 4.46 10 4 mg, 6.16 10 4 mg, 7.90 10 4 mg, 1.03 10 3 mg, 2.73 10 3 mg, 5.70 10 3 mg, 6.49 10 3 mg, and 1.16 10 2 mg. The resistance ratio (RR)¼ LD50 of resistant strain/LD50 of susceptible strain.
2.7. Quantitative real-time reverse transcriptase polymerase chain reaction (qRT-PCR) The following detailed experiment was conducted according to the method of Ge et al. (2011) and modifications. The gene-specific primers used for CAT, SOD, POD and β-actin were as follows: CAT-F: GGCTCAGACCCAGATTAC; CAT-R: CTGTCCAGGACCAGTTTT; SOD-F: ACAGGAAACGCTGGAAGT; SOD-R: CACCACAAGCCAAACGAC; POD-F: TAAGTGCATGGGTAAAGG; POD-R: AACTGGGAGAAGAGGAGA; β-F: TGGACTTCGAGCAGGAAATGG; and β-R: ACGTCGCACTTCAGATCGAG. The βactin gene was used as an internal standard. mRNA levels of CAT, SOD, and POD were quantified in relation to the expression of β-actin. The qRT-PCR was conducted with the following cycling regime: followed by 95 1C for 3 min, 42 cycles of 95 1C for 5 s, 55 1C for 20 s, and 72 1C for 15 s.
3. Results 3.1. Changes of chlorpyrifos susceptibility The topical LD50 values of chlorpyrifos against BPH are given in Fig. 1The LD50 of G0 was 3.52 10 4 mg/female, which is 1.17 times of S strain, indicating that the field population was already with susceptibility to chlorpyrifos. From G0 to G8, the change of LD50 in successive generations was different. The change of LD50 from G0 to G4 was small and the LD50 of G4 was 1.03 10 3 mg/ female. The change from G4 to G7 was medium, but the LD50 of G8 reached 1.16 10 2 mg/female.
2.4. Resistance selection
2.5. Preparation of enzymes and determination of enzyme activities Enzymes were prepared according to the method of Tang et al. (2010). The macropterous females (3 day old) were used for the preparation of enzyme resources. In each replication, 27 insects were homogenized with 2 ml homogenization buffer (0.1 M sodium phosphate buffer, pH 7.6, containing 1 mM EDTA, 1 mM DTT, and 1 mM PMSF). Each treatment included three replications. After centrifugation at 15,000g and 4 1C for 15 min, the supernatant was re-centrifuged at 10,000g and 4 1C for 20 min. The clear supernatant was then collected and used as enzyme resource for analysis of the activities of SOD, CAT, and POD. Enzyme activities were determined by measuring the absorbance of the samples in a dual beam spectrophotometer. Total SOD (EC 1.15.1.1) activity was determined according to Marklund and Marklund (1974) assaying the auto-oxidation and illumination of pyrogallol at 440 nm for 3 min. One unit total SOD activity was calculated as the amount of protein causing 50% inhibition of pyrogallol autooxidation. The total SOD activity was expressed as units per milligram of protein (U/mg). CAT activity was measured following the decline in A240 as H2O2 was catabolised, according to the method of Ni et al. (2001) in a reaction mixture containing 100 ml enzyme extract in 50 mM potassium phosphate buffer (pH 7). The reaction was started by addition of H2O2 at the final concentration 67 mM, and its consumption is monitored for about 5 min at 240 nm. One unit of catalase activity was defined as the amount of enzyme that decomposes 1 mmol of H2O2/ min. POD activity was measured with reaction medium containing 50 mM phosphate buffer (pH 7.0), 18 mM guaiacol and 67 mM H2O2 according to the method of Heng-moss et al. (2004). The kinetic evolution of absorbency at 470 nm was measured during 1 min. Peroxidase activity was calculated using the extinction coefficient (26.6 mM 1 cm 1 at 470 nm). One unit of peroxidase was defined as the amount of enzyme that caused the formation of 1 mM of tetraguaiacol per minute. All analyses were made at least in triplicate. Carboxylesterase, cytochrome P450, and glutathione S-transferase assays were performed according to Wang et al. (2010) with minor modification.
3.2. Antioxidant enzyme activities and the analysis of the inducibility of CAT, SOD, and POD genes by qRT-PCR Fig. 2 shows that SOD activity changed in successive generations but different from the change of LD50. SOD activity increased in a generation-related manner in the 3-day old macropterous females selected by chlorpyrifos. Figs. 3 and 4 show that the changes of CAT activities and POD activities in successive generations were similar in the resistance development, and also similar to the change of LD50 in the same period. Regression analysis (Curve Estimation of SPSS) showed that their relationships between SOD activities and LD50 of each generation, POD activities and LD50 in the full course were in Quadratic curve mode and Cubic curve mode, respectively. The correlation coefficients between SOD activities and LD50 of each generation, POD
16 14 12 LD50 (ng/female)
In each generation, the LD50 doses (calculated from the above bioassay) were applied to about 300–500 macropterous females and males using the same topical application method described above. The treated insects were reared on seedlings cultured in the rearing box without soil at 277 1 1C with a 16 h:8 h light:dark photoperiod. Three days later, the surviving insects were transferred to a caged rearing box (37 37 35 cm3) with fresh rice.
10 8 6 4 2 0 S G0 G1 G2 G3 G4 G5 G6 G7 G8 Generation
Fig. 1. Changes of LD50 value over generations. All experiments were performed three times and the results are the mean7 SE.
