- Email: [email protected]
Inhibition of cell proliferation in head and neck squamous cell carcinoma cell lines with antisense cyclin D1
Inhibition of cell proliferation in head and neck squamous cell carcinoma cell lines with antisense cyclin D1 MARILENE B. WANG, MD, KATHLEEN R. BILLINGS, MD, NATARAJAN VENKATESAN, PhD, FREDERICK L. HALL, PhD, and ERI S. SRIVATSAN, PhD, Los Angeles, California
Cyclin D1 and cyclin G are essential regulatory factors in the progression of the cell cycle from G0 through G1 and S phase. Aberrations in expression of these cyclins may lead to dysregulated cellular proliferation that could result in neoplasia. Amplification and overexpression of cyclin D1 have been observed in many human cancers, whereas cyclin G is a new cyclin recently described in osteosarcoma cells. This study was performed to determine whether these cyclins were amplified in head and neck squamous cell carcinoma (HNSCC) tumors. Polymerase chain reaction of DNA extracted from 22 HNSCC primary tumors and three HNSCC cell lines did not reveal amplification of cyclin D1 in any of the tumor samples. Southern blot analysis identified amplification of cyclin D1 in a single tumor. Amplification of cyclin G was not observed in any of the tumors by Southern blot hybridization with a cyclin G probe. HNSCC cell lines transfected with antisense cyclin D1 were tested for cell proliferation by the incorporation of 3Hthymidine into cells grown in serum-free media. By 72 hours of incubation, there was a greater than 30% reduction in proliferation of cells transfected with antisense cyclin D1 as compared with nontransfected control cells. The results indicate that cyclin D1 may play an important role in the growth and proliferation of HNSCC cells. (Otolaryngol Head Neck Surg 1998;119:593-9.)
From the Division of Head and Neck Surgery (Drs. Wang and Billings) and the Department of Surgery (Dr. Srivatsan), UCLA School of Medicine, West Los Angeles Veterans Administration Medical Center; and the Division of Orthopedic Surgery (Drs. Venkatesan and Hall), Children’s Hospital of Los Angeles. Supported by the Resident Research Grant from the American Academy of Otolaryngology–Head and Neck Surgery (no. H940510). Presented at the Annual Meeting of the American Academy of Otolaryngology–Head and Neck Surgery, New Orleans, La., Sept. 17-20, 1995. Reprint requests: Marilene B. Wang, MD, Division of Head and Neck Surgery, UCLA Medical Center, CHS 62-132, 10833 LeConte Ave., Los Angeles, CA 90095-1624. 23/1/87438
T
he cyclins and cyclin-dependent kinases are essential regulatory factors in the progression of the cell from G1 through S phase.1 The crucial point between G1 and S determines the ultimate fate of the cell. At this junction, the cell will either proceed with DNA synthesis and subsequent proliferation or enter a state of relative senescence, and it may even begin the process of apoptosis. Aberration of the cell cycle control mechanism at the G1-S interphase could result in uncontrolled cellular proliferation (transformation) or excessive cell death (apoptosis). Dysregulation of the cell cycle leading to uncontrolled cellular proliferation is the hallmark of neoplastic transformation. Cyclin D1 is a G1 cyclin that is required for entry into S phase.2 Amplification and overexpression of cyclin D1 have been observed in many human tumors, including head and neck squamous cell carcinoma (HNSCC).3-5 Such an aberration is believed to result in shortening of the G1 phase and accelerated entry of cells into S phase, with subsequent cellular proliferation. The mechanism of action of cyclin D1 involves activation of cyclin-dependent kinase 4 (cdk-4), which then phosphorylates the tumor-suppressor gene product pRb. pRb normally functions as a growth suppressor by preventing entry of the cell into the S phase. However, hyperphosphorylation of pRb in late G1 phase inactivates pRb function and allows the cell to proceed to S phase.6 It is thus apparent that overexpression of cyclin D1 could result in an increased activation of cdk-4, which in turn can lead to increased phosphorylation of pRb and accelerated entry of cells into S phase. Amplification and overexpression of cyclin D1 in many human tumors suggest that amplification plays an important role in the uncontrolled proliferation of neoplastic cells. Cyclin G is a new cyclin that has recently been described in human osteosarcoma cell lines through the use of rat cyclin G coding sequences.7 This cyclin appears to function in the regulation of the G0-G1 transition. Although overexpression of cyclin G has been observed in several human osteosarcoma cell lines, functional significance of this overexpression is not yet known. It is postulated that this cyclin may play a role in the priming of cells to respond to mitogenic serum factors. In the highly synchronized MG-63 osteosarcoma 593
594
Otolaryngology– Head and Neck Surgery December 1998
WANG et al.
cell line, the level of cyclin G expression remained high throughout the cell cycle and was not diminished during prolonged serum deprivation. The studies therefore indicate that cyclin G may function early in cell cycle, perhaps during G0 phase, to allow the cell to enter G1.7 The purpose of this study was to determine the level of amplification of cyclin D1 and cyclin G in HNSCC tumor samples. In addition, transfection studies were performed to determine whether the blockage of cyclin D1 expression with antisense cyclin D1 could result in decreased proliferation of HNSCC cells. METHODS AND MATERIAL HNSCC Tumor Collection and Cell Lines Subjects for study were selected from those patients undergoing surgical resection of their head and neck cancer at the Wadsworth Veterans Administration Medical Center, UCLA Medical Center, and the Harbor-UCLA Medical Center in Los Angeles. The protocol was approved by the UCLA Human Subject Protection Committee (HSPC no. 93-12-679), the Committee on Human Studies at the Veterans Administration Medical Center, West Los Angeles, and the Human Subject Protection Committee of Harbor-UCLA Medical Center. Informed consent was obtained according to the guidelines of the Human Subjects Protection Committees of these individual institutions. After the tumor was resected in the operating room, approximately 1 cm3 piece of tumor tissue was provided by the pathologist after ascertaining that there was sufficient material left for pathologic evaluation. Tumor tissue was then snap-frozen on dry ice and stored in liquid nitrogen for later use. Diagnosis of squamous cell carcinoma was confirmed by the pathologist. The CAL 27 cell line was a gift of G. Juilliard, MD, UCLA Medical Center, and the CCL 23 and CCL 138 cell lines were acquired from the American Type Culture Collection. All cell lines were maintained in Eagle’s minimal essential medium (Gibco, Grand Island, N.Y.) containing 1 mmol/L glutamine, 100 IU/ml penicillin, 100 IU/ml streptomycin, 0.5 µg/ml amphotericin B (Fungizone), and 10% fetal calf serum (Intergen). Cultures were incubated at 37° C and passaged biweekly by trypsinization. DNA Extraction Frozen tumor tissue was minced into fine pieces and suspended in lysis buffer (10 mmol/L Tris-HCl [pH 7.5], 100 mmol/L EDTA, 0.5% SDS, 0.1 mg/ml proteinase K) for 24 hours at 37° C. DNA was extracted twice with each phenol and phenol/chloroform/isoamyl alcohol (25:24:1) mix and once with chloroform before precipitation with the addition of two volumes of 100% ethanol. Precipitates were washed with 70% ethanol, suspended in TE buffer, pH 8.0 (10 mmol/L Tris-HCl, 1 mmol/L EDTA buffer [pH 8.0]) and incubated for 2 hours at 37° C. DNA was reextracted once with phenol,
