- Email: [email protected]
β-catenin pathway
Chemosphere 176 (2017) 1e7
Contents lists available at ScienceDirect
Chemosphere journal homepage: www.elsevier.com/locate/chemosphere
Inhibition of bone formation in rats by aluminum exposure via Wnt/bcatenin pathway Xudong Sun a, Haoran Wang a, Wanyue Huang a, Hongyan Yu a, Tongtong Shen a, Miao Song a, Yanfei Han a, Yanfei Li a, *, Yanzhu Zhu b, ** a b
College of Veterinary Medicine, Northeast Agricultural University, Harbin 150030, China Institute of Special Animal and Plant Sciences of Chinese Academy of Agricultural Sciences, Changchun 130112, China
h i g h l i g h t s Dynamic analysis of exposure to AlCl3 on rats bone formation. AlCl3 inactivated the Wnt/b-catenin signaling pathway in vivo. AlCl3 inhibited rats bone formation via inactivating Wnt/b-catenin signaling pathway.
a r t i c l e i n f o
a b s t r a c t
Article history: Received 25 April 2016 Received in revised form 20 January 2017 Accepted 15 February 2017 Available online 20 February 2017
The previous research found that aluminum trichloride (AlCl3) inhibited rat osteoblastic differentiation through inactivation of Wnt/b-catenin signaling pathway in vitro. On that basis, the experiment in vivo was conducted in this study. Rats were orally exposed to 0 (control group) and 0.4 g/L AlCl3 (AlCl3-treated group) for 30, 60, 90 or 120 days, respectively. We found that mRNA expressions of type I collagen and insulin-like growth factor-1, mRNA and protein expressions of Runx2 and survivin, ratio of p-GSK3b/ GSK3b and protein expression of b-catenin were all decreased, whereas the mRNA and protein expressions Dkk1 and sFRP1 and the mRNA expressions and activity of Caspase-3 were increased in the AlCl3treated group compared with the control group with time prolonged. These results suggest that AlCl3 inhibits bone formation and induces bone impairment by inhibiting the Wnt/b-catenin signaling pathway in young growing rats. © 2017 Elsevier Ltd. All rights reserved.
Handling Editor: A. Gies Keywords: Aluminum trichloride Bone formation Wnt/b-catenin signaling pathway Rat
1. Introduction Aluminum (Al) is an accumulative toxic metal for human (Crisponi et al., 2013; Bondy, 2014). It is used in various fields, such as Al containers and utensils, therapeutic agents, water purifiers and food additives (Wang et al., 2010a,b; Celik et al., 2012). Therefore, humans are susceptible to Al ion (Al3þ) toxicity, primarily through the ingestion of contaminated food and water (Ribes et al., 2008). Based on occurrence data for food in combination with consumption data, the French population’s mean exposure to Al in food is estimated at 40.3 mg/kg bw/day in adults
* Corresponding author. ** Corresponding author. Institute of Special Economic Animal and Plant Science, Chinese Academy of Agricultural Sciences, Jilin 130112, China. E-mail addresses: [email protected] (Y. Li), [email protected] (Y. Zhu). http://dx.doi.org/10.1016/j.chemosphere.2017.02.086 0045-6535/© 2017 Elsevier Ltd. All rights reserved.
and 62.2 mg/kg bw/day in children, in China with the highest exposure levels observed in children 471.7 mg/kg bw/day (Djouina et al., 2016). The wide distribution, extensive exposure to humans and inherent toxicity of Al is indeed a global public health problem that affects millions of people (Zhang et al., 2014). Bone is the primary site for Al accumulation, and 58e70% of the €m et al., total human Al body burden accumulates in bone (Hellstro 2005). The accumulation of Al in bone disrupts the bone formation, ultimately leads to Al-related bone disease (e.g., osteoporosis) (Kausz et al., 1999; Aaseth et al., 2012; Crisponi et al., 2013). In dialyzed patients, as bone Al concentrations increased from 46 ± 7 to 175 ± 22 mg/kg (dry weight), the severity of Al-induced bone disease increased (Hodsman et al., 1982). In our previous research aluminum trichloride (AlCl3) disturbed the metabolism of calcium and phosphorus, disrupted the microstructure of the bone, decreased the bone mineral density, thereby inhibited bone
2
X. Sun et al. / Chemosphere 176 (2017) 1e7
formation (Li et al., 2011; Sun et al., 2015a,b). But the molecular mechanism of inhibition of bone formation caused by AlCl3 are still not completely clarified. The Wnt/b-catenin signaling pathway plays an important role in regulating skeletal formation during the development, as well as bone remodeling, regeneration and repairment in the whole life (Lerner and Ohlsson, 2015; Maeda et al., 2015). Human bone diseases such as osteoporosis pseudoglioma syndrome, sclerosteosis and van Buchem’s disease are associated with aberrant Wnt/bcatenin signaling pathway (Wang et al., 2014). This pathway is triggered by binding Wnt ligand (e.g., Wnt3a) to frizzled receptor and its coreceptor low-density lipoprotein receptor-related protein (LRP-5/6) (Chuang et al., 2013). Disheveled is subsequently activated, which inhibits phosphorylation of glycogen synthase kinase 3b (GSK3b) and stabilizes b-catenin in cytoplasmic, and facilitates its transport to nuclei where it binds to transcription factors (Lef1/ Tcf) and alters gene expression (Pan et al., 2014). Inhibition of the Wnt/b-catenin signaling pathway results in osteoporosis (Kim et al., 2013). Thus, we concluded that the Wnt/b-catenin signaling pathway was involved in the inhibition of bone formation induced by Al. Furthermore, osteoblastic differentiation is an essential process of bone formation (Ducy et al., 2000). On that basis, our previous research further found that AlCl3 inhibits osteoblastic differentiation through inactivation of Wnt/b-catenin signaling pathway in vitro (Cao et al., 2016). But limited data showed the in vivo effects. Therefore, the effects of AlCl3 on the bone formation (marker for bone formation type I collagen (Col I) and Insulin-like growth factor-1 (IGF-1)) and Wnt/b-catenin signaling pathway (the mRNA and protein expressions of Dkk1, sFRP1, Runx2 and survivin, and the mRNA and activity of Caspase-3, the ratio of p-GSK3b/GSK3b and protein expression of b-catenin) in rat bone were determined on day 30, 60, 90 or 120, respectively. This study can provide a theoretical foundation for revealing the mechanism of inhibition of bone formation caused by AlCl3. 2. Materials and methods 2.1. Animals and treatments This experimental protocol was approved by the Ethics Committee on the Use and Care of Animals, Northeast Agricultural University, China. All efforts were made to comply with the roles for animal ethics and welfare. One-hundred and sixty 4-week-old healthy male Wistar rats weighed 72e95 g were acclimatized for 1 week then randomly divided into two groups, each 80 rats. Rats were orally exposed to 0 (control group) and 0.4 g/L AlCl3 (0.08 g/L Al, AlCl3-treated group) in drink water for 30, 60, 90 or 120 days, respectively. During the whole exposure duration, the water consumption was increased gradually with the increased of rat body weight. And the water consumption of the individual rat averaged at 16 ± 2 mL/d for 100 g body weight per day, resulting in the dose of AlCl3 at 64 mg/kg body weight for treatment group. The dose of this experiment was determined referencing the research of Sun (Sun et al., 2015a,b). A standard laboratory diet was fed to rats with free access to food and water. Rats were housed in the Biomedical Research Center, Northeast Agriculture University. The housing conditions were maintained at a constant temperature (24 ± 1 C), relative humidity at 55 ± 5%, and in a 12/12-h light/dark cycle. The rats were kept in plastic cages (five rats per cage) with soft chip bedding. The size of all the cages was 470: 300: 150 mm, large enough for the growth of five rats. The health status of rats were monitored daily and the body weight of rats were recorded every 10 days. No died rats were discovered during the experimental period. Twenty rats in each group were sacrificed under light ether
anesthesia on day 30, 60, 90 and 120 respectively. The femora were separated and stored at 70 C. 2.2. Measurement of serum pH Serum pH was measured with an Orion 868 pH meter (Thermo Electron Corporation, Waltham, MA, USA). 2.3. Measurement of serum and urine phosphorus content The concentration of phosphorus was detected using a diagnostic kit (SigmaeAldrich, St Louis, MO, USA) using the molybdenum blue method (Tsang et al., 2007). 2.4. Observation of femoral ultrastructure The femora shaft was fixed in 4% phosphate buffered paraformaldehyde for 4 weeks. The femora shaft was then decalcified in 10% EDTA until the femora shaft was soft and flexible, then the femora shaft was embedded with embedding medium (100% acetone: Epon812 ¼ 2:1). Embedded samples were sectioned to a thickness of 600 Å and stained with lead staining solution. Finally, the sections were analyzed with a transmission electron microscope T-400 (Philips, Eindhoven, NL). 2.5. qRT-PCR The mRNA expressions of Col I, IGF-1, Dkk1, sFRP1, Runx2, survivin and Caspase-3 were detected by quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR). The shaft of femur was stripped of periosteum and then it was cut transversely with bone cutters to expose the bone marrow. The trabecular bone and marrow cavities were flushed with ice-cold sterile phosphate-buffered saline to remove the marrow. Femora were crushed using a mortar and pestle in liquid nitrogen. Total RNA was extracted with Trizol reagent (Invitrogen, USA) from femora according to the manufacturer’s guidelines. cDNA was synthesized with the transcriptor First Strand cDNA Synthesis kit (TransScript First-Strand cDNA Synthesis SuperMix, TransGen Blotech, China). The relative expression of target genes was determined by the 2DDCT method (Suzuki et al., 2015). The primers of the genes are shown Table 1. The light cycler was programmed to carry out a melting cycle to verify the specificity of the amplified products. b-actin was used as internal control to adjust the amount of mRNA in each sample. qRT-PCR was performed using ABI PRISM 7500 Real-Time PCR System (Applied Biosystems, CA). The data were presented as the relative mRNA levels. 2.6. Western blotting The distal femoral metaphysis was stripped of periosteum and then it was cut transversely with bone cutters to expose the bone marrow. The trabecular bone and marrow cavities were flushed with ice-cold sterile phosphate-buffered saline to remove the marrow. The total protein was extracted using a bone protein extraction kit (Beijing Tiandz, Inc. Beijing, China) and the total protein content was quantified by the BCA assay (Beyotime Institute of Biotechnology, China). The protein was separated in sodium dodecyl sulfate-polyacrylamide gels electrophoresis, electrotransferred onto PVDF membranes. Then the PVDF membranes were incubated with anti-phospho-GSK3b(Ser-9), anti-GSK3b, anti-Runx2, anti-Dkk1, anti-sFRP1 and anti-survivin (Abcam, USA) under 4 C overnight. Subsequently the PVDF membranes were incubated with an appropriate secondary antibody (ZSGB-BIO, China). b-actin protein level was used as internal control to adjust
X. Sun et al. / Chemosphere 176 (2017) 1e7
3
Table 1 Primer sequences and amplification lengths of destination fragments. Gene
Gene Number
Primer Sequence
Primer Length (bp)
Product Length (bp)
Col I
NM053304.1 NM_178866.4
Dkk1
NM_001106350
sFRP1
NM_001276712
Runx2
NM_35789.2
survivin
NM_171992
Caspase-3
NM_012922.2
b-actin
NM_031144
21 21 20 20 20 19 20 20 22 21 20 20 18 19 18 21
193
IGF-1
UP 50 AGCAGACGGGAGTTTCACCTC 30 LOW 50 TGTCTTCTTGGCCATGCGTCA 30 UP 50 GAAAGCACTTGGCCCAATGG30 LOW 50 CTGCTCTCCACCACCATTCT30 UP 50 TGACCACAGCCATTTACCTC30 LOW 50 AGAGCCTTCTTGCCCTTTG30 UP 50 GGACAACCTCAGCCACAACT30 LOW 50 GACTGGAAGGTGGGACACTC30 UP 50 ACAAACGAGAAAAGCGTCAAGC30 LOW 50 CCAGTCATTCCACCCCACATCA30 UP 50 AAAGGGTCACCACCAGCTTA30 LOW 50 ACAGGGCAGACTGTGTGGAT30 UP 50 ACGGCGAGAACAGTTGAA30 LOW 50 AGAAAGAAGATGGGAAGCA30 UP 50 GCCAACACAGTGCTGTCT30 LOW 50 AGGAGCAATGATCTTGATCTT30
the amount of protein expression in each sample. Finally, protein bands were observed using the enhanced chemiluminescent (ECL) reagent (Beyotime Institute of Biotechnology, China).