S. Ling, H. Zhang / Ecotoxicology and Environmental Safety 98 (2013) 187–190
a
a SOD activity (U) SOD Expression fold
a a
8
a
a
10 9
a
a
8 7 6
6
aa
4
a aa a
aa
aa
5 4
aa
3 2 1 0
0 S
G0
G1
G2
G3
G4
G5
G6
G7
POD activity (U)
10
11
SOD Expression fold
SOD activity (U)
13 12
12
2
14
4.2 3.9 3.6 3.3 3.0 2.7 2.4 2.1 1.8 1.5 1.2 0.9 0.6 0.3 0.0
a
A
CAT activity (U) CAT Expression fold
B
BB
B
C C
S
B
B
G0
B
G1
B B
G2
B
G3
B
B
B
B
G4
G5
G6
G7
G8
26 24 22 20 18 16 14 12 10 8 6 4 2 0 -2
CAT Expression fold
CAT activity (U)
A
B
a
3.2
a
2.8 2.4
a
a a a
a
a
a
a
a
a
a
a
a
2.0 1.6 1.2 0.8 0.4
G0
G1
G2
G3
G4
G5
G6
G7
0.0 G8
Generation
Fig. 2. SOD activity (U) of the BPH macropterous females (3 day old) by the microtopical application and quantitative real-time PCR data for the mRNA expression levels of SOD genes in 10 samples. The expression value of control (S) population was converted to 1. Values are reported as mean 7 SE, and bars with the same letters indicate that means are not significantly different at the p o 0.05 level. Values are normalized relative to β-actin transcript levels. Each treatment and control was replicated three times. Data were transformed by arcsine transformation before LSD test. Means within column followed by the same letter are not significantly different (p 40.05 or p 40.01, LSD test). Data in the figure were before arcsine transformation.
B
3.6
a
Generation
26 24 22 20 18 16 14 12 10 8 6 4 2 0 -2
4.0
a
POD activity(U) POD Expression fold
S
G8
a
a
POD Expression fold
14
189
Generation Fig. 3. CAT enzyme activity (U) of the BPH macropterous females (3 day old) by the microtopical application and quantitative real-time PCR data for the mRNA expression levels of CAT genes in 10 samples. The expression value of control (S) population was converted to 1. Values are reported as mean 7 SE, and bars with different letters indicate that means are significantly different at the p o 0.01 level. Values are normalized relative to β-actin transcript levels. Each treatment and control was replicated three times. Data were transformed by arcsine transformation before LSD test. Means within column followed by the same letter are not significantly different (p 40.05 or p 40.01, LSD test). Data in the figure were before arcsine transformation.
activities and LD50 in the full course did not reach the significant level, respectively. But Linear (stepwise) regression analysis showed that the correlation coefficient between CAT activities and LD50 in the ful1 course was 0.969 (R2 ¼0.939 and p o0.01). CAT and POD activities were significantly increased in the 3-day old macropterous females selected by chlorpyrifos from S to G8. CAT activities were positively correlated with SOD activities and POD activities in BPH. Ten sample genes from N. lugens before and after resistance development were selected for the analysis. As shown in Fig. 3, CAT transcript levels gradually increased from S strain to G7, and the average values of CAT mRNA expression in G8 were significantly higher than the control (Fig. 3). It increased to the level that was 23.6 times the control level in S strain. Linear (stepwise) regression analysis showed that the correlation
Fig. 4. POD enzyme activity (U) of the BPH macropterous females (3 day old) by the microtopical application and quantitative real-time PCR data for the mRNA expression levels of POD genes in 10 samples. The expression value of control (S) population was converted to 1. Values are reported as mean7 SE, and bars with the same letters indicate that means are not significantly different at the po 0.05 level. Values are normalized relative to β-actin transcript levels. Each treatment and control was replicated three times. Data were transformed by arcsine transformation before LSD test. Means within column followed by the same letter are not significantly different (p 40.05 or p 40.01, LSD test). Data in the figure were before arcsine transformation.
coefficient between CAT mRNA expression and LD50 in the ful1 course was 0.985 (R2 ¼ 0.971 and po 0.01). However, the average values of SOD mRNA expression in G8 were not significantly higher than the control and it increased to the level that was 10.7 times the control level in S strain (Fig. 2). The average POD mRNA expression in G8 increased to the level that was 3.6 times the control level in S strain (Fig. 4). Regression analysis (Curve Estimation of SPSS) showed their relationships between SOD mRNA expression and LD50 of each generation, POD mRNA expression and LD50 in the full course were in no-linear modes (Quadratic curve mode and Cubic curve mode, respectively). Moreover, the correlation coefficients between two variables did not reach the significant level. These results indicated that due to some changes of CAT activity in the resistance development, the CAT changes were the important factors in response to chlorpyrifos resistance-induced oxidative stress. Glutathione S-transferase and cytochrome P450 monooxygenase mainly contributed to chlorpyrifos detoxification (Table 1). This result was in agreement with Wang's inference (Wang et al., 2010) that the enhanced activities of carboxylesterase would be the important mechanism for chlorpyrifos resistance in the planthopper. In summary, significant differences in CAT were revealed between the resistant population and the susceptible population (Fig.3), indicating that CAT was the important response to chlorpyrifos toxicity. Our study confirms that the antioxidant enzymes, in particular CAT activities, are much involved in chlorpyrifos stress.
4. Discussion From the related changes between LD50 and SOD activity, CAT activity, POD activity in the successive selection generations, it was found that they played different roles. In the resistance development, although all the SOD activity, CAT activity and POD activity all changed in the ful1 course, only the change of CAT activity was significantly correlated with that of LD50, which indicated that CAT would be an important factor in chlorpyrifos-causing oxidative stress.
