- Email: [email protected]
Influenza virus NS1 protein mutations at position 171 impact innate interferon responses by respiratory epithelial cells
Accepted Manuscript Title: Influenza Virus NS1 Protein Mutations at Position 171 Impact Innate Interferon Responses by Respiratory Epithelial Cells Authors: Ewan P. Plant, Natalia A. Ilyushina, Faruk Sheikh, Raymond P. Donnelly, Zhiping Ye PII: DOI: Reference:
S0168-1702(17)30201-0 http://dx.doi.org/doi:10.1016/j.virusres.2017.07.021 VIRUS 97206
To appear in:
Virus Research
Received date: Revised date: Accepted date:
7-3-2017 21-7-2017 26-7-2017
Please cite this article as: Plant, Ewan P., Ilyushina, Natalia A., Sheikh, Faruk, Donnelly, Raymond P., Ye, Zhiping, Influenza Virus NS1 Protein Mutations at Position 171 Impact Innate Interferon Responses by Respiratory Epithelial Cells.Virus Research http://dx.doi.org/10.1016/j.virusres.2017.07.021 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Influenza Virus NS1 Protein Mutations at Position 171 Impact Innate Interferon Responses by Respiratory Epithelial Cells
Ewan P. Planta,1,2, Natalia A. Ilyushinab,1, Faruk Sheikhb, Raymond P. Donnellyb, Zhiping Yea.
a
Division of Viral Products, Center for Biologics Evaluation and Research, US Food and Drug Administration, 10903 New Hampshire Ave., Silver Spring, MD., USA b
Division of Biotechnology Research and Review II, Center for Drug Evaluation and Research, US Food and Drug Administration, 10903 New Hampshire Ave., Silver Spring, MD, USA 1
These authors contributed equally.
[email protected] [email protected] [email protected] [email protected] [email protected]
2
Corresponding Author.
Highlights Influenza A virus NS1 protein suppresses host cell immune responses Mutations at position 171 result in decreased interferon expression Effect is context specific, not amino acid specific
Abstract The influenza virus NS1 protein interacts with a wide range of proteins to suppress the host cell immune response and facilitate virus replication. The amino acid sequence of the 2009 pandemic virus NS1 protein differed from sequences of earlier related viruses. The functional impact of these differences has not been fully defined. Therefore, we made mutations to the NS1 protein based on these sequence differences, and assessed the impact of these changes on host cell interferon (IFN) responses. We found that viruses with mutations at position 171 replicated efficiently but did not induce expression of interferon genes as effectively as wild-type viruses in A459 lung epithelial cells. The decreased ability of these NS1 mutant viruses to induce IFN gene and protein expression correlated with decreased activation of STAT1 and lower levels of IFN-stimulated gene (ISG) expression. These findings demonstrate that mutations at position 171 in the NS1 protein result in decreased expression of IFN and ISGs by A549 cells. Consequently, these viruses may be more virulent than the parental strains that do not contain mutations at position 171 in the NS1 protein.
Keywords Influenza, Interferon, ISG, A459 cells, STAT1, NS1
Funding This project was supported in part by Grant No. 2011094 from the FDA Medical Countermeasures (MCM) Program to RPD, and FDA intramural funds, Program No. Z01 BK 02022-14 LPRVD to ZY.
1. Introduction The activation of the innate immune response after influenza virus infection is an important mechanism for controlling viruses that emerge each season. Influenza viruses in turn express proteins that suppress the innate immune response. The non-structural protein, NS1, is the major viral protein that targets the immune system, and is known to interact with many cellular proteins (Hale et al., 2008). The NS1 protein sequence varies between influenza strains, and there is concern that mutations in this protein or introduction of a new NS1 sequence through reassortment may alter the host range, infectivity or pathogenesis of a virus (Forbes et al., 2012; Thepmalee et al., 2013). Identifying NS1 amino acid sequence differences in new pandemic strains is important because of the role of the NS1 protein as an innate immune antagonist. The NS1 protein has been shown to bind dsRNA and mask viral RNA species from recognition by the host cells (Donelan et al., 2003; Wang et al., 1999). NS1 also interacts with retinoic acid-inducible gene I (RIG-I) and its co-activator, TRIM25, leading to impaired activation of the IRF3, ATF/c-Jun and NF-κB transcription factors (Gack et al., 2009; Ludwig et al., 2002; Wang et al., 2000). In addition, NS1 can interact with PKR and inhibit its activation (Bergmann et al., 2000; Li et al., 2006). The interaction of the NS1 protein with multiple host proteins makes it difficult to delineate the exact mechanism of action, and the same outcome observed in different species may be the result of different protein interactions (Rajsbaum et al., 2012). There is variation in the ability of different NS1 proteins to inhibit the IFN-β pathway (Hayman et al., 2006). It was previously shown that the 2009 pandemic H1N1 virus did not strongly induce interferon production responses in monocyte-derived dendritic cells (Osterlund et al., 2010). These weak antiviral responses could result in more severe or more prolonged infection.
Determining if changes in the NS1 protein sequence are associated with differences in the innate immune response is useful information that can be used to guide the response to emerging strains. Here we investigated the interferon response of respiratory epithelial cells infected with virus containing a 2009 pandemic strain NS1 sequence. We also examined the effects of changes in amino acid residue 171 because this residue differs between the 2009 pandemic strains and earlier H1N1 strains.
2. Materials & Methods The A/California/04/2009 (H1N1, CA/04) strain was kindly provided by the USA Center for Disease Control, Atlanta. The NS segment was amplified using PCR primers 5’GAAGTTGGGGGGGAGCAAAAGCAGGGTG and 5’CCGCCGGGTTATTAGTAGAAACAAGGGTG and cloned into the pHW2000 plasmid. A reassortant virus containing the NS segment from A/California/04/2009 and the remaining seven segments from the high growth strain A/Puerto Rico/8/34 (H1N1, PR8) was generated by plasmid transfection (Hoffmann et al., 2002). Co-cultured 293T and Madin-Darby canine kidney (MDCK) cells were transfected with 0.5μg of each of the plasmids expressing the eight viral segments with 3μl of TransIT-293 (Mirus Bio) in 200 μl of Opti-MEM (Invitrogen). After 72 hours the virus was rescued and amplified in allantoic cavity of 9 day old embryonated hen’s eggs at 33°C. Allantoic fluid was harvested and viral titer was determined by plaque assay in MDCK cells. Plaque assays were performed in MDCK cells overlaid with Eagle’s Minimum Essential Media (Quality Biologicals) and 0.8% agar (final concentration) containing 2μg/mL TPCK-trypsin (Sigma-Aldrich). Plates were incubated at 33°C or 35°C for 72 hours. Mutant viruses were generated via reverse genetics. Viruses containing the wild-type segment 8 from either PR8 or CA/04 and the remaining segments from PR8 were created. The A171Y change in the NS1 gene was made by replacing the alanine codon with a tyrosine codon in the PR8 virus to create PR8-A171Y. The tyrosine codon of the NS1 gene in the CA/04 virus was replaced with alanine or asparagine to create viruses CA/04-Y171A and CA/04-Y171N respectively. Mutations to the plasmid DNA were made using the QuikChange II XL SiteDirected Mutagenesis Kit (Stratagene, Santa Clara, CA). 293T and MDCK cells were transfected and virus was recovered as described above. Segment 8 sequences from each virus
isolated were confirmed by sequencing PCR products amplified from each virus stock (first egg passage). Viral RNA was extracted using QIAamp Viral RNA mini kit (Qiagen), cDNA synthesized using SuperScript III (Invitrogen), and the NS segment PCR amplified using the primers described above. Multistep growth curves were performed by incubating A549 cells infected at a multiplicity of infection (MOI) of 0.005 in E-MEM containing 0.2μg/mL TPCK-trypsin at 37°C. Cell supernatants were harvested at different time points and titrated by plaque assay. Measurement of NS1 gene expression. Total cellular RNA was isolated from virusinfected A549 cells (MOI = 5) using PureLink RNA mini kit (Invitrogen, Carlsbad, CA). The RNA samples were then then reverse-transcribed to cDNA with Superscript IV reverse transcriptase (Invitrogen). The cDNAs were mixed with PowerUp SYBR green Master Mix (Applied Biosystems, Waltham, MA), and qPCR analyses were performed using the Mx3000P instrument (Stratagene). NS1 gene copy numbers were assayed using primers AGTATGTCCTGGAAGAGAAGG and ACTGAAAGCGAACTTCAGTG. Changes in NS1 levels were expressed as the mean-fold increase relative to the untreated control gene expression levels. Values represent the mean and standard deviation of three separate qPCR experiments. Measurement of IFNs and IFN-stimulated genes (ISGs) expression. Quantification of changes in gene expression was carried out by qPCR analyses of individual IFNs and ISGs (i.e., IFNB1, IFNL1, IFNL2/3, IFIT1, IFIT3, and MX1 genes). Total cellular RNA was isolated from virus-infected A549 cells (MOI = 2) using RNeasy Minikit (Qiagen, Germantown, MD). The RNA samples were then treated with DNase, and 1 μg of each purified RNA sample was then reverse-transcribed to cDNA with Quantiscript reverse transcriptase (Qiagen). The cDNAs were mixed with RT2 SYBR® green qPCR Mastermix (Qiagen), and qPCR analyses were performed