2.7. Activity analysis The activity of Caspase-3 was determined by Caspase-3 activity assay kits (Beyotime institute of biotechnology, Jiangsu, China). The procedure was carried out according to the manufacturer’s instructions. The adsorption values were recorded under 405 nm by a 318 MC microplate reader (Shanghai Sanco instrument Co., Ltd., China).
2.8. Immunofluorescence staining The femora shaft was fixed in 4% phosphate buffered paraformaldehyde for 4 weeks. The femora shaft was then decalcified in 10% EDTA until the femora shaft was soft and flexible, then the femora shaft was embedded in paraffin in a Tissue-Tekо VIP 3000 processor. Embedded samples were sectioned to a thickness of 5 mm and incubated using mouse monoclonal anti-b-catenin (1: 200) overnight at 4 C followed by FITC-conjugated secondary antibody and. The fluorescence signal of b-catenin was visualized using confocal fluorescence microscopy (Olympus, Japan). 2.9. Statistical analysis Statistical analyses were done using SPSS 22.0 for Windows (SPSS Inc., Chicago, IL, USA) with one-way analysis of variance followed by Student’s t-test. Data are shown as least square means and standard deviation (SD, bar on the top of each column). The P values of less than 0.05 were considered significant, and P values of less than 0.01 were considered markedly significant.
3. Results 3.1. AlCl3 increased the contents of phosphorus in serum and urine As shown in Table 2, there were no significant changes in serum pH in the control group and AlCl3-treated group during the experimental period. While the phosphorus contents in serum and urine also increased gradually in the AlCl3-treated group, and were significantly higher than in the control group on day 120 (P < 0.05).
163 185 208 335 177 255 114
3.2. AlCl3 damaged femoral ultrastructure and inhibited bone formation related genes expression To investigate the effect of AlCl3 on the ultrastructure of bone and the reliable and sensitive marker for bone formation. The ultrastructure of bone are shown in Fig. 1A for control group, and Fig. 1B, C, D and E for AlCl3-treated group on day 30, 60, 90 and 120, respectively. There were obvious damages on the membrane and cytoplasm in AlCl3-treated group on day 90 and 120. The structure of bone showed that cell membrane incomplete, cell swelling, spinal fracture, lots of foam-like structure, lysosomal increasing (Fig. 1D and E). Furthermore, we measured the gene expressions of Col I and IGF-1 by qRT-PCR. As shown in Fig. 1F and G, the mRNA expressions of Col I and IGF-1 decreased gradually in the AlCl3-treated group with the time prolonged and were markedly lower than those in control group on day 60, 90 and 120 (P < 0.05; P < 0.01). These results suggested that AlCl3 damaged femoral ultrastructure and inhibited bone formation related genes expression. 3.3. AlCl3 promoted the inhibitors of Wnt/b-catenin pathway expressions In order to explore the effect of AlCl3 on inhibitors of Wnt/bcatenin signaling pathway. We measured the gene expressions of Dkk1 and sFRP1 by qRT-PCR and the protein levels of Dkk1 and sFRP1 by Western Blotting. As shown in Fig. 2A, B, C, D and E the Dkk1 and sFRP1 mRNA and protein levels were all increased in the AlCl3-treated group with the time prolonged and were significantly higher than those in control group on day 60, 90 and 120 (P < 0.05; P < 0.01), indicating that AlCl3 increased the mRNA and protein levels of the inhibitors of Wnt/b-catenin signaling pathway, which inactivated Wnt/b-catenin signaling pathway. 3.4. AlCl3 inhibited of Wnt/b-catenin pathway To further clarify the effect of AlCl3 on the Wnt/b-catenin signaling pathway. We measured the protein levels of p-GSK3b and GSK3b by Western Blotting, and the protein expression of b-catenin by immunofluorescence. As shown in Fig. 3A and B, the ratio of pGSK3b/GSK3b protein levels were decreased in the AlCl3-treated group with the time prolonged and were significantly lower than those in control group on day 60, 90 and 120 (P < 0.05; P < 0.01). The protein expression of b-catenin (Fig. 3C) were decreased gradually in the AlCl3-treated group with the time prolonged,
4
X. Sun et al. / Chemosphere 176 (2017) 1e7
Table 2 Effects of AlCl3 exposure on serum pH, the level of phosphorus in serum and urine. 30d Serum pH Serum phosphorus (mg/dL) Urine phosphorus (mg/dL)
C At C At C At
7.21 7.19 3.10 3.24 0.34 0.33
60d ± ± ± ± ± ±
0.28 0.25 0.21 0.22 0.05 0.06
7.24 7.20 3.04 3.18 0.32 0.35
90d ± ± ± ± ± ±
0.20 0.34 0.18 0.16 0.07 0.08
7.27 7.15 3.23 3.31 0.33 0.40
120d ± ± ± ± ± ±
0.18 0.16 0.20 0.24 0.06 0.06
7.27 7.16 3.11 3.35 0.37 0.45
± ± ± ± ± ±
0.18 0.23 0.17 0.21* 0.08 0.07*#
Data are means ± SD (n ¼ 20 per time-point). C, control group; At, AlCl3-treated group. *P < 0.05 and **P < 0.01 versus the control group. #P < 0.05 and ##P < 0.01 versus the AlCl3-treated group on day 30.
A
B
C
D
E
Fig. 1. Effects of AlCl3 on the femora ultrastructure and the Col I and IGF-1 mRNA expressions in femora of rats. The rats were orally exposed to 0 (control group) and 0.4 g/L AlCl3 (0.08 g/L Al, AlCl3-treated group) in drink water for 30, 60, 90 or 120 days, respectively. The femora ultrastructure and the Col I and IGF-1 mRNA expressions in femora of rats were measured by transmission electron microscope and qRT-PCR. A, bone tissue of rats in control group (8000). B, C, D and E, bone tissue of rats in AlCl3-treated group on days 30, 60, 90 and 120, respectively (8000). F and G, the Col I and IGF-1 mRNA expressions in femora of rats. Data are means ± SD (n ¼ 20 per time-point). *P < 0.05 and **P < 0.01 versus the control group. #P < 0.05 and ##P < 0.01 versus the AlCl3-treated group on day 30.