190
S. Ling, H. Zhang / Ecotoxicology and Environmental Safety 98 (2013) 187–190
5. Conclusion
Table 1 Data of GST and P450 of BPH from S strain to G8. Generation
GSTs
P450
S (control) G0 G1 G2 G3 G4 G5 G6 G7 G8
9.69 70.77 11.7071.76 13.90 71.90 27.51 73.43 36.3376.47 48.30 711.77 42.2479.88 50.27 713.11 90.93 723.59 119.72 741.67
2.23 7 0.39 4.87 7 0.83 5.39 7 1.30 5.56 7 1.53 5.99 7 1.48 7.02 7 1.97 6.017 1.83 6.127 1.57 6.53 7 1.28 7.277 1.91
Mean 7 SE of three replicates. Student's t-test: * and ** indicate significant differences between the treatment and control at po 0.05 and p o 0.01, respectively. Data in the table are the average activity (mM/min/mg).
The measurement of enzyme activity could be a useful indicator of the ecological fitness of resistant insect (Ling et al., 2011; Ling and Zhang, 2011). An elevated esterase-based mechanism is the major organophosphate resistance mechanism reported in rice planthopper (Zhang et al., 2012; Kwon et al., 2012; Latif et al., 2010). Therefore, the measurement of general esterase activity within BPH may provide a diagnostic tool for resistance management. In our experiment, resistance selection with chlorpyrifos showed that along with the increase of resistance of BPH, the SOD, CAT and POD activities in the selected strain became higher. That is to say, an increasing of LD50 values were parallel to increasing of enzyme activities involved in antioxidant cascade. It was shown that the activities of SOD, CAT and POD were all elevated in a similar manner during the resistance development, especially CAT, indicating that chlorpyrifos stimulated successive antioxidant cascade. These results suggested that CAT could act as the biomarker in the chlorpyrifos-mediating oxidative pathway. Hydrogen peroxide is thought to be produced in response to insecticide stress on the insect. The level of hydrogen peroxide is mediated by the presence of insect antioxidant enzymes such as CAT and POD. Insect antioxidant enzymes serve to catalyze the reduction of toxic intermediates of oxygen metabolism to prevent cellular damage (Heng-moss et al., 2004;Wang et al., 2010). The results by qRT-PCR showed that CAT was not directly involved in chlorpyrifos detoxification, but could be transcriptionally induced by chlorpyrifos. The expression levels under chlorpyrifos treatment in G8 were notably higher than those of the control group, indicating that chlorpyrifos greatly upregulated CAT gene expression. Selection of BPH with increasing dose of chlorpyrifos might be the cause of the elevation in CAT activity. H2O2 was a signaling agent and the regulation of H2O2 levels was of utmost importance in BPH cell metabolism. During the resistance selection from Go to G8, accumulation of H2O2 in BPH initiated signaling responses that included CAT activation and its gene expression which caused the increase of CAT activity. The CAT upregulation would help to reduce the build-up of ROS. Therefore, in latter generation CAT expression was high compared to early generation. We believe that significant increase of CAT activity allows the insect to detoxify peroxides from tissues and can be used as an index in the experiment. Changes in antioxidant enzyme activities in BPH in response to chlorpyrifos-induced oxidative stress would provide interesting information on the mechanism of action of the OP insecticide. Hence, it was possible for CAT as the bioindicator for assessing the toxicity of chlorpyrifos in BPH.
In summary, CAT mRNA was specifically induced in the presence of chlorpyrifos. It was suggested that the intensified CAT enzyme activities contributed to enhancing BPH antioxidant capacity and population growth. It was supposed that the CAT effect of oxidative stress in N. lugens may have a certain relationship with BPH Chlorpyrifos resistance development through an unknown pathway, which needs to be investigated in the next research.
Acknowledgments The authors thank State Key Laboratory for Biocontrol of Sun Yat-Sen University. This study was supported by the grants of the Nature Science Foundation of China, the Nature Science Foundation of Hubei and China Science & Technology Support Project (2008BADA5B01). References Anna, L.H., 2010. Role of oxidative stress in organophosphate insecticide toxicity – short review. Pestic. Biochem. Physiol. 98, 145–150. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein–dye binding. Anal. Biochem. 72, 248–254. Buyukguzeli, E., Kalender, Y., 2007. Penicillin-induced oxidative stress: effects on antioxidative response of midgut tissues in instars of Galleria mellonella. J. Econ. Entomol. 100, 1533–1541. Fridovich, I., 1978. The biology of oxygen radicals. Science 201, 875–880. Ge, L.Q., Cheng, Y., Wu, J.C., Jahn, G.C., 2011. Proteomic analysis of insecticide triazophos-induced mating-responsive proteins of Nilaparvata lugens Stål (Hemiptera: Delphacidae). J. Proteome Res. 10, 4597–4612. Heng-moss, T., Sarath, G., Baxendale, F., Novak, D., Bose, S., Ni, X., Quisenberry, S., 2004. Characterization of oxidative enzyme changes in buffalograsses challenged by Blissus occiduus. J. Econ. Entomol. 97, 1086–1095. Kwon, D.H., Min, S., Lee, S.W., Park, J.H., Lee, S.H., 2012. Monitoring of carbamate and organophosphate resistance levels in Nilaparvata lugens based on bioassay and quantitative sequencing. J. Asia Pac. Entomol. 15, 635–639. Latif, M.A., Omar, M.Y., Tan, S.G., Siraj, S.S., Ismail, A.R., 2010. Biochemical studies on malathion resistance, inheritance and association of carboxylesterase activity in brown planthopper, Nilaparvata lugens complex in Peninsular Malaysia. Insect Sci. 17, 517–526. Ling, S.F., Zhang, R.J., 2011. Cross resistance of bisultap resistant strain of Nilaparvata lugens and its biochemical mechanism. J. Econ. Entomol. 104, 243–249. Ling, S.F, Zhang, H., Zhang, R., 2011. Effect of fenvalerate on the reproduction and fitness costs of the brown planthopper, Nilaparvata lugens and its resistance mechanism. Pestic. Biochem. Physiol. 101, 148–153. Marklund, S., Marklund, G., 1974. Involvement of the superoxide anion radical in the autoxidation of pyrogallol and a convenient assay for superoxide dismutase. Eur. J. Biochem. 