using the ViiATM 7 instrument (Applied Biosystems, Waltham, MA). IFNB1, IFNL1, and IFNL2/3 gene copy numbers were assayed using Taqman gene expression assay primer/probe sets and master mix (Life Technologies, Carlsbad, CA) and ViiATM 7 software v.1.2.2 (Applied Biosystems). The values were determined by comparison to standard curves for each gene. Changes in ISGs expression levels were expressed as the mean-fold increase relative to the untreated control gene expression levels after normalization to the housekeeping gene, GAPDH. Graphing and statistical analysis of the qPCR results were performed using Prism 6.0 (GraphPad Software). Values represent the mean ± standard deviation (SD) of triplicate measurements. Enzyme-linked immunosorbent assay (ELISA). The secreted levels of IFN-λ1 and IFNλ2/3 from A549 cells supernatants were analyzed using ELISA kits supplied by BioLegend (San Diego, CA) and RayBiotech Inc. (Norcross, GA), respectively. ELISA to detect human IFN-β was supplied by PBL Biomedical Laboratories (Piscataway, NJ). Western blot. The levels of tyrosine-phosphorylated STAT1 were measured by Western blot analysis as described previously (Dickensheets et al., 2013). Whole cell lysates were prepared from virus-infected A549 cultures (MOI = 2) at the indicated time points. Proteins were resolved by electrophoresis on 8% polyacrylamide Tris-Glycine gels (Invitrogen, Carlsbad, CA), and then transferred to polyvinylidene difluoride (PVDF) membranes. The levels of tyrosine-phosphorylated STAT1 were then measured by immunoblotting with mouse monoclonal anti-phospho-Y701-STAT1 Ab (Cell Signaling Technology, Beverly, MA).
3. Results The NS1 protein sequences from the pandemic H1N1 California/04/2009 virus and PR8 were compared. The two proteins are highly homologous sharing 83% identity at the amino acid level. The key residues involved in RNA binding and in the nuclear localization sequence located in the RNA binding domain (residues 1-73) are identical. There are several differences in the effector domain that may affect protein:protein interactions. Some of these differences, such as the CPSF30 binding domain and the C-terminal PDZ ligand motif, have been analyzed by other groups (Hale et al., 2010a; Hale et al., 2010b). The proteins differ at position 171 with a tyrosine present in PR8 and an alanine in CA/04. This difference has not been examined previously. Viruses containing segment 8 from PR8 and CA/04 in a PR8 background were created using reverse genetics. Additional viruses were made with changes to the codon for amino acid position 171 (Table 1). The alanine codon in the PR8 sequence was replaced with tyrosine codon (creating virus PR8-A171Y), and the tyrosine codon in the CA/04 sequence was replaced with an alanine codon (creating virus CA/04-Y171A). An asparagine is encoded at position 171 in several other H1N1 viruses, and the alanine codon in the CA/04 sequence was replaced with asparagine codon to create the CA/04-Y171N variant. After confirming the presence of the mutations by sequencing, the viruses were analyzed for plaque formation, growth and temperature sensitivity. The A171Y mutation in the PR8 NS1 gene resulted in a more opaque, diffuse plaque phenotype compared to that of the PR8 virus on MDCK cells (Fig. 1). Inclusion of the CA/04 NS1 gene with or without mutations at position 171 did not alter plaque phenotype. Multistep growth curves on A549 cells (a human lung epithelial cell line) showed that PR8A171Y grew to a higher titer (Fig. 2A). The CA/04-Y171A and CA/04-Y171N viruses took
longer to reach the same titer as the CA/04 virus. The NS1 expression levels of the viruses were measured 24 hours post-infection. The faster growing viruses had higher levels of NS1 expression at this timepoint (Fig. 2B). The viruses containing segment 8 from the CA/04 virus were temperature sensitive at 39°C with titers more than two log lower than at 33°C on MDCK cells (Table 1). A major function of the NS1 protein is to suppress the host cell immune response after infection. The infected cell upregulates expression of interferons and interferon stimulated genes (ISGs) to counteract the viral infection. To examine the potential effects of mutations at position 171 in the NS1 protein on the ability of the viruses to induce interferon gene expression, we infected A549 cells with the PR8, PR8-A171Y, CA/04, CA/04-Y171A or CA/04-Y171N viruses at a MOI of 2. After incubation for 24, 48 or 72 hours, the levels of IFNB1, IFNL1, and IFNL2/3 gene expression were measured by qPCR. Infection with the wild-type PR8 virus, the CA/04 virus or the CA/04-Y171A variant induced much higher levels of IFNB1 gene expression at 24 hpi compared to infection with viruses containing the PR8-A171Y and CA/04-Y171N mutations (Fig. 3A). The IFNB1 mRNA copy numbers decreased significantly at the 48 and 72 hour time points. Similar results were obtained for the IFNL1 and IFNL2/3 genes. However, it is noteworthy that induction of IFNL1 expression was lower in response to PR8 and higher for IFNL2/3 in response to CA/04. To determine if the differences in the levels of IFN gene expression correlated with differences in the levels of IFN protein expression, we performed ELISAs to measure the levels of IFN-, IFN-λ1 and IFN-λ2/3 proteins produced by the infected cells (Fig. 3B). The protein levels for both IFN-λ1 and IFN-λ2/3 reached the highest levels after infection with the wild-type CA/04 virus. The viruses containing the PR8 and CA/04-Y171A NS1 segments resulted in an
intermediate level of each protein, and the viruses containing the PR8-A171Y and CA/04Y171N mutations induced the lowest levels of IFN-λ1 and IFN-λ2/3 production. The IFN proteins produced by A549 cells in response to viral infection can bind and signal via their cognate cell surface receptors. As part of the host cell interferon signaling pathway, STAT1 is phosphorylated. To compare the relative ability of our five viruses to activate STAT1, we prepared whole cell protein extracts from A549 cells after infection with either the parental viruses (PR8 or CA/04) or the position 171 mutant viruses. We then examined the levels of activated (tyrosine-phosphorylated) STAT1 by western blotting. As shown in Fig. 4A, the levels of phosphorylated STAT1 were significantly increased in all samples at 24 hours post-infection. However, at the 48 hour time point, the levels of phosphorylated STAT1 were lower for the PR8A171Y mutant compared to the PR8 virus. They were also lower for the CA/04-Y171A and CA/04-Y171N mutants compared to the wild-type CA/04 virus. These findings indicated that mutations in the NS1 171 residue can result in decreased interferon responses by the target A549 cells. To determine if differences in the levels of STAT1 activity correlated with differences in the ability of the viruses to induce interferon-stimulated gene (ISG) expression, we measured expression levels of three different ISGs at several time points post infection. A549 cells were infected, and expression levels of the interferon-stimulated genes (IFIT1, IFIT3 and MX1) were measured at several time points post-infection (Fig. 4B). Expression of all three of these genes increased significantly at the 24 hour time point following infection with either the wild-type PR8 or CA/04 viruses. However, infection with the CA/04-Y171N mutant virus resulted in delayed expression of these ISGs. Infection by the PR8-A171Y virus resulted in the lowest induction of the interferon-stimulated genes. These findings demonstrate that there was a good
correlation between the levels of STAT1 activity and the levels of ISG expression induced by these viruses. In particular, the PR8-A171Y mutant was a very weak activator of ISG expression in A549 cells, and this correlated with the very low levels of IFN gene and protein expression induced by this virus (Fig. 3).