Fig. 2. Effects of AlCl3 on Dkk1 and sFRP1 protein levels (A, B and C) and mRNA expressions (D and E) in femora of rats. The Dkk1 and sFRP1 protein levels and mRNA expressions were measured by Western Blotting and qRT-PCR. Data are means ± SD (n ¼ 20 per time-point). *P < 0.05 and **P < 0.01 versus the control group. #P < 0.05 and ##P < 0.01 versus the AlCl3-treated group on day 30.
indicating that AlCl3 inactivated Wnt/b-catenin signaling pathway. 3.5. Runx2, survivin and Caspase-3 involved in regulating AlCl3induced rat bone impairment To ascertain the effect of AlCl3 on target gene of Wnt/b-catenin signaling pathway, and the marker for the apoptosis bone
functional cell. We measured the gene expressions of Runx2, antiapoptotic gene (survivin) and pro-apoptotic gene (Caspase-3) by qRT-PCR; the protein expressions of Runx2 and survivin by Western Blotting; the activity of Caspase-3 by activity assay kits. As shown in Fig. 4A, B, C, D and E, the protein and mRNA levels of Runx2 and survivin were decreased gradually in the AlCl3-treated group with the time prolonged and were markedly lower than those in control
X. Sun et al. / Chemosphere 176 (2017) 1e7
5
4. Discussion
Fig. 3. The p-GSK3b/GSK3b protein levels (A and B) and b-catenin protein expression (C) in femora of rats were measured by Western Blotting and immunofluorescence staining. The arrows represents green b-catenin protein in femora of rats. A representative result from the three independent experiments is shown. (Magnification 40). Scale bar, 50 mm. Data are means ± SD (n ¼ 20 per time-point). *P < 0.05 and **P < 0.01 versus the control group. #P < 0.05 and ##P < 0.01 versus the AlCl3-treated group on day 30. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
group on day 30, 60, 90 and 120 (P < 0.05; P < 0.01). Whereas, the mRNA expression and activity of Caspase-3 (Fig. 4F and G) increased gradually in the AlCl3-treated group with the time prolonged and were markedly higher than those in control group on day 60, 90 and 120 (P < 0.05; P < 0.01).
Our results showed that AlCl3 significantly inhibited bone formation and induced bone impairment of rats, which agreed with previous studies (Li et al., 2011; Crisponi et al., 2013; Sun et al., 2015a,b). We found AlCl3 inhibited bone formation by decreasing the mRNA expressions of bone formation makers such as Col I and IGF-1 in rat bone. Then, we found that AlCl3 inactivated Wnt/bcatenin pathway, following enhanced the mRNA and protein levels of Dkk1 and sFRP1, inhibited ratio of p-GSK3b/GSK3b, decreased bcatenin stabilization. Finally, AlCl3 induced bone cell apoptosis by decreasing the expressions of Runx2 and survivin, increasing the mRNA expressions and activities of Caspase-3. With time prolonged the adverse effects of AlCl3 exposure got worse. All above results suggested that AlCl3 inhibited bone formation and induced bone cell apoptosis through inactivation of Wnt/b-catenin pathway in rat bone. Col I and IGF-1 are reliable and sensitive markers for mineralization and formation of bone. Col I is the primary composition of extracellular matrix, which provides a mineralization scaffold for bone matrix (Cui et al., 2010). Sprague et al. proved that AlCl3 inhibited collagen synthesis, thereby, inhibited nodule formation and calcification in mouse osteoblast (Sprague et al., 1993). Our previous research found that 0.01, 0.02 and 0.04 mg/mL Al3þ inhibited Col I mRNA expression of rat osteoblast (Sun et al., 2015a,b). In this study, AlCl3 significant decreased Col I mRNA expression, which indicated AlCl3 inhibited synthesis, secretion, and mineralization of bone matrix. In addition, IGF-1 is considered essential for longitudinal bone growth, skeletal maturation, and bone mass acquisition during the growth, as well as the maintenance of bone in adult life (Locatelli and Bianchi, 2014). In a model where chondrocyte IGF-1 synthesis was disrupted, significant reductions in body weight, body length, total-body bone mineral density, and femoral length were observed beginning at 4 weeks of
Fig. 4. Effects of AlCl3 on Runx2 and survivin protein and mRNA expressions (A, B, C, D and E) and on the Capase-3 mRNA expression (F) and activity (G) in femora of rats. The Runx2 and survivin protein and mRNA expressions were measured by Western Blotting and qRT-PCR, and Capase-3 mRNA expression and activity were measured by byqRT-PCR and activity assay kits. Data are means ± SD (n ¼ 20 per time-point). *P < 0.05 and **P < 0.01 versus the control group. #P < 0.05 and ##P < 0.01 versus the AlCl3-treated group on day 30.
6
X. Sun et al. / Chemosphere 176 (2017) 1e7
Fig. 5. AlCl3 inhibits the Wnt/b-catenin signaling pathway to mediate bone metabolism in rats. AlCl3 increases Dkk1 and sFRP1 mRNA and protein expressions, thus inhibits the ratio of p-GSK3b/GSK3b and protein expression of b-catenin. Down-regulation of b-catenin decreases the expression of Runx2. Inactivated Runx2 decreases bone formation genes expression, including Col I and IGF-1, which further decrease bone formation.
age in both female and male mice (Yakar et al., 2010). In this study, AlCl3 significant decreased IGF-1 mRNA expression, which indicated AlCl3 inhibited bone formation. Furthermore, IGF-1 regulated Col I synthesis in osteoblast, which is essential for processes required for bone formation. The down-regulated IGF-1 expression might be a main reason for the inhibitory effect of AlCl3 on mRNA expression of Col I. Collectively, these results indicated that AlCl3 inhibited the bone formation related genes expression. Wnt/b-catenin signaling pathway is associated with bone diseases (Wang et al., 2014). Inhibition of the Wnt/b-catenin signaling pathway results in osteoporosis (Kim et al., 2013). Dkk1 and sFRP1 are upstream inhibitor of Wnt/b-catenin pathway (Qiang et al., 2008; Trevant et al., 2008). Dkk-1 negatively controls Wnt/b-catenin signaling pathway by competing with Wnt proteins for binding to LRP-5/6 receptor (Qiang et al., 2008). sFRP1 bind directly to Wnt proteins to antagonise Wnt/b-catenin pathway (Trevant et al., 2008). Increase of Dkk-1 and sFRP1 inactivate Wnt/b-catenin pathway and inhibit bone formation (Kim et al., 2013). In this study, AlCl3 significant increased Dkk-1 and sFRP1 mRNA and protein levels with AlCl3 administration time prolonged, which indicated AlCl3 inactivated Wnt/b-catenin pathway. In addition, parathyroid hormone (PTH) can active Wnt/b-catenin signaling pathway by reducing Dkk1 and sFRP1 expressions, which promote bone formation (Wang et al., 2014). Our previous studies showed that AlCl3 exposure decreased serum PTH level of rat (Li et al., 2011). Thus we deduced that the lower serum level of PTH was a reason for up-regulating Dkk-1 and sFRP1, eventually inactivated Wnt/bcatenin signaling pathway with AlCl3 exposure. GSK3b negatively controls Wnt/b-catenin signaling pathway by phosphorylating and promoting the degradation of b-catenin (Pan et al., 2014). Decrease of GSK3b phosphorylation could promote GSK3b activity, inducing the degradation of b-catenin in rat bone pez-Herrado n et al., 2013). Our previous (Matsuzaki et al., 2006; Lo research found that 0.204 mM, 0.408 mM and 0.816 mM AlCl3 significant decreased ratio of p-GSK-3b/GSK3b and the protein expression of b-catenin in rats osteoblast (Cao et al., 2016). Consistent with previous studies, our results showed that AlCl3 significant decreased ratio of p-GSK-3b/GSK3b and b-catenin protein level with AlCl3 administration time prolonged, indicating that AlCl3 inhibited the phosphorylation of GSK3b, leading to inactivation of Wnt/b-catenin signaling.
Runx2 is a direct target of the Wnt/b-catenin pathway, which regulates numerous target genes (Col and IGF-1) essential for processes required for bone formation (Prince et al., 2001; Bialek et al., 2004; Pan et al., 2014). The inhibition effects of AlCl3 on bone formation were attributed to the decreased expression of Runx2 (Cao et al., 2016). In this study, the mRNA and protein expression of Runx2 were decreased with AlCl3 administration time prolonged, which might attribute to the inactivation of Wnt/bcatenin signaling or the direct effect of AlCl3 exposure. Survivin in an anti-apoptosis gene, which interdicted the progress of cell apoptosis by inhibiting the expression of Caspase-3 (Zhang et al., 2009). Caspase-3 is a member of cysteine proteases family and responsible for the cleavage of key cellular proteins, then leads to typical morphological changes in cells undergoing apoptosis (Krajewski et al., 1999). Down-regulation of Runx2 would inhibit the survivin expression and promote the Caspase-3 expression, eventually leading to bone cell apoptosis and the inhibition of bone formation (Lim et al., 2010). In this study, AlCl3 significant decreased gene and protein level of survivin, and increased gene expression and activity of Caspase-3, subsequently caused bone cell apoptosis, which may be at least partially responsible for the bone impairment induced by AlCl3. Taken together, the inhibition of the Wnt/b-catenin pathway and the consequent depression of Runx2 and survivin, up-regulation of Caspase-3 gene expression and activity strongly suggest that the Wnt/b-catenin signaling pathway is involved in AlCl3-induced bone impairment and inhibition of bone formation.
5. Conclusion AlCl3 exposure decreased gene expressions of Col I and IGF-1, and downregulated the Wnt/b-catenin signaling pathway with AlCl3 administration time prolonged, indicating that AlCl3 inhibits bone formation by inactivating the Wnt/b-catenin signaling pathway (Fig. 5).
Conflict of interest The authors declare that there are no conflicts of interest.