47, 469–474. Ni, X., Quisenberry, S.S., Heng-moss, T., Markwell, J., Sarath, G., Klucas, R., Baxendale, F., 2001. Oxidative responses of resistant and susceptible cereal leaves to symptomatic and nonsymptomatic cereal aphid (Hemiptera: Aphididae) feeding. J. Econ. Entomol. 94, 743–751. Tang, J., Li, J., Shao, Y., Yang, B., Liu, Z., 2010. Fipronil resistance in the whitebacked planthopper (Sogatella furcifera): possible resistance mechanisms and crossresistance. Pest Manag. Sci. 66, 121–125. Theorell, H., 1951. In: Sumner, B., Myrback, K. (Eds.), In The Enzymes, vol. 2. Academic Press, New York, p. 397. Thomaz, J.M., Martins, N.D., Monteiro, D.A., Rantin, F.T., Kalinin, A.L., 2009. Cardiorespiratory function and oxidative stress biomarkers in Nile tilapia exposed to the organophosphate insecticide trichlorfon (NEGUVON). Ecotoxicol. Environ. Saf. 72, 1413–1424. Velki, M., Kodrík, D., Vecera, J., Hackenberger, B.K., Socha, R., 2011. Oxidative stress elicited by insecticides: a role for the adipokinetic hormone. Gen. Comp. Endocr. 172, 77–84. Wang, L.H., Zhang, Y.L., Han, Z.J., Liu, Y.H., Fang, J.C., 2010. Cross-resistance and possible mechanisms of chlorpyrifos resistance in Laodelphax striatellus (Fallen). Pest Manag. Sci. 66, 1096–1100. Zhang, Y.L., Wang, L.H., Guo, H.F., Li, G..Q., Zhang, Z.C., Xie, L., Fang, J.C., 2012. A transcriptome-based screen of carboxylesterase-like genes that are involved in chlorpyrifos resistance in Laodelphax striatellus (Fallén). Pestic. Biochem. Physiol. 104, 224–228.
Contents lists available at ScienceDirect
Ecotoxicology and Environmental Safety journal homepage: www.elsevier.com/locate/ecoenv
Influences of chlorpyrifos on antioxidant enzyme activities of Nilaparvata lugens Shanfeng Ling n, Hong Zhang Bioengineering College, Jingchu University of Technology, Jingmen, Hubei 448000, PR China
art ic l e i nf o
a b s t r a c t
Article history: Received 16 May 2013 Received in revised form 29 August 2013 Accepted 30 August 2013 Available online 21 September 2013
The brown planthoppers (Nilaparvata lugens, BPH) resistant to chlorpyrifos were selected in laboratory for eight generations. In the full course, the successive changes of activities of SOD, CAT and POD were analyzed. The analyses revealed that increasing of LD50 value was parallel to increasing of SOD, CAT, and POD, all of which increased gradually generation by generation. qRT-PCR showed that CAT was not directly involved in chlorpyrifos detoxification, but could be transcriptionally induced by chlorpyrifos. The results showed that the change of CAT activity was high correlated with chlorpyrifos toxicity in the full course, indicating that CAT played very important role in BPH antioxidant defense. It was suggested that the significant induction of CAT activity could contribute to enhancing antioxidant capacity in BPH and its population growth. CAT as an oxidative stress biomarker was recommended. & 2013 Elsevier Inc. All rights reserved.
Keywords: Chlorpyrifos Nilaparvata lugens Antioxidant enzyme activities CAT induction qRT-PCR
1. Introduction Reactive oxygen species (ROS), including superoxide anion radical (O2 ), hydroxyl radical (OH) and hydrogen peroxide (H2O2), are generated during normal aerobic metabolism (Fridovich, 1978) and are increased under the stress of the insecticides (Velki et al., 2011). ROS are considered to cause oxidative damage of biological macromolecules such as DNA, lipids and proteins, leading to the damage of insect tissues and the diseases (Fridovich, 1978). Insect antioxidant enzymes include superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD). CAT reduces H2O2 to water and oxygen, and POD can decompose H2O2. That means POD reduces H2O2 to water. The substrate specificity of catalases and peroxidase for hydrogen peroxide has been recognized for some time, and Theorell has suggested the term hydroperoxidases for this class of enzymes (Theorell, 1951). Oxidative stress is induced in both acute and chronic intoxication with organophosphate compounds (OP) in experimental animals, which is manifested by changes in the activities of antioxidant enzymes (Anna, 2010). Induction of oxidative stress by organophosphate exposition has been reported as the main mechanism of OP toxicity (Thomaz et al., 2009). The malathion treatment results in a significant increase of CAT activity in the firebug Pyrrhocoris apterus's body (Velki et al., 2011).One of the effects of chemical (dietary penicillin) is to increase oxidative stress on midgut tissues of Galleria mellonella (Buyukguzeli and Kalender, 2007). However, relatively few investigations have defined the CAT and POD alterations of brown
planthoppers (BPH) after insecticide exposure. Little was known about what responses in BPH might account for the occurrence of the resistance. The current literature survey has revealed that intoxication with OP implicates not only AChE inhibition and the resulting consequences, but also the induction of oxidative stress (Anna, 2010). OP insecticides exert their biological effects via generation of ROS. SOD catalyzes the dismutation of superoxide radicals to H2O2 and oxygen, and it seems to be the main response to OP insecticide pro-oxidant exposure. H2O2 initiates signaling responses that include enzyme activation, gene expression, cell apoptosis and cellular damage (Thomaz et al., 2009). Hence, SOD, CAT and POD appear to be of great importance for OP insecticide in Nilaparvata lugens. We hypothesize that the activities of enzymes (SOD, CAT, and POD) have dynamic changes and the elevated enzyme activities form a mutually supportive defense complex against ROS. The increase in protective enzymes activities signals the enhancement of antioxidant capacity and can serve as bioindicators of OP toxicity. In this study, we investigated the changes of SOD, CAT and POD activities in BPH under chlorpyrifos-selected conditions. Based on the results from enzymes analysis, we hope to demonstrate the remarkable enzymes effects in response to pesticide stress.