4. Discussion There is considerable variation in the ability of different NS1 proteins to inhibit the IFN-β pathway (Hayman et al., 2006). It has been noted previously that pandemic H1N1 viruses induce weak cytokine responses in human macrophages, dendritic cells and lung epithelial cells (Mukherjee et al., 2011; Osterlund et al., 2010). Here we assessed the effects of NS1 from the CA/04 influenza A virus in the PR8 background. We found that a virus engineered to contain the CA/04 NS1 segment was able to induce an interferon expression at least as effectively as the virus with the PR8 NS1 protein; however, mutations at position 171 significantly altered these responses. An open reading frame on the non-coding strand of segment 8 has been identified that ends at position 171 in NS1 when a tyrosine is present (Baez et al., 1980). When an alanine or asparagine is present, this unconventional open reading frame extends for another 82-131 codons depending on the strain. It is not known why the non-conventional open reading frame is maintained or even if it is functional (Sabath et al., 2011; Vasin et al., 2014). The putative protein encoded by the non-conventional reading frame has been designated NEG8. Our analysis does not address the existence or function of NEG8, or if the mutations we introduced affect the spliced gene product, NEP. Differences in the cellular responses after infection with the CA/04-Y171A or CA/04-Y171N viruses (which both have 217 amino acid putative NEG8 proteins and identical NEP proteins) indicate that position 171 in the NS1 gene itself affects interferon induction. Our findings demonstrate that the A171Y change in the PR8 background increased the abundance of NS1 expression and significantly reduced IFNB1, IFNL1, and IFNL2/3 gene expression (p < 0.01). As a result, IFN-β, IFN-λ1 and IFN-λ2/3 protein production and induction
of interferon stimulated genes IFIT1, IFIT3 and MX1 was also reduced. The opposite change to the CA/04 NS1 protein was less dramatic because after infection with either the CA/04 or CA/04-Y171A virus interferon expression levels were similar to or higher than those induced by infection with the PR8 virus. This suggests that the protein sequence surrounding the 171 mutations plays a significant role in modulating the interferon response. Interestingly both mutations to the CA/04-derived segment resulted in lower levels of NS1 expression. The origin of the NS1 segment also had a role in temperature sensitivity regardless of the amino acid at position 171 because all of the viruses with a CA/04-derived NS1 segment did not grow at 39°C, whereas those with a PR8 derived NS1 sequence did. We did not determine if the amino acid at 171 affected the folding of NS1 or interactions between NS1 and other proteins. A comparison of viruses isolated from different patients (Farooqui et al., 2012) and viruses with different NS1 proteins (Shelton et al., 2012) indicate that the speed of replication plays more of a contributory role to virulence than the NS1 protein. A correlation between the viral replication rates and NS1 expression for the different viruses was observed in A549 cells in this study. However, this did not correlate with the induction of interferon observed for each of the viruses which suggests that different mechanisms control replication efficiency and suppression of the host response. A difference in plaque morphology on MDCK cells and viral titer in A549 cells was observed for the PR8-A171Y virus. This indicates that A171Y differed in its ability to spread between cells. The PR8-A171Y virus also induced the lowest levels of interferon gene and protein expression and the lowest levels of interferon stimulated genes. Our findings demonstrate that mutations at position 171 in the NS1 protein result in decreased expression of IFN and IFN-stimulated genes by lung epithelial cells. These findings extend our
understanding of the critical role of the influenza A virus NS1 protein in negatively regulating innate antiviral responses.
1
NEG8 (86)
2
Titer 33°C
2
Virus
NS1 (171)
NEP (14)
Titer 39°C
PR8
A
L
A (168)
7.0 (±0.4)
8.7 (±1.8)
PR8-A171Y
Y
M
* (86)
7.8 (±0.6)
8.3 (±0.5)
CA/04
Y
M
* (86)
7.9 (±0.7)
<5
CA/04-Y171A
A
L
A (217)
7.7 (±0.6)
<5
CA/04-Y171N
N
L
I (217)
7.4 (±0.5)
<5
Table 1. Virus Characteristics. The identities of the amino acid at position 171 in the NS1 protein, position 14 in the NEP protein and position 86 in the NEG8 open reading frame on the non-coding strand are shown. 1The length of the NEG8 ORF is shown in parentheses, * indicates the presence of a stop codon at position 86. 2Titers are shown as log10 values and the lower limit of the plaque assay used for the temperature sensitivity experiment is 1.0 x 105 PFU/mL.
Figure 1. Virus stocks were plaqued in MDCK cells. Photographs of representative plaques for each of the viruses are shown. Virus with altered plaque morphology is indicated by an arrow.
Figure 2. Multistep Growth Curves. (A) A549 cells were infected with viruses at MOI = 0.005 and cell supernatants were titrated by plaque assay. °, P < 0.01 compared with the value for PR8 or CA/04 virus (unpaired two-tailed t-test or one-way ANOVA) (B) A549 cells were infected with the PR8, PR8-A171Y, CA/04, CA/04-Y171A, and CA/04-Y171N viruses at a MOI of 5, and the level of NS1 was quantified by qPCR at 24 hpi. Values represent the mean and standard deviation of three independent qPCR experiments. *, P < 0.05; **, P < 0.01 compared with the value for PR8 (blue) or CA/04 (green) virus (unpaired two-tailed t-test).
Figure 3. Effect of infection by the parental and mutant H1N1 influenza viruses on interferon gene and protein expression in A549 cells. (A) A549 cells were infected with the PR8, PR8-A171Y, CA/04, CA/04-Y171A, and CA/04Y171N viruses at a MOI of 2, and the levels of IFNB1, IFNL1, and IFNL2/3 were quantified by qPCR at 24, 48, and 72 hpi. (B) Supernatants were collected at 24, 48, and 72 hpi, and the levels of secreted proteins were determined by ELISA. °, P < 0.01 compared with the value for PR8 or CA/04 virus (unpaired two-tailed t-test or one-way ANOVA).
Figure 4. Effect of infection by the parental and mutant H1N1 influenza viruses on activation of STAT1 and induction of interferon-stimulated gene (ISG) expression in A549 cells.
(A) Confluent cultures of A549 cells were infected with the PR8, PR8-A171Y, CA/04, CA/04Y171A, and CA/04-Y171N viruses at a MOI of 2. After incubation for 24, 48 or 72 hours at 37C, whole cell protein lysates were prepared. The levels of STAT1 activation were then measured by Western blotting with anti-phospho-Y701-STAT1 Ab. (B) The levels of IFIT1, IFIT3, and MX1 were quantified by qPCR at 24, 48, and 72 hpi. °, P < 0.01 compared with the value for PR8 or CA/04 virus (unpaired two-tailed t-test or one-way ANOVA).