phenol/chloroform/isoamyl, and chloroform; reprecipitated; washed; and suspended in TE buffer. Optical density was measured at 260 nm to determine the DNA concentrations. Samples were stored at 4° C for use in polymerase chain reaction (PCR) and Southern blots. Polymerase Chain Reaction The PCR was performed in 50 µl aliquots in the buffer provided by the manufacturer (Perkin-Elmer Corp., Norwalk, Conn.). Cyclin D1 sequences 5´-3´GGAAAGCTTCATTCTCCTTGTTG (sense) and TCTAGGTAAACCTCTGAGGTCC (antisense) and β-actin sequences 5´-3´GTGGGGCGCCCCAGGCACCA (sense) and CTCCTTAATGTCACGCACGATTTC (antisense) were used as primers for the PCR. The reaction mix contained 1 µg of DNA, 20 pmol of each of the primers, 200 µmol/L dNTP, 2.5 mmol/L MgCl2, and 2.5 U of Ampli Taq DNA polymerase. Reactions were performed under established conditions. Typically, DNA present in the PCR mix was denatured at 95° C for 7 minutes, it was then cooled on ice, and Taq polymerase was added. Samples were overlaid with mineral oil, and the PCR was performed: denaturation at 94° C for 1 minute, annealing at 60° C for 1 minute, and extension at 72° C for 3 minutes for 30 cycles in a PerkinElmer thermal cycler. The cycling was followed by a final extension at 72° C for 10 minutes. PCR products were analyzed on 10% polyacrylamide gel in ×1 TBE buffer, pH 8.0 (89 mmol/L Tris-borate buffer [pH 8.0], 2 mmol/L EDTA), stained with ethidium bromide (1 µg/ml) for 10 minutes and destained in water for 5 minutes. Bands were visualized under the UV light and photographed. PCR products were of size 1008 bp for cyclin D1 and 450 bp for β-actin. Southern Blotting Ten micrograms of genomic DNAs were digested with the restriction enzyme EcoRI. The digested DNAs were electrophoresed through a 1% agarose gel in TAE buffer, pH 7.4 (40 mmol/L Tris-acetate [pH 7.4], 1 mmol/L EDTA). DNA fragments were then transferred onto a Nytran (Schleicher & Schuell, Inc., Keene, N.H.) membrane. Filters were hybridized to the appropriate probes at 65° C for 24 hours and washed as described.8 Filters were exposed to Kodak XAR-5 films (Eastman Kodak Co., Rochester, N.Y.) for 1 to 3 days at –70° C with intensifying screens. Intensities of cyclin D1 and cyclin G bands on Southern blots were normalized to their corresponding β-actin control bands. Transfection CCL 23 and CAL 27 cell lines were cultured in 100 mm tissue culture dishes containing complete medium. Cells were transfected with a cyclin D1 antisense plasmid by use of the DOTAP transfection reagent (Boehringer Mannheim Corp., Indianapolis, Ind.). This plasmid contained G418 (geneticin) resistance gene as a selectable marker. Essentially, 5 µg of
Otolaryngology– Head and Neck Surgery Volume 119 Number 6
WANG et al.
595
plasmid DNA was mixed with 70 µl of transfection reagent in a polystyrene reaction vial containing HBS (HEPES, 20 mmol/L; NaCl, 150 mmol/L; pH 7.4). The solution was incubated for 30 minutes at room temperature and then added to the tissue culture dishes containing fresh complete medium. Transfected cells were maintained in a complete medium containing 1 mg/ml geneticin. Stable transformants were isolated after 2 weeks in geneticin (1 mg/ml concentration) selection medium, and clones from each of the two cell lines were used in proliferation assays. Western Blotting Cells were passaged and grown in complete medium for 24 hours before being harvested for Western blotting. The cell monolayer (106 cells in a 100 mm tissue culture dish) was rapidly rinsed twice with ice-cold medium without serum and lysed in 1 ml of ice-cold lysis buffer. The lysis buffer contained 0.1 mmol/L phenylmethylsulfonyl fluoride, 2 mmol/L EDTA, 25 mmol/L β-glycerophosphate, 0.1 mmol/L sodium orthovanadate, 25 mmol/L sodium fluoride, 5 µg of leupeptin, 0.2% Triton X-100, and 0.3% Nonidet P-40 in 50 mmol/L TriHCl/150 mmol/L NaCl, pH 7.5. The lysates were centrifuged at 12,000g at 4° C for 5 minutes, and the supernatants were collected. Aliquots of supernatants containing 5 to 10 µg of protein (as assayed by the Bradford dye method), and prestained protein markers were subjected to sodium dodecylsulfate–polyacrylamide gel electrophoresis in 10% gels under reducing conditions and proteins electrotransferred to PVDF membranes (Millipore Corp., Bedford, Mass.) as described.9 After nonspecific binding was blocked by incubation with 5% nonfat milk in phosphate-buffered saline solution, the membranes were incubated with polyclonal anticyclin D1 antibody at 4° C overnight.9 The 36 kD protein corresponding to cyclin D1 was detected with an alkaline phosphatase–conjugated secondary antibody. Proliferation Assays Proliferation assays were performed in 96-well flat-bottom trays (Falcon Products, Inc., St. Louis, Mo.). Stable transformants were seeded in triplicate wells at 2.5 × 103 to 1.0 × 104 cells/well, depending on the duration of incubation in lowserum medium (0.5% fetal bovine serum) or complete medium. One control consisted of nontransfected cells grown in complete or serum-free media. An additional control consisted of cells transfected with a plasmid containing a sense sequence of cyclin D1. This control plasmid did not have a significant effect on cellular proliferation. Plates were incubated for 24, 48, 72, 96, or 120 hours at 37° C before the addition of 0.5 µCi of radioactive thymidine label (H3-Tdr; specific activity 15.50 Ci/mmol/L [DuPont, New England Nuclear, Boston, Mass.]). Plates were pulsed for an additional 8 hours before filtration onto Whatman glass microfiber paper by use of a Mash II filtration unit. Filters were dried
Fig. 1. PCR was performed on 22 primary tumors and three cell lines by use of the cyclin D1 and β-actin primers as described in Methods and Material. PCR products were separated on 10% polyacrylamide gel, and bands were visualized by staining with ethidium bromide. Data are shown for seven of the tumors and their constitutional controls (*). The a columns contain PCR products from samples amplified with cyclin D1 primers, and b columns contain that of β-actin controls. A and B columns are controls containing no DNA and no DNA/no primers, respectively. Results show that there is no apparent amplification of cyclin D1 in any of the tumor samples when compared with β-actin.
overnight and then placed in 2 ml of scintillation cocktail and counted for 1 minute on a Beckman LS 6000 TA liquid scintillation counter. The mean counts per minute (cpm) of triplicate wells were recorded. Their standard deviations were always less than 5% of the means. The percent growth was calculated as follows: cpm of treatment group/cpm of control × 100. RESULTS Patients
The clinical features, stage, and treatment of patients with HNSCC whose tumor samples were used for study are shown in Table 1. The patients’ average age was 59.8 years (range 21 to 73 year), and the male-to-female ratio was 2:1. T1 or T2 lesions comprised 45.5% of the samples, whereas 54.5% were T3 or T4. The cell lines CAL 27, CCL 23, and CCL 138 were derived from the tongue, larynx, and pharynx, respectively. Amplification of Cyclin D1 in Primary Tumors PCR data. Twenty-five tumors (22 tumors and 3 cell lines) were evaluated for amplification of cyclin D1 by PCR. Controls consisted of amplification of β-actin from the same tumor samples. Where possible, constitutional cells from the patients (normal tissue collected at time of tumor resection) were also used. Amplification of cyclin D1 was not observed in any of the tumor
596
Otolaryngology– Head and Neck Surgery December 1998
WANG et al.
Table 1. Clinical features, stage, and treatment of HNSCC patients whose tumor samples were used for study Sample no.