X. Sun et al. / Chemosphere 176 (2017) 1e7
Acknowledgments This study was supported by a grant from the National Natural Science Foundation Project (31372496 and 31302147). References Aaseth, J., Boivin, G., Andersen, O., 2012. Osteoporosis and trace elementsean overview. J. Trace Elem. Med. Biol. 26, 149e152. Bialek, P., Kern, B., Yang, X., Schrock, M., Sosic, D., Hong, N., Wu, H., Yu, K., Ornitz, D.M., Olson, E.N., Justice, M.J., Karsenty, G., 2004. A twist code determines the onset of osteoblast differentiation. Dev. Cell. 6, 423e435. Bondy, S.C., 2014. Prolonged exposure to low levels of aluminum leads to changes associated with brain aging and neurodegeneration. Toxicology 315, 1e7. Cao, Z., Fu, Y., Sun, X., Zhang, Q., Xu, F., Li, Y., 2016. Aluminum trichloride inhibits osteoblastic differentiation through inactivation of Wnt/b-catenin signaling pathway in rat osteoblasts. Environ. Toxicol. Pharmacol. 42, 198e204. Celik, H., Celik, N., Kocyigit, A., Dikilitas, M., 2012. The relationship between plasma aluminum content, lymphocyte DNA damage, and oxidative status in persons using aluminum containers and utensils daily. Clin. Biochem. 45, 1629e1633. Chuang, K.A., Lieu, C.H., Tsai, W.J., Huang, W.H., Lee, A.R., Kuo, Y.C., 2013. 3Methoxyapigenin modulates b-catenin stability and inhibits Wnt/b-catenin signaling in Jurkat leukemic cells. Life Sci. 92, 677e686. Crisponi, G., Fanni, D., Gerosa, C., Nemolato, S., Nurchi, V.M., Crespo-Alonso, M., Lachowicz, J.I., Faa, G., 2013. The meaning of aluminium exposure on human health and aluminium-related diseases. Biomol. Concepts 4, 77e87. Cui, C., Wang, S., Myneni, V.D., Hitomi, K., Kaartinen, M.T., 2010. Transglutaminase activity arising from Factor XIIIA is required for stabilization and conversion of plasma fibronectin into matrix in osteoblast cultures. Bone 59, 127e138. Djouina, M., Esquerre, N., Desreumaux, P., Vignal, C., Body-Malapel, M., 2016. Toxicological consequences of experimental exposure to aluminum in human intestinal epithelial cells. Food Chem. Toxicol. 91, 108e116. Ducy, P., Schinke, T., Karsenty, G., 2000. The osteoblast: a sophisticated fibroblast under central surveillance. Science 289, 1501e1504. € m, H.O., Mjo €berg, B., Mallmin, H., Michae €lsson, K., 2005. The aluminum Hellstro content of bone increases with age, but is not higher in hip fracture cases with and without dementia compared to controls. Osteoporos. Int. 16, 1982e1988. Hodsman, A.B., Sherrard, D.J., Alfrey, A.C., Ott, S., Brickman, A.S., Miller, N.L., Maloney, N.A., Coburn, J.W., 1982. Bone aluminum and histomorphometric features of renal osteodystrophy. J. Clin. Endocr. Metab. 54, 539e546. Kausz, A.T., Antonsen, J.E., Hercz, G., Pei, Y., Weiss, N.S., Emerson, S., Sherrard, D.J., 1999. Screening plasma aluminum levels in relation to aluminum bone disease among asymptomatic dialysis patients. Am. J. Kidney Dis. 34, 688e693. Kim, J.H., Liu, X., Wang, J., Chen, X., Zhang, H., Kim, S.H., Cui, J., Li, R., Zhang, W., Kong, Y., Zhang, J., Shui, W., Lamplot, J., Rogers, M.R., Zhao, C., Wang, N., Rajan, P., Tomal, J., Statz, J., Wu, N., Luu, H.H., Haydon, R.C., He, T.C., 2013. Wnt signaling in bone formation and its therapeutic potential for bone diseases. Ther. Adv. Musculoskelet. Dis. 5, 13e31. Krajewski, S., Krajewska, M., Ellerby, L.M., Welsh, K., Xie, Z., Deveraux, Q.L., Salvesen, G.S., Bredesen, D.E., Rosenthal, R.E., Fiskum, G., Reed, J.C., 1999. Release of caspase-9 from mitochondria during neuronal apoptosis and cerebral ischemia. Proc. Natl. Acad. Sci. U. S. A. 96, 5752e5757. Lerner, U.H., Ohlsson, C., 2015. The WNT system: background and its role in bone. J. Intern Med. 277, 630e649. Locatelli, V., Bianchi, V.E., 2014. Effect of GH/IGF-1 on bone metabolism and osteoporsosis. Int. J. Endocrinol. 235060. Lim, M., Zhong, C., Yang, S., Bell, A.M., Cohen, M.B., Roy-Burman, P., 2010. Runx2 regulates survivin expression in prostate cancer cells. Lab. Invest. 90, 222e233. Li, X., Zhang, L., Zhu, Y., Li, Y., 2011. Dynamic analysis of exposure to aluminum and an acidic condition on bone formation in young growing rats. Environ. Toxicol.
7
Pharmacol. 31, 295e301. pez-Herrado n, A., Portal-Nún ~ ez, S., García-Martín, A., Lozano, D., Pe rezLo ~ a, V., Esbrit, P., 2013. Inhibition of the canonical Wnt pathway Martínez, F.C., Cen by high glucose can be reversed by parathyroid hormone-related protein in osteoblastic cells. J. Cell Biochem. 114, 1908e1916. Maeda, A., Ono, M., Holmbeck, K., Li, L., Kilts, T.M., Kram, V., Noonan, M.L., Yoshioka, Y., McNerny, E., Tantillo, M., Kohn, D., Lyons, K.M., Robey, P.G., Young, M.F., 2015. WNT1 induced secreted protein-1 (WISP1): a novel regulator of bone turnover and Wnt signaling. J. Biol. Chem. 290, 14004e14018. Matsuzaki, E., Takahashi-Yanaga, F., Miwa, Y., Hirata, M., Watanabe, Y., Sato, N., Morimoto, S., Hirofuji, T., Maeda, K., Sasaguri, T., 2006. Differentiation-inducing factor-1 alters canonical Wnt signaling and suppresses alkaline phosphatase expression in osteoblast-like cell lines. J. Bone Min. Res. 21, 1307e1316. Pan, L., Shi, X., Liu, S., Guo, X., Zhao, M., Cai, R., Sun, G., 2014. Fluoride promotes osteoblastic differentiation through canonical Wnt/b-catenin signaling pathway. Toxicol. Lett. 225, 34e42. Prince, M., Banerjee, C., Javed, A., Green, J., Lian, J.B., Stein, G.S., Bodine, P.V., Komm, B.S., 2001. Expression and regulation of Runx2/Cbfa1 and osteoblast phenotypic markers during the growth and differentiation of human osteoblasts. J. Cell Biochem. 80, 424e440. Qiang, Y.W., Barlogie, B., Rudikoff, S., Shaughnessy Jr., J.D., 2008. Dkk1-induced inhibition of Wnt signaling in osteoblast differentiation is an underlying mechanism of bone loss in multiple myeloma. Bone 42, 669e680. Ribes, D., Colomina, M.T., Vicens, P., Domingo, J.L., 2008. Effects of oral aluminum exposure on behavior and neurogenesis in a transgenic mouse model of Alzheimer’s disease. Exp. Neurol. 214, 293e300. Sprague, S.M., Krieger, N.S., Bushinsky, D.A., 1993. Aluminum inhibits bone nodule formation and calcification in vitro. Am. J. Physiol. 264, 882e890. Sun, X., Cao, Z., Zhang, Q., Liu, S., Xu, F., Che, J., Zhu, Y., Li, Y., Pan, C., Liang, W., 2015a. Aluminum trichloride impairs bone and downregulates Wnt/b-catenin signaling pathway in young growing rats. Food Chem. Toxicol. 86, 154e162. Sun, X., Cao, Z., Zhang, Q., Li, M., Han, L., Li, Y., 2015b. Aluminum trichloride inhibits osteoblast mineralization via TGF-b1/Smad signaling pathway. Chem. Biol. Interact. 244, 9e15. Suzuki, M., Bandoski, C., Bartlett, J.D., 2015. Fluoride induces oxidative damage and SIRT1/autophagy through ROS-mediated JNK signaling. Free Radic. Biol. Med. 89, 369e378. Tsang, S., Phu, F., Baum, M.M., Poskrebyshev, G.A., 2007. Determination of phosphate/arsenate by a modified molybdenum blue method and reduction of arsenate by S2O2 4 . Talanta 71, 1560e1568. Trevant, B., Gaur, T., Hussain, S., Symons, J., Komm, B.S., Bodine, P.V., Stein, G.S., Lian, J.B., 2008. Expression of secreted frizzled related protein 1, a Wnt antagonist, in brain, kidney, and skeleton is dispensable for normal embryonic development. J. Cell Physiol. 217, 113e126. Wang, B., Xing, W., Zhao, Y., Deng, X., 2010a. Effects of chronic aluminum exposure on memory through multiple signal transduction pathways. Environ. Toxicol. Pharmacol. 29, 308e313. Wang, M., Han, T., Cao, C., Wang, J., 2010b. Effects of aluminium and fluoride on the expression of type i collagen in the teeth of Guinea pigs. Fluoride 43, 45e51. Wang, Y.P., Li, Y.P., Christie, P., Shao, J.Z., Zhang, X.L., Wu, M.R., Chen, W., 2014. Wnt and the Wnt signaling pathway in bone development and disease. Front. Biosci. (Landmark Ed. 19, 379e407. Yakar, S., Courtland, H.W., Clemmons, D., 2010. IGF-1 and bone: new discoveries from mouse models. J. Bone Min. Res. 25, 2543e2552. Zhang, L., Jin, C., Lu, X., Yang, J., Wu, S., Liu, Q., Chen, R., Bai, C., Zhang, D., Zheng, L., Du, Y., Cai, Y., 2014. Aluminium chloride impairs long-term memory and downregulates cAMP-PKA-CREB signalling in rats. Toxicology 323, 95e108. Zhang, M., Lin, L., Lee, S.J., Mo, L., Cao, J., Ifedigbo, E., Jin, Y., 2009. Deletion of caveolin-1 protects hyperoxia-induced apoptosis via survivin-mediated pathways. Am. J. Physiol. Lung Cell Mol. Physiol. 297, 945e953.