References Baez, M., Taussig, R., Zazra, J.J., Young, J.F., Palese, P., Reisfeld, A., Skalka, A.M., 1980. Complete nucleotide sequence of the influenza A/PR/8/34 virus NS gene and comparison with the NS genes of the A/Udorn/72 and A/FPV/Rostock/34 strains. Nucleic Acids Res 8, 5845-5858. Bergmann, M., Garcia-Sastre, A., Carnero, E., Pehamberger, H., Wolff, K., Palese, P., Muster, T., 2000. Influenza virus NS1 protein counteracts PKR-mediated inhibition of replication. J Virol 74, 6203-6206. Dickensheets, H., Sheikh, F., Park, O., Gao, B., Donnelly, R.P., 2013. Interferon-lambda (IFN-lambda) induces signal transduction and gene expression in human hepatocytes, but not in lymphocytes or monocytes. J Leukoc Biol 93, 377-385. Donelan, N.R., Basler, C.F., Garcia-Sastre, A., 2003. A recombinant influenza A virus expressing an RNAbinding-defective NS1 protein induces high levels of beta interferon and is attenuated in mice. J Virol 77, 13257-13266. Farooqui, A., Leon, A.J., Lei, Y., Wang, P., Huang, J., Tenorio, R., Dong, W., Rubino, S., Lin, J., Li, G., Zhao, Z., Kelvin, D.J., 2012. Heterogeneous virulence of pandemic 2009 influenza H1N1 virus in mice. Virol J 9, 104. Forbes, N.E., Ping, J., Dankar, S.K., Jia, J.J., Selman, M., Keleta, L., Zhou, Y., Brown, E.G., 2012. Multifunctional adaptive NS1 mutations are selected upon human influenza virus evolution in the mouse. PLoS One 7, e31839. Gack, M.U., Albrecht, R.A., Urano, T., Inn, K.S., Huang, I.C., Carnero, E., Farzan, M., Inoue, S., Jung, J.U., Garcia-Sastre, A., 2009. Influenza A virus NS1 targets the ubiquitin ligase TRIM25 to evade recognition by the host viral RNA sensor RIG-I. Cell Host Microbe 5, 439-449. Hale, B.G., Randall, R.E., Ortin, J., Jackson, D., 2008. The multifunctional NS1 protein of influenza A viruses. J Gen Virol 89, 2359-2376. Hale, B.G., Steel, J., Manicassamy, B., Medina, R.A., Ye, J., Hickman, D., Lowen, A.C., Perez, D.R., GarciaSastre, A., 2010a. Mutations in the NS1 C-terminal tail do not enhance replication or virulence of the 2009 pandemic H1N1 influenza A virus. J Gen Virol 91, 1737-1742. Hale, B.G., Steel, J., Medina, R.A., Manicassamy, B., Ye, J., Hickman, D., Hai, R., Schmolke, M., Lowen, A.C., Perez, D.R., Garcia-Sastre, A., 2010b. Inefficient control of host gene expression by the 2009 pandemic H1N1 influenza A virus NS1 protein. J Virol 84, 6909-6922. Hayman, A., Comely, S., Lackenby, A., Murphy, S., McCauley, J., Goodbourn, S., Barclay, W., 2006. Variation in the ability of human influenza A viruses to induce and inhibit the IFN-beta pathway. Virology 347, 52-64. Li, S., Min, J.Y., Krug, R.M., Sen, G.C., 2006. Binding of the influenza A virus NS1 protein to PKR mediates the inhibition of its activation by either PACT or double-stranded RNA. Virology 349, 13-21. Ludwig, S., Wang, X., Ehrhardt, C., Zheng, H., Donelan, N., Planz, O., Pleschka, S., Garcia-Sastre, A., Heins, G., Wolff, T., 2002. The influenza A virus NS1 protein inhibits activation of Jun N-terminal kinase and AP1 transcription factors. J Virol 76, 11166-11171. Mukherjee, S., Vipat, V.C., Mishra, A.C., Pawar, S.D., Chakrabarti, A.K., 2011. Pandemic (H1N1) 2009 influenza virus induces weaker host immune responses in vitro: a possible mechanism of high transmissibility. Virol J 8, 140. Osterlund, P., Pirhonen, J., Ikonen, N., Ronkko, E., Strengell, M., Makela, S.M., Broman, M., Hamming, O.J., Hartmann, R., Ziegler, T., Julkunen, I., 2010. Pandemic H1N1 2009 influenza A virus induces weak cytokine responses in human macrophages and dendritic cells and is highly sensitive to the antiviral actions of interferons. J Virol 84, 1414-1422. Rajsbaum, R., Albrecht, R.A., Wang, M.K., Maharaj, N.P., Versteeg, G.A., Nistal-Villan, E., Garcia-Sastre, A., Gack, M.U., 2012. Species-specific inhibition of RIG-I ubiquitination and IFN induction by the influenza A virus NS1 protein. PLoS Pathog 8, e1003059.
Sabath, N., Morris, J.S., Graur, D., 2011. Is there a twelfth protein-coding gene in the genome of influenza A? A selection-based approach to the detection of overlapping genes in closely related sequences. J Mol Evol 73, 305-315. Shelton, H., Smith, M., Hartgroves, L., Stilwell, P., Roberts, K., Johnson, B., Barclay, W., 2012. An influenza reassortant with polymerase of pH1N1 and NS gene of H3N2 influenza A virus is attenuated in vivo. J Gen Virol 93, 998-1006. Thepmalee, C., Sanguansermsri, P., Suwanankhon, N., Chamnanpood, C., Chamnanpood, P., Pongcharoen, S., Niumsap, P.R., Surangkul, D., Sanguansermsri, D., 2013. Changes in the NS1 gene of avian influenza viruses isolated in Thailand affect expression of type I interferon in primary chicken embryonic fibroblast cells. Indian J Virol 24, 365-372. Vasin, A.V., Temkina, O.A., Egorov, V.V., Klotchenko, S.A., Plotnikova, M.A., Kiselev, O.I., 2014. Molecular mechanisms enhancing the proteome of influenza A viruses: an overview of recently discovered proteins. Virus Res 185, 53-63. Wang, W., Riedel, K., Lynch, P., Chien, C.Y., Montelione, G.T., Krug, R.M., 1999. RNA binding by the novel helical domain of the influenza virus NS1 protein requires its dimer structure and a small number of specific basic amino acids. RNA 5, 195-205. Wang, X., Li, M., Zheng, H., Muster, T., Palese, P., Beg, A.A., Garcia-Sastre, A., 2000. Influenza A virus NS1 protein prevents activation of NF-kappaB and induction of alpha/beta interferon. J Virol 74, 1156611573.
Viral titers (log10PFU/ml)
A 12 10
°
8
°
°
°
6
°°
4 2 0
0
6
24
48
72
96
Hours post-infection
PR8 PR8-A171Y CA/04 CA/04-Y171A CA/04-Y171N
B
PR8
PR8 A1 7 1 Y
CA/ 0 4
CA/ 0 4 Y1 7 1 A CA/ 0 4 Y1 7 1 N
200
° 100
° ° 0
24
48
72
Hours post-infection
500
PR8 PR8-A171Y CA/04 CA/04-Y171A CA/04-Y171N
400 300 200 100 0
0
° °
24
IFNL2/3 400
PR8 PR8-A171Y CA/04 CA/04-Y171A CA/04-Y171N
20
° 10
°
200 100
°° 0
0
°°
° °
24
48
72
Hours post-infection
6 4
°
0
°° 0
24
24
°
48
72
Hours post-infection
IFN-l 2/3
8
2
PR8 PR8-A171Y CA/04 CA/04-Y171A CA/04-Y171N
300
IFN-l 1
30
0
72
Hours post-infection
IFN-b
0
48
°
°
° °
°° 48
72
Hours post-infection
PR8 PR8-A171Y CA/04 CA/04-Y171A CA/04-Y171N
Human IFN-l2/3 (ng/ml)
0
B Human IFN-b (ng/ml)
PR8 PR8-A171Y CA/04 CA/04-Y171A CA/04-Y171N
IFNL1
Copy numbers x 103/100 ng of RNA
300
Copy numbers x 103/100 ng of RNA
IFNB1
Human IFN-l1 (ng/ml)
Copy numbers x 103/100 ng of RNA
A
4
PR8 PR8-A171Y CA/04 CA/04-Y171A CA/04-Y171N
3 2 1 0
° 0
°
24
°
°
48
° °° 72
Hours post-infection
A M o c k
PR8
PR8-A171Y
24 48 72 24 48 72
CA/04
CA/04-Y171A CA/04-Y171N
24 48 72 24 48 72 24 48 72 hpi ¬pY-STAT1
¬STAT1
IFIT3
8
°
6 4 2 0
°° 0
°
24
° °
°
48
72
Hours post-infection
PR8 PR8-A171Y CA/04 CA/04-Y171A CA/04-Y171N
1500
1000
°
500
° 0
° 0
24
°
° °° 48
° ° 72
Hours post-infection
PR8 PR8-A171Y CA/04 CA/04-Y171A CA/04-Y171N
Relative Expression (x103)
IFIT1
Relative Expression
Relative Expression (x103)
B MX1 10
°
8
°
6 4 2 0
° 0
24
° °
°
48
72
Hours post-infection
PR8 PR8-A171Y CA/04 CA/04-Y171A CA/04-Y171N
S0168-1702(17)30201-0 http://dx.doi.org/doi:10.1016/j.virusres.2017.07.021 VIRUS 97206
To appear in:
Virus Research
Received date: Revised date: Accepted date:
7-3-2017 21-7-2017 26-7-2017
Please cite this article as: Plant, Ewan P., Ilyushina, Natalia A., Sheikh, Faruk, Donnelly, Raymond P., Ye, Zhiping, Influenza Virus NS1 Protein Mutations at Position 171 Impact Innate Interferon Responses by Respiratory Epithelial Cells.Virus Research http://dx.doi.org/10.1016/j.virusres.2017.07.021 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Influenza Virus NS1 Protein Mutations at Position 171 Impact Innate Interferon Responses by Respiratory Epithelial Cells
Ewan P. Planta,1,2, Natalia A. Ilyushinab,1, Faruk Sheikhb, Raymond P. Donnellyb, Zhiping Yea.