Age (yr)/race/sex
4 7 8 9 10 11 20 22 25 31 32 33 34 35 36 37 38 39 40 41 42 43 Cell line CAL 27 CCL 23 CCL 138
62/B/M 69/H/M 58/W/F 53/B/M 64/W/F 64/W/M 67/W/F 66/W/M 51/W/M 60/W/M 52/W/M 61/W/F 65/W/F 66/W/M 21/W/M 58/W/M 61/W/M 60/W/M 68/W/F 73/B/M 60/W/F 57/W/M — — —
Site
Tongue base piriform sinus piriform sinus Alveolar ridge Tongue Epiglottis Floor of month Tongue base Tongue base Glottis Glottis Floor of mouth Retromolar trigone Floor of mouth Floor of mouth Tonsil Floor of mouth Glottis Piriform sinus False cord Tonsil Glottis Tongue Larynx Pharynx
T stage
Treatment
T4N0M0 T3N1M0 T3N2M0 T4N2M0 T2N0M0 T2N0M0 T2N0M0 T2N0M0 T4N1M0 T3N0M0 T3N0M0 T2N0M0 T1N0M0 T2N0M0 T4N0M0 T2N0M0 T4N2M0 T2N0M0 T3N0M0 T3N0M0 T3N0M0 T2N0M0
Glossectomy Laryngectomy Laryngectomy Composite resection Hemiglossectomy Laryngectomy Composite resection Composite resection Composite resection Laryngectomy Laryngectomy Composite resection Composite resection Composite resection Composite resection Composite resection Composite resection Laryngectomy Laryngectomy Laryngectomy Composite resection Laryngectomy
— — —
— — —
B, Black; H, Hispanic; W, white.
samples when compared with the β-actin control. Results for seven of the samples are shown in Fig. 1. Southern blot analysis. Data from six control matched tumor samples and one of the cell lines are shown in Fig. 2. β-Actin was used as a control in these amplification studies. Because cyclin D1 is localized to chromosome 11q13, two other markers on 11q, INT2 (11q13) and APO A1 (11q23), were also used as probes in the Southern blot hybridizations. Amplification of cyclin D1 and INT2 were observed in a single tumor, sample 32. APO A1 was not amplified in any of the tumors. Cyclin G Southern Blot Analysis
The Southern blots containing the tumor DNAs were also hybridized with the cyclin G probe. None of the tumors showed amplification of this cyclin (Fig. 3). Inhibition of Cell Proliferation with Antisense Cyclin D1
Western blot analyses were performed on proteins extracted from nontransfected and antisense cyclin D1–transfected (stable transformants) HNSCC cell lines by use of the anticyclin D1 antibody. Fibroblast
cell line IMR90 containing a high level of expression of cyclin D1 was used as a control in these studies. Cell lines CAL 27 and CCL 23 had IMR90 activity levels of 25% and 10%, respectively (Fig. 4). To determine the effect of antisense cyclin D1 on the expression of cyclin D1 in HNSCC, antisense cyclin D1 DNA was introduced into the cell lines CCL 23 and CAL 27. The transformants were grown in selection medium containing 1 mg/ml of geneticin. Stable transformants were isolated after 3 weeks in selection media. The presence of antisense cyclin D1 plasmid DNA in these transformants was confirmed by Southern hybridization with the plasmid DNA as the probe (data not shown). Transfection of the antisense cyclin D1 DNA resulted in a 50% reduction in the expression of cyclin D1 in the cell line CCL 23 as measured with a densitometer (Fig. 4). Expression of cyclin D1 was not affected in the transfected CAL 27 cells. To determine the effect of antisense cyclin D1 expression on cell proliferation, we studied transfected CAL 27 and CCL 23 cells for DNA synthesis using the 3H-thymidine incorporation assay system. Diminished incorporation of thymidine was observed at early times in the CAL 27 transformants grown in low-serum media
Otolaryngology– Head and Neck Surgery Volume 119 Number 6
WANG et al.
597
Fig. 3. Southern blot hybridization for cyclin G. Data for five tumor samples, one cell line (CAL 27), and constitutional controls (*) are shown. β-Actin was again used as a control for these hybridizations. Analysis reveals that there is no amplification of cyclin G in any of the tumor samples.
Fig. 2. Southern blot hybridization analysis was performed on 22 primary tumors and three cell lines by use of the cyclin D1 probe. Data for six tumors, one cell line (CAL 27), and constitutional controls (*) are shown. β-Actin was used as a control for single copy hybridization. Results reveal amplification of cyclin D1 in sample 32. Whereas INT 2 (integration site 2—11q13) is also amplified in this tumor, APO A1 (apoprotein A1—11q23) is not amplified in any of the tumors.
(Fig. 5A). Specifically, a greater than 60% growth reduction occurred between 24 and 72 hours of growth in serum-free media. The cells recovered to near normal growth after 72 hours. Significant growth inhibition was observed at later time periods for CCL 23 transformants (Fig. 5B). The nontransfected cells grew well in lowserum media. As expected, the control nontransfected cells grown in G418 selection media had little to no growth in both complete and low-serum media. Thus the transfection studies suggested that cyclin D1 may play an important role in the growth and proliferation of HNSCC cells and that antisense cyclin D1 expression can interfere with this growth regulation. DISCUSSION
Cancer involves a complex process of neoplastic transformation of a population of cells that are not susceptible to the normal mechanisms of growth regulation. This process appears to be related to activation of oncogenes (growth promoters) and inactivation of tumor suppressor genes.10 In cancer cells, specific chromosomal regions encoding oncogenes become amplified and overexpressed, resulting in accelerated cellular proliferation. The cyclins are a group of crucial regulatory proteins that activate protein kinases and function to control cell cycle progression. As such, dysregulation of cyclin activity could result in loss of normal cell cycle restrictions and, consequently, the development of neoplasia.
Fig. 4. Expression of cyclin D1 in head and neck cancer cell lines. Western blot analysis was performed on proteins extracted from CAL 27 and CCL 23 cells by use of the anticyclin D1 antibody. Fibroblast cell line IMR 90 was used as the control. Whereas 5 µg of IMR 90 protein was loaded on the gels, 10 µg of cell line proteins was used. Results show CAL 27 and CCL 23 to contain IMR 90 expression levels of 25% and 10%, respectively. Whereas the antisense cyclin D1–transfected CAL 27 cells (*) did not show a significant reduction in cyclin D1 expression, the antisense cyclin D1–transfected CCL 23 cells (*) showed a 50% reduction in the expression level of cyclin D1 as compared with the nontransfected controls.
Amplification and overexpression of cyclin D1 have been implicated in several cancers, including breast, esophagus, and B cell lymphomas.11 Chromosome 11q13, which contains the region encoding cyclin D1, has been found to be amplified in HNSCCs.5,12,13 Amplification of 11q13 has also been shown to correlate with poor prognosis and lymph node metastasis in head and neck cancer and breast cancer.14,15 Genes mapped to this region include cyclin D1, INT2, and EMS 1.5,16-18 The most likely candidate for proto-oncogene on the 11q13 appears to be cyclin D1.19-22 Although others have reported amplification of 11q13 in 30% to 50% of HNSCCs,5,13 the head and neck cancers in our series exhibited a much lower incidence of cyclin D1 amplification (i.e., a single tumor of the 22 primary tumors analyzed). There are several possible reasons for this difference. Because fresh-frozen tumor tissue was used in our series rather than archival specimens or cell lines as in other studies, less homogeneous tissue was available in the present analysis. Thus the low incidence of amplification we have observed may be caused by contamination of tumor tissue by
598
Otolaryngology– Head and Neck Surgery December 1998
WANG et al.