2. Materials and methods 2.1. Insecticide
Abbreviations: ROS, reactive oxygen species; CAT, catalase; SOD, superoxide dismutase; POD, peroxidase; BPH, brown planthopper n Corresponding author. Fax: þ 86 20 841 122 97. E-mail addresses: [email protected], [email protected] (S. Ling). 0147-6513/$ - see front matter & 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.ecoenv.2013.08.023
Chlorpyrifos, a widely used organophosphorus insecticide, was used against the rice planthopper during the maximum tillering and heading stages of rice. The insecticide was used in bioassays at the proper application concentrations.
188
S. Ling, H. Zhang / Ecotoxicology and Environmental Safety 98 (2013) 187–190
2.2. Insects
2.6. The protein assay
The susceptible (S) strain of BPH has been maintained for 2 years in the laboratory of Jingmen Academy of Agricultural Science and the State Key Laboratory for Biocontrol without any exposure to insecticides. S strain is used as control population without chlorpyrifos applied in this strain. The field population (F), originally collected from paddy fields in Qingyuan City (Guangdong, China), was reared on susceptible rice variety TN1 at 20–32 1C in meshed cages. F strain was used as a starting population for chlorpyrifos resistance selection and named as Go. The resistance selection was carried out in consecutive eight generations (G1–G8).
The total protein content of the enzyme solution was determined by the Bradford method (Bradford, 1976) using bovine serum albumin as the standard.
2.3. Bioassay The bioassay followed the microtopical application technique reported by Ling et al. (2011) with modifications. Three-day-old macropterous female adults (unmated) were used as test insect in this study. Insecticides were dissolved at a series of concentrations in acetone. After anesthetization with carbon dioxide, a 0.2 ml droplet of insecticide dissolved in acetone was applied to the dorsal side of the thorax with a hand microapplicator (Burkard Manufacturing Co. Ltd., Rickmansworth, UK). About 30 insects were treated at each concentration, and each treatment was repeated three times. The controls used acetone instead of the insecticide solution. The treated insects were reared on seedlings cultured in the rearing box (37 37 35 cm3) without soil at 2771 1C with a 16 h:8 h light:dark photoperiod. Mortality was recorded 24 h after the treatment. LD50 values of both the susceptible strain and resistant strain, were determined by probit analysis. The LD50 value of the susceptible strain was 3.52 10 4 mg. The LD50 values of resistant strains were 4.12 10 4 mg, 4.46 10 4 mg, 6.16 10 4 mg, 7.90 10 4 mg, 1.03 10 3 mg, 2.73 10 3 mg, 5.70 10 3 mg, 6.49 10 3 mg, and 1.16 10 2 mg. The resistance ratio (RR)¼ LD50 of resistant strain/LD50 of susceptible strain.
2.7. Quantitative real-time reverse transcriptase polymerase chain reaction (qRT-PCR) The following detailed experiment was conducted according to the method of Ge et al. (2011) and modifications. The gene-specific primers used for CAT, SOD, POD and β-actin were as follows: CAT-F: GGCTCAGACCCAGATTAC; CAT-R: CTGTCCAGGACCAGTTTT; SOD-F: ACAGGAAACGCTGGAAGT; SOD-R: CACCACAAGCCAAACGAC; POD-F: TAAGTGCATGGGTAAAGG; POD-R: AACTGGGAGAAGAGGAGA; β-F: TGGACTTCGAGCAGGAAATGG; and β-R: ACGTCGCACTTCAGATCGAG. The βactin gene was used as an internal standard. mRNA levels of CAT, SOD, and POD were quantified in relation to the expression of β-actin. The qRT-PCR was conducted with the following cycling regime: followed by 95 1C for 3 min, 42 cycles of 95 1C for 5 s, 55 1C for 20 s, and 72 1C for 15 s.
3. Results 3.1. Changes of chlorpyrifos susceptibility The topical LD50 values of chlorpyrifos against BPH are given in Fig. 1The LD50 of G0 was 3.52 10 4 mg/female, which is 1.17 times of S strain, indicating that the field population was already with susceptibility to chlorpyrifos. From G0 to G8, the change of LD50 in successive generations was different. The change of LD50 from G0 to G4 was small and the LD50 of G4 was 1.03 10 3 mg/ female. The change from G4 to G7 was medium, but the LD50 of G8 reached 1.16 10 2 mg/female.