a
Division of Viral Products, Center for Biologics Evaluation and Research, US Food and Drug Administration, 10903 New Hampshire Ave., Silver Spring, MD., USA b
Division of Biotechnology Research and Review II, Center for Drug Evaluation and Research, US Food and Drug Administration, 10903 New Hampshire Ave., Silver Spring, MD, USA 1
These authors contributed equally.
[email protected] [email protected] [email protected] [email protected] [email protected]
2
Corresponding Author.
Highlights Influenza A virus NS1 protein suppresses host cell immune responses Mutations at position 171 result in decreased interferon expression Effect is context specific, not amino acid specific
Abstract The influenza virus NS1 protein interacts with a wide range of proteins to suppress the host cell immune response and facilitate virus replication. The amino acid sequence of the 2009 pandemic virus NS1 protein differed from sequences of earlier related viruses. The functional impact of these differences has not been fully defined. Therefore, we made mutations to the NS1 protein based on these sequence differences, and assessed the impact of these changes on host cell interferon (IFN) responses. We found that viruses with mutations at position 171 replicated efficiently but did not induce expression of interferon genes as effectively as wild-type viruses in A459 lung epithelial cells. The decreased ability of these NS1 mutant viruses to induce IFN gene and protein expression correlated with decreased activation of STAT1 and lower levels of IFN-stimulated gene (ISG) expression. These findings demonstrate that mutations at position 171 in the NS1 protein result in decreased expression of IFN and ISGs by A549 cells. Consequently, these viruses may be more virulent than the parental strains that do not contain mutations at position 171 in the NS1 protein.
Keywords Influenza, Interferon, ISG, A459 cells, STAT1, NS1
Funding This project was supported in part by Grant No. 2011094 from the FDA Medical Countermeasures (MCM) Program to RPD, and FDA intramural funds, Program No. Z01 BK 02022-14 LPRVD to ZY.
1. Introduction The activation of the innate immune response after influenza virus infection is an important mechanism for controlling viruses that emerge each season. Influenza viruses in turn express proteins that suppress the innate immune response. The non-structural protein, NS1, is the major viral protein that targets the immune system, and is known to interact with many cellular proteins (Hale et al., 2008). The NS1 protein sequence varies between influenza strains, and there is concern that mutations in this protein or introduction of a new NS1 sequence through reassortment may alter the host range, infectivity or pathogenesis of a virus (Forbes et al., 2012; Thepmalee et al., 2013). Identifying NS1 amino acid sequence differences in new pandemic strains is important because of the role of the NS1 protein as an innate immune antagonist. The NS1 protein has been shown to bind dsRNA and mask viral RNA species from recognition by the host cells (Donelan et al., 2003; Wang et al., 1999). NS1 also interacts with retinoic acid-inducible gene I (RIG-I) and its co-activator, TRIM25, leading to impaired activation of the IRF3, ATF/c-Jun and NF-κB transcription factors (Gack et al., 2009; Ludwig et al., 2002; Wang et al., 2000). In addition, NS1 can interact with PKR and inhibit its activation (Bergmann et al., 2000; Li et al., 2006). The interaction of the NS1 protein with multiple host proteins makes it difficult to delineate the exact mechanism of action, and the same outcome observed in different species may be the result of different protein interactions (Rajsbaum et al., 2012). There is variation in the ability of different NS1 proteins to inhibit the IFN-β pathway (Hayman et al., 2006). It was previously shown that the 2009 pandemic H1N1 virus did not strongly induce interferon production responses in monocyte-derived dendritic cells (Osterlund et al., 2010). These weak antiviral responses could result in more severe or more prolonged infection.
Determining if changes in the NS1 protein sequence are associated with differences in the innate immune response is useful information that can be used to guide the response to emerging strains. Here we investigated the interferon response of respiratory epithelial cells infected with virus containing a 2009 pandemic strain NS1 sequence. We also examined the effects of changes in amino acid residue 171 because this residue differs between the 2009 pandemic strains and earlier H1N1 strains.
2. Materials & Methods The A/California/04/2009 (H1N1, CA/04) strain was kindly provided by the USA Center for Disease Control, Atlanta. The NS segment was amplified using PCR primers 5’GAAGTTGGGGGGGAGCAAAAGCAGGGTG and 5’CCGCCGGGTTATTAGTAGAAACAAGGGTG and cloned into the pHW2000 plasmid. A reassortant virus containing the NS segment from A/California/04/2009 and the remaining seven segments from the high growth strain A/Puerto Rico/8/34 (H1N1, PR8) was generated by plasmid transfection (Hoffmann et al., 2002). Co-cultured 293T and Madin-Darby canine kidney (MDCK) cells were transfected with 0.5μg of each of the plasmids expressing the eight viral segments with 3μl of TransIT-293 (Mirus Bio) in 200 μl of Opti-MEM (Invitrogen). After 72 hours the virus was rescued and amplified in allantoic cavity of 9 day old embryonated hen’s eggs at 33°C. Allantoic fluid was harvested and viral titer was determined by plaque assay in MDCK cells. Plaque assays were performed in MDCK cells overlaid with Eagle’s Minimum Essential Media (Quality Biologicals) and 0.8% agar (final concentration) containing 2μg/mL TPCK-trypsin (Sigma-Aldrich). Plates were incubated at 33°C or 35°C for 72 hours. Mutant viruses were generated via reverse genetics. Viruses containing the wild-type segment 8 from either PR8 or CA/04 and the remaining segments from PR8 were created. The A171Y change in the NS1 gene was made by replacing the alanine codon with a tyrosine codon in the PR8 virus to create PR8-A171Y. The tyrosine codon of the NS1 gene in the CA/04 virus was replaced with alanine or asparagine to create viruses CA/04-Y171A and CA/04-Y171N respectively. Mutations to the plasmid DNA were made using the QuikChange II XL SiteDirected Mutagenesis Kit (Stratagene, Santa Clara, CA). 293T and MDCK cells were transfected and virus was recovered as described above. Segment 8 sequences from each virus
isolated were confirmed by sequencing PCR products amplified from each virus stock (first egg passage). Viral RNA was extracted using QIAamp Viral RNA mini kit (Qiagen), cDNA synthesized using SuperScript III (Invitrogen), and the NS segment PCR amplified using the primers described above. Multistep growth curves were performed by incubating A549 cells infected at a multiplicity of infection (MOI) of 0.005 in E-MEM containing 0.2μg/mL TPCK-trypsin at 37°C. Cell supernatants were harvested at different time points and titrated by plaque assay. Measurement of NS1 gene expression. Total cellular RNA was isolated from virusinfected A549 cells (MOI = 5) using PureLink RNA mini kit (Invitrogen, Carlsbad, CA). The RNA samples were then then reverse-transcribed to cDNA with Superscript IV reverse transcriptase (Invitrogen). The cDNAs were mixed with PowerUp SYBR green Master Mix (Applied Biosystems, Waltham, MA), and qPCR analyses were performed using the Mx3000P instrument (Stratagene). NS1 gene copy numbers were assayed using primers AGTATGTCCTGGAAGAGAAGG and ACTGAAAGCGAACTTCAGTG. Changes in NS1 levels were expressed as the mean-fold increase relative to the untreated control gene expression levels. Values represent the mean and standard deviation of three separate qPCR experiments. Measurement of IFNs and IFN-stimulated genes (ISGs) expression. Quantification of changes in gene expression was carried out by qPCR analyses of individual IFNs and ISGs (i.e., IFNB1, IFNL1, IFNL2/3, IFIT1, IFIT3, and MX1 genes). Total cellular RNA was isolated from virus-infected A549 cells (MOI = 2) using RNeasy Minikit (Qiagen, Germantown, MD). The RNA samples were then treated with DNase, and 1 μg of each purified RNA sample was then reverse-transcribed to cDNA with Quantiscript reverse transcriptase (Qiagen). The cDNAs were mixed with RT2 SYBR® green qPCR Mastermix (Qiagen), and qPCR analyses were performed