Fig. 5. Effect of antisense cyclin D1 expression on cell growth. Mean data from four repetitions of experiments are shown. Stable transformants containing antisense cyclin D1 DNA were assayed for growth proliferation with the thymidine incorporation assay as described in Methods and Material. Data are plotted as percentage of proliferation of nontransfected cells grown in serumfree media. CAL 27 transformants show decreased growth at early times after serum starvation and recover to control levels after 72 hours (A). However, CCL 23 transformants have continuous growth reduction with serum starvation (B). Both CAL 27 and CCL 23 transformants grew well in serum-fed media. Results thus imply that cyclin D1 may have a role in cellular proliferation. Standard error of the mean of data was negligible.
adjacent normal cells. The specimens were microscopically examined by a pathologist and found to contain greater than 90% tumor cells (<10% normal cells); however, even at this low level of contamination by normal tissue, tumors with low levels (twofold to threefold) of amplification of cyclin D1 may not be detected by PCR. Additionally, almost half of the tumors in our series were early stage (T1 or T2); it is possible that early-stage tumors may not exhibit cyclin D1 amplification because amplification of cyclin D1 is associated with advanced-stage tumors and portends a poor prognosis. Evaluation of a larger series consisting of both archival and fresh head and neck tumors may reveal the clinical significance of cyclin D1 amplification and/or overexpression in these tumors. To complement the gene amplification studies, we are presently undertaking immunohistochemical analysis of the tumor samples using anticyclin D1 antibodies.
It is important to note that transfection of the cyclin D1 antisense plasmid into head and neck cancer cell lines resulted in a significant decrease in proliferation. In one of the cell lines, CCL 23, this growth inhibition correlated with decreased expression of cyclin D1 in this cell line. The antisense plasmid appeared to have an earlier effect on cellular proliferation in the CAL 27 cell line (Fig. 5A). Because the Western blot analyses were performed on stable transformant colonies after 2 to 3 weeks of growth, this early effect of decreased cyclin D1 expression was not detected in CAL 27. These findings tend to support the role of cyclin D1 as an important cell cycle regulator with oncogenic potential in head and neck cancer. Although amplification and overexpression of cyclin G have been found in several human osteosarcoma lines, we did not find amplification of cyclin G in any of the head and neck cancers in our series. Although cyclin G may have a regulatory role in the cell cycle, it will be necessary to analyze cyclin G in a larger series of head and neck tumors to arrive at a definitive conclusion on its functional role in these tumors. Despite recent advances in cancer therapy, the survival rate in head and neck cancer has not improved significantly during the past 20 years. It is among the major cancers with the lowest 5-year survival rate, often requiring debilitating and morbid treatments.23 Further investigations into the roles of cyclin D1 and cyclin G in head and neck cancer should yield insights into the genetic regulation of this devastating disease. Greater understanding of the mechanisms behind the development and progression of HNSCC will lead to more efficacious therapeutic protocols. In the future treatment may be aimed at manipulation of the genetic control of the cancer cell. REFERENCES 1. Nigg EA. Targets of cyclin-dependent protein kinases. Curr Opin Cell Biol 1993;5:187-93. 2. Lukas J, Pagano M, Staskova Z, et al. Cyclin D1 protein oscillates and is essential for cell cycle progression in human tumour cell lines. Oncogene 1994;9:707-18. 3. Jiang W, Kahn S, Tomita N, et al. Amplification and expression of the human cyclin D gene in esophageal cancer. Cancer Res 1992;52:2980-3. 4. Lammie G, Fantl V, Smith R, et al. D11S287, a putative oncogene on chromosome 11q13 is amplified and expressed in squamous cell and mammary carcinomas and linked to BCL-1. Oncogene 1991;6:439-44. 5. Schuuring E, Verhoeven E, Mooi W, et al. Identification and cloning of two overexpressed genes U21B31/PRAD1 and EMS1, within the amplified chromosome 11q13 region in human carcinomas. Oncogene 1992;7:355-61. 6. Kato J, Matsushime H, Hiebert S, et al. Direct binding of cyclin D to the retinoblastoma gene product (pRb) and pRb phosphorylation by the cyclin D–dependent kinase CDK4. Genes Dev 1993;7:331-42. 7. Wu L, Liu L, Yee A, et al. Molecular cloning of the human
Otolaryngology– Head and Neck Surgery Volume 119 Number 6
8. 9.
10. 11. 12. 13.
14.
CYCG1 gene encoding a G-type cyclin: overexpression in human osteosarcoma cells. Oncology Reports 1994;1:705-11. Srivatsan ES, Benedict WF, Stanbridge EJ. Implication of chromosome 11 in the suppression of neoplastic expression in human cell hybrids. Cancer Res 1986;46:6174-9. Hall FL, Williams RT, Wu L, et al. Two potentially oncogenic cyclins, cyclin A and cyclin D1, share common properties of subunit configuration, tyrosine phosphorylation and physical association with the Rb protein. Oncogene 1993;8:1377-84. Field JK. Oncogenes and tumour-suppressor genes in squamous cell carcinoma of the head and neck. Eur J Cancer B Oral Oncol 1992;28B:67-76. Hinds P, Dowdy S, Eaton S, et al. Function of a human cyclin gene as an oncogene. Proc Natl Acad Sci 1994;91:709-13. Williams M, Gaffey M, Weiss L, et al. Chromosome 11q13 amplification in head and neck squamous cell carcinoma. Arch Otolaryngol Head Neck Surg 1993;119:1238-43. Lammie GA, Fantl V, Smith R, et al. D11S287, a putative oncogene on chromosome 11q13 is amplified and expressed in squamous cell and mammary carcinomas and linked to BCL-1. Oncogene 1991;6:430-44. Muller D, Millon R, Lidereau R, et al. Frequent amplification of 11q13 DNA markers is associated with lymph node involvement in human head and neck squamous cell carcinoma. Eur J Cancer B Oral Oncol 1994;30B:113-20.
WANG et al.
599
15. Schuuring E, Verhoeven E, van Tinderen H, et al. Amplification of genes within the chromosome 11q13 region is indicative of poor prognosis in patients with operable breast cancer. Cancer Res 1992;52:5229-34. 16. Tsujimoto Y, Yunis J, Onorato-Showe L, et al. Molecular cloning of the chromosomal breakpoint of B-cell lymphomas and leukemias with the t(11;14) chromosome translocation. Science 1984;224:1403-6. 17. Motokura T, Bloom T, Kim HG, et al. A novel cyclin encoded by a bcl-1 linked candidate oncogene. Nature 1991;350:5125. 18. Casey G, Smith R, McGillivray D, et al. Characterization and chromosome assignment of the human homolog of int-2, a potential proto-oncogene. Mol Cell Biol 1986;6:502-10. 19. Matsushime H, Roussel JF, Ashmun RA, et al. Colony-stimulating factor 1 regulates novel cyclins during the G1 phase of the cell cycle. Cell 1991;65:701-13. 20. Xiong Y, Connolly T, Futcher B, et al. Human D-type cyclin. Cell 1991;65:691-9. 21. Sherr CJ. Mammalian G1 cyclins. Cell 1993;73:1059-65. 22. Bartkova J, Lukas J, Muller H, et al. Abnormal patterns of D-type cyclin expression and G1 regulation in human head and neck cancer. Cancer Res 1995;55:949-56. 23. Boring CC, Squires TS, Tong T. Cancer statistics. CA Cancer J Clin 1991;41:19-36.
Otoplasty and Reconstruction of Auricular Defects
An International Course on Otoplasty and Reconstruction of Auricular Defects will be held March 21-22, 1999, at the ENT Department, Medical University of Lübeck, Lübeck, Germany. For further information, contact PD Dr Dr R. Siegert/M. Haase, Department of Otorhinolaryngology and Plastic Head and Neck Surgery, Medical University of Lübeck, Ratzeburger Allee 160, D-23538 Lübeck, Germany; phone, 49-451-5003189; fax, 49-451-500-4192; e-mail, [email protected].