2.4. Resistance selection
2.5. Preparation of enzymes and determination of enzyme activities Enzymes were prepared according to the method of Tang et al. (2010). The macropterous females (3 day old) were used for the preparation of enzyme resources. In each replication, 27 insects were homogenized with 2 ml homogenization buffer (0.1 M sodium phosphate buffer, pH 7.6, containing 1 mM EDTA, 1 mM DTT, and 1 mM PMSF). Each treatment included three replications. After centrifugation at 15,000g and 4 1C for 15 min, the supernatant was re-centrifuged at 10,000g and 4 1C for 20 min. The clear supernatant was then collected and used as enzyme resource for analysis of the activities of SOD, CAT, and POD. Enzyme activities were determined by measuring the absorbance of the samples in a dual beam spectrophotometer. Total SOD (EC 1.15.1.1) activity was determined according to Marklund and Marklund (1974) assaying the auto-oxidation and illumination of pyrogallol at 440 nm for 3 min. One unit total SOD activity was calculated as the amount of protein causing 50% inhibition of pyrogallol autooxidation. The total SOD activity was expressed as units per milligram of protein (U/mg). CAT activity was measured following the decline in A240 as H2O2 was catabolised, according to the method of Ni et al. (2001) in a reaction mixture containing 100 ml enzyme extract in 50 mM potassium phosphate buffer (pH 7). The reaction was started by addition of H2O2 at the final concentration 67 mM, and its consumption is monitored for about 5 min at 240 nm. One unit of catalase activity was defined as the amount of enzyme that decomposes 1 mmol of H2O2/ min. POD activity was measured with reaction medium containing 50 mM phosphate buffer (pH 7.0), 18 mM guaiacol and 67 mM H2O2 according to the method of Heng-moss et al. (2004). The kinetic evolution of absorbency at 470 nm was measured during 1 min. Peroxidase activity was calculated using the extinction coefficient (26.6 mM 1 cm 1 at 470 nm). One unit of peroxidase was defined as the amount of enzyme that caused the formation of 1 mM of tetraguaiacol per minute. All analyses were made at least in triplicate. Carboxylesterase, cytochrome P450, and glutathione S-transferase assays were performed according to Wang et al. (2010) with minor modification.
3.2. Antioxidant enzyme activities and the analysis of the inducibility of CAT, SOD, and POD genes by qRT-PCR Fig. 2 shows that SOD activity changed in successive generations but different from the change of LD50. SOD activity increased in a generation-related manner in the 3-day old macropterous females selected by chlorpyrifos. Figs. 3 and 4 show that the changes of CAT activities and POD activities in successive generations were similar in the resistance development, and also similar to the change of LD50 in the same period. Regression analysis (Curve Estimation of SPSS) showed that their relationships between SOD activities and LD50 of each generation, POD activities and LD50 in the full course were in Quadratic curve mode and Cubic curve mode, respectively. The correlation coefficients between SOD activities and LD50 of each generation, POD
16 14 12 LD50 (ng/female)
In each generation, the LD50 doses (calculated from the above bioassay) were applied to about 300–500 macropterous females and males using the same topical application method described above. The treated insects were reared on seedlings cultured in the rearing box without soil at 277 1 1C with a 16 h:8 h light:dark photoperiod. Three days later, the surviving insects were transferred to a caged rearing box (37 37 35 cm3) with fresh rice.
10 8 6 4 2 0 S G0 G1 G2 G3 G4 G5 G6 G7 G8 Generation
Fig. 1. Changes of LD50 value over generations. All experiments were performed three times and the results are the mean7 SE.
S. Ling, H. Zhang / Ecotoxicology and Environmental Safety 98 (2013) 187–190
a
a SOD activity (U) SOD Expression fold
a a
8
a
a
10 9
a
a
8 7 6
6
aa
4
a aa a
aa
aa
5 4
aa
3 2 1 0
0 S
G0
G1
G2
G3
G4
G5
G6
G7
POD activity (U)
10
11
SOD Expression fold
SOD activity (U)
13 12
12
2
14
4.2 3.9 3.6 3.3 3.0 2.7 2.4 2.1 1.8 1.5 1.2 0.9 0.6 0.3 0.0
a
A
CAT activity (U) CAT Expression fold
B
BB
B
C C
S
B
B
G0
B
G1
B B
G2
B
G3
B
B
B
B
G4
G5
G6
G7
G8
26 24 22 20 18 16 14 12 10 8 6 4 2 0 -2
CAT Expression fold
CAT activity (U)
A
B
a
3.2
a
2.8 2.4
a
a a a
a
a
a
a
a
a
a
a
a
2.0 1.6 1.2 0.8 0.4
G0
G1
G2
G3
G4
G5
G6
G7
0.0 G8
Generation
Fig. 2. SOD activity (U) of the BPH macropterous females (3 day old) by the microtopical application and quantitative real-time PCR data for the mRNA expression levels of SOD genes in 10 samples. The expression value of control (S) population was converted to 1. Values are reported as mean 7 SE, and bars with the same letters indicate that means are not significantly different at the p o 0.05 level. Values are normalized relative to β-actin transcript levels. Each treatment and control was replicated three times. Data were transformed by arcsine transformation before LSD test. Means within column followed by the same letter are not significantly different (p 40.05 or p 40.01, LSD test). Data in the figure were before arcsine transformation.
