Inhibition of CXCL1-CXCR2 axis ameliorates cisplatin-induced acute kidney injury by mediating inflammatory response

Biomedicine & Pharmacotherapy 122 (2020) 109693

Contents lists available at ScienceDirect

Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha

Inhibition of CXCL1-CXCR2 axis ameliorates cisplatin-induced acute kidney injury by mediating inflammatory response

T

Peng Liua, Xinxiu Lib,c,*, Weixing Lva, Zhaojun Xua,** a

Department of Intensive Care Unit, Hwamei Hospital, University of Chinese Academy of Sciences, Ningbo, China Department of Experimental Medical Science, Hwamei Hospital, University of Chinese Academy of Sciences, Ningbo, China c Key Laboratory of Diagnosis and Treatment of Digestive System Tumors of Zhejiang Province, Ningbo, China b

A R T I C LE I N FO

A B S T R A C T

Keywords: CXCL1 CXCR2 Cisplatin Acute kidney injury Inflammation P38 NF-κB

One of the limiting side effects of cisplatin use in cancer chemotherapy is nephrotoxicity. Inflammation is now believed to play a major role in the pathogenesis of cisplatin-induced acute kidney injury (AKI), and the mediators of inflammation contribute to it. CXCL1 was recently reported to be involved in renal physiology and pathology in ischemia mouse model; however, its roles and mechanisms in cisplatin-induced AKI are completely unknown. We observed that CXCL1 and CXCR2 expression in the kidney was markedly increased on day 7 after cisplatin treatment. Subsequently, we demonstrate that inhibition of CXCL1-CXCR2 signaling axis, using genetic and pharmacological approaches, reduces renal damage following cisplatin treatment as compared with control mice. Specifically, deficiency of CXCL1 or CXCR2 extensively preserved the renal histology and maintained the kidney functions after cisplatin treatment, which was associated with reduced expression of the pro-inflammatory cytokines and infiltration of neutrophils in the kidneys as compared. Furthermore, inhibition of CXCR2 by intragastric administration of repertaxin in mice with AKI reduces kidney injury associated with a reduction of inflammatory cytokines and neutrophils infiltration. Finally, we found that CXCL1/CXCR2 regulated cisplatin-induced inflammatory responses via the P38 and NF-κB signaling pathways in vitro and in vivo. In conclusion, our results indicate that CXCL1-CXCR2 signaling axis plays a crucial role in the pathogenesis of cisplatin–induced AKI through regulation of inflammatory response and maybe a novel therapeutic target for cisplatin-induced AKI.

1. Introduction Acute kidney injury (AKI) is a very dangerous complication among inpatients with high mortality, morbidity and healthcare costs [1,2]. Hospitalized patients, especially in Intensive Care Unit (ICU), are prone and at a high risk of death. Among those patients who survive, longterm outcome is far from benign with substantial risk of progression to chronic kidney disease (CKD) [3]. Unfortunately, a specific treatment for AKI is not available, nor is there convincing evidence that supporting preventive measures have a clear impact [4]. Current treatments focus on avoiding the potential injury due to nephrotoxic drugs or intravenous contrast agents and on providing supportive care [5,6]. Cisplatin remains an important and effective therapy in many forms of cancer today, and even we are still struggling with its major side effect of nephrotoxicity inducing AKI [7,8]. Cisplatin nephrotoxicity is the composite result of the transport of cisplatin into renal epithelial

⁎

cells, injury to nuclear and mitochondrial DNA, activation of a multiple cell death and survival pathways and initiation of a robust inflammatory response [9–11]. Cisplatin-induced nephrotoxicity is widely accepted as a model for AKI to study pathogenesis of AKI and to test new therapeutic options [12]. Inflammation is now believed to play a major role in the pathophysiology of cisplatin-induced AKI [13,14]. Morphological and functional changes of vascular endothelial or tubular epithelium cells, infiltration of leukocytes and generation of inflammatory mediators are involved in this biological process [11,15,16]. It has been reported that various cytokines and chemokines contribute to tissue injury in both cisplatin-induced and ischemia-reperfusion AKI animal models. For examples, in vivo studies have shown an increase of cytokines IL-1β, IL-18, IL-6 in the kidney is associated with cisplatininduced acute renal failure [17,18]; The inflammatory cytokines/chemokines IFN-γ, IL-2, IL-10, GM-CSF, TGF-β, CXCL1, IL-6, MIP-2, and MCP-1 are increased in the kidney in ischemic AKI [19–21].

Corresponding author at: Department of Experimental Medical Science, Hwamei Hospital, University of Chinese Academy of Sciences, Ningbo, China. Corresponding author at: Department of Intensive Care Unit, Hwamei Hospital, University of Chinese Academy of Sciences, Ningbo, China E-mail addresses: [email protected] (X. Li), [email protected] (Z. Xu).

⁎⁎

https://doi.org/10.1016/j.biopha.2019.109693 Received 17 September 2019; Received in revised form 11 November 2019; Accepted 22 November 2019 0753-3322/ © 2019 The Authors. Published by Elsevier Masson SAS. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).

Biomedicine & Pharmacotherapy 122 (2020) 109693

P. Liu, et al.

Fig. 1. CXCL1 and CXCR2 levels were increased in kidney tissues by cisplatin treatment. In 8-week-old C57BL/6 mice on days 1–7 after intraperitoneal injection with cisplatin (a single dose of 15 mg/kg), serum creatinine (A) and BUN (B) levels was determined using mouse albumin or creatinine kit and shown as bar graph (n = 5 per group, unpaired Student’s t-test). ELISA analysis (C) and quantitative RTPCR (D) were performed to measure CXCL1 and CXCR2 levels in the kidneys of cisplatininduced AKI mice compared with vehicle control mice (n = 5 per group, unpaired Student’s t-test). IHC staining (E) were performed to detect expression of CXCL1 and CXCR2 in the kidneys of cisplatin-induced AKI mice compared with vehicle control mice. Images were collected and analysed using open-source software ImageJ (F) (Scale bar = 0 μ m, n = 5, unpaired Student’s t-test). Bars indicate mean values ± SEM. *, p < 0.05; **, p < 0.01; ***, p < 0.001.

2. Materials and methods

Chemokine (C–X–C motif) ligand 1 (CXCL1), also known as KC and GROα, and its receptor CXCR2 that belongs to a superfamily of signaling molecules [22], whose expression is driven in different kinds of cells [23–25]. Observations have shown that CXCL1 plays an crucial role not only in tumorigenesis and metastasis of several types of human cancers [26–28] but also in wound repair and inflammation, acting as neutrophil activators, chemoattractants and angiogenic factors [29,30]. Recent studies showed that CXCL1 levels were elevated in serum, urine and kidney tissue of renal ischemia mouse model [31,32], which suggested that it could be an early biomarker of ischemic acute kidney injury. However, whether CXCL1-CXCR2 axis contributes to the regulation in the pathological processes of cisplatin-induced AKI is unknown. Given the differential expression of CXC chemokine including CXCL1 in AKI, we hypothesized that blocking the expression of CXCL1 or CXCR2 can modulate inflammatory response in the kidney to impede deterioration of kidney function in cisplatin-induced AKI mouse. To explore the role of CXCL1-CXCR2 axis in this pathological process, mice with genetic defect of CXCL1 or CXCR2 and CXCR2 specific inhibitor were used. We also tried to demonstrate the underlying mechanism by which CXCL1and CXCR2 are upregulated in AKI in vitro and in vivo. Our findings identify that inhibition of CXCL1-CXCR2 axis protected the kidney from cisplatin-induced acute injury, and this protection was probably mediated by reduced inflammation.

2.1. Animals C57BL/6 (WT) mice were obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd and maintained at Laboratory Animal Center of Ningbo University. CXCL1-deficient (CXCL1 KO) and CXCR2-deficient (CXCR2 KO) mice were obtained from Model Animal Research Center of Nanjing University. Animal treatment was consistent with the National Institutes of Health Guidelines on the care and use of laboratory animals. All animal experiments were conducted in compliance with the protocols of the Institutional Animal Care and Use Committee at Ningbo No.2 hospital. To establish mouse cisplatin-induced AKI model, male mice aged 6–8 weeks (weight, 20−25 g) suffered from single cisplatin intraperitoneal injection. Control group mice are given physiological saline intraperitoneal injection with the equal capacity. For repertaxin experiments, mice were pre-treated daily with repertaxin (30 mg/kg/day) by intragastric administration 60 min before intraperitoneal injection of cisplatin. After 7 days, mice were euthanized to collect kidney samples and serum for subsequent examination.