Cyclin D1 and cyclin G are essential regulatory factors in the progression of the cell cycle from G0 through G1 and S phase. Aberrations in expression of these cyclins may lead to dysregulated cellular proliferation that could result in neoplasia. Amplification and overexpression of cyclin D1 have been observed in many human cancers, whereas cyclin G is a new cyclin recently described in osteosarcoma cells. This study was performed to determine whether these cyclins were amplified in head and neck squamous cell carcinoma (HNSCC) tumors. Polymerase chain reaction of DNA extracted from 22 HNSCC primary tumors and three HNSCC cell lines did not reveal amplification of cyclin D1 in any of the tumor samples. Southern blot analysis identified amplification of cyclin D1 in a single tumor. Amplification of cyclin G was not observed in any of the tumors by Southern blot hybridization with a cyclin G probe. HNSCC cell lines transfected with antisense cyclin D1 were tested for cell proliferation by the incorporation of 3Hthymidine into cells grown in serum-free media. By 72 hours of incubation, there was a greater than 30% reduction in proliferation of cells transfected with antisense cyclin D1 as compared with nontransfected control cells. The results indicate that cyclin D1 may play an important role in the growth and proliferation of HNSCC cells. (Otolaryngol Head Neck Surg 1998;119:593-9.)
From the Division of Head and Neck Surgery (Drs. Wang and Billings) and the Department of Surgery (Dr. Srivatsan), UCLA School of Medicine, West Los Angeles Veterans Administration Medical Center; and the Division of Orthopedic Surgery (Drs. Venkatesan and Hall), Children’s Hospital of Los Angeles. Supported by the Resident Research Grant from the American Academy of Otolaryngology–Head and Neck Surgery (no. H940510). Presented at the Annual Meeting of the American Academy of Otolaryngology–Head and Neck Surgery, New Orleans, La., Sept. 17-20, 1995. Reprint requests: Marilene B. Wang, MD, Division of Head and Neck Surgery, UCLA Medical Center, CHS 62-132, 10833 LeConte Ave., Los Angeles, CA 90095-1624. 23/1/87438
T
he cyclins and cyclin-dependent kinases are essential regulatory factors in the progression of the cell from G1 through S phase.1 The crucial point between G1 and S determines the ultimate fate of the cell. At this junction, the cell will either proceed with DNA synthesis and subsequent proliferation or enter a state of relative senescence, and it may even begin the process of apoptosis. Aberration of the cell cycle control mechanism at the G1-S interphase could result in uncontrolled cellular proliferation (transformation) or excessive cell death (apoptosis). Dysregulation of the cell cycle leading to uncontrolled cellular proliferation is the hallmark of neoplastic transformation. Cyclin D1 is a G1 cyclin that is required for entry into S phase.2 Amplification and overexpression of cyclin D1 have been observed in many human tumors, including head and neck squamous cell carcinoma (HNSCC).3-5 Such an aberration is believed to result in shortening of the G1 phase and accelerated entry of cells into S phase, with subsequent cellular proliferation. The mechanism of action of cyclin D1 involves activation of cyclin-dependent kinase 4 (cdk-4), which then phosphorylates the tumor-suppressor gene product pRb. pRb normally functions as a growth suppressor by preventing entry of the cell into the S phase. However, hyperphosphorylation of pRb in late G1 phase inactivates pRb function and allows the cell to proceed to S phase.6 It is thus apparent that overexpression of cyclin D1 could result in an increased activation of cdk-4, which in turn can lead to increased phosphorylation of pRb and accelerated entry of cells into S phase. Amplification and overexpression of cyclin D1 in many human tumors suggest that amplification plays an important role in the uncontrolled proliferation of neoplastic cells. Cyclin G is a new cyclin that has recently been described in human osteosarcoma cell lines through the use of rat cyclin G coding sequences.7 This cyclin appears to function in the regulation of the G0-G1 transition. Although overexpression of cyclin G has been observed in several human osteosarcoma cell lines, functional significance of this overexpression is not yet known. It is postulated that this cyclin may play a role in the priming of cells to respond to mitogenic serum factors. In the highly synchronized MG-63 osteosarcoma 593
594
Otolaryngology– Head and Neck Surgery December 1998
WANG et al.
cell line, the level of cyclin G expression remained high throughout the cell cycle and was not diminished during prolonged serum deprivation. The studies therefore indicate that cyclin G may function early in cell cycle, perhaps during G0 phase, to allow the cell to enter G1.7 The purpose of this study was to determine the level of amplification of cyclin D1 and cyclin G in HNSCC tumor samples. In addition, transfection studies were performed to determine whether the blockage of cyclin D1 expression with antisense cyclin D1 could result in decreased proliferation of HNSCC cells. METHODS AND MATERIAL HNSCC Tumor Collection and Cell Lines Subjects for study were selected from those patients undergoing surgical resection of their head and neck cancer at the Wadsworth Veterans Administration Medical Center, UCLA Medical Center, and the Harbor-UCLA Medical Center in Los Angeles. The protocol was approved by the UCLA Human Subject Protection Committee (HSPC no. 93-12-679), the Committee on Human Studies at the Veterans Administration Medical Center, West Los Angeles, and the Human Subject Protection Committee of Harbor-UCLA Medical Center. Informed consent was obtained according to the guidelines of the Human Subjects Protection Committees of these individual institutions. After the tumor was resected in the operating room, approximately 1 cm3 piece of tumor tissue was provided by the pathologist after ascertaining that there was sufficient material left for pathologic evaluation. Tumor tissue was then snap-frozen on dry ice and stored in liquid nitrogen for later use. Diagnosis of squamous cell carcinoma was confirmed by the pathologist. The CAL 27 cell line was a gift of G. Juilliard, MD, UCLA Medical Center, and the CCL 23 and CCL 138 cell lines were acquired from the American Type Culture Collection. All cell lines were maintained in Eagle’s minimal essential medium (Gibco, Grand Island, N.Y.) containing 1 mmol/L glutamine, 100 IU/ml penicillin, 100 IU/ml streptomycin, 0.5 µg/ml amphotericin B (Fungizone), and 10% fetal calf serum (Intergen). Cultures were incubated at 37° C and passaged biweekly by trypsinization. DNA Extraction Frozen tumor tissue was minced into fine pieces and suspended in lysis buffer (10 mmol/L Tris-HCl [pH 7.5], 100 mmol/L EDTA, 0.5% SDS, 0.1 mg/ml proteinase K) for 24 hours at 37° C. DNA was extracted twice with each phenol and phenol/chloroform/isoamyl alcohol (25:24:1) mix and once with chloroform before precipitation with the addition of two volumes of 100% ethanol. Precipitates were washed with 70% ethanol, suspended in TE buffer, pH 8.0 (10 mmol/L Tris-HCl, 1 mmol/L EDTA buffer [pH 8.0]) and incubated for 2 hours at 37° C. DNA was reextracted once with phenol,