Contents lists available at ScienceDirect
Chemosphere journal homepage: www.elsevier.com/locate/chemosphere
Inhibition of bone formation in rats by aluminum exposure via Wnt/bcatenin pathway Xudong Sun a, Haoran Wang a, Wanyue Huang a, Hongyan Yu a, Tongtong Shen a, Miao Song a, Yanfei Han a, Yanfei Li a, *, Yanzhu Zhu b, ** a b
College of Veterinary Medicine, Northeast Agricultural University, Harbin 150030, China Institute of Special Animal and Plant Sciences of Chinese Academy of Agricultural Sciences, Changchun 130112, China
h i g h l i g h t s Dynamic analysis of exposure to AlCl3 on rats bone formation. AlCl3 inactivated the Wnt/b-catenin signaling pathway in vivo. AlCl3 inhibited rats bone formation via inactivating Wnt/b-catenin signaling pathway.
a r t i c l e i n f o
a b s t r a c t
Article history: Received 25 April 2016 Received in revised form 20 January 2017 Accepted 15 February 2017 Available online 20 February 2017
The previous research found that aluminum trichloride (AlCl3) inhibited rat osteoblastic differentiation through inactivation of Wnt/b-catenin signaling pathway in vitro. On that basis, the experiment in vivo was conducted in this study. Rats were orally exposed to 0 (control group) and 0.4 g/L AlCl3 (AlCl3-treated group) for 30, 60, 90 or 120 days, respectively. We found that mRNA expressions of type I collagen and insulin-like growth factor-1, mRNA and protein expressions of Runx2 and survivin, ratio of p-GSK3b/ GSK3b and protein expression of b-catenin were all decreased, whereas the mRNA and protein expressions Dkk1 and sFRP1 and the mRNA expressions and activity of Caspase-3 were increased in the AlCl3treated group compared with the control group with time prolonged. These results suggest that AlCl3 inhibits bone formation and induces bone impairment by inhibiting the Wnt/b-catenin signaling pathway in young growing rats. © 2017 Elsevier Ltd. All rights reserved.
Handling Editor: A. Gies Keywords: Aluminum trichloride Bone formation Wnt/b-catenin signaling pathway Rat
1. Introduction Aluminum (Al) is an accumulative toxic metal for human (Crisponi et al., 2013; Bondy, 2014). It is used in various fields, such as Al containers and utensils, therapeutic agents, water purifiers and food additives (Wang et al., 2010a,b; Celik et al., 2012). Therefore, humans are susceptible to Al ion (Al3þ) toxicity, primarily through the ingestion of contaminated food and water (Ribes et al., 2008). Based on occurrence data for food in combination with consumption data, the French population’s mean exposure to Al in food is estimated at 40.3 mg/kg bw/day in adults
* Corresponding author. ** Corresponding author. Institute of Special Economic Animal and Plant Science, Chinese Academy of Agricultural Sciences, Jilin 130112, China. E-mail addresses: [email protected] (Y. Li), [email protected] (Y. Zhu). http://dx.doi.org/10.1016/j.chemosphere.2017.02.086 0045-6535/© 2017 Elsevier Ltd. All rights reserved.
and 62.2 mg/kg bw/day in children, in China with the highest exposure levels observed in children 471.7 mg/kg bw/day (Djouina et al., 2016). The wide distribution, extensive exposure to humans and inherent toxicity of Al is indeed a global public health problem that affects millions of people (Zhang et al., 2014). Bone is the primary site for Al accumulation, and 58e70% of the €m et al., total human Al body burden accumulates in bone (Hellstro 2005). The accumulation of Al in bone disrupts the bone formation, ultimately leads to Al-related bone disease (e.g., osteoporosis) (Kausz et al., 1999; Aaseth et al., 2012; Crisponi et al., 2013). In dialyzed patients, as bone Al concentrations increased from 46 ± 7 to 175 ± 22 mg/kg (dry weight), the severity of Al-induced bone disease increased (Hodsman et al., 1982). In our previous research aluminum trichloride (AlCl3) disturbed the metabolism of calcium and phosphorus, disrupted the microstructure of the bone, decreased the bone mineral density, thereby inhibited bone
2
X. Sun et al. / Chemosphere 176 (2017) 1e7
formation (Li et al., 2011; Sun et al., 2015a,b). But the molecular mechanism of inhibition of bone formation caused by AlCl3 are still not completely clarified. The Wnt/b-catenin signaling pathway plays an important role in regulating skeletal formation during the development, as well as bone remodeling, regeneration and repairment in the whole life (Lerner and Ohlsson, 2015; Maeda et al., 2015). Human bone diseases such as osteoporosis pseudoglioma syndrome, sclerosteosis and van Buchem’s disease are associated with aberrant Wnt/bcatenin signaling pathway (Wang et al., 2014). This pathway is triggered by binding Wnt ligand (e.g., Wnt3a) to frizzled receptor and its coreceptor low-density lipoprotein receptor-related protein (LRP-5/6) (Chuang et al., 2013). Disheveled is subsequently activated, which inhibits phosphorylation of glycogen synthase kinase 3b (GSK3b) and stabilizes b-catenin in cytoplasmic, and facilitates its transport to nuclei where it binds to transcription factors (Lef1/ Tcf) and alters gene expression (Pan et al., 2014). Inhibition of the Wnt/b-catenin signaling pathway results in osteoporosis (Kim et al., 2013). Thus, we concluded that the Wnt/b-catenin signaling pathway was involved in the inhibition of bone formation induced by Al. Furthermore, osteoblastic differentiation is an essential process of bone formation (Ducy et al., 2000). On that basis, our previous research further found that AlCl3 inhibits osteoblastic differentiation through inactivation of Wnt/b-catenin signaling pathway in vitro (Cao et al., 2016). But limited data showed the in vivo effects. Therefore, the effects of AlCl3 on the bone formation (marker for bone formation type I collagen (Col I) and Insulin-like growth factor-1 (IGF-1)) and Wnt/b-catenin signaling pathway (the mRNA and protein expressions of Dkk1, sFRP1, Runx2 and survivin, and the mRNA and activity of Caspase-3, the ratio of p-GSK3b/GSK3b and protein expression of b-catenin) in rat bone were determined on day 30, 60, 90 or 120, respectively. This study can provide a theoretical foundation for revealing the mechanism of inhibition of bone formation caused by AlCl3. 2. Materials and methods 2.1. Animals and treatments This experimental protocol was approved by the Ethics Committee on the Use and Care of Animals, Northeast Agricultural University, China. All efforts were made to comply with the roles for animal ethics and welfare. One-hundred and sixty 4-week-old healthy male Wistar rats weighed 72e95 g were acclimatized for 1 week then randomly divided into two groups, each 80 rats. Rats were orally exposed to 0 (control group) and 0.4 g/L AlCl3 (0.08 g/L Al, AlCl3-treated group) in drink water for 30, 60, 90 or 120 days, respectively. During the whole exposure duration, the water consumption was increased gradually with the increased of rat body weight. And the water consumption of the individual rat averaged at 16 ± 2 mL/d for 100 g body weight per day, resulting in the dose of AlCl3 at 64 mg/kg body weight for treatment group. The dose of this experiment was determined referencing the research of Sun (Sun et al., 2015a,b). A standard laboratory diet was fed to rats with free access to food and water. Rats were housed in the Biomedical Research Center, Northeast Agriculture University. The housing conditions were maintained at a constant temperature (24 ± 1 C), relative humidity at 55 ± 5%, and in a 12/12-h light/dark cycle. The rats were kept in plastic cages (five rats per cage) with soft chip bedding. The size of all the cages was 470: 300: 150 mm, large enough for the growth of five rats. The health status of rats were monitored daily and the body weight of rats were recorded every 10 days. No died rats were discovered during the experimental period. Twenty rats in each group were sacrificed under light ether
anesthesia on day 30, 60, 90 and 120 respectively. The femora were separated and stored at 70 C. 2.2. Measurement of serum pH Serum pH was measured with an Orion 868 pH meter (Thermo Electron Corporation, Waltham, MA, USA). 2.3. Measurement of serum and urine phosphorus content The concentration of phosphorus was detected using a diagnostic kit (SigmaeAldrich, St Louis, MO, USA) using the molybdenum blue method (Tsang et al., 2007). 2.4. Observation of femoral ultrastructure The femora shaft was fixed in 4% phosphate buffered paraformaldehyde for 4 weeks. The femora shaft was then decalcified in 10% EDTA until the femora shaft was soft and flexible, then the femora shaft was embedded with embedding medium (100% acetone: Epon812 ¼ 2:1). Embedded samples were sectioned to a thickness of 600 Å and stained with lead staining solution. Finally, the sections were analyzed with a transmission electron microscope T-400 (Philips, Eindhoven, NL). 2.5. qRT-PCR The mRNA expressions of Col I, IGF-1, Dkk1, sFRP1, Runx2, survivin and Caspase-3 were detected by quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR). The shaft of femur was stripped of periosteum and then it was cut transversely with bone cutters to expose the bone marrow. The trabecular bone and marrow cavities were flushed with ice-cold sterile phosphate-buffered saline to remove the marrow. Femora were crushed using a mortar and pestle in liquid nitrogen. Total RNA was extracted with Trizol reagent (Invitrogen, USA) from femora according to the manufacturer’s guidelines. cDNA was synthesized with the transcriptor First Strand cDNA Synthesis kit (TransScript First-Strand cDNA Synthesis SuperMix, TransGen Blotech, China). The relative expression of target genes was determined by the 2DDCT method (Suzuki et al., 2015). The primers of the genes are shown Table 1. The light cycler was programmed to carry out a melting cycle to verify the specificity of the amplified products. b-actin was used as internal control to adjust the amount of mRNA in each sample. qRT-PCR was performed using ABI PRISM 7500 Real-Time PCR System (Applied Biosystems, CA). The data were presented as the relative mRNA levels. 2.6. Western blotting The distal femoral metaphysis was stripped of periosteum and then it was cut transversely with bone cutters to expose the bone marrow. The trabecular bone and marrow cavities were flushed with ice-cold sterile phosphate-buffered saline to remove the marrow. The total protein was extracted using a bone protein extraction kit (Beijing Tiandz, Inc. Beijing, China) and the total protein content was quantified by the BCA assay (Beyotime Institute of Biotechnology, China). The protein was separated in sodium dodecyl sulfate-polyacrylamide gels electrophoresis, electrotransferred onto PVDF membranes. Then the PVDF membranes were incubated with anti-phospho-GSK3b(Ser-9), anti-GSK3b, anti-Runx2, anti-Dkk1, anti-sFRP1 and anti-survivin (Abcam, USA) under 4 C overnight. Subsequently the PVDF membranes were incubated with an appropriate secondary antibody (ZSGB-BIO, China). b-actin protein level was used as internal control to adjust
X. Sun et al. / Chemosphere 176 (2017) 1e7
3
Table 1 Primer sequences and amplification lengths of destination fragments. Gene
Gene Number
Primer Sequence
Primer Length (bp)
Product Length (bp)
Col I
NM053304.1 NM_178866.4
Dkk1
NM_001106350
sFRP1
NM_001276712
Runx2
NM_35789.2
survivin
NM_171992
Caspase-3
NM_012922.2
b-actin
NM_031144
21 21 20 20 20 19 20 20 22 21 20 20 18 19 18 21
193
IGF-1
UP 50 AGCAGACGGGAGTTTCACCTC 30 LOW 50 TGTCTTCTTGGCCATGCGTCA 30 UP 50 GAAAGCACTTGGCCCAATGG30 LOW 50 CTGCTCTCCACCACCATTCT30 UP 50 TGACCACAGCCATTTACCTC30 LOW 50 AGAGCCTTCTTGCCCTTTG30 UP 50 GGACAACCTCAGCCACAACT30 LOW 50 GACTGGAAGGTGGGACACTC30 UP 50 ACAAACGAGAAAAGCGTCAAGC30 LOW 50 CCAGTCATTCCACCCCACATCA30 UP 50 AAAGGGTCACCACCAGCTTA30 LOW 50 ACAGGGCAGACTGTGTGGAT30 UP 50 ACGGCGAGAACAGTTGAA30 LOW 50 AGAAAGAAGATGGGAAGCA30 UP 50 GCCAACACAGTGCTGTCT30 LOW 50 AGGAGCAATGATCTTGATCTT30
the amount of protein expression in each sample. Finally, protein bands were observed using the enhanced chemiluminescent (ECL) reagent (Beyotime Institute of Biotechnology, China).