2

Biomedicine & Pharmacotherapy 122 (2020) 109693

P. Liu, et al.

Fig. 2. Genetic deficiency of CXCL1-CXCR2 ameliorated cisplatin-induced AKI. Serum creatinine (A) and BUN (B) levels of WT, CXCL1 KO mice, CXCR2 KO mice were analysed after treatment of cisplatin or saline for 1–7 days (n = 5 per group, two-way ANOVA). Bars indicate mean values ± SEM. *, p < 0.05; **, p < 0.01; ***, p < 0.001; ns, not significant. Sections of the ligated kidneys from saline or cisplatin-injected WT, CXCL1 KO and CXCR2 KO mice were stained with PAS (C) and H&E (D). Representative photomicrographs of the injured region are shown, and damaged areas on tissue sections are marked with asterisks (C) and arrows (D). Typical microscopic images of tubular dilation, epithelial necrosis in death area were defined with black arrows when compared with histomorphological features in normal tissues (white arrows) (C). PAS-stained sections showed no damage in the vehicle group, the tubular injury in cisplatin group, and attenuated tubular injury in the CXCL1 KO and CXCR2 KO group. Note there were many dilated tubules (asterisk) in cisplatin-induced AKI mice (D). n = 5 per group, scale bar = 50 μ m.

being exposed to cisplatin. 12 h later, the cells were harvested for the indexes of inflammatory response such as phospho-p65, anti-phosphop38 using Western blot analysis.

2.2. Urine albumin and creatinine assay Kidney function of animals in this study was assayed by measuring the concentrations of urine albumin and creatinine in serum using mouse albumin or creatinine kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer’s instructions. In brief, double distilled water, standards and samples were transferred in duplicate into the wells of a clear bottom 96-well plate. Then, working reagent was added, and the plate was tapped lightly to mix the solution. The plate was incubated for indicated time at room temperature, and the optical density (OD) was read at certain wavelength as protocols.

2.4. Histological and immunohistochemical staining Hematoxylin eosin (H&E), Periodic Acid Schiff (PAS) reaction and immune- histochemical staining were performed in paraffin-embedded kidney sections after fixation in 10 % formalin at 4 °C for 24 h. The waxes were sectioned serially at 4-μm thickness. After deparaffinization and rehydration, standard H&E staining and PAS staining was carried out for morphological analysis. Tubular injuries were indicated by necrotic lysis, tubular dilatation, brush border loss, cast formation, and marked with asterisks and arrows. To visualize the CXCL1 expression profile and neutrophil infiltration, immunohistochemical staining was performed using the Maixin IHC Kit. After incubating with CXCL1 (1:50 dilution; Abcam), myeloperoxidase (1:100 dilution; Abcam) and F4/80 (1:100; Abcam) primary antibody overnight at 4 °C, the kidney sections were incubated with HRP-conjugated secondary antibodies, and immunoreactive cells were visualized using DAB. The histological images

2.3. Cell culture Human renal proximal tubular epithelial cells HK2 (COBIOER, Nanjing, China) were cultured in 10 % FBS-containing HyCloneTM DMEM/F12 medium at 37 °C in humidified 5 % CO2. After overnight starving in DMEM/F12 medium containing 0.5 % FBS, HK2 cells were pretreated with repertaxin (Selleck Chemicals, USA) for 30 min before 3

Biomedicine & Pharmacotherapy 122 (2020) 109693

P. Liu, et al.

Fig. 3. Expression of inflammatory cytokines in the kidneys of control, CXCL1 KO and CXCR2-KO mice before and after cisplatin-induced AKI. Kidney tissues were dissected from control, CXCL1 KO mice and CXCR2 KO mice after treatment with saline or cisplatin. After RNA extraction, the relative mRNA levels of IL-6 (A), MCP1 (B) and TNF-α(C) were determined by quantitative real-time PCR. GAPDH was used as an internal control (n = 4 per group, two-way ANOVA). The protein levels of IL-6 (D), MCP-1 (E) and TNF-α (F) in kidney tissues were analyzed by ELISA. Quantification of the levels was shown as bar graph. (n = 4 per group, two-way ANOVA). Myeloperoxidase expression profiles in the kidneys of mice (WT, CXCL1 KO and CXCR2 KO) after saline or cisplatin treatment were shown in representative images of IHC staining (G) to indicate infiltrated neutrophils. Quantification of myeloperoxidase positive area is shown (H). (Scale bar = 50 μm, n = 4, two-way ANOVA). All samples were from the mice on day 7 after cisplatin treatment. Bars indicate mean values ± SEM. *, p < 0.05; **, p < 0.01; ***, p < 0.001; ns, not significant.

quantified and checked for quality using a Nanodrop 2000 (Thermo Fisher Scientific, Madison, WI, USA). 2 μg RNA was reverse-transcribed into first-strand cDNA using TransScript All-in-One First-Strand cDNA Synthesis SuperMix (TRANSGEN BIOTECH, Beijing, China) according to the manufacturer’s protocol. The PCR amplification products were quantified by the FastStart Universal SYBR Green Master (Roche) following a standard procedure (95 °C for 10 s, 60 °C for 10 s and 72 °C for 20 s; 45 cycles). The primer sequences used for CXCL1, CXCR2, TNF-α, IL-1β, IL-6, MCP-1 and GAPDH were as following: CXCL1 forward, 5′ GGCTGGGATTCACCTCAAGAA3′; CXCL1 reverse, 5′ TGTGGCTATGAC TTCG GTTTG 3′；CXCR2 forward, 5′ TTCTGACCCGCCCTTTACTCTGT 3′; CXCR2 reverse, 5′ CGCAGTGTGAACCCATAGCAG3′; TNF-α forward, 5′ ACGGCAT GGATCTCAAAG AC 3′; TNF-α reverse, 5′ AGATAGCAAA TCGGCTGACG 3′; IL-6 forward, 5′ ACAACCACGGCCTTCCCTAC 3′; IL-6 reverse, 5′ TCCACGATTT CCCAGAGAACA 3′; MIP-1 forward, 5′ ACCT GCTCAACATCATGAAGG 3′; MIP-1 reverse, 5′ AGATGGAGCTATGCAG

were observed and captured under a light microscope at 400× or 200× magnification for each sample. Quantification of positive staining area was analysed using Image J v 1.8.0. 2.5. Serum concentration of inflammatory mediators Concentration of inflammatory cytokines (TNF-α, IL-6, MCP-1) in serum were determined by ELISA (mouse: SEA133Mu 96 T for TNF-α, SEA087Mu 96 T for IL-6 and SEA371Mu 96 T for MCP-1). All commercial kits were purchased from Cloud-Clone Corp (Nanjing, China) and used according to the manufacturer’s instructions. 2.6. qPCR assay For the qPCR assay, total mRNA was extracted from kidney tissue samples using TRIzol reagent (Invitrogen). The isolated RNA was 4

Biomedicine & Pharmacotherapy 122 (2020) 109693

P. Liu, et al.

Fig. 4. Repertaxin inhibits kidney damage in cisplatin-induced AKI mouse model. AKI mice were pre-treated daily with repertaxin (30 mg/ kg/day) by intragastric administration 60 min before intraperitoneal injection of cisplatin. After 7 days, serum creatinine (A) and BUN (B) levels in mice were determined by creatinine and BUN assay kits (n = 5 per group, one-way ANOVA). The data are presented as the means ± SEM. ***, P < 0.001. Kidney sections were prepared and stained with PAS (C) and H&E (D). Histomorphological features were shown with different colour arrows and red asterisks among different treatment groups after HE and PAS staining. The tubular injury in cisplatin group marked with black arrows and attenuated tubular injury marked with green arrows in the cisplatin + repertaxin group were shown in D, and dilated tubules (asterisk) in cisplatin-induced AKI mice were shown in C. n = 5 per group, scale bar = 50 μm. Mice were split to three groups, WT group (intraperitoneal injection of saline), cisplatin group (intraperitoneal injection of cisplatin) and cisplatin + repertaxin group (intragastric administration of repertaxin, intraperitoneal injection of cisplatin).

quantified using ImageJ v 1.8.0.