phenol/chloroform/isoamyl, and chloroform; reprecipitated; washed; and suspended in TE buffer. Optical density was measured at 260 nm to determine the DNA concentrations. Samples were stored at 4° C for use in polymerase chain reaction (PCR) and Southern blots. Polymerase Chain Reaction The PCR was performed in 50 µl aliquots in the buffer provided by the manufacturer (Perkin-Elmer Corp., Norwalk, Conn.). Cyclin D1 sequences 5´-3´GGAAAGCTTCATTCTCCTTGTTG (sense) and TCTAGGTAAACCTCTGAGGTCC (antisense) and β-actin sequences 5´-3´GTGGGGCGCCCCAGGCACCA (sense) and CTCCTTAATGTCACGCACGATTTC (antisense) were used as primers for the PCR. The reaction mix contained 1 µg of DNA, 20 pmol of each of the primers, 200 µmol/L dNTP, 2.5 mmol/L MgCl2, and 2.5 U of Ampli Taq DNA polymerase. Reactions were performed under established conditions. Typically, DNA present in the PCR mix was denatured at 95° C for 7 minutes, it was then cooled on ice, and Taq polymerase was added. Samples were overlaid with mineral oil, and the PCR was performed: denaturation at 94° C for 1 minute, annealing at 60° C for 1 minute, and extension at 72° C for 3 minutes for 30 cycles in a PerkinElmer thermal cycler. The cycling was followed by a final extension at 72° C for 10 minutes. PCR products were analyzed on 10% polyacrylamide gel in ×1 TBE buffer, pH 8.0 (89 mmol/L Tris-borate buffer [pH 8.0], 2 mmol/L EDTA), stained with ethidium bromide (1 µg/ml) for 10 minutes and destained in water for 5 minutes. Bands were visualized under the UV light and photographed. PCR products were of size 1008 bp for cyclin D1 and 450 bp for β-actin. Southern Blotting Ten micrograms of genomic DNAs were digested with the restriction enzyme EcoRI. The digested DNAs were electrophoresed through a 1% agarose gel in TAE buffer, pH 7.4 (40 mmol/L Tris-acetate [pH 7.4], 1 mmol/L EDTA). DNA fragments were then transferred onto a Nytran (Schleicher & Schuell, Inc., Keene, N.H.) membrane. Filters were hybridized to the appropriate probes at 65° C for 24 hours and washed as described.8 Filters were exposed to Kodak XAR-5 films (Eastman Kodak Co., Rochester, N.Y.) for 1 to 3 days at –70° C with intensifying screens. Intensities of cyclin D1 and cyclin G bands on Southern blots were normalized to their corresponding β-actin control bands. Transfection CCL 23 and CAL 27 cell lines were cultured in 100 mm tissue culture dishes containing complete medium. Cells were transfected with a cyclin D1 antisense plasmid by use of the DOTAP transfection reagent (Boehringer Mannheim Corp., Indianapolis, Ind.). This plasmid contained G418 (geneticin) resistance gene as a selectable marker. Essentially, 5 µg of
Otolaryngology– Head and Neck Surgery Volume 119 Number 6
WANG et al.
595
plasmid DNA was mixed with 70 µl of transfection reagent in a polystyrene reaction vial containing HBS (HEPES, 20 mmol/L; NaCl, 150 mmol/L; pH 7.4). The solution was incubated for 30 minutes at room temperature and then added to the tissue culture dishes containing fresh complete medium. Transfected cells were maintained in a complete medium containing 1 mg/ml geneticin. Stable transformants were isolated after 2 weeks in geneticin (1 mg/ml concentration) selection medium, and clones from each of the two cell lines were used in proliferation assays. Western Blotting Cells were passaged and grown in complete medium for 24 hours before being harvested for Western blotting. The cell monolayer (106 cells in a 100 mm tissue culture dish) was rapidly rinsed twice with ice-cold medium without serum and lysed in 1 ml of ice-cold lysis buffer. The lysis buffer contained 0.1 mmol/L phenylmethylsulfonyl fluoride, 2 mmol/L EDTA, 25 mmol/L β-glycerophosphate, 0.1 mmol/L sodium orthovanadate, 25 mmol/L sodium fluoride, 5 µg of leupeptin, 0.2% Triton X-100, and 0.3% Nonidet P-40 in 50 mmol/L TriHCl/150 mmol/L NaCl, pH 7.5. The lysates were centrifuged at 12,000g at 4° C for 5 minutes, and the supernatants were collected. Aliquots of supernatants containing 5 to 10 µg of protein (as assayed by the Bradford dye method), and prestained protein markers were subjected to sodium dodecylsulfate–polyacrylamide gel electrophoresis in 10% gels under reducing conditions and proteins electrotransferred to PVDF membranes (Millipore Corp., Bedford, Mass.) as described.9 After nonspecific binding was blocked by incubation with 5% nonfat milk in phosphate-buffered saline solution, the membranes were incubated with polyclonal anticyclin D1 antibody at 4° C overnight.9 The 36 kD protein corresponding to cyclin D1 was detected with an alkaline phosphatase–conjugated secondary antibody. Proliferation Assays Proliferation assays were performed in 96-well flat-bottom trays (Falcon Products, Inc., St. Louis, Mo.). Stable transformants were seeded in triplicate wells at 2.5 × 103 to 1.0 × 104 cells/well, depending on the duration of incubation in lowserum medium (0.5% fetal bovine serum) or complete medium. One control consisted of nontransfected cells grown in complete or serum-free media. An additional control consisted of cells transfected with a plasmid containing a sense sequence of cyclin D1. This control plasmid did not have a significant effect on cellular proliferation. Plates were incubated for 24, 48, 72, 96, or 120 hours at 37° C before the addition of 0.5 µCi of radioactive thymidine label (H3-Tdr; specific activity 15.50 Ci/mmol/L [DuPont, New England Nuclear, Boston, Mass.]). Plates were pulsed for an additional 8 hours before filtration onto Whatman glass microfiber paper by use of a Mash II filtration unit. Filters were dried
Fig. 1. PCR was performed on 22 primary tumors and three cell lines by use of the cyclin D1 and β-actin primers as described in Methods and Material. PCR products were separated on 10% polyacrylamide gel, and bands were visualized by staining with ethidium bromide. Data are shown for seven of the tumors and their constitutional controls (*). The a columns contain PCR products from samples amplified with cyclin D1 primers, and b columns contain that of β-actin controls. A and B columns are controls containing no DNA and no DNA/no primers, respectively. Results show that there is no apparent amplification of cyclin D1 in any of the tumor samples when compared with β-actin.
overnight and then placed in 2 ml of scintillation cocktail and counted for 1 minute on a Beckman LS 6000 TA liquid scintillation counter. The mean counts per minute (cpm) of triplicate wells were recorded. Their standard deviations were always less than 5% of the means. The percent growth was calculated as follows: cpm of treatment group/cpm of control × 100. RESULTS Patients
The clinical features, stage, and treatment of patients with HNSCC whose tumor samples were used for study are shown in Table 1. The patients’ average age was 59.8 years (range 21 to 73 year), and the male-to-female ratio was 2:1. T1 or T2 lesions comprised 45.5% of the samples, whereas 54.5% were T3 or T4. The cell lines CAL 27, CCL 23, and CCL 138 were derived from the tongue, larynx, and pharynx, respectively. Amplification of Cyclin D1 in Primary Tumors PCR data. Twenty-five tumors (22 tumors and 3 cell lines) were evaluated for amplification of cyclin D1 by PCR. Controls consisted of amplification of β-actin from the same tumor samples. Where possible, constitutional cells from the patients (normal tissue collected at time of tumor resection) were also used. Amplification of cyclin D1 was not observed in any of the tumor
596
Otolaryngology– Head and Neck Surgery December 1998
WANG et al.
Table 1. Clinical features, stage, and treatment of HNSCC patients whose tumor samples were used for study Sample no.