2.7. Activity analysis The activity of Caspase-3 was determined by Caspase-3 activity assay kits (Beyotime institute of biotechnology, Jiangsu, China). The procedure was carried out according to the manufacturer’s instructions. The adsorption values were recorded under 405 nm by a 318 MC microplate reader (Shanghai Sanco instrument Co., Ltd., China).
2.8. Immunofluorescence staining The femora shaft was fixed in 4% phosphate buffered paraformaldehyde for 4 weeks. The femora shaft was then decalcified in 10% EDTA until the femora shaft was soft and flexible, then the femora shaft was embedded in paraffin in a Tissue-Tekо VIP 3000 processor. Embedded samples were sectioned to a thickness of 5 mm and incubated using mouse monoclonal anti-b-catenin (1: 200) overnight at 4 C followed by FITC-conjugated secondary antibody and. The fluorescence signal of b-catenin was visualized using confocal fluorescence microscopy (Olympus, Japan). 2.9. Statistical analysis Statistical analyses were done using SPSS 22.0 for Windows (SPSS Inc., Chicago, IL, USA) with one-way analysis of variance followed by Student’s t-test. Data are shown as least square means and standard deviation (SD, bar on the top of each column). The P values of less than 0.05 were considered significant, and P values of less than 0.01 were considered markedly significant.
3. Results 3.1. AlCl3 increased the contents of phosphorus in serum and urine As shown in Table 2, there were no significant changes in serum pH in the control group and AlCl3-treated group during the experimental period. While the phosphorus contents in serum and urine also increased gradually in the AlCl3-treated group, and were significantly higher than in the control group on day 120 (P < 0.05).
163 185 208 335 177 255 114
3.2. AlCl3 damaged femoral ultrastructure and inhibited bone formation related genes expression To investigate the effect of AlCl3 on the ultrastructure of bone and the reliable and sensitive marker for bone formation. The ultrastructure of bone are shown in Fig. 1A for control group, and Fig. 1B, C, D and E for AlCl3-treated group on day 30, 60, 90 and 120, respectively. There were obvious damages on the membrane and cytoplasm in AlCl3-treated group on day 90 and 120. The structure of bone showed that cell membrane incomplete, cell swelling, spinal fracture, lots of foam-like structure, lysosomal increasing (Fig. 1D and E). Furthermore, we measured the gene expressions of Col I and IGF-1 by qRT-PCR. As shown in Fig. 1F and G, the mRNA expressions of Col I and IGF-1 decreased gradually in the AlCl3-treated group with the time prolonged and were markedly lower than those in control group on day 60, 90 and 120 (P < 0.05; P < 0.01). These results suggested that AlCl3 damaged femoral ultrastructure and inhibited bone formation related genes expression. 3.3. AlCl3 promoted the inhibitors of Wnt/b-catenin pathway expressions In order to explore the effect of AlCl3 on inhibitors of Wnt/bcatenin signaling pathway. We measured the gene expressions of Dkk1 and sFRP1 by qRT-PCR and the protein levels of Dkk1 and sFRP1 by Western Blotting. As shown in Fig. 2A, B, C, D and E the Dkk1 and sFRP1 mRNA and protein levels were all increased in the AlCl3-treated group with the time prolonged and were significantly higher than those in control group on day 60, 90 and 120 (P < 0.05; P < 0.01), indicating that AlCl3 increased the mRNA and protein levels of the inhibitors of Wnt/b-catenin signaling pathway, which inactivated Wnt/b-catenin signaling pathway. 3.4. AlCl3 inhibited of Wnt/b-catenin pathway To further clarify the effect of AlCl3 on the Wnt/b-catenin signaling pathway. We measured the protein levels of p-GSK3b and GSK3b by Western Blotting, and the protein expression of b-catenin by immunofluorescence. As shown in Fig. 3A and B, the ratio of pGSK3b/GSK3b protein levels were decreased in the AlCl3-treated group with the time prolonged and were significantly lower than those in control group on day 60, 90 and 120 (P < 0.05; P < 0.01). The protein expression of b-catenin (Fig. 3C) were decreased gradually in the AlCl3-treated group with the time prolonged,
4
X. Sun et al. / Chemosphere 176 (2017) 1e7
Table 2 Effects of AlCl3 exposure on serum pH, the level of phosphorus in serum and urine. 30d Serum pH Serum phosphorus (mg/dL) Urine phosphorus (mg/dL)
C At C At C At
7.21 7.19 3.10 3.24 0.34 0.33
60d ± ± ± ± ± ±
0.28 0.25 0.21 0.22 0.05 0.06
7.24 7.20 3.04 3.18 0.32 0.35
90d ± ± ± ± ± ±
0.20 0.34 0.18 0.16 0.07 0.08
7.27 7.15 3.23 3.31 0.33 0.40
120d ± ± ± ± ± ±
0.18 0.16 0.20 0.24 0.06 0.06
7.27 7.16 3.11 3.35 0.37 0.45
± ± ± ± ± ±
0.18 0.23 0.17 0.21* 0.08 0.07*#
Data are means ± SD (n ¼ 20 per time-point). C, control group; At, AlCl3-treated group. *P < 0.05 and **P < 0.01 versus the control group. #P < 0.05 and ##P < 0.01 versus the AlCl3-treated group on day 30.
A
B
C
D
E
Fig. 1. Effects of AlCl3 on the femora ultrastructure and the Col I and IGF-1 mRNA expressions in femora of rats. The rats were orally exposed to 0 (control group) and 0.4 g/L AlCl3 (0.08 g/L Al, AlCl3-treated group) in drink water for 30, 60, 90 or 120 days, respectively. The femora ultrastructure and the Col I and IGF-1 mRNA expressions in femora of rats were measured by transmission electron microscope and qRT-PCR. A, bone tissue of rats in control group (8000). B, C, D and E, bone tissue of rats in AlCl3-treated group on days 30, 60, 90 and 120, respectively (8000). F and G, the Col I and IGF-1 mRNA expressions in femora of rats. Data are means ± SD (n ¼ 20 per time-point). *P < 0.05 and **P < 0.01 versus the control group. #P < 0.05 and ##P < 0.01 versus the AlCl3-treated group on day 30.