GTGG 3′; GAPDH forward, 5′ TGCAGTGGCAAAGTGGAGATT 3′; and GAPDH reverse, 5′ TCGCTCCTGGAAG ATGGTGAT 3′.

2.8. Statistical analyses 2.7. Western blot

Statistical analyses were performed using GraphPad Prism 7.0 and all data were presented as mean ± SEM. At least three independent experiments were analyzed by unpaired t-test, one-way ANOVA and two-way ANOVA. To classify and indicate significant values, the following p-values were used: ∗ p < 0.05; ∗∗ p < 0.01; ∗∗∗ p < 0.001; ns, not significant.

Cultured cells were lysed and protein was extracted using RIPA buffer containing protease and phosphotase inhibitors cocktails. BCA protein assay kit was used to determine protein concentrations according to the manufacturer’s instruction (Thermo Fisher Scientific). An equal amount of protein was separated on sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE) for ∼30 min at 80 V in stacking gel and ∼1 h at 130 V in resolving gel, and then electrophoretically transferred onto PVDF membranes at 0.3A for 1.5 h. After blocking with 10 % skim milk for 2 h, the membranes were incubated with appropriate primary antibodies including rabbit anti-phosphop38, rabbit anti-p38, rabbit anti-phospho-ERK, rabbit anti-ERK, rabbit anti-phospho-JNK, rabbit anti-JNK, rabbit anti-phospho-p65, rabbit anti-p65. Antibodies including anti-phospho-p65, anti-phospho-p38, anti-p65 and anti-p38 have species reactivity of both human and mouse, and all antibodies are purchased from Cell Signaling Technology (Danvers, MA). Following by overnight incubation at 4 °C, the membranes were incubated with HRP-conjugated secondary antibodies goat anti-mouse IgG or goat anti-rabbit IgG antibody for 1 h at room temperature on a shaker. These antibodies were purchased from Cell Signaling Technology. Proteins were visualized using ECL Western blotting detection reagents (Millipore). Immunoreactive bands were

3. Results 3.1. CXCL1 and CXCR2 expressions were increased significantly in the cisplatin-induced AKI Blood urea nitrogen (BUN) and serum creatinine (SCr) are important indicators of renal health. To confirm an established model of AKI could be used, we measured the levels of blood urea nitrogen, serum creatinine on day 7 after single intraperitoneal injection with cisplatin daily. Compared with baseline values, BUN and SCr were significantly increased in mice, indicating impaired renal function after cisplatin administration (Fig. 1A–B). CXCL1 levels were elevated in serum, urine and kidney tissue of renal ischemia mouse model [31,32]. To investigate the expressions of CXCL1 in kidney after AKI induced by cisplatin, we measured CXCL1 mRNA and protein expression in kidney 5

Biomedicine & Pharmacotherapy 122 (2020) 109693

P. Liu, et al.

Fig. 5. Repertaxin inhibits inflammatory response in cisplatin-induced AKI mice. AKI mice were pre-treated daily with repertaxin (30 mg/ kg/day) by intragastric administration 60 min before intraperitoneal injection of cisplatin. After 7 days, the mRNA expression levels of inflammatory cytokines in the kidney were analyzed by quantitative RT-PCR, including IL6 (A), MCP-1 (B) and TNF-α(C) (n = 4 per group, one-way ANOVA). The protein levels of IL-6 (D), MCP-1 (E) and TNF-α (F) in kidney tissues were analysed by ELISA (n = 4 per group, one-way ANOVA). IHC staining of myeloperoxidase in the ligated kidneys was performed to detect infiltrated neutrophils (G). H shows the quantification of myeloperoxidase positive area. (n = 4, two-way ANOVA, scale bar = 100 μ m). Mice were split to three groups, WT group, cisplatin group and cisplatin + repertaxin group. The data are presented as the means ± SEM. *, p < 0.05; **, p < 0.01; ***, p < 0.001; ns, not significant.

development of cisplatin-induced AKI.

tissues from mice with cisplatin injection and compared expression in samples with normal saline. We found significantly greater CXCL1 expression in cisplatin-induced AKI mice as compared to control group (Fig. 1C–F). The signaling receptor for CXCL1 in other tissues is CXCR2. To determine whether CXCR2 was highly expressed in line with increased CXCL1 in AKI mice, quantitative real-time PCR analyses and IHC for CXCR2 were performed. As we expected, the CXCR2 expression level was also much higher in kidney tissue of AKI mouse model underwent cisplatin induction (Fig. 1C–F). In brief, after cisplatin injection, renal dysfunction was severe with significantly increased BUN and serum creatinine level. At the same time, it is very interesting that CXCL1 and its receptor CXCR2 expression levels are induced greatly by cisplatin.

3.3. Deficiency of CXCL1-CXCR2 axis inhibits a burst of inflammation and neutrophils infiltration in cisplatin-induced AKI Previous studies have shown that exposure of tubular cells or tissues to cisplatin can lead to a robust inflammatory response, which is an important form resulting in renal tissue damage [33]. The injurious role of inflammation in AKI is increasingly appreciated with the involvement of adhesion molecules and cytokines [15]. To determine the mechanisms underlying the protective effects of CXCL1 KO and CXCR2 KO against cisplatin-induced AKI, we examined production of inflammatory cytokines MCP-1, IL-6, TNF-α in the kidney after cisplatin treatment, using real-time PCR and ELISA. CXCL1 deficiency significantly lowered the serum concentrations of inflammatory cytokines and chemokines induced by cisplatin (Fig. 3D–F). This effect was accompanied by lower expression levels of genes encoding inflammatory mediators (Fig. 3A–C). In accordance with these differences, loss of CXCR2 elicited a remarkable reduction of inflammatory response as compared to WT controls in response to cisplatin (Fig. 3A–F). In the mouse, two chemokines, CXCL1 and CXCL2, have been identified as neutrophil chemoattractants and are thought to be functional homologues of human IL-8 [34,35]. To determine whether CXCL1-mediated inhibition of inflammatory responses was caused by reduction of immune cell infiltration, IHC staining were performed to evaluate the infiltration of neutrophils. Seven days after cisplatin treatment, a large amount of neutrophils were detected in the ligated kidneys but not in the contralateral kidneys. In the absence of CXCL1, the numbers of recruited neutrophils were significantly decreased (Fig. 3G–H). Similarly, in animals lacking CXCR2, the number of neutrophils was reduced and the cells were displaced to the margin of the kidney (Fig. 3G–H), suggesting that CXCL1 signaling through CXCR2 is required for recruitment of neutrophils into the kidney. Taken together,

3.2. Loss of CXCL1-CXCR2 signaling ameliorates the degree of cisplatininduced AKI To obtain a direct evidence supporting a causative role for changes in the CXCL1 expression in cisplatin-induced AKI mouse model, we subjected CXCL1-KO mice to 7-days cisplatin intraperitoneal injection. Serum BUN and SCr levels were significantly decreased in CXCL1 KO mice subjected to cisplatin when compared to WT controls (Fig. 2A–B). Injured renal parenchymal cells and acute tubular necrosis are significantly reduced in the CXCL1 KO mice with AKI (Fig. 2C–D). To determine whether CXCL1-mediated kidney injury was associated with CXCR2, BUN and SCr levels in serum and pathologic manifestation were compared between WT and CXCR2 KO mice suffered from cisplatin. In condition of AKI, absence of CXCR2 signaling resulted in a reduction of BUN and SCr in serum (Fig. 2A–B). A concomitant alteration in histopathology was also seen in CXCR2 KO injured kidneys (Fig. 2C–D). These data suggest that relief of symptoms in cisplatin-induced AKI mice resulted from the absence of CXCL1 or its receptor CXCR2. Thus, CXCL1 signaling through the CXCR2 receptor appears to be required for 6