B
3.6
a
Generation
26 24 22 20 18 16 14 12 10 8 6 4 2 0 -2
4.0
a
POD activity(U) POD Expression fold
S
G8
a
a
POD Expression fold
14
189
Generation Fig. 3. CAT enzyme activity (U) of the BPH macropterous females (3 day old) by the microtopical application and quantitative real-time PCR data for the mRNA expression levels of CAT genes in 10 samples. The expression value of control (S) population was converted to 1. Values are reported as mean 7 SE, and bars with different letters indicate that means are significantly different at the p o 0.01 level. Values are normalized relative to β-actin transcript levels. Each treatment and control was replicated three times. Data were transformed by arcsine transformation before LSD test. Means within column followed by the same letter are not significantly different (p 40.05 or p 40.01, LSD test). Data in the figure were before arcsine transformation.
activities and LD50 in the full course did not reach the significant level, respectively. But Linear (stepwise) regression analysis showed that the correlation coefficient between CAT activities and LD50 in the ful1 course was 0.969 (R2 ¼0.939 and p o0.01). CAT and POD activities were significantly increased in the 3-day old macropterous females selected by chlorpyrifos from S to G8. CAT activities were positively correlated with SOD activities and POD activities in BPH. Ten sample genes from N. lugens before and after resistance development were selected for the analysis. As shown in Fig. 3, CAT transcript levels gradually increased from S strain to G7, and the average values of CAT mRNA expression in G8 were significantly higher than the control (Fig. 3). It increased to the level that was 23.6 times the control level in S strain. Linear (stepwise) regression analysis showed that the correlation
Fig. 4. POD enzyme activity (U) of the BPH macropterous females (3 day old) by the microtopical application and quantitative real-time PCR data for the mRNA expression levels of POD genes in 10 samples. The expression value of control (S) population was converted to 1. Values are reported as mean7 SE, and bars with the same letters indicate that means are not significantly different at the po 0.05 level. Values are normalized relative to β-actin transcript levels. Each treatment and control was replicated three times. Data were transformed by arcsine transformation before LSD test. Means within column followed by the same letter are not significantly different (p 40.05 or p 40.01, LSD test). Data in the figure were before arcsine transformation.
coefficient between CAT mRNA expression and LD50 in the ful1 course was 0.985 (R2 ¼ 0.971 and po 0.01). However, the average values of SOD mRNA expression in G8 were not significantly higher than the control and it increased to the level that was 10.7 times the control level in S strain (Fig. 2). The average POD mRNA expression in G8 increased to the level that was 3.6 times the control level in S strain (Fig. 4). Regression analysis (Curve Estimation of SPSS) showed their relationships between SOD mRNA expression and LD50 of each generation, POD mRNA expression and LD50 in the full course were in no-linear modes (Quadratic curve mode and Cubic curve mode, respectively). Moreover, the correlation coefficients between two variables did not reach the significant level. These results indicated that due to some changes of CAT activity in the resistance development, the CAT changes were the important factors in response to chlorpyrifos resistance-induced oxidative stress. Glutathione S-transferase and cytochrome P450 monooxygenase mainly contributed to chlorpyrifos detoxification (Table 1). This result was in agreement with Wang's inference (Wang et al., 2010) that the enhanced activities of carboxylesterase would be the important mechanism for chlorpyrifos resistance in the planthopper. In summary, significant differences in CAT were revealed between the resistant population and the susceptible population (Fig.3), indicating that CAT was the important response to chlorpyrifos toxicity. Our study confirms that the antioxidant enzymes, in particular CAT activities, are much involved in chlorpyrifos stress.
4. Discussion From the related changes between LD50 and SOD activity, CAT activity, POD activity in the successive selection generations, it was found that they played different roles. In the resistance development, although all the SOD activity, CAT activity and POD activity all changed in the ful1 course, only the change of CAT activity was significantly correlated with that of LD50, which indicated that CAT would be an important factor in chlorpyrifos-causing oxidative stress.
190
S. Ling, H. Zhang / Ecotoxicology and Environmental Safety 98 (2013) 187–190
5. Conclusion
Table 1 Data of GST and P450 of BPH from S strain to G8. Generation
GSTs
P450
S (control) G0 G1 G2 G3 G4 G5 G6 G7 G8
9.69 70.77 11.7071.76 13.90 71.90 27.51 73.43 36.3376.47 48.30 711.77 42.2479.88 50.27 713.11 90.93 723.59 119.72 741.67
2.23 7 0.39 4.87 7 0.83 5.39 7 1.30 5.56 7 1.53 5.99 7 1.48 7.02 7 1.97 6.017 1.83 6.127 1.57 6.53 7 1.28 7.277 1.91
Mean 7 SE of three replicates. Student's t-test: * and ** indicate significant differences between the treatment and control at po 0.05 and p o 0.01, respectively. Data in the table are the average activity (mM/min/mg).
The measurement of enzyme activity could be a useful indicator of the ecological fitness of resistant insect (Ling et al., 2011; Ling and Zhang, 2011). An elevated esterase-based mechanism is the major organophosphate resistance mechanism reported in rice planthopper (Zhang et al., 2012; Kwon et al., 2012; Latif et al., 2010). Therefore, the measurement of general esterase activity within BPH may provide a diagnostic tool for resistance management. In our experiment, resistance selection with chlorpyrifos showed that along with the increase of resistance of BPH, the SOD, CAT and POD activities in the selected strain became higher. That is to say, an increasing of LD50 values were parallel to increasing of enzyme activities involved in antioxidant cascade. It was shown that the activities of SOD, CAT and POD were all elevated in a similar manner during the resistance development, especially CAT, indicating that chlorpyrifos stimulated successive antioxidant cascade. These results suggested that CAT could act as the biomarker in the chlorpyrifos-mediating oxidative pathway. Hydrogen peroxide is thought to be produced in response to insecticide stress on the insect. The level of hydrogen peroxide is mediated by the presence of insect antioxidant enzymes such as CAT and POD. Insect antioxidant enzymes serve to catalyze the reduction of toxic intermediates of oxygen metabolism to prevent cellular damage (Heng-moss et al., 2004;Wang et al., 2010). The results by qRT-PCR showed that CAT was not directly involved in chlorpyrifos detoxification, but could be transcriptionally induced by chlorpyrifos. The expression levels under chlorpyrifos treatment in G8 were notably higher than those of the control group, indicating that chlorpyrifos greatly upregulated CAT gene expression. Selection of BPH with increasing dose of chlorpyrifos might be the cause of the elevation in CAT activity. H2O2 was a signaling agent and the regulation of H2O2 levels was of utmost importance in BPH cell metabolism. During the resistance selection from Go to G8, accumulation of H2O2 in BPH initiated signaling responses that included CAT activation and its gene expression which caused the increase of CAT activity. The CAT upregulation would help to reduce the build-up of ROS. Therefore, in latter generation CAT expression was high compared to early generation. We believe that significant increase of CAT activity allows the insect to detoxify peroxides from tissues and can be used as an index in the experiment. Changes in antioxidant enzyme activities in BPH in response to chlorpyrifos-induced oxidative stress would provide interesting information on the mechanism of action of the OP insecticide. Hence, it was possible for CAT as the bioindicator for assessing the toxicity of chlorpyrifos in BPH.