Fig. 2. Effects of AlCl3 on Dkk1 and sFRP1 protein levels (A, B and C) and mRNA expressions (D and E) in femora of rats. The Dkk1 and sFRP1 protein levels and mRNA expressions were measured by Western Blotting and qRT-PCR. Data are means ± SD (n ¼ 20 per time-point). *P < 0.05 and **P < 0.01 versus the control group. #P < 0.05 and ##P < 0.01 versus the AlCl3-treated group on day 30.
indicating that AlCl3 inactivated Wnt/b-catenin signaling pathway. 3.5. Runx2, survivin and Caspase-3 involved in regulating AlCl3induced rat bone impairment To ascertain the effect of AlCl3 on target gene of Wnt/b-catenin signaling pathway, and the marker for the apoptosis bone
functional cell. We measured the gene expressions of Runx2, antiapoptotic gene (survivin) and pro-apoptotic gene (Caspase-3) by qRT-PCR; the protein expressions of Runx2 and survivin by Western Blotting; the activity of Caspase-3 by activity assay kits. As shown in Fig. 4A, B, C, D and E, the protein and mRNA levels of Runx2 and survivin were decreased gradually in the AlCl3-treated group with the time prolonged and were markedly lower than those in control
X. Sun et al. / Chemosphere 176 (2017) 1e7
5
4. Discussion
Fig. 3. The p-GSK3b/GSK3b protein levels (A and B) and b-catenin protein expression (C) in femora of rats were measured by Western Blotting and immunofluorescence staining. The arrows represents green b-catenin protein in femora of rats. A representative result from the three independent experiments is shown. (Magnification 40). Scale bar, 50 mm. Data are means ± SD (n ¼ 20 per time-point). *P < 0.05 and **P < 0.01 versus the control group. #P < 0.05 and ##P < 0.01 versus the AlCl3-treated group on day 30. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
group on day 30, 60, 90 and 120 (P < 0.05; P < 0.01). Whereas, the mRNA expression and activity of Caspase-3 (Fig. 4F and G) increased gradually in the AlCl3-treated group with the time prolonged and were markedly higher than those in control group on day 60, 90 and 120 (P < 0.05; P < 0.01).
Our results showed that AlCl3 significantly inhibited bone formation and induced bone impairment of rats, which agreed with previous studies (Li et al., 2011; Crisponi et al., 2013; Sun et al., 2015a,b). We found AlCl3 inhibited bone formation by decreasing the mRNA expressions of bone formation makers such as Col I and IGF-1 in rat bone. Then, we found that AlCl3 inactivated Wnt/bcatenin pathway, following enhanced the mRNA and protein levels of Dkk1 and sFRP1, inhibited ratio of p-GSK3b/GSK3b, decreased bcatenin stabilization. Finally, AlCl3 induced bone cell apoptosis by decreasing the expressions of Runx2 and survivin, increasing the mRNA expressions and activities of Caspase-3. With time prolonged the adverse effects of AlCl3 exposure got worse. All above results suggested that AlCl3 inhibited bone formation and induced bone cell apoptosis through inactivation of Wnt/b-catenin pathway in rat bone. Col I and IGF-1 are reliable and sensitive markers for mineralization and formation of bone. Col I is the primary composition of extracellular matrix, which provides a mineralization scaffold for bone matrix (Cui et al., 2010). Sprague et al. proved that AlCl3 inhibited collagen synthesis, thereby, inhibited nodule formation and calcification in mouse osteoblast (Sprague et al., 1993). Our previous research found that 0.01, 0.02 and 0.04 mg/mL Al3þ inhibited Col I mRNA expression of rat osteoblast (Sun et al., 2015a,b). In this study, AlCl3 significant decreased Col I mRNA expression, which indicated AlCl3 inhibited synthesis, secretion, and mineralization of bone matrix. In addition, IGF-1 is considered essential for longitudinal bone growth, skeletal maturation, and bone mass acquisition during the growth, as well as the maintenance of bone in adult life (Locatelli and Bianchi, 2014). In a model where chondrocyte IGF-1 synthesis was disrupted, significant reductions in body weight, body length, total-body bone mineral density, and femoral length were observed beginning at 4 weeks of
Fig. 4. Effects of AlCl3 on Runx2 and survivin protein and mRNA expressions (A, B, C, D and E) and on the Capase-3 mRNA expression (F) and activity (G) in femora of rats. The Runx2 and survivin protein and mRNA expressions were measured by Western Blotting and qRT-PCR, and Capase-3 mRNA expression and activity were measured by byqRT-PCR and activity assay kits. Data are means ± SD (n ¼ 20 per time-point). *P < 0.05 and **P < 0.01 versus the control group. #P < 0.05 and ##P < 0.01 versus the AlCl3-treated group on day 30.
6
X. Sun et al. / Chemosphere 176 (2017) 1e7
Fig. 5. AlCl3 inhibits the Wnt/b-catenin signaling pathway to mediate bone metabolism in rats. AlCl3 increases Dkk1 and sFRP1 mRNA and protein expressions, thus inhibits the ratio of p-GSK3b/GSK3b and protein expression of b-catenin. Down-regulation of b-catenin decreases the expression of Runx2. Inactivated Runx2 decreases bone formation genes expression, including Col I and IGF-1, which further decrease bone formation.
age in both female and male mice (Yakar et al., 2010). In this study, AlCl3 significant decreased IGF-1 mRNA expression, which indicated AlCl3 inhibited bone formation. Furthermore, IGF-1 regulated Col I synthesis in osteoblast, which is essential for processes required for bone formation. The down-regulated IGF-1 expression might be a main reason for the inhibitory effect of AlCl3 on mRNA expression of Col I. Collectively, these results indicated that AlCl3 inhibited the bone formation related genes expression. Wnt/b-catenin signaling pathway is associated with bone diseases (Wang et al., 2014). Inhibition of the Wnt/b-catenin signaling pathway results in osteoporosis (Kim et al., 2013). Dkk1 and sFRP1 are upstream inhibitor of Wnt/b-catenin pathway (Qiang et al., 2008; Trevant et al., 2008). Dkk-1 negatively controls Wnt/b-catenin signaling pathway by competing with Wnt proteins for binding to LRP-5/6 receptor (Qiang et al., 2008). sFRP1 bind directly to Wnt proteins to antagonise Wnt/b-catenin pathway (Trevant et al., 2008). Increase of Dkk-1 and sFRP1 inactivate Wnt/b-catenin pathway and inhibit bone formation (Kim et al., 2013). In this study, AlCl3 significant increased Dkk-1 and sFRP1 mRNA and protein levels with AlCl3 administration time prolonged, which indicated AlCl3 inactivated Wnt/b-catenin pathway. In addition, parathyroid hormone (PTH) can active Wnt/b-catenin signaling pathway by reducing Dkk1 and sFRP1 expressions, which promote bone formation (Wang et al., 2014). Our previous studies showed that AlCl3 exposure decreased serum PTH level of rat (Li et al., 2011). Thus we deduced that the lower serum level of PTH was a reason for up-regulating Dkk-1 and sFRP1, eventually inactivated Wnt/bcatenin signaling pathway with AlCl3 exposure. GSK3b negatively controls Wnt/b-catenin signaling pathway by phosphorylating and promoting the degradation of b-catenin (Pan et al., 2014). Decrease of GSK3b phosphorylation could promote GSK3b activity, inducing the degradation of b-catenin in rat bone pez-Herrado n et al., 2013). Our previous (Matsuzaki et al., 2006; Lo research found that 0.204 mM, 0.408 mM and 0.816 mM AlCl3 significant decreased ratio of p-GSK-3b/GSK3b and the protein expression of b-catenin in rats osteoblast (Cao et al., 2016). Consistent with previous studies, our results showed that AlCl3 significant decreased ratio of p-GSK-3b/GSK3b and b-catenin protein level with AlCl3 administration time prolonged, indicating that AlCl3 inhibited the phosphorylation of GSK3b, leading to inactivation of Wnt/b-catenin signaling.
Runx2 is a direct target of the Wnt/b-catenin pathway, which regulates numerous target genes (Col and IGF-1) essential for processes required for bone formation (Prince et al., 2001; Bialek et al., 2004; Pan et al., 2014). The inhibition effects of AlCl3 on bone formation were attributed to the decreased expression of Runx2 (Cao et al., 2016). In this study, the mRNA and protein expression of Runx2 were decreased with AlCl3 administration time prolonged, which might attribute to the inactivation of Wnt/bcatenin signaling or the direct effect of AlCl3 exposure. Survivin in an anti-apoptosis gene, which interdicted the progress of cell apoptosis by inhibiting the expression of Caspase-3 (Zhang et al., 2009). Caspase-3 is a member of cysteine proteases family and responsible for the cleavage of key cellular proteins, then leads to typical morphological changes in cells undergoing apoptosis (Krajewski et al., 1999). Down-regulation of Runx2 would inhibit the survivin expression and promote the Caspase-3 expression, eventually leading to bone cell apoptosis and the inhibition of bone formation (Lim et al., 2010). In this study, AlCl3 significant decreased gene and protein level of survivin, and increased gene expression and activity of Caspase-3, subsequently caused bone cell apoptosis, which may be at least partially responsible for the bone impairment induced by AlCl3. Taken together, the inhibition of the Wnt/b-catenin pathway and the consequent depression of Runx2 and survivin, up-regulation of Caspase-3 gene expression and activity strongly suggest that the Wnt/b-catenin signaling pathway is involved in AlCl3-induced bone impairment and inhibition of bone formation.
5. Conclusion AlCl3 exposure decreased gene expressions of Col I and IGF-1, and downregulated the Wnt/b-catenin signaling pathway with AlCl3 administration time prolonged, indicating that AlCl3 inhibits bone formation by inactivating the Wnt/b-catenin signaling pathway (Fig. 5).
Conflict of interest The authors declare that there are no conflicts of interest.