Age (yr)/race/sex
4 7 8 9 10 11 20 22 25 31 32 33 34 35 36 37 38 39 40 41 42 43 Cell line CAL 27 CCL 23 CCL 138
62/B/M 69/H/M 58/W/F 53/B/M 64/W/F 64/W/M 67/W/F 66/W/M 51/W/M 60/W/M 52/W/M 61/W/F 65/W/F 66/W/M 21/W/M 58/W/M 61/W/M 60/W/M 68/W/F 73/B/M 60/W/F 57/W/M — — —
Site
Tongue base piriform sinus piriform sinus Alveolar ridge Tongue Epiglottis Floor of month Tongue base Tongue base Glottis Glottis Floor of mouth Retromolar trigone Floor of mouth Floor of mouth Tonsil Floor of mouth Glottis Piriform sinus False cord Tonsil Glottis Tongue Larynx Pharynx
T stage
Treatment
T4N0M0 T3N1M0 T3N2M0 T4N2M0 T2N0M0 T2N0M0 T2N0M0 T2N0M0 T4N1M0 T3N0M0 T3N0M0 T2N0M0 T1N0M0 T2N0M0 T4N0M0 T2N0M0 T4N2M0 T2N0M0 T3N0M0 T3N0M0 T3N0M0 T2N0M0
Glossectomy Laryngectomy Laryngectomy Composite resection Hemiglossectomy Laryngectomy Composite resection Composite resection Composite resection Laryngectomy Laryngectomy Composite resection Composite resection Composite resection Composite resection Composite resection Composite resection Laryngectomy Laryngectomy Laryngectomy Composite resection Laryngectomy
— — —
— — —
B, Black; H, Hispanic; W, white.
samples when compared with the β-actin control. Results for seven of the samples are shown in Fig. 1. Southern blot analysis. Data from six control matched tumor samples and one of the cell lines are shown in Fig. 2. β-Actin was used as a control in these amplification studies. Because cyclin D1 is localized to chromosome 11q13, two other markers on 11q, INT2 (11q13) and APO A1 (11q23), were also used as probes in the Southern blot hybridizations. Amplification of cyclin D1 and INT2 were observed in a single tumor, sample 32. APO A1 was not amplified in any of the tumors. Cyclin G Southern Blot Analysis
The Southern blots containing the tumor DNAs were also hybridized with the cyclin G probe. None of the tumors showed amplification of this cyclin (Fig. 3). Inhibition of Cell Proliferation with Antisense Cyclin D1
Western blot analyses were performed on proteins extracted from nontransfected and antisense cyclin D1–transfected (stable transformants) HNSCC cell lines by use of the anticyclin D1 antibody. Fibroblast
cell line IMR90 containing a high level of expression of cyclin D1 was used as a control in these studies. Cell lines CAL 27 and CCL 23 had IMR90 activity levels of 25% and 10%, respectively (Fig. 4). To determine the effect of antisense cyclin D1 on the expression of cyclin D1 in HNSCC, antisense cyclin D1 DNA was introduced into the cell lines CCL 23 and CAL 27. The transformants were grown in selection medium containing 1 mg/ml of geneticin. Stable transformants were isolated after 3 weeks in selection media. The presence of antisense cyclin D1 plasmid DNA in these transformants was confirmed by Southern hybridization with the plasmid DNA as the probe (data not shown). Transfection of the antisense cyclin D1 DNA resulted in a 50% reduction in the expression of cyclin D1 in the cell line CCL 23 as measured with a densitometer (Fig. 4). Expression of cyclin D1 was not affected in the transfected CAL 27 cells. To determine the effect of antisense cyclin D1 expression on cell proliferation, we studied transfected CAL 27 and CCL 23 cells for DNA synthesis using the 3H-thymidine incorporation assay system. Diminished incorporation of thymidine was observed at early times in the CAL 27 transformants grown in low-serum media
Otolaryngology– Head and Neck Surgery Volume 119 Number 6
WANG et al.
597
Fig. 3. Southern blot hybridization for cyclin G. Data for five tumor samples, one cell line (CAL 27), and constitutional controls (*) are shown. β-Actin was again used as a control for these hybridizations. Analysis reveals that there is no amplification of cyclin G in any of the tumor samples.
Fig. 2. Southern blot hybridization analysis was performed on 22 primary tumors and three cell lines by use of the cyclin D1 probe. Data for six tumors, one cell line (CAL 27), and constitutional controls (*) are shown. β-Actin was used as a control for single copy hybridization. Results reveal amplification of cyclin D1 in sample 32. Whereas INT 2 (integration site 2—11q13) is also amplified in this tumor, APO A1 (apoprotein A1—11q23) is not amplified in any of the tumors.
(Fig. 5A). Specifically, a greater than 60% growth reduction occurred between 24 and 72 hours of growth in serum-free media. The cells recovered to near normal growth after 72 hours. Significant growth inhibition was observed at later time periods for CCL 23 transformants (Fig. 5B). The nontransfected cells grew well in lowserum media. As expected, the control nontransfected cells grown in G418 selection media had little to no growth in both complete and low-serum media. Thus the transfection studies suggested that cyclin D1 may play an important role in the growth and proliferation of HNSCC cells and that antisense cyclin D1 expression can interfere with this growth regulation. DISCUSSION
Cancer involves a complex process of neoplastic transformation of a population of cells that are not susceptible to the normal mechanisms of growth regulation. This process appears to be related to activation of oncogenes (growth promoters) and inactivation of tumor suppressor genes.10 In cancer cells, specific chromosomal regions encoding oncogenes become amplified and overexpressed, resulting in accelerated cellular proliferation. The cyclins are a group of crucial regulatory proteins that activate protein kinases and function to control cell cycle progression. As such, dysregulation of cyclin activity could result in loss of normal cell cycle restrictions and, consequently, the development of neoplasia.
Fig. 4. Expression of cyclin D1 in head and neck cancer cell lines. Western blot analysis was performed on proteins extracted from CAL 27 and CCL 23 cells by use of the anticyclin D1 antibody. Fibroblast cell line IMR 90 was used as the control. Whereas 5 µg of IMR 90 protein was loaded on the gels, 10 µg of cell line proteins was used. Results show CAL 27 and CCL 23 to contain IMR 90 expression levels of 25% and 10%, respectively. Whereas the antisense cyclin D1–transfected CAL 27 cells (*) did not show a significant reduction in cyclin D1 expression, the antisense cyclin D1–transfected CCL 23 cells (*) showed a 50% reduction in the expression level of cyclin D1 as compared with the nontransfected controls.
Amplification and overexpression of cyclin D1 have been implicated in several cancers, including breast, esophagus, and B cell lymphomas.11 Chromosome 11q13, which contains the region encoding cyclin D1, has been found to be amplified in HNSCCs.5,12,13 Amplification of 11q13 has also been shown to correlate with poor prognosis and lymph node metastasis in head and neck cancer and breast cancer.14,15 Genes mapped to this region include cyclin D1, INT2, and EMS 1.5,16-18 The most likely candidate for proto-oncogene on the 11q13 appears to be cyclin D1.19-22 Although others have reported amplification of 11q13 in 30% to 50% of HNSCCs,5,13 the head and neck cancers in our series exhibited a much lower incidence of cyclin D1 amplification (i.e., a single tumor of the 22 primary tumors analyzed). There are several possible reasons for this difference. Because fresh-frozen tumor tissue was used in our series rather than archival specimens or cell lines as in other studies, less homogeneous tissue was available in the present analysis. Thus the low incidence of amplification we have observed may be caused by contamination of tumor tissue by
598
Otolaryngology– Head and Neck Surgery December 1998
WANG et al.