using the ViiATM 7 instrument (Applied Biosystems, Waltham, MA). IFNB1, IFNL1, and IFNL2/3 gene copy numbers were assayed using Taqman gene expression assay primer/probe sets and master mix (Life Technologies, Carlsbad, CA) and ViiATM 7 software v.1.2.2 (Applied Biosystems). The values were determined by comparison to standard curves for each gene. Changes in ISGs expression levels were expressed as the mean-fold increase relative to the untreated control gene expression levels after normalization to the housekeeping gene, GAPDH. Graphing and statistical analysis of the qPCR results were performed using Prism 6.0 (GraphPad Software). Values represent the mean ± standard deviation (SD) of triplicate measurements. Enzyme-linked immunosorbent assay (ELISA). The secreted levels of IFN-λ1 and IFNλ2/3 from A549 cells supernatants were analyzed using ELISA kits supplied by BioLegend (San Diego, CA) and RayBiotech Inc. (Norcross, GA), respectively. ELISA to detect human IFN-β was supplied by PBL Biomedical Laboratories (Piscataway, NJ). Western blot. The levels of tyrosine-phosphorylated STAT1 were measured by Western blot analysis as described previously (Dickensheets et al., 2013). Whole cell lysates were prepared from virus-infected A549 cultures (MOI = 2) at the indicated time points. Proteins were resolved by electrophoresis on 8% polyacrylamide Tris-Glycine gels (Invitrogen, Carlsbad, CA), and then transferred to polyvinylidene difluoride (PVDF) membranes. The levels of tyrosine-phosphorylated STAT1 were then measured by immunoblotting with mouse monoclonal anti-phospho-Y701-STAT1 Ab (Cell Signaling Technology, Beverly, MA).
3. Results The NS1 protein sequences from the pandemic H1N1 California/04/2009 virus and PR8 were compared. The two proteins are highly homologous sharing 83% identity at the amino acid level. The key residues involved in RNA binding and in the nuclear localization sequence located in the RNA binding domain (residues 1-73) are identical. There are several differences in the effector domain that may affect protein:protein interactions. Some of these differences, such as the CPSF30 binding domain and the C-terminal PDZ ligand motif, have been analyzed by other groups (Hale et al., 2010a; Hale et al., 2010b). The proteins differ at position 171 with a tyrosine present in PR8 and an alanine in CA/04. This difference has not been examined previously. Viruses containing segment 8 from PR8 and CA/04 in a PR8 background were created using reverse genetics. Additional viruses were made with changes to the codon for amino acid position 171 (Table 1). The alanine codon in the PR8 sequence was replaced with tyrosine codon (creating virus PR8-A171Y), and the tyrosine codon in the CA/04 sequence was replaced with an alanine codon (creating virus CA/04-Y171A). An asparagine is encoded at position 171 in several other H1N1 viruses, and the alanine codon in the CA/04 sequence was replaced with asparagine codon to create the CA/04-Y171N variant. After confirming the presence of the mutations by sequencing, the viruses were analyzed for plaque formation, growth and temperature sensitivity. The A171Y mutation in the PR8 NS1 gene resulted in a more opaque, diffuse plaque phenotype compared to that of the PR8 virus on MDCK cells (Fig. 1). Inclusion of the CA/04 NS1 gene with or without mutations at position 171 did not alter plaque phenotype. Multistep growth curves on A549 cells (a human lung epithelial cell line) showed that PR8A171Y grew to a higher titer (Fig. 2A). The CA/04-Y171A and CA/04-Y171N viruses took
longer to reach the same titer as the CA/04 virus. The NS1 expression levels of the viruses were measured 24 hours post-infection. The faster growing viruses had higher levels of NS1 expression at this timepoint (Fig. 2B). The viruses containing segment 8 from the CA/04 virus were temperature sensitive at 39°C with titers more than two log lower than at 33°C on MDCK cells (Table 1). A major function of the NS1 protein is to suppress the host cell immune response after infection. The infected cell upregulates expression of interferons and interferon stimulated genes (ISGs) to counteract the viral infection. To examine the potential effects of mutations at position 171 in the NS1 protein on the ability of the viruses to induce interferon gene expression, we infected A549 cells with the PR8, PR8-A171Y, CA/04, CA/04-Y171A or CA/04-Y171N viruses at a MOI of 2. After incubation for 24, 48 or 72 hours, the levels of IFNB1, IFNL1, and IFNL2/3 gene expression were measured by qPCR. Infection with the wild-type PR8 virus, the CA/04 virus or the CA/04-Y171A variant induced much higher levels of IFNB1 gene expression at 24 hpi compared to infection with viruses containing the PR8-A171Y and CA/04-Y171N mutations (Fig. 3A). The IFNB1 mRNA copy numbers decreased significantly at the 48 and 72 hour time points. Similar results were obtained for the IFNL1 and IFNL2/3 genes. However, it is noteworthy that induction of IFNL1 expression was lower in response to PR8 and higher for IFNL2/3 in response to CA/04. To determine if the differences in the levels of IFN gene expression correlated with differences in the levels of IFN protein expression, we performed ELISAs to measure the levels of IFN-, IFN-λ1 and IFN-λ2/3 proteins produced by the infected cells (Fig. 3B). The protein levels for both IFN-λ1 and IFN-λ2/3 reached the highest levels after infection with the wild-type CA/04 virus. The viruses containing the PR8 and CA/04-Y171A NS1 segments resulted in an
intermediate level of each protein, and the viruses containing the PR8-A171Y and CA/04Y171N mutations induced the lowest levels of IFN-λ1 and IFN-λ2/3 production. The IFN proteins produced by A549 cells in response to viral infection can bind and signal via their cognate cell surface receptors. As part of the host cell interferon signaling pathway, STAT1 is phosphorylated. To compare the relative ability of our five viruses to activate STAT1, we prepared whole cell protein extracts from A549 cells after infection with either the parental viruses (PR8 or CA/04) or the position 171 mutant viruses. We then examined the levels of activated (tyrosine-phosphorylated) STAT1 by western blotting. As shown in Fig. 4A, the levels of phosphorylated STAT1 were significantly increased in all samples at 24 hours post-infection. However, at the 48 hour time point, the levels of phosphorylated STAT1 were lower for the PR8A171Y mutant compared to the PR8 virus. They were also lower for the CA/04-Y171A and CA/04-Y171N mutants compared to the wild-type CA/04 virus. These findings indicated that mutations in the NS1 171 residue can result in decreased interferon responses by the target A549 cells. To determine if differences in the levels of STAT1 activity correlated with differences in the ability of the viruses to induce interferon-stimulated gene (ISG) expression, we measured expression levels of three different ISGs at several time points post infection. A549 cells were infected, and expression levels of the interferon-stimulated genes (IFIT1, IFIT3 and MX1) were measured at several time points post-infection (Fig. 4B). Expression of all three of these genes increased significantly at the 24 hour time point following infection with either the wild-type PR8 or CA/04 viruses. However, infection with the CA/04-Y171N mutant virus resulted in delayed expression of these ISGs. Infection by the PR8-A171Y virus resulted in the lowest induction of the interferon-stimulated genes. These findings demonstrate that there was a good
correlation between the levels of STAT1 activity and the levels of ISG expression induced by these viruses. In particular, the PR8-A171Y mutant was a very weak activator of ISG expression in A549 cells, and this correlated with the very low levels of IFN gene and protein expression induced by this virus (Fig. 3).