X. Sun et al. / Chemosphere 176 (2017) 1e7
Acknowledgments This study was supported by a grant from the National Natural Science Foundation Project (31372496 and 31302147). References Aaseth, J., Boivin, G., Andersen, O., 2012. Osteoporosis and trace elementsean overview. J. Trace Elem. Med. Biol. 26, 149e152. Bialek, P., Kern, B., Yang, X., Schrock, M., Sosic, D., Hong, N., Wu, H., Yu, K., Ornitz, D.M., Olson, E.N., Justice, M.J., Karsenty, G., 2004. A twist code determines the onset of osteoblast differentiation. Dev. Cell. 6, 423e435. Bondy, S.C., 2014. Prolonged exposure to low levels of aluminum leads to changes associated with brain aging and neurodegeneration. Toxicology 315, 1e7. Cao, Z., Fu, Y., Sun, X., Zhang, Q., Xu, F., Li, Y., 2016. Aluminum trichloride inhibits osteoblastic differentiation through inactivation of Wnt/b-catenin signaling pathway in rat osteoblasts. Environ. Toxicol. Pharmacol. 42, 198e204. Celik, H., Celik, N., Kocyigit, A., Dikilitas, M., 2012. The relationship between plasma aluminum content, lymphocyte DNA damage, and oxidative status in persons using aluminum containers and utensils daily. Clin. Biochem. 45, 1629e1633. Chuang, K.A., Lieu, C.H., Tsai, W.J., Huang, W.H., Lee, A.R., Kuo, Y.C., 2013. 3Methoxyapigenin modulates b-catenin stability and inhibits Wnt/b-catenin signaling in Jurkat leukemic cells. Life Sci. 92, 677e686. Crisponi, G., Fanni, D., Gerosa, C., Nemolato, S., Nurchi, V.M., Crespo-Alonso, M., Lachowicz, J.I., Faa, G., 2013. The meaning of aluminium exposure on human health and aluminium-related diseases. Biomol. Concepts 4, 77e87. Cui, C., Wang, S., Myneni, V.D., Hitomi, K., Kaartinen, M.T., 2010. Transglutaminase activity arising from Factor XIIIA is required for stabilization and conversion of plasma fibronectin into matrix in osteoblast cultures. Bone 59, 127e138. Djouina, M., Esquerre, N., Desreumaux, P., Vignal, C., Body-Malapel, M., 2016. Toxicological consequences of experimental exposure to aluminum in human intestinal epithelial cells. Food Chem. Toxicol. 91, 108e116. Ducy, P., Schinke, T., Karsenty, G., 2000. The osteoblast: a sophisticated fibroblast under central surveillance. Science 289, 1501e1504. € m, H.O., Mjo €berg, B., Mallmin, H., Michae €lsson, K., 2005. The aluminum Hellstro content of bone increases with age, but is not higher in hip fracture cases with and without dementia compared to controls. Osteoporos. Int. 16, 1982e1988. Hodsman, A.B., Sherrard, D.J., Alfrey, A.C., Ott, S., Brickman, A.S., Miller, N.L., Maloney, N.A., Coburn, J.W., 1982. Bone aluminum and histomorphometric features of renal osteodystrophy. J. Clin. Endocr. Metab. 54, 539e546. Kausz, A.T., Antonsen, J.E., Hercz, G., Pei, Y., Weiss, N.S., Emerson, S., Sherrard, D.J., 1999. Screening plasma aluminum levels in relation to aluminum bone disease among asymptomatic dialysis patients. Am. J. Kidney Dis. 34, 688e693. Kim, J.H., Liu, X., Wang, J., Chen, X., Zhang, H., Kim, S.H., Cui, J., Li, R., Zhang, W., Kong, Y., Zhang, J., Shui, W., Lamplot, J., Rogers, M.R., Zhao, C., Wang, N., Rajan, P., Tomal, J., Statz, J., Wu, N., Luu, H.H., Haydon, R.C., He, T.C., 2013. Wnt signaling in bone formation and its therapeutic potential for bone diseases. Ther. Adv. Musculoskelet. Dis. 5, 13e31. Krajewski, S., Krajewska, M., Ellerby, L.M., Welsh, K., Xie, Z., Deveraux, Q.L., Salvesen, G.S., Bredesen, D.E., Rosenthal, R.E., Fiskum, G., Reed, J.C., 1999. Release of caspase-9 from mitochondria during neuronal apoptosis and cerebral ischemia. Proc. Natl. Acad. Sci. U. S. A. 96, 5752e5757. Lerner, U.H., Ohlsson, C., 2015. The WNT system: background and its role in bone. J. Intern Med. 277, 630e649. Locatelli, V., Bianchi, V.E., 2014. Effect of GH/IGF-1 on bone metabolism and osteoporsosis. Int. J. Endocrinol. 235060. Lim, M., Zhong, C., Yang, S., Bell, A.M., Cohen, M.B., Roy-Burman, P., 2010. Runx2 regulates survivin expression in prostate cancer cells. Lab. Invest. 90, 222e233. Li, X., Zhang, L., Zhu, Y., Li, Y., 2011. Dynamic analysis of exposure to aluminum and an acidic condition on bone formation in young growing rats. Environ. Toxicol.
7
Pharmacol. 31, 295e301. pez-Herrado n, A., Portal-Nún ~ ez, S., García-Martín, A., Lozano, D., Pe rezLo ~ a, V., Esbrit, P., 2013. Inhibition of the canonical Wnt pathway Martínez, F.C., Cen by high glucose can be reversed by parathyroid hormone-related protein in osteoblastic cells. J. Cell Biochem. 114, 1908e1916. Maeda, A., Ono, M., Holmbeck, K., Li, L., Kilts, T.M., Kram, V., Noonan, M.L., Yoshioka, Y., McNerny, E., Tantillo, M., Kohn, D., Lyons, K.M., Robey, P.G., Young, M.F., 2015. WNT1 induced secreted protein-1 (WISP1): a novel regulator of bone turnover and Wnt signaling. J. Biol. Chem. 290, 14004e14018. Matsuzaki, E., Takahashi-Yanaga, F., Miwa, Y., Hirata, M., Watanabe, Y., Sato, N., Morimoto, S., Hirofuji, T., Maeda, K., Sasaguri, T., 2006. Differentiation-inducing factor-1 alters canonical Wnt signaling and suppresses alkaline phosphatase expression in osteoblast-like cell lines. J. Bone Min. Res. 21, 1307e1316. Pan, L., Shi, X., Liu, S., Guo, X., Zhao, M., Cai, R., Sun, G., 2014. Fluoride promotes osteoblastic differentiation through canonical Wnt/b-catenin signaling pathway. Toxicol. Lett. 225, 34e42. Prince, M., Banerjee, C., Javed, A., Green, J., Lian, J.B., Stein, G.S., Bodine, P.V., Komm, B.S., 2001. Expression and regulation of Runx2/Cbfa1 and osteoblast phenotypic markers during the growth and differentiation of human osteoblasts. J. Cell Biochem. 80, 424e440. Qiang, Y.W., Barlogie, B., Rudikoff, S., Shaughnessy Jr., J.D., 2008. Dkk1-induced inhibition of Wnt signaling in osteoblast differentiation is an underlying mechanism of bone loss in multiple myeloma. Bone 42, 669e680. Ribes, D., Colomina, M.T., Vicens, P., Domingo, J.L., 2008. Effects of oral aluminum exposure on behavior and neurogenesis in a transgenic mouse model of Alzheimer’s disease. Exp. Neurol. 214, 293e300. Sprague, S.M., Krieger, N.S., Bushinsky, D.A., 1993. Aluminum inhibits bone nodule formation and calcification in vitro. Am. J. Physiol. 264, 882e890. Sun, X., Cao, Z., Zhang, Q., Liu, S., Xu, F., Che, J., Zhu, Y., Li, Y., Pan, C., Liang, W., 2015a. Aluminum trichloride impairs bone and downregulates Wnt/b-catenin signaling pathway in young growing rats. Food Chem. Toxicol. 86, 154e162. Sun, X., Cao, Z., Zhang, Q., Li, M., Han, L., Li, Y., 2015b. Aluminum trichloride inhibits osteoblast mineralization via TGF-b1/Smad signaling pathway. Chem. Biol. Interact. 244, 9e15. Suzuki, M., Bandoski, C., Bartlett, J.D., 2015. Fluoride induces oxidative damage and SIRT1/autophagy through ROS-mediated JNK signaling. Free Radic. Biol. Med. 89, 369e378. Tsang, S., Phu, F., Baum, M.M., Poskrebyshev, G.A., 2007. Determination of phosphate/arsenate by a modified molybdenum blue method and reduction of arsenate by S2O2 4 . Talanta 71, 1560e1568. Trevant, B., Gaur, T., Hussain, S., Symons, J., Komm, B.S., Bodine, P.V., Stein, G.S., Lian, J.B., 2008. Expression of secreted frizzled related protein 1, a Wnt antagonist, in brain, kidney, and skeleton is dispensable for normal embryonic development. J. Cell Physiol. 217, 113e126. Wang, B., Xing, W., Zhao, Y., Deng, X., 2010a. Effects of chronic aluminum exposure on memory through multiple signal transduction pathways. Environ. Toxicol. Pharmacol. 29, 308e313. Wang, M., Han, T., Cao, C., Wang, J., 2010b. Effects of aluminium and fluoride on the expression of type i collagen in the teeth of Guinea pigs. Fluoride 43, 45e51. Wang, Y.P., Li, Y.P., Christie, P., Shao, J.Z., Zhang, X.L., Wu, M.R., Chen, W., 2014. Wnt and the Wnt signaling pathway in bone development and disease. Front. Biosci. (Landmark Ed. 19, 379e407. Yakar, S., Courtland, H.W., Clemmons, D., 2010. IGF-1 and bone: new discoveries from mouse models. J. Bone Min. Res. 25, 2543e2552. Zhang, L., Jin, C., Lu, X., Yang, J., Wu, S., Liu, Q., Chen, R., Bai, C., Zhang, D., Zheng, L., Du, Y., Cai, Y., 2014. Aluminium chloride impairs long-term memory and downregulates cAMP-PKA-CREB signalling in rats. Toxicology 323, 95e108. Zhang, M., Lin, L., Lee, S.J., Mo, L., Cao, J., Ifedigbo, E., Jin, Y., 2009. Deletion of caveolin-1 protects hyperoxia-induced apoptosis via survivin-mediated pathways. Am. J. Physiol. Lung Cell Mol. Physiol. 297, 945e953.