In summary, CAT mRNA was specifically induced in the presence of chlorpyrifos. It was suggested that the intensified CAT enzyme activities contributed to enhancing BPH antioxidant capacity and population growth. It was supposed that the CAT effect of oxidative stress in N. lugens may have a certain relationship with BPH Chlorpyrifos resistance development through an unknown pathway, which needs to be investigated in the next research.
Acknowledgments The authors thank State Key Laboratory for Biocontrol of Sun Yat-Sen University. This study was supported by the grants of the Nature Science Foundation of China, the Nature Science Foundation of Hubei and China Science & Technology Support Project (2008BADA5B01). References Anna, L.H., 2010. Role of oxidative stress in organophosphate insecticide toxicity – short review. Pestic. Biochem. Physiol. 98, 145–150. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein–dye binding. Anal. Biochem. 72, 248–254. Buyukguzeli, E., Kalender, Y., 2007. Penicillin-induced oxidative stress: effects on antioxidative response of midgut tissues in instars of Galleria mellonella. J. Econ. Entomol. 100, 1533–1541. Fridovich, I., 1978. The biology of oxygen radicals. Science 201, 875–880. Ge, L.Q., Cheng, Y., Wu, J.C., Jahn, G.C., 2011. Proteomic analysis of insecticide triazophos-induced mating-responsive proteins of Nilaparvata lugens Stål (Hemiptera: Delphacidae). J. Proteome Res. 10, 4597–4612. Heng-moss, T., Sarath, G., Baxendale, F., Novak, D., Bose, S., Ni, X., Quisenberry, S., 2004. Characterization of oxidative enzyme changes in buffalograsses challenged by Blissus occiduus. J. Econ. Entomol. 97, 1086–1095. Kwon, D.H., Min, S., Lee, S.W., Park, J.H., Lee, S.H., 2012. Monitoring of carbamate and organophosphate resistance levels in Nilaparvata lugens based on bioassay and quantitative sequencing. J. Asia Pac. Entomol. 15, 635–639. Latif, M.A., Omar, M.Y., Tan, S.G., Siraj, S.S., Ismail, A.R., 2010. Biochemical studies on malathion resistance, inheritance and association of carboxylesterase activity in brown planthopper, Nilaparvata lugens complex in Peninsular Malaysia. Insect Sci. 17, 517–526. Ling, S.F., Zhang, R.J., 2011. Cross resistance of bisultap resistant strain of Nilaparvata lugens and its biochemical mechanism. J. Econ. Entomol. 104, 243–249. Ling, S.F, Zhang, H., Zhang, R., 2011. Effect of fenvalerate on the reproduction and fitness costs of the brown planthopper, Nilaparvata lugens and its resistance mechanism. Pestic. Biochem. Physiol. 101, 148–153. Marklund, S., Marklund, G., 1974. Involvement of the superoxide anion radical in the autoxidation of pyrogallol and a convenient assay for superoxide dismutase. Eur. J. Biochem. 47, 469–474. Ni, X., Quisenberry, S.S., Heng-moss, T., Markwell, J., Sarath, G., Klucas, R., Baxendale, F., 2001. Oxidative responses of resistant and susceptible cereal leaves to symptomatic and nonsymptomatic cereal aphid (Hemiptera: Aphididae) feeding. J. Econ. Entomol. 94, 743–751. Tang, J., Li, J., Shao, Y., Yang, B., Liu, Z., 2010. Fipronil resistance in the whitebacked planthopper (Sogatella furcifera): possible resistance mechanisms and crossresistance. Pest Manag. Sci. 66, 121–125. Theorell, H., 1951. In: Sumner, B., Myrback, K. (Eds.), In The Enzymes, vol. 2. Academic Press, New York, p. 397. Thomaz, J.M., Martins, N.D., Monteiro, D.A., Rantin, F.T., Kalinin, A.L., 2009. Cardiorespiratory function and oxidative stress biomarkers in Nile tilapia exposed to the organophosphate insecticide trichlorfon (NEGUVON). Ecotoxicol. Environ. Saf. 72, 1413–1424. Velki, M., Kodrík, D., Vecera, J., Hackenberger, B.K., Socha, R., 2011. Oxidative stress elicited by insecticides: a role for the adipokinetic hormone. Gen. Comp. Endocr. 172, 77–84. Wang, L.H., Zhang, Y.L., Han, Z.J., Liu, Y.H., Fang, J.C., 2010. Cross-resistance and possible mechanisms of chlorpyrifos resistance in Laodelphax striatellus (Fallen). Pest Manag. Sci. 66, 1096–1100. Zhang, Y.L., Wang, L.H., Guo, H.F., Li, G..Q., Zhang, Z.C., Xie, L., Fang, J.C., 2012. A transcriptome-based screen of carboxylesterase-like genes that are involved in chlorpyrifos resistance in Laodelphax striatellus (Fallén). Pestic. Biochem. Physiol. 104, 224–228.