Biomedicine & Pharmacotherapy 122 (2020) 109693

P. Liu, et al.

Fig. 6. CXCL1-CXCR2 axis regulates MAPK subtypes (p38) and NF-κB signalling pathways in vitro and in vivo. (A) HK-2 cells were pretreated with 10 μM repertaxin for 30 min, followed by stimulated with 500 ng/mL cisplatin or vehicle control for 12 h. Cytoplasmic extracts were analyzed using antibodies specific for CXCL1, CXCR2, P38, ERK, JNK and NF-κB (p65), or for phosphorylated versions of these proteins. Blot with Actin serves as loading control. (B–F) Bar graphs show the quantification of western blots as ratios of CXCL1, CXCR2, phospho-JNK/total JNK, phosphoP38/total P38, phospho-ERK/total ERK and phospho-P65/total P65, respectively. The ratio of vehicle control treatment served as a control. (n = 4, one-way ANOVA). (H–J) The relative protein levels of phospho-P65 and phospho-P38 in kidney tissues were detected by western blots and analysed with ImageJ software (n = 3 per group, one-way ANOVA). Error bars indicate SEM. Data represent mean ± SEM. *, p < 0.05; **, p < 0.01; ***, p < 0.001; ns, not significant.

CXCL1-CXCR2 signaling could mediate inflammatory responses and immune cell infiltration. 3.4. CXCR2 inhibitor repertaxin inhibits kidney damage in cisplatin-induced AKI mouse model Considering the critical effect of CXCL1-CXCR2 axis on cisplatininduced AKI, we examined whether blocking CXCR2 signaling using a previously reported CXCR2 inhibitor repertaxin that could suppress these pathologies. Repertaxin is highly effective in suppressing acute renal damage and protecting mice against nephrotoxicity of cisplatin, as evidenced by the significantly reduced serum BUN and SCr levels (Fig. 4A–B) and lower injury of renal parenchymal cells as compared to the vehicle-treated group (Fig. 4C–D). These results together demonstrate that inhibition of CXCL1-CXCR2 signaling protects the kidney against cisplatin-induced AKI.

Fig. 7. Schematic model of the interplay between CXCL1/CXCR2 axis and inflammation in cisplatin-induced AKI. Inhibition of CXCL1/CXCR2 suppresses the neutrophils infiltration to reduce cisplatin-induced inflammatory response in kidney via regulating the activation of P38 and NF-κB.

3.5. CXCR2 inhibitor repertaxin improves inflammatory environment of kidney injury induced by cisplatin Remarkably, renal cisplatin-induced inflammatory responses, including cytokine and chemokine production, inflammatory cell infiltration were all attenuated by repertaxin treatment. Notably, 7

Biomedicine & Pharmacotherapy 122 (2020) 109693

P. Liu, et al.

described previously, which confers recruitment of leukocytes and adhesion molecules, as well as endothelial injury [45–47]. There is also increasing evidence that cisplatin-induced AKI is an inflammatory process [18,48]. These findings support our results here and our conclusion that the pathogenesis of cisplatin-induced AKI is marked primarily by inflammatory responses. Many cytokines are released by leukocytes and renal tubular cells into the injured kidney, which are important components of both the initiation and extension of inflammation in AKI. Although mediators of inflammation could regulate the differential expression of inflammatory cytokines/chemokines both in ischemic AKI and in cisplatin-induced AKI, the mechanism of modulation is not simply explained by the differences in pro- and anti-inflammatory cytokines. For example, both ischemic AKI and cisplatin-induced AKI can activate the cytokines IL-1 β and IL-18. Only IL-18 deficient mice are protected against ischemic AKI rather than deficiency of IL-1β [49,50]; Inhibition of IL-1 β and IL18 was not sufficient to prevent cisplatin-induced AKI [18]. It has been previously demonstrated that CXCL1 is increased in the kidney in ischemic AKI [51], and studies suggest that CXCL1-CXCR2 axis is a mediator of ischemic AKI [52]. There is a growing recognition of the importance of inflammation, in addition to direct cellular toxicity, in the pathogenesis of cisplatin nephrotoxicity. The expression of a number of inflammatory cytokines and chemokines is changed greatly in the kidney after cisplatin injury, such as TNF-α, IL-1β, IL-18, IL-10, CX3CL1 and IL-6 [18,53]. On top of that, the levels of several pro-inflammatory cytokines, including TNF-α, IL-6, IL-2, IP-10, MCP-1 and CXCL1, are increased in the urine of cisplatin-treated mice and dogs [54,55]. However, evidence for a functional role for many of these cytokines is lacking. Ali Akcay etc. have shown that mice deficient in the CXCR2 had lower serum creatinine, ATN and apoptosis than WT mice following cisplatin-induced AKI [56], and IL-33 promotes AKI through CD4 T cellmediated production of CXCL1. CXCR2 is not specific for CXCL1 and binds other CXC chemokines like CXCL2 (MIP-2) [57]. Actually, both CXCL1 and CXCL2 levels were elevated in the kidney tissue of cisplatininduced AKI model, but upregulation of CXCL2 was not more significant than CXCL1. It may be because CXCL2 has a lower affinity for CXCR2 than CXCL1 and is less able to initiate signal transduction and a biologic effect than CXCL1 [58]. It is well known that CXCL1 and CXCR2 are necessary for recruitment and adhesion of circulating leukocytes, macrophages into the site of injury [28,59,60], migration of stromal cells osteoclast and OPC [61–63]. Injection of a neutralizing antibody to CXCL1 or a CXCR2 inhibitor-repertaxin in animal models results in decreased neutrophil infiltration in the kidney and protection against ischemic AKI [51,52]. Previous study concluded that macrophages are the main source of CXCL1 in ischemic AKI because inhibition of macrophage infiltration prevented the increase in CXCL1 in the kidney [64]. However, it was unclear whether macrophages are the main source of CXCL1 in the kidney in ischemic AKI. In fact, CXCL1/ CXCR2 signaling has been reported to be expressed in monocytes [65], endothelial cells [24], fibroblasts [23], nerve cells [66] and some tumor cells cancer cells [28]. Since CXCL1 and CXCR2 protein levels are increased significantly after cisplatin-induced AKI, we examined CXCL1 and CXCR2 in the kidney tissues after AKI by immunohistochemistry in vivo and found that CXCL1 and CXCR2 colocalized in endothelial or tubular epithelium cells. In this regard, Joshua M. Thurman etc. previously showed that tubular epithelial cells contribute to renal CXCL1 production [31]. A review motioned that endothelium cells of blood vessels are the main source of CXCL1 in the injured kidney [67]. Thus, multiple kidney cell types appear to be important in CXCL1 production after AKI. Up-regulation of CXCL1 in endothelial or tubular epithelium cells results in the infiltration of inflammatory cells like neutrophils, lymphocytes and macrophages and drive inflammation. Phosphorylation of MAPK proteins induced by cisplatin can cause inflammation in the kidney tubules which lead to kidney dysfunction [68,69]. Previous studies reported that the modulatory response of NF-κB in

