- Email: [email protected]
Inhibition of in vitro VEGF expression and choroidal neovascularization by synthetic dendrimer peptide mediated delivery of a sense oligonucleotide
Experimental Eye Research 79 (2004) 525–535 www.elsevier.com/locate/yexer
Inhibition of in vitro VEGF expression and choroidal neovascularization by synthetic dendrimer peptide mediated delivery of a sense oligonucleotide Robert J. Maranoa, Norbert Wimmerb, Philip S. Kearnsb, Bradley G. Thomasb, Istvan Tothb, Meliha Brankova, P. Elizabeth Rakoczya,* a
Centre for Ophthalmology and Visual Science, Lions Eye Institute, University of Western Australia, 2 Verdun Street, Nedlands, WA 6009, Australia b School of Pharmacy, The University of Queensland, Steele Building, St. Lucia, QLD 4072, Australia Received 14 October 2003; accepted in revised form 22 June 2004 Available online 14 August 2004
Abstract Ocular neovascularisation is the leading cause of blindness in developed countries and the most potent angiogenic factor associated with neovascularisation is vascular endothelial growth factor (VEGF). We have previously described a sense oligonucleotide (ODN-1) that possesses anti-human and rat VEGF activity. This paper describes the synthesis of lipid–lysine dendrimers and their subsequent ability to delivery ODN-1 to its target and mediate a reduction in VEGF concentration both in vitro and in vivo. Positively charged dendrimers were used to deliver ODN-1 into the nucleus of cultured D407 cells. The effects on VEGF mRNA transcription and protein expression were analysed using RT-PCR and ELISA, respectively. The most effective dendrimers in vitro were further investigated in vivo using an animal model of choroidal neovascularisation (CNV). All dendrimer/ODN-1 complexes mediated in a significant reduction in VEGF expression during an initial 24 hr period (40–60%). Several complexes maintained this level of VEGF reduction during a subsequent, second 24 hr period, which indicated protection of ODN-1 from the effects of endogenous nucleases. In addition, the transfection efficiency of dendrimers that possessed 8 positive charges (xZ81$51%) was significantly better (PZ0$0036) than those that possessed 4 positive charges (xZ 56$8%). RT-PCR revealed a correlation between levels of VEGF protein mRNA. These results indicated that the most effective structural combination was three branched chains of intermediate length with 8 positive charges such as that found for dendrimer 4. Dendrimer 4 and 7/ODN-1 complexes were subsequently chosen for in vivo analysis. Fluorescein angiography demonstrated that both dendrimers significantly (P!0$0001) reduced the severity of laser mediated CNV for up to two months post-injection. This study demonstrated that lipophilic, charged dendrimer mediated delivery of ODN-1 resulted in the down-regulation of in vitro VEGF expression. In addition, in vivo delivery of ODN-1 by two of the dendrimers resulted in significant inhibition of CNV in an inducible rat model. Time course studies showed that the dendrimer/ODN-1 complexes remained active for up to two months indicating the dendrimer compounds provided protection against the effects of nucleases. q 2004 Elsevier Ltd. All rights reserved. Keywords: VEGF; dendrimer; oligonucleotide; lipidic polyamide; lipoamino acids; cationic lipids; choroid; laser photocoagulation; transfection
1. Introduction The formation of new blood vessels (neovascularization) is essential for normal eye development; however, in severe * Corresponding author. Dr P. Elizabeth Rakoczy, Department of Molecular Ophthalmology, Lions Eye Institute, University of Western Australia, 2 Verdun Street, Nedlands, Perth, WA 6009 Australia. E-mail address: [email protected] (P.E. Rakoczy). 0014-4835/$ - see front matter q 2004 Elsevier Ltd. All rights reserved. DOI:10.1016/j.exer.2004.06.023
ocular diseases, like age-related macular degeneration (AMD) and diabetic retinopathy, this process is uncontrolled. In developed countries AMD is the most common cause of blindness in patients over 60 years of age (Leibowitz et al., 1980; Sommer et al., 1991). One of the main angiogenic factors involved in intraocular neovascularization is vascular endothelial growth factor (VEGF), a protein that is secreted by retinal pigment epithelial (RPE) cells under both physiological and pathological conditions
526
R.J. Marano et al. / Experimental Eye Research 79 (2004) 525–535
(Adamis et al., 1994; Aiello et al., 1995; Kvanta et al., 1996). Under hypoxic conditions, the expression of VEGF is regulated by hypoxia-inducible factor 1 (HIF-1), which binds to the hypoxia response element on the VEGF promoter (Forsythe et al., 1996). HIF-1 is also functions to stabilise VEGF mRNA by binding to sites on both the 5 0 and 3 0 untranslated region (UTR) resulting in greater amounts of VEGF expression (Levy et al., 1997; Liu et al., 2002). In addition, it has been postulated that during periods of cellular starvation, internal ribosomal entry sites (IRES) located on the 5 0 UTR facilitate the continued expression of VEGF by allowing ribosomal binding without involving the 5 0 cap (Miller et al., 1998). Recently, we reported the use of a particular oligonucleotide: (ODN-1: GAGCCGGAGAGGGAGCGCGA) that targets the 5 0 UTR of the VEGF operon to inhibit choroidal neovascularization (CNV) in an animal model (Garrett et al., 2001). However, if this oligonucleotide is to be used as a therapeutic agent, delivery efficacy must be maximized. The formation of complexes between ODN’s and cationic lipids, called lipoplexes, is the most common strategy used to enhance gene delivery. These lipoplexes are positively charged and have a high affinity for cell membranes, which are negatively charged under physiological conditions, and enter cells by adsorptive endocytosis (Akhtar et al., 2000). Many commercial transfection agents contain a helper lipid, such as dioelylphosphatidylethanolamine (DOPE) to aid in the release of the ODNs from the endosomal/lysosomal compartments. Studies have shown that once internalized within the cell or nucleus the lipoplexes dissociate (Alahari et al., 1996; Abe et al., 1998). As a consequence of this, it is necessary to protect the ODNs from the effects of nucleases. This may be achieved by the replacement of the phosphodiester backbone of ODN with a phoshorothioate (S) backbone (Crooke, 1993; Stein and Cheng, 1993). However, S-oligonucleotides form poor hybrids with the target mRNA and inhibit several non-related cellular enzymes (Stein and Cheng, 1993). We have designed and developed lipid–lysine dendrimers in an attempt to improve the delivery of the P form of ODN-1 into the nuclei of retinal cells (Wimmer et al., 2002). These dendrimers contain a tail of lipidic a-aminocarboxylic acids (Laas) and a poly-lysine head, and are, therefore, amphiphilic. Laas, their homo-oligomers and lipidic peptides represent a class of compounds that combines the structural features of lipids with those of amino acids (Shah et al., 2000). These lipid–lysine dendrimers facilitate transmembrane transportation, act as lipid solubilizers and protect the labile DNA from nuclease digestion. In this study, we have tested the effectiveness of synthetic lipid–lysine dendrimers to deliver ODN-1 into cultured D407 cells and mediate a reduction of VEGF expression. Based upon the outcome of the in vitro study, the most effective dendrimer/ODN-1 complexes were chosen for in vivo analysis. Using a laser induced rat model of CNV, we examined the anti-angiogenic effect
and longevity of a dendrimer mediated delivery of ODN-1 into retinal cells by intravitreal injection.
2. Materials and methods 2.1. Dendrimers and oligonucleotide 2-Aminododecanoic acid (C12 Laa), 2-aminotetradecanoic acid (C14 Laa) and 2-aminooctadecanoic acid (C18 Laa), and their Boc-protected analogues, were synthesised using previously described methods (Gibbons et al., 1990). Standard solid-phase synthetic methods were used (Merrifield, 1963) and dendrimers 1–9 were synthesised by varying the length and number of the lipid residues, and the number of free amino functions on the poly-lysine head (Fig. 1 and Table 1). The general experimental procedure for the synthesis of compounds 1–9 was: MBHA resin [4-methyl benzhydrylamine, substitution ratio, 0$62 mmol/g, 1 g resin (0$62 mmol) for 1–5 and 500 mg resin (0$31 mmol) for 6–9] was placed in a sintered glass peptide synthesis vessel and allowed to swell DMF for 90 min. A mixture containing the Boc-protected amino acid (3 eq), HBTU (2-(1H benzotriazole-1-yl)-1,3,3-tetramethyluronium hexafluoro phosphate, 0$5 M in DMF, 3 eq) and DIEA (0$442 ml for peptides 1–5, 0$221 ml for peptides 6–9, 4 eq) was then added to the resin and shaken for 12 min. The progress of the reaction was monitored by a qualitative ninhydrin assay. A negative ninhydrin reaction showed nearly quantitative coupling (R99$98%) after a single coupling reaction. The Boc-protecting group was then removed using neat TFA. The resin was washed intensively with DMF after all manipulations. All other coupling reactions and deprotections were done in an analogous manner. After the last coupling the terminal Boc group was removed and the resin was washed with DMF, DCM and methanol, respectively. The resin was then dried to a constant weight over KOH under vacuum. The peptide was cleaved from the resin using the high HF method. The cleaved peptide was precipitated by diethyl ether, re-dissolved in 2$5% aqueous acetic acid and lyophilised to afford an amorphous powder.
Fig. 1. Chemical structure of dendrimers 1–9 illustrating their respective side chains. 1, R1ZC10H21, R2ZNH2, nZ2; 2, R1ZC10H21, R2ZLys(NH2)2, nZ2; 3, R1ZC10H21, R2ZLys-(NH2)2, nZ3; 4, R1ZC12H25, R2ZLys-(NH2)2, nZ2; 5, R1ZC12H25, R2ZLys-(NH2)2, nZ3; 6, R1Z C12H25, R2ZNH2, nZ3; 7, R1ZC16H33, R2ZNH2, nZ2; 8, R1ZC16H33, R2ZLys-(NH2)2, nZ2; 9, R1ZC16H33, R2ZLys-(NH2)2, nZ3.
R.J. Marano et al. / Experimental Eye Research 79 (2004) 525–535
527
Table 1 Chemical and analytical data of the dendrimers Dendrimer
Formula
Mass