Fig. 5. Effect of antisense cyclin D1 expression on cell growth. Mean data from four repetitions of experiments are shown. Stable transformants containing antisense cyclin D1 DNA were assayed for growth proliferation with the thymidine incorporation assay as described in Methods and Material. Data are plotted as percentage of proliferation of nontransfected cells grown in serumfree media. CAL 27 transformants show decreased growth at early times after serum starvation and recover to control levels after 72 hours (A). However, CCL 23 transformants have continuous growth reduction with serum starvation (B). Both CAL 27 and CCL 23 transformants grew well in serum-fed media. Results thus imply that cyclin D1 may have a role in cellular proliferation. Standard error of the mean of data was negligible.
adjacent normal cells. The specimens were microscopically examined by a pathologist and found to contain greater than 90% tumor cells (<10% normal cells); however, even at this low level of contamination by normal tissue, tumors with low levels (twofold to threefold) of amplification of cyclin D1 may not be detected by PCR. Additionally, almost half of the tumors in our series were early stage (T1 or T2); it is possible that early-stage tumors may not exhibit cyclin D1 amplification because amplification of cyclin D1 is associated with advanced-stage tumors and portends a poor prognosis. Evaluation of a larger series consisting of both archival and fresh head and neck tumors may reveal the clinical significance of cyclin D1 amplification and/or overexpression in these tumors. To complement the gene amplification studies, we are presently undertaking immunohistochemical analysis of the tumor samples using anticyclin D1 antibodies.
It is important to note that transfection of the cyclin D1 antisense plasmid into head and neck cancer cell lines resulted in a significant decrease in proliferation. In one of the cell lines, CCL 23, this growth inhibition correlated with decreased expression of cyclin D1 in this cell line. The antisense plasmid appeared to have an earlier effect on cellular proliferation in the CAL 27 cell line (Fig. 5A). Because the Western blot analyses were performed on stable transformant colonies after 2 to 3 weeks of growth, this early effect of decreased cyclin D1 expression was not detected in CAL 27. These findings tend to support the role of cyclin D1 as an important cell cycle regulator with oncogenic potential in head and neck cancer. Although amplification and overexpression of cyclin G have been found in several human osteosarcoma lines, we did not find amplification of cyclin G in any of the head and neck cancers in our series. Although cyclin G may have a regulatory role in the cell cycle, it will be necessary to analyze cyclin G in a larger series of head and neck tumors to arrive at a definitive conclusion on its functional role in these tumors. Despite recent advances in cancer therapy, the survival rate in head and neck cancer has not improved significantly during the past 20 years. It is among the major cancers with the lowest 5-year survival rate, often requiring debilitating and morbid treatments.23 Further investigations into the roles of cyclin D1 and cyclin G in head and neck cancer should yield insights into the genetic regulation of this devastating disease. Greater understanding of the mechanisms behind the development and progression of HNSCC will lead to more efficacious therapeutic protocols. In the future treatment may be aimed at manipulation of the genetic control of the cancer cell. REFERENCES 1. Nigg EA. Targets of cyclin-dependent protein kinases. Curr Opin Cell Biol 1993;5:187-93. 2. Lukas J, Pagano M, Staskova Z, et al. Cyclin D1 protein oscillates and is essential for cell cycle progression in human tumour cell lines. Oncogene 1994;9:707-18. 3. Jiang W, Kahn S, Tomita N, et al. Amplification and expression of the human cyclin D gene in esophageal cancer. Cancer Res 1992;52:2980-3. 4. Lammie G, Fantl V, Smith R, et al. D11S287, a putative oncogene on chromosome 11q13 is amplified and expressed in squamous cell and mammary carcinomas and linked to BCL-1. Oncogene 1991;6:439-44. 5. Schuuring E, Verhoeven E, Mooi W, et al. Identification and cloning of two overexpressed genes U21B31/PRAD1 and EMS1, within the amplified chromosome 11q13 region in human carcinomas. Oncogene 1992;7:355-61. 6. Kato J, Matsushime H, Hiebert S, et al. Direct binding of cyclin D to the retinoblastoma gene product (pRb) and pRb phosphorylation by the cyclin D–dependent kinase CDK4. Genes Dev 1993;7:331-42. 7. Wu L, Liu L, Yee A, et al. Molecular cloning of the human
Otolaryngology– Head and Neck Surgery Volume 119 Number 6
8. 9.
10. 11. 12. 13.
14.
CYCG1 gene encoding a G-type cyclin: overexpression in human osteosarcoma cells. Oncology Reports 1994;1:705-11. Srivatsan ES, Benedict WF, Stanbridge EJ. Implication of chromosome 11 in the suppression of neoplastic expression in human cell hybrids. Cancer Res 1986;46:6174-9. Hall FL, Williams RT, Wu L, et al. Two potentially oncogenic cyclins, cyclin A and cyclin D1, share common properties of subunit configuration, tyrosine phosphorylation and physical association with the Rb protein. Oncogene 1993;8:1377-84. Field JK. Oncogenes and tumour-suppressor genes in squamous cell carcinoma of the head and neck. Eur J Cancer B Oral Oncol 1992;28B:67-76. Hinds P, Dowdy S, Eaton S, et al. Function of a human cyclin gene as an oncogene. Proc Natl Acad Sci 1994;91:709-13. Williams M, Gaffey M, Weiss L, et al. Chromosome 11q13 amplification in head and neck squamous cell carcinoma. Arch Otolaryngol Head Neck Surg 1993;119:1238-43. Lammie GA, Fantl V, Smith R, et al. D11S287, a putative oncogene on chromosome 11q13 is amplified and expressed in squamous cell and mammary carcinomas and linked to BCL-1. Oncogene 1991;6:430-44. Muller D, Millon R, Lidereau R, et al. Frequent amplification of 11q13 DNA markers is associated with lymph node involvement in human head and neck squamous cell carcinoma. Eur J Cancer B Oral Oncol 1994;30B:113-20.
WANG et al.
599
15. Schuuring E, Verhoeven E, van Tinderen H, et al. Amplification of genes within the chromosome 11q13 region is indicative of poor prognosis in patients with operable breast cancer. Cancer Res 1992;52:5229-34. 16. Tsujimoto Y, Yunis J, Onorato-Showe L, et al. Molecular cloning of the chromosomal breakpoint of B-cell lymphomas and leukemias with the t(11;14) chromosome translocation. Science 1984;224:1403-6. 17. Motokura T, Bloom T, Kim HG, et al. A novel cyclin encoded by a bcl-1 linked candidate oncogene. Nature 1991;350:5125. 18. Casey G, Smith R, McGillivray D, et al. Characterization and chromosome assignment of the human homolog of int-2, a potential proto-oncogene. Mol Cell Biol 1986;6:502-10. 19. Matsushime H, Roussel JF, Ashmun RA, et al. Colony-stimulating factor 1 regulates novel cyclins during the G1 phase of the cell cycle. Cell 1991;65:701-13. 20. Xiong Y, Connolly T, Futcher B, et al. Human D-type cyclin. Cell 1991;65:691-9. 21. Sherr CJ. Mammalian G1 cyclins. Cell 1993;73:1059-65. 22. Bartkova J, Lukas J, Muller H, et al. Abnormal patterns of D-type cyclin expression and G1 regulation in human head and neck cancer. Cancer Res 1995;55:949-56. 23. Boring CC, Squires TS, Tong T. Cancer statistics. CA Cancer J Clin 1991;41:19-36.
Otoplasty and Reconstruction of Auricular Defects
An International Course on Otoplasty and Reconstruction of Auricular Defects will be held March 21-22, 1999, at the ENT Department, Medical University of Lübeck, Lübeck, Germany. For further information, contact PD Dr Dr R. Siegert/M. Haase, Department of Otorhinolaryngology and Plastic Head and Neck Surgery, Medical University of Lübeck, Ratzeburger Allee 160, D-23538 Lübeck, Germany; phone, 49-451-5003189; fax, 49-451-500-4192; e-mail, [email protected].