4. Discussion There is considerable variation in the ability of different NS1 proteins to inhibit the IFN-β pathway (Hayman et al., 2006). It has been noted previously that pandemic H1N1 viruses induce weak cytokine responses in human macrophages, dendritic cells and lung epithelial cells (Mukherjee et al., 2011; Osterlund et al., 2010). Here we assessed the effects of NS1 from the CA/04 influenza A virus in the PR8 background. We found that a virus engineered to contain the CA/04 NS1 segment was able to induce an interferon expression at least as effectively as the virus with the PR8 NS1 protein; however, mutations at position 171 significantly altered these responses. An open reading frame on the non-coding strand of segment 8 has been identified that ends at position 171 in NS1 when a tyrosine is present (Baez et al., 1980). When an alanine or asparagine is present, this unconventional open reading frame extends for another 82-131 codons depending on the strain. It is not known why the non-conventional open reading frame is maintained or even if it is functional (Sabath et al., 2011; Vasin et al., 2014). The putative protein encoded by the non-conventional reading frame has been designated NEG8. Our analysis does not address the existence or function of NEG8, or if the mutations we introduced affect the spliced gene product, NEP. Differences in the cellular responses after infection with the CA/04-Y171A or CA/04-Y171N viruses (which both have 217 amino acid putative NEG8 proteins and identical NEP proteins) indicate that position 171 in the NS1 gene itself affects interferon induction. Our findings demonstrate that the A171Y change in the PR8 background increased the abundance of NS1 expression and significantly reduced IFNB1, IFNL1, and IFNL2/3 gene expression (p < 0.01). As a result, IFN-β, IFN-λ1 and IFN-λ2/3 protein production and induction
of interferon stimulated genes IFIT1, IFIT3 and MX1 was also reduced. The opposite change to the CA/04 NS1 protein was less dramatic because after infection with either the CA/04 or CA/04-Y171A virus interferon expression levels were similar to or higher than those induced by infection with the PR8 virus. This suggests that the protein sequence surrounding the 171 mutations plays a significant role in modulating the interferon response. Interestingly both mutations to the CA/04-derived segment resulted in lower levels of NS1 expression. The origin of the NS1 segment also had a role in temperature sensitivity regardless of the amino acid at position 171 because all of the viruses with a CA/04-derived NS1 segment did not grow at 39°C, whereas those with a PR8 derived NS1 sequence did. We did not determine if the amino acid at 171 affected the folding of NS1 or interactions between NS1 and other proteins. A comparison of viruses isolated from different patients (Farooqui et al., 2012) and viruses with different NS1 proteins (Shelton et al., 2012) indicate that the speed of replication plays more of a contributory role to virulence than the NS1 protein. A correlation between the viral replication rates and NS1 expression for the different viruses was observed in A549 cells in this study. However, this did not correlate with the induction of interferon observed for each of the viruses which suggests that different mechanisms control replication efficiency and suppression of the host response. A difference in plaque morphology on MDCK cells and viral titer in A549 cells was observed for the PR8-A171Y virus. This indicates that A171Y differed in its ability to spread between cells. The PR8-A171Y virus also induced the lowest levels of interferon gene and protein expression and the lowest levels of interferon stimulated genes. Our findings demonstrate that mutations at position 171 in the NS1 protein result in decreased expression of IFN and IFN-stimulated genes by lung epithelial cells. These findings extend our
understanding of the critical role of the influenza A virus NS1 protein in negatively regulating innate antiviral responses.
1
NEG8 (86)
2
Titer 33°C
2
Virus
NS1 (171)
NEP (14)
Titer 39°C
PR8
A
L
A (168)
7.0 (±0.4)
8.7 (±1.8)
PR8-A171Y
Y
M
* (86)
7.8 (±0.6)
8.3 (±0.5)
CA/04
Y
M
* (86)
7.9 (±0.7)
<5
CA/04-Y171A
A
L
A (217)
7.7 (±0.6)
<5
CA/04-Y171N
N
L
I (217)
7.4 (±0.5)
<5
Table 1. Virus Characteristics. The identities of the amino acid at position 171 in the NS1 protein, position 14 in the NEP protein and position 86 in the NEG8 open reading frame on the non-coding strand are shown. 1The length of the NEG8 ORF is shown in parentheses, * indicates the presence of a stop codon at position 86. 2Titers are shown as log10 values and the lower limit of the plaque assay used for the temperature sensitivity experiment is 1.0 x 105 PFU/mL.
Figure 1. Virus stocks were plaqued in MDCK cells. Photographs of representative plaques for each of the viruses are shown. Virus with altered plaque morphology is indicated by an arrow.
Figure 2. Multistep Growth Curves. (A) A549 cells were infected with viruses at MOI = 0.005 and cell supernatants were titrated by plaque assay. °, P < 0.01 compared with the value for PR8 or CA/04 virus (unpaired two-tailed t-test or one-way ANOVA) (B) A549 cells were infected with the PR8, PR8-A171Y, CA/04, CA/04-Y171A, and CA/04-Y171N viruses at a MOI of 5, and the level of NS1 was quantified by qPCR at 24 hpi. Values represent the mean and standard deviation of three independent qPCR experiments. *, P < 0.05; **, P < 0.01 compared with the value for PR8 (blue) or CA/04 (green) virus (unpaired two-tailed t-test).
Figure 3. Effect of infection by the parental and mutant H1N1 influenza viruses on interferon gene and protein expression in A549 cells. (A) A549 cells were infected with the PR8, PR8-A171Y, CA/04, CA/04-Y171A, and CA/04Y171N viruses at a MOI of 2, and the levels of IFNB1, IFNL1, and IFNL2/3 were quantified by qPCR at 24, 48, and 72 hpi. (B) Supernatants were collected at 24, 48, and 72 hpi, and the levels of secreted proteins were determined by ELISA. °, P < 0.01 compared with the value for PR8 or CA/04 virus (unpaired two-tailed t-test or one-way ANOVA).
Figure 4. Effect of infection by the parental and mutant H1N1 influenza viruses on activation of STAT1 and induction of interferon-stimulated gene (ISG) expression in A549 cells.
(A) Confluent cultures of A549 cells were infected with the PR8, PR8-A171Y, CA/04, CA/04Y171A, and CA/04-Y171N viruses at a MOI of 2. After incubation for 24, 48 or 72 hours at 37C, whole cell protein lysates were prepared. The levels of STAT1 activation were then measured by Western blotting with anti-phospho-Y701-STAT1 Ab. (B) The levels of IFIT1, IFIT3, and MX1 were quantified by qPCR at 24, 48, and 72 hpi. °, P < 0.01 compared with the value for PR8 or CA/04 virus (unpaired two-tailed t-test or one-way ANOVA).