inhibiting CXCL1-CXCR2 signaling with repertaxin significantly blocked cisplatin-induced kidney dysfunction and inflammatory response, suppressed the production and release of cytokines and chemokines (Fig. 5A–F), and largely inhibited the recruitment of neutrophils (Fig. 5G–H). These data suggests that CXCL1-CXCR2 signaling is essential for suppressing inflammation when kidney tissues are exposed to cisplatin stimuli, and this axis can be blocked by its inhibitorrepertaxin. 3.6. Inhibition of CXCL1-CXCR2 signalling attenuates the activation of inflammatory response pathways in vitro and in vivo The transcription factor NF-κB and the major MAPKs subtypes (ERK1/2, p38 and JNK) are reported to function downstream of cisplatin stimulation [36–38]. To identify the signalling pathways that mediate the inflammatory responses induced by cisplatin in the absence of CXCL1/CXCR2, we first examined the activation kinetics of NF-κB, ERK1/2, p38 and JNK in cisplatin-induced HK-2 cells that are an immortalized proximal tubule epithelial cell line from normal adult human kidney. We confirmed that expression of CXCL1 and CXCR2 was decreased in the HK-2 cells co-treated with cisplatin and repertaxin compared to treated with cisplatin alone (Fig. 6A–C). In HK-2 cells treated with cisplatin, the phosphorylation of NF-κB, ERK1/2, and p38 was more pronounced compared with control (Fig. 6A–C). Interestingly, inhibiting the expression of CXCL1/CXCR2 in cisplatin-induced HK-2 cells significantly decreased the phosphorylation of p38 and NFκB (Fig. 6E and G), whereas no effects were observed for phosphorylated ERK1/2 and JNK (Fig. 6D and F). In detail, there was a remarkable difference in expression and phosphorylation of ERK when treated with cisplatin, and JNK activation and expression were not changed by cisplatin treatment though it has a tendency to increase (Fig. 6D). To further define the role of CXCL1/CXCR2 in MAPK signaling pathways in vivo, we measure the expression level of phosphorylated p38 and NF-κB in CXCL1-deficient and CXCR2-deficient mice after cisplatin treatment. Similar results were observed in transgenic mice when compared with WT mice (Fig. 6H–J). We therefore conclude that inhibiting CXCL1/ CXCR2 axis may specifically block the activation of p38 and NF-κB signaling pathways to regulate the inflammatory responses in cisplatininduced AKI. 4. Discussion Cisplatin remains an important and effective therapy in many forms of cancer today, though its nephrotoxicity often limits its clinical use [8]. AKI is a frequent complication in critically ill patients undergoing cisplatin chemotherapy [11,39]. An improved knowledge about the pathogenesis of cisplatin-induced AKI is crucial for developing effective therapeutic strategy to prevent cisplatin-induced AKI and improve survival in cancer patients receiving cisplatin-based chemotherapy. In this study, we demonstrated that the expression of CXCL1 and its receptor CXCR2 is significantly upregulated by cisplatin in vivo and in vitro. Cisplatin induced AKI mice lacking CXCL1 or CXCR2 gene show attenuated kidney injury and diminished pro-inflammatory effects. Meanwhile, inhibiting CXCR2 signaling with CXCR2 receptor antagonist (repertaxin) could partly attenuate cisplatin-induced AKI. Mechanistically, repertaxin suppressed the hyperactivation of p38 and NFκB signaling pathway upon cisplatin stimulation (Fig. 7). The pro-inflammatory nature of cisplatin-induced AKI has been well documented including increases in the inflammatory cytokines and neutrophil infiltration in the kidney [40–42]. Researches have also shown that cisplatin is involved in generation of reactive oxygen species (ROS), apoptosis via the death receptor-tumor necrosis factor interaction and intrinsic caspases [14,43,44]. Thus, all these pathologic processes including endothelial and epithelial cell death, oxidative stress, as well as inflammatory processes contribute to cisplatin-induced nephrotoxicity. Inflammation in AKI, especially in ischemic AKI, has been 8

Biomedicine & Pharmacotherapy 122 (2020) 109693

P. Liu, et al.

inflammatory and immunomodulatory genes is associated with the nephrotoxicity due to cisplatin [70,71]. P38-dependent translocation and NF-κB transcription factors were regulated by CXCR2-binding chemokines [72,73]. In our study, cisplatin indeed increased the phosphorylation of MAPK family member proteins and NF-κB. Blocking CXCR2 regulated P38 phosphorylation at different stage of adipogenesis [74], whereas we found pretreatment with repertaxin reversed the effect through blocking of P38 and NF-κB signaling pathway specifically. Future work must examine whether CXCL1-CXCR2 deficiency plays a protective role in other organs, such as the liver during cisplatin treatment. If so, CXCL1 or its receptor may be novel therapeutic targets. Importantly, as CXCL1 is strongly associated with biological processes of some cancers, including prostate cancer [62] and breast cancer [28], clinical suppression of CXCL1-CXCR2 expression or activity may achieve the best combination for prevention of cisplatin-induced injury and cisplatin anti-tumor efficiency.

1016/j.kint.2018.08.036. [2] S.G. Coca, B. Yusuf, M.G. Shlipak, A.X. Garg, C.R. Parikh, Long-term risk of mortality and other adverse outcomes after acute kidney injury: a systematic review and meta-analysis, Am. J. Kidney Dis. 53 (6) (2009) 961–973, https://doi.org/10.1053/ j.ajkd.2008.11.034. [3] I.D. Bucaloiu, H.L. Kirchner, E.R. Norfolk, J.E. Hartle 2nd, R.M. Perkins, Increased risk of death and de novo chronic kidney disease following reversible acute kidney injury, Kidney Int. 81 (5) (2012) 477–485, https://doi.org/10.1038/ki.2011.405. [4] A. Zarbock, J.A. Kellum, C. Schmidt, H. Van Aken, C. Wempe, H. Pavenstadt, A. Boanta, J. Gerss, M. Meersch, Effect of early vs delayed initiation of renal replacement therapy on mortality in critically Ill patients with acute kidney injury: the ELAIN randomized clinical trial, JAMA 315 (20) (2016) 2190–2199, https:// doi.org/10.1001/jama.2016.5828. [5] R. Mehran, G.D. Dangas, S.D. Weisbord, Contrast-associated acute kidney injury, N. Engl. J. Med. 380 (22) (2019) 2146–2155, https://doi.org/10.1056/ NEJMra1805256. [6] J. Radhakrishnan, D.C. Cattran, The KDIGO practice guideline on glomerulonephritis: reading between the (guide)lines—application to the individual patient, Kidney Int. 82 (8) (2012) 840–856, https://doi.org/10.1038/ki.2012.280. [7] H. Mehanna, M. Robinson, A. Hartley, A. Kong, B. Foran, T. Fulton-Lieuw, M. Dalby, P. Mistry, M. Sen, L. O’Toole, H. Al Booz, K. Dyker, R. Moleron, S. Whitaker, S. Brennan, A. Cook, M. Griffin, E. Aynsley, M. Rolles, E. De Winton, A. Chan, D. Srinivasan, I. Nixon, J. Grumett, C.R. Leemans, J. Buter, J. Henderson, K. Harrington, C. McConkey, A. Gray, J. Dunn, E.H.P.V.T.G, Radiotherapy plus cisplatin or cetuximab in low-risk human papillomavirus-positive oropharyngeal cancer (De-ESCALaTE HPV): an open-label randomised controlled phase 3 trial, Lancet 393 (10166) (2019) 51–60, https://doi.org/10.1016/S0140-6736(18) 32752-1. [8] N.A. dos Santos, M.A. Carvalho Rodrigues, N.M. Martins, A.C. dos Santos, Cisplatininduced nephrotoxicity and targets of nephroprotection: an update, Arch. Toxicol. 86 (8) (2012) 1233–1250, https://doi.org/10.1007/s00204-012-0821-7. [9] V. Volarevic, B. Djokovic, M.G. Jankovic, C.R. Harrell, C. Fellabaum, V. Djonov, N. Arsenijevic, Molecular mechanisms of cisplatin-induced nephrotoxicity: a balance on the knife edge between renoprotection and tumor toxicity, J. Biomed. Sci. 26 (1) (2019) 25, https://doi.org/10.1186/s12929-019-0518-9. [10] R.P. Miller, R.K. Tadagavadi, G. Ramesh, W.B. Reeves, Mechanisms of cisplatin nephrotoxicity, Toxins (Basel) 2 (11) (2010) 2490–2518, https://doi.org/10.3390/ toxins2112490. [11] S. Manohar, N. Leung, Cisplatin nephrotoxicity: a review of the literature, J. Nephrol. 31 (1) (2018) 15–25, https://doi.org/10.1007/s40620-017-0392-z. [12] J.N. Wang, M.M. Liu, F. Wang, B. Wei, Q. Yang, Y.T. Cai, X. Chen, X.Q. Liu, L. Jiang, C. Li, X.W. Hu, J.T. Yu, T.T. Ma, J. Jin, Y.G. Wu, J. Li, X.M. Meng, RIPK1 inhibitor Cpd-71 attenuates renal dysfunction in cisplatin-treated mice via attenuating necroptosis, inflammation and oxidative stress, Clin. Sci. (Lond.) 133 (14) (2019) 1609–1627, https://doi.org/10.1042/CS20190599. [13] L. Gao, M.M. Liu, H.M. Zang, Q.Y. Ma, Q. Yang, L. Jiang, G.L. Ren, H.D. Li, W.F. Wu, J.N. Wang, B. Wei, X.Q. Liu, C. Jiang, C. Huang, J. Li, X.M. Meng, Restoration of Ecadherin by PPBICA protects against cisplatin-induced acute kidney injury by attenuating inflammation and programmed cell death, Lab. Invest. 98 (7) (2018) 911–923, https://doi.org/10.1038/s41374-018-0052-5. [14] N. Pabla, Z. Dong, Cisplatin nephrotoxicity: mechanisms and renoprotective strategies, Kidney Int. 73 (9) (2008) 994–1007, https://doi.org/10.1038/sj.ki. 5002786. [15] D.W. Lee, S. Faubel, C.L. Edelstein, Cytokines in acute kidney injury (AKI), Clin. Nephrol. 76 (3) (2011) 165–173. [16] A. Ozkok, C.L. Edelstein, Pathophysiology of cisplatin-induced acute kidney injury, Biomed Res. Int. 2014 (2014) 967826, , https://doi.org/10.1155/2014/967826. [17] N. Miao, F. Yin, H. Xie, Y. Wang, Y. Xu, Y. Shen, D. Xu, J. Yin, B. Wang, Z. Zhou, Q. Cheng, P. Chen, H. Xue, L. Zhou, J. Liu, X. Wang, W. Zhang, L. Lu, The cleavage of gasdermin D by caspase-11 promotes tubular epithelial cell pyroptosis and urinary IL-18 excretion in acute kidney injury, Kidney Int. 96 (5) (2019) 1105–1120, https://doi.org/10.1016/j.kint.2019.04.035. [18] S. Faubel, E.C. Lewis, L. Reznikov, D. Ljubanovic, T.S. Hoke, H. Somerset, D.J. Oh, L. Lu, C.L. Klein, C.A. Dinarello, C.L. Edelstein, Cisplatin-induced acute renal failure is associated with an increase in the cytokines interleukin (IL)-1beta, IL-18, IL-6, and neutrophil infiltration in the kidney, J. Pharmacol. Exp. Ther. 322 (1) (2007) 8–15, https://doi.org/10.1124/jpet.107.119792. [19] A. Andres-Hernando, K. Okamura, R. Bhargava, C.M. Kiekhaefer, D. Soranno, L.A. Kirkbride-Romeo, H.W. Gil, C. Altmann, S. Faubel, Circulating IL-6 upregulates IL-10 production in splenic CD4(+) T cells and limits acute kidney injury-induced lung inflammation, Kidney Int. 91 (5) (2017) 1057–1069, https://doi.org/10.1016/ j.kint.2016.12.014. [20] A. Bihorac, T.O. Baslanti, A.G. Cuenca, C.E. Hobson, D. Ang, P.A. Efron, R.V. Maier, F.A. Moore, L.L. Moldawer, Acute kidney injury is associated with early cytokine changes after trauma, J. Trauma Acute Care Surg. 74 (4) (2013) 1005–1013, https://doi.org/10.1097/TA.0b013e31828586ec. [21] N. Ahuja, A. Andres-Hernando, C. Altmann, R. Bhargava, J. Bacalja, R.G. Webb, Z. He, C.L. Edelstein, S. Faubel, Circulating IL-6 mediates lung injury via CXCL1 production after acute kidney injury in mice, Am. J. Physiol. Renal Physiol. 303 (6) (2012) F864–872, https://doi.org/10.1152/ajprenal.00025.2012. [22] J.T. He, H.Y. Huang, D. Qu, Y. Xue, K.K. Zhang, X.L. Xie, Q. Wang, CXCL1 and CXCR2 as potential markers for vital reactions in skin contusions, Forensic Sci. Med. Pathol. 14 (2) (2018) 174–179, https://doi.org/10.1007/s12024-018-9969-7. [23] W.B. Fang, B. Mafuvadze, M. Yao, A. Zou, M. Portsche, N. Cheng, TGF-beta negatively regulates CXCL1 chemokine expression in mammary fibroblasts through enhancement of Smad2/3 and suppression of HGF/c-Met signaling mechanisms,

5. Conclusion Here we demonstrate a role for the chemokine CXCL1 and its receptor CXCR2 in pathologic process of cisplatin-induced AKI. Signaling through CXCR2, CXCL1 induced renal damage and a burst of inflammation. Inhibition of CXCL1-CXCR2 axis in cisplatin-induced AKI protects against acute injury as judged by reduced pro-inflammatory cytokines and neutrophils, which is modified through p38 and NF-κB signaling in vitro and in vivo. The CXCR2 inhibitor repertaxin is being studied in clinical trials in other settings. Thus, CXCR2 inhibition may be a useful therapeutic target in patients at risk for cisplatin-induced AKI. Data availability The data used to support the findings of this study are available from the corresponding author upon request. Ethical approval Our experiments have abided by the statement of ethical standards for manuscripts submitted to CYTOKINE. Authors’ contributions Zhaojun Xu designed the experiments. Peng Liu performed data collection and analysis, and drafted the manuscript. Xinxiu Li carried out the animal experiments. Weixing Lv provided critical suggestions to the data analysis and helped to do cellular experiments. All authors read and approved the final manuscript. Declaration of Competing Interest The authors have no conflict of interest. Acknowledgments The data used to support the findings of this study are included within the article. Our research was supported by the Zhejiang Medical Science and Technology Research Foundation, China(Grant No.2019KY588). References [1] E.J. See, K. Jayasinghe, N. Glassford, M. Bailey, D.W. Johnson, K.R. Polkinghorne, N.D. Toussaint, R. Bellomo, Long-term risk of adverse outcomes after acute kidney injury: a systematic review and meta-analysis of cohort studies using consensus definitions of exposure, Kidney Int. 95 (1) (2019) 160–172, https://doi.org/10.

9

Biomedicine & Pharmacotherapy 122 (2020) 109693

P. Liu, et al.

[24]

[25]

[26]

[27] [28]

[29]

[30] [31]

[32]

[33]

[34]

[35]

[36]

[37]

[38]

[39]

[40] [41]

[42]

[43]

[44] [45]

[46] [47]

[48]

[49] M. Haq, J. Norman, S.R. Saba, G. Ramirez, H. Rabb, Role of IL-1 in renal ischemic reperfusion injury, J. Am. Soc. Nephrol. 9 (4) (1998) 614–619. [50] Z. He, B. Dursun, D.J. Oh, L. Lu, S. Faubel, C.L. Edelstein, Macrophages are not the source of injurious interleukin-18 in ischemic acute kidney injury in mice, American journal of physiology, Ren. Physiol. 296 (3) (2009) F535–42, https://doi.org/10. 1152/ajprenal.90634.2008. [51] M. Miura, X. Fu, Q.W. Zhang, D.G. Remick, R.L. Fairchild, Neutralization of Gro alpha and macrophage inflammatory protein-2 attenuates renal ischemia/reperfusion injury, Am. J. Pathol. 159 (6) (2001) 2137–2145. [52] D. Cugini, N. Azzollini, E. Gagliardini, P. Cassis, R. Bertini, F. Colotta, M. Noris, G. Remuzzi, A. Benigni, Inhibition of the chemokine receptor CXCR2 prevents kidney graft function deterioration due to ischemia/reperfusion, Kidney Int. 67 (5) (2005) 1753–1761, https://doi.org/10.1111/j.1523-1755.2005.00272.x. [53] J. Deng, Y. Kohda, H. Chiao, Y. Wang, X. Hu, S.M. Hewitt, T. Miyaji, P. McLeroy, B. Nibhanupudy, S. Li, R.A. Star, Interleukin-10 inhibits ischemic and cisplatininduced acute renal injury, Kidney Int. 60 (6) (2001) 2118–2128, https://doi.org/ 10.1046/j.1523-1755.2001.00043.x. [54] B. Zhang, G. Ramesh, S. Uematsu, S. Akira, W.B. Reeves, TLR4 signaling mediates inflammation and tissue injury in nephrotoxicity, J. Am. Soc. Nephrol. 19 (5) (2008) 923–932, https://doi.org/10.1681/ASN.2007090982. [55] J.E. McDuffie, M. Sablad, J. Ma, S. Snook, Urinary parameters predictive of cisplatin-induced acute renal injury in dogs, Cytokine 52 (3) (2010) 156–162, https:// doi.org/10.1016/j.cyto.2010.06.005. [56] A. Akcay, Q. Nguyen, Z. He, K. Turkmen, D. Won Lee, A.A. Hernando, C. Altmann, A. Toker, A. Pacic, D.G. Ljubanovic, A. Jani, S. Faubel, C.L. Edelstein, IL-33 exacerbates acute kidney injury, J. Am. Soc. Nephrol. 22 (11) (2011) 2057–2067, https://doi.org/10.1681/ASN.2010091011. [57] Z.B. Levashova, N. Sharma, O.A. Timofeeva, J.S. Dome, A.O. Perantoni, ELR+-CXC chemokines and their receptors in early metanephric development, J. Am. Soc. Nephrol. 18 (8) (2007) 2359–2370, https://doi.org/10.1681/asn.2006040380. [58] R. Stillie, S.M. Farooq, J.R. Gordon, A.W. Stadnyk, The functional significance behind expressing two IL-8 receptor types on PMN, J. Leukoc. Biol. 86 (3) (2009) 529–543, https://doi.org/10.1189/jlb.0208125. [59] T. Semba, M. Nishimura, S. Nishimura, O. Ohara, T. Ishige, S. Ohno, K. Nonaka, K. Sogawa, M. Satoh, S. Sawai, K. Matsushita, F. Imazeki, O. Yokosuka, F. Nomura, The FLS (fatty liver Shionogi) mouse reveals local expressions of lipocalin-2, CXCL1 and CXCL9 in the liver with non-alcoholic steatohepatitis, BMC Gastroenterol. 13 (2013) 120, https://doi.org/10.1186/1471-230X-13-120. [60] L. Seifert, G. Werba, S. Tiwari, N.N. Giao Ly, S. Alothman, D. Alqunaibit, A. Avanzi, R. Barilla, D. Daley, S.H. Greco, A. Torres-Hernandez, M. Pergamo, A. Ochi, C.P. Zambirinis, M. Pansari, M. Rendon, D. Tippens, M. Hundeyin, V.R. Mani, C. Hajdu, D. Engle, G. Miller, The necrosome promotes pancreatic oncogenesis via CXCL1 and Mincle-induced immune suppression, Nature 532 (7598) (2016) 245–249, https://doi.org/10.1038/nature17403. [61] H.H. Tsai, E. Frost, V. To, S. Robinson, C. Ffrench-Constant, R. Geertman, R.M. Ransohoff, R.H. Miller, The chemokine receptor CXCR2 controls positioning of oligodendrocyte precursors in developing spinal cord by arresting their migration, Cell 110 (3) (2002) 373–383. [62] T. Zhang, C. Tseng, Y. Zhang, O. Sirin, P.G. Corn, E.M. Li-Ning-Tapia, P. Troncoso, J. Davis, C. Pettaway, J. Ward, M.L. Frazier, C. Logothetis, M.G. Kolonin, CXCL1 mediates obesity-associated adipose stromal cell trafficking and function in the tumour microenvironment, Nat. Commun. 7 (2016) 11674, https://doi.org/10. 1038/ncomms11674. [63] K. Miyamoto, K. Ninomiya, K.H. Sonoda, Y. Miyauchi, H. Hoshi, R. Iwasaki, H. Miyamoto, S. Yoshida, Y. Sato, H. Morioka, K. Chiba, K. Egashira, T. Suda, Y. Toyama, T. Miyamoto, MCP-1 expressed by osteoclasts stimulates osteoclastogenesis in an autocrine/paracrine manner, Biochem. Biophys. Res. Commun. 383 (3) (2009) 373–377, https://doi.org/10.1016/j.bbrc.2009.04.020. [64] S.K. Jo, S.A. Sung, W.Y. Cho, K.J. Go, H.K. Kim, Macrophages contribute to the initiation of ischaemic acute renal failure in rats, Nephrol. Dial. Transplant. 21 (5) (2006) 1231–1239, https://doi.org/10.1093/ndt/gfk047. [65] A.O. Kittang, K. Hatfield, K. Sand, H. Reikvam, O. Bruserud, The chemokine network in acute myelogenous leukemia: molecular mechanisms involved in leukemogenesis and therapeutic implications, Curr. Top. Microbiol. Immunol. 341 (2010) 149–172, https://doi.org/10.1007/82_2010_25. [66] R.R. Ji, Z.Z. Xu, Y.J. Gao, Emerging targets in neuroinflammation-driven chronic pain, Nat. Rev. Drug Discov. 13 (7) (2014) 533–548, https://doi.org/10.1038/ nrd4334. [67] A. Akcay, Q. Nguyen, C.L. Edelstein, Mediators of inflammation in acute kidney injury, Mediators Inflamm. 2009 (2009) 1–12, https://doi.org/10.1155/2009/ 137072. [68] A.K. Sahu, V.K. Verma, E. Mutneja, S. Malik, T.C. Nag, A.K. Dinda, D.S. Arya, J. Bhatia, Mangiferin attenuates cisplatin-induced acute kidney injury in rats mediating modulation of MAPK pathway, Mol. Cell. Biochem. 452 (1-2) (2019) 141–152, https://doi.org/10.1007/s11010-018-3420-y. [69] G. Ramesh, W.B. Reeves, p38 MAP kinase inhibition ameliorates cisplatin nephrotoxicity in mice, Am. J. Physiol. Renal Physiol. 289 (1) (2005) F166–74, https://doi.org/10.1152/ajprenal.00401.2004. [70] W. Zhang, J. Hou, X. Yan, J. Leng, R. Li, J. Zhang, J. Xing, C. Chen, Z. Wang, W. Li, Platycodon grandiflorum saponins ameliorate cisplatin-induced acute nephrotoxicity through the NF-kappaB-Mediated inflammation and PI3K/Akt/ Apoptosis signaling pathways, Nutrients 10 (9) (2018), https://doi.org/10.3390/ nu10091328. [71] G. Benedetti, L. Fredriksson, B. Herpers, J. Meerman, B. van de Water, M. de Graauw, TNF-alpha-mediated NF-kappaB survival signaling impairment by cisplatin enhances JNK activation allowing synergistic apoptosis of renal proximal

PLoS One 10 (8) (2015) e0135063, , https://doi.org/10.1371/journal.pone. 0135063. M. Miyake, S. Goodison, V. Urquidi, E. Gomes Giacoia, C.J. Rosser, Expression of CXCL1 in human endothelial cells induces angiogenesis through the CXCR2 receptor and the ERK1/2 and EGF pathways, Lab. Invest. 93 (7) (2013) 768–778, https://doi.org/10.1038/labinvest.2013.71. H. Ni, Y. Wang, K. An, Q. Liu, L. Xu, C. Zhu, H. Deng, Q. He, T. Wang, M. Xu, Y. Zheng, B. Huang, J. Fang, M. Yao, Crosstalk between NFkappaB-dependent astrocytic CXCL1 and neuron CXCR2 plays a role in descending pain facilitation, J. Neuroinflammation 16 (1) (2019) 1, https://doi.org/10.1186/s12974-018-1391-2. J.W. Griffith, C.L. Sokol, A.D. Luster, Chemokines and chemokine receptors: positioning cells for host defense and immunity, Annu. Rev. Immunol. 32 (2014) 659–702, https://doi.org/10.1146/annurev-immunol-032713-120145. P. Dhawan, A. Richmond, Role of CXCL1 in tumorigenesis of melanoma, J. Leukoc. Biol. 72 (1) (2002) 9–18. S. Acharyya, T. Oskarsson, S. Vanharanta, S. Malladi, J. Kim, P.G. Morris, K. Manova-Todorova, M. Leversha, N. Hogg, V.E. Seshan, L. Norton, E. Brogi, J. Massague, A CXCL1 paracrine network links cancer chemoresistance and metastasis, Cell 150 (1) (2012) 165–178, https://doi.org/10.1016/j.cell.2012.04.042. M. Baggiolini, P. Imboden, P. Detmers, Neutrophil activation and the effects of interleukin-8/neutrophil-activating peptide 1 (IL-8/NAP-1), Cytokines 4 (1992) 1–17. M. Baggiolini, Chemokines and leukocyte traffic, Nature 392 (6676) (1998) 565–568, https://doi.org/10.1038/33340. J.M. Thurman, A.M. Lenderink, P.A. Royer, K.E. Coleman, J. Zhou, J.D. Lambris, R.A. Nemenoff, R.J. Quigg, V.M. Holers, C3a is required for the production of CXC chemokines by tubular epithelial cells after renal Ishemia/Reperfusion, J. Immunol. 178 (3) (2007) 1819–1828, https://doi.org/10.4049/jimmunol.178.3.1819. A. Akcay, Q. Nguyen, Z. He, K. Turkmen, D. Won Lee, A.A. Hernando, C. Altmann, A. Toker, A. Pacic, D.G. Ljubanovic, A. Jani, S. Faubel, C.L. Edelstein, IL-33 exacerbates acute kidney injury, J. Am. Soc. Nephrol. 22 (11) (2011) 2057–2067, https://doi.org/10.1681/asn.2010091011. B. Sharma, M.L. Varney, S. Saxena, L. Wu, R.K. Singh, Induction of CXCR2 ligands, stem cell-like phenotype, and metastasis in chemotherapy-resistant breast cancer cells, Cancer Lett. 372 (2) (2016) 192–200, https://doi.org/10.1016/j.canlet.2015. 12.011. M.M. Yung, H.W. Tang, P.C. Cai, T.H. Leung, S.F. Ngu, K.K. Chan, D. Xu, H. Yang, H.Y. Ngan, D.W. Chan, GRO-alpha and IL-8 enhance ovarian cancer metastatic potential via the CXCR2-mediated TAK1/NFkappaB signaling cascade, Theranostics 8 (5) (2018) 1270–1285, https://doi.org/10.7150/thno.22536. T. Girbl, T. Lenn, L. Perez, L. Rolas, A. Barkaway, A. Thiriot, C. Del Fresno, E. Lynam, E. Hub, M. Thelen, G. Graham, R. Alon, D. Sancho, U.H. von Andrian, M.B. Voisin, A. Rot, S. Nourshargh, Distinct compartmentalization of the chemokines CXCL1 and CXCL2 and the atypical receptor ACKR1 determine discrete stages of neutrophil diapedesis, Immunity 49 (6) (2018) 1062–1076, https://doi.org/10. 1016/j.immuni.2018.09.018 e6. S. Roy, S. Roy, M. Kar, S. Thakur, Y. Akhter, A. Kumar, F. Delogu, S. Padhi, A. Saha, B. Banerjee, p38 MAPK pathway and its interaction with TRF2 in cisplatin induced chemotherapeutic response in head and neck cancer, Oncogenesis 7 (7) (2018) 53, https://doi.org/10.1038/s41389-018-0062-6. L. Zhang, X. Yang, X. Li, C. Li, L. Zhao, Y. Zhou, H. Hou, Butein sensitizes HeLa cells to cisplatin through the AKT and ERK/p38 MAPK pathways by targeting FoxO3a, Int. J. Mol. Med. 36 (4) (2015) 957–966, https://doi.org/10.3892/ijmm.2015. 2324. W.S. Kim, H. Kim, K.W. Kwon, S.H. Im, B.R. Lee, S.J. Ha, S.J. Shin, Cisplatin induces tolerogenic dendritic cells in response to TLR agonists via the abundant production of IL-10, thereby promoting Th2- and Tr1-biased T-cell immunity, Oncotarget 7 (23) (2016) 33765–33782, https://doi.org/10.18632/oncotarget.9260. R. Oun, Y.E. Moussa, N.J. Wheate, The side effects of platinum-based chemotherapy drugs: a review for chemists, Dalton Trans. 47 (19) (2018) 6645–6653, https://doi. org/10.1039/c8dt00838h. R. Tadagavadi, W.B. Reeves, Neutrophils in cisplatin AKI-mediator or marker? Kidney Int. 92 (1) (2017) 11–13, https://doi.org/10.1016/j.kint.2017.03.023. G. Ramesh, W.B. Reeves, TNFR2-mediated apoptosis and necrosis in cisplatin-induced acute renal failure, Am. J. Physiol. Renal Physiol. 285 (4) (2003) F610–8, https://doi.org/10.1152/ajprenal.00101.2003. G. Ramesh, W.B. Reeves, TNF-alpha mediates chemokine and cytokine expression and renal injury in cisplatin nephrotoxicity, J. Clin. Invest. 110 (6) (2002) 835–842, https://doi.org/10.1172/JCI15606. A.M. Florea, D. Busselberg, Cisplatin as an anti-tumor drug: cellular mechanisms of activity, drug resistance and induced side effects, Cancers (Basel) 3 (1) (2011) 1351–1371, https://doi.org/10.3390/cancers3011351. G.P. Kaushal, S.V. Shah, Autophagy in acute kidney injury, Kidney Int. 89 (4) (2016) 779–791, https://doi.org/10.1016/j.kint.2015.11.021. D.A. Ferenbach, J.V. Bonventre, Mechanisms of maladaptive repair after AKI leading to accelerated kidney ageing and CKD, Nat. Rev. Nephrol. 11 (5) (2015) 264–276, https://doi.org/10.1038/nrneph.2015.3. J.J. Friedewald, H. Rabb, Inflammatory cells in ischemic acute renal failure, Kidney Int. 66 (2) (2004) 486–491, https://doi.org/10.1111/j.1523-1755.2004.761_3.x. J.V. Bonventre, A. Zuk, Ischemic acute renal failure: an inflammatory disease? Kidney Int. 66 (2) (2004) 480–485, https://doi.org/10.1111/j.1523-1755.2004. 761_2.x. B. Dursun, Z. He, H. Somerset, D.J. Oh, S. Faubel, C.L. Edelstein, Caspases and calpain are independent mediators of cisplatin-induced endothelial cell necrosis, Am. J. Physiol. Renal Physiol. 291 (3) (2006) F578–87, https://doi.org/10.1152/ ajprenal.00455.2005.

10

Biomedicine & Pharmacotherapy 122 (2020) 109693

P. Liu, et al.

M. Fumagalli, M. Da Costa, C. Brown, N. Popov, Y. Takatsu, J. Melamed, F. d’Adda di Fagagna, D. Bernard, E. Hernando, J. Gil, Chemokine signaling via the CXCR2 receptor reinforces senescence, Cell 133 (6) (2008) 1006–1018, https://doi.org/10. 1016/j.cell.2008.03.038. [74] D. Cao, F. Ma, S. Ouyang, Z. Liu, Y. Li, J. Wu, Effects of macrophages and CXCR2 on adipogenic differentiation of bone marrow mesenchymal stem cells, J. Cell. Physiol. 234 (6) (2019) 9475–9485, https://doi.org/10.1002/jcp.27634.

tubular cells, Biochem. Pharmacol. 85 (2) (2013) 274–286, https://doi.org/10. 1016/j.bcp.2012.10.012. [72] H.L. Rittner, D. Labuz, J.F. Richter, A. Brack, M. Schafer, C. Stein, S.A. Mousa, CXCR1/2 ligands induce p38 MAPK-dependent translocation and release of opioid peptides from primary granules in vitro and in vivo, Brain Behav. Immun. 21 (8) (2007) 1021–1032, https://doi.org/10.1016/j.bbi.2007.05.002. [73] J.C. Acosta, A. O’Loghlen, A. Banito, M.V. Guijarro, A. Augert, S. Raguz,

11