References Baez, M., Taussig, R., Zazra, J.J., Young, J.F., Palese, P., Reisfeld, A., Skalka, A.M., 1980. Complete nucleotide sequence of the influenza A/PR/8/34 virus NS gene and comparison with the NS genes of the A/Udorn/72 and A/FPV/Rostock/34 strains. Nucleic Acids Res 8, 5845-5858. Bergmann, M., Garcia-Sastre, A., Carnero, E., Pehamberger, H., Wolff, K., Palese, P., Muster, T., 2000. Influenza virus NS1 protein counteracts PKR-mediated inhibition of replication. J Virol 74, 6203-6206. Dickensheets, H., Sheikh, F., Park, O., Gao, B., Donnelly, R.P., 2013. Interferon-lambda (IFN-lambda) induces signal transduction and gene expression in human hepatocytes, but not in lymphocytes or monocytes. J Leukoc Biol 93, 377-385. Donelan, N.R., Basler, C.F., Garcia-Sastre, A., 2003. A recombinant influenza A virus expressing an RNAbinding-defective NS1 protein induces high levels of beta interferon and is attenuated in mice. J Virol 77, 13257-13266. Farooqui, A., Leon, A.J., Lei, Y., Wang, P., Huang, J., Tenorio, R., Dong, W., Rubino, S., Lin, J., Li, G., Zhao, Z., Kelvin, D.J., 2012. Heterogeneous virulence of pandemic 2009 influenza H1N1 virus in mice. Virol J 9, 104. Forbes, N.E., Ping, J., Dankar, S.K., Jia, J.J., Selman, M., Keleta, L., Zhou, Y., Brown, E.G., 2012. Multifunctional adaptive NS1 mutations are selected upon human influenza virus evolution in the mouse. PLoS One 7, e31839. Gack, M.U., Albrecht, R.A., Urano, T., Inn, K.S., Huang, I.C., Carnero, E., Farzan, M., Inoue, S., Jung, J.U., Garcia-Sastre, A., 2009. Influenza A virus NS1 targets the ubiquitin ligase TRIM25 to evade recognition by the host viral RNA sensor RIG-I. Cell Host Microbe 5, 439-449. Hale, B.G., Randall, R.E., Ortin, J., Jackson, D., 2008. The multifunctional NS1 protein of influenza A viruses. J Gen Virol 89, 2359-2376. Hale, B.G., Steel, J., Manicassamy, B., Medina, R.A., Ye, J., Hickman, D., Lowen, A.C., Perez, D.R., GarciaSastre, A., 2010a. Mutations in the NS1 C-terminal tail do not enhance replication or virulence of the 2009 pandemic H1N1 influenza A virus. J Gen Virol 91, 1737-1742. Hale, B.G., Steel, J., Medina, R.A., Manicassamy, B., Ye, J., Hickman, D., Hai, R., Schmolke, M., Lowen, A.C., Perez, D.R., Garcia-Sastre, A., 2010b. Inefficient control of host gene expression by the 2009 pandemic H1N1 influenza A virus NS1 protein. J Virol 84, 6909-6922. Hayman, A., Comely, S., Lackenby, A., Murphy, S., McCauley, J., Goodbourn, S., Barclay, W., 2006. Variation in the ability of human influenza A viruses to induce and inhibit the IFN-beta pathway. Virology 347, 52-64. Li, S., Min, J.Y., Krug, R.M., Sen, G.C., 2006. Binding of the influenza A virus NS1 protein to PKR mediates the inhibition of its activation by either PACT or double-stranded RNA. Virology 349, 13-21. Ludwig, S., Wang, X., Ehrhardt, C., Zheng, H., Donelan, N., Planz, O., Pleschka, S., Garcia-Sastre, A., Heins, G., Wolff, T., 2002. The influenza A virus NS1 protein inhibits activation of Jun N-terminal kinase and AP1 transcription factors. J Virol 76, 11166-11171. Mukherjee, S., Vipat, V.C., Mishra, A.C., Pawar, S.D., Chakrabarti, A.K., 2011. Pandemic (H1N1) 2009 influenza virus induces weaker host immune responses in vitro: a possible mechanism of high transmissibility. Virol J 8, 140. Osterlund, P., Pirhonen, J., Ikonen, N., Ronkko, E., Strengell, M., Makela, S.M., Broman, M., Hamming, O.J., Hartmann, R., Ziegler, T., Julkunen, I., 2010. Pandemic H1N1 2009 influenza A virus induces weak cytokine responses in human macrophages and dendritic cells and is highly sensitive to the antiviral actions of interferons. J Virol 84, 1414-1422. Rajsbaum, R., Albrecht, R.A., Wang, M.K., Maharaj, N.P., Versteeg, G.A., Nistal-Villan, E., Garcia-Sastre, A., Gack, M.U., 2012. Species-specific inhibition of RIG-I ubiquitination and IFN induction by the influenza A virus NS1 protein. PLoS Pathog 8, e1003059.
Sabath, N., Morris, J.S., Graur, D., 2011. Is there a twelfth protein-coding gene in the genome of influenza A? A selection-based approach to the detection of overlapping genes in closely related sequences. J Mol Evol 73, 305-315. Shelton, H., Smith, M., Hartgroves, L., Stilwell, P., Roberts, K., Johnson, B., Barclay, W., 2012. An influenza reassortant with polymerase of pH1N1 and NS gene of H3N2 influenza A virus is attenuated in vivo. J Gen Virol 93, 998-1006. Thepmalee, C., Sanguansermsri, P., Suwanankhon, N., Chamnanpood, C., Chamnanpood, P., Pongcharoen, S., Niumsap, P.R., Surangkul, D., Sanguansermsri, D., 2013. Changes in the NS1 gene of avian influenza viruses isolated in Thailand affect expression of type I interferon in primary chicken embryonic fibroblast cells. Indian J Virol 24, 365-372. Vasin, A.V., Temkina, O.A., Egorov, V.V., Klotchenko, S.A., Plotnikova, M.A., Kiselev, O.I., 2014. Molecular mechanisms enhancing the proteome of influenza A viruses: an overview of recently discovered proteins. Virus Res 185, 53-63. Wang, W., Riedel, K., Lynch, P., Chien, C.Y., Montelione, G.T., Krug, R.M., 1999. RNA binding by the novel helical domain of the influenza virus NS1 protein requires its dimer structure and a small number of specific basic amino acids. RNA 5, 195-205. Wang, X., Li, M., Zheng, H., Muster, T., Palese, P., Beg, A.A., Garcia-Sastre, A., 2000. Influenza A virus NS1 protein prevents activation of NF-kappaB and induction of alpha/beta interferon. J Virol 74, 1156611573.
Viral titers (log10PFU/ml)
A 12 10
°
8
°
°
°
6
°°
4 2 0
0
6
24
48
72
96
Hours post-infection
PR8 PR8-A171Y CA/04 CA/04-Y171A CA/04-Y171N
B
PR8
PR8 A1 7 1 Y
CA/ 0 4
CA/ 0 4 Y1 7 1 A CA/ 0 4 Y1 7 1 N
200
° 100
° ° 0
24
48
72
Hours post-infection
500
PR8 PR8-A171Y CA/04 CA/04-Y171A CA/04-Y171N
400 300 200 100 0
0
° °
24
IFNL2/3 400
PR8 PR8-A171Y CA/04 CA/04-Y171A CA/04-Y171N
20
° 10
°
200 100
°° 0
0
°°
° °
24
48
72
Hours post-infection
6 4
°
0
°° 0
24
24
°
48
72
Hours post-infection
IFN-l 2/3
8
2
PR8 PR8-A171Y CA/04 CA/04-Y171A CA/04-Y171N
300
IFN-l 1
30
0
72
Hours post-infection
IFN-b
0
48
°
°
° °
°° 48
72
Hours post-infection
PR8 PR8-A171Y CA/04 CA/04-Y171A CA/04-Y171N
Human IFN-l2/3 (ng/ml)
0
B Human IFN-b (ng/ml)
PR8 PR8-A171Y CA/04 CA/04-Y171A CA/04-Y171N
IFNL1
Copy numbers x 103/100 ng of RNA
300
Copy numbers x 103/100 ng of RNA
IFNB1
Human IFN-l1 (ng/ml)
Copy numbers x 103/100 ng of RNA
A
4
PR8 PR8-A171Y CA/04 CA/04-Y171A CA/04-Y171N
3 2 1 0
° 0
°
24
°
°
48
° °° 72
Hours post-infection
A M o c k
PR8
PR8-A171Y
24 48 72 24 48 72
CA/04
CA/04-Y171A CA/04-Y171N
24 48 72 24 48 72 24 48 72 hpi ¬pY-STAT1
¬STAT1
IFIT3
8
°
6 4 2 0
°° 0
°
24
° °
°
48
72
Hours post-infection
PR8 PR8-A171Y CA/04 CA/04-Y171A CA/04-Y171N
1500
1000
°
500
° 0
° 0
24
°
° °° 48
° ° 72
Hours post-infection
PR8 PR8-A171Y CA/04 CA/04-Y171A CA/04-Y171N
Relative Expression (x103)
IFIT1
Relative Expression
Relative Expression (x103)
B MX1 10
°
8
°
6 4 2 0
° 0
24
° °
°
48
72
Hours post-infection
PR8 PR8-A171Y CA/04 CA/04-Y171A CA/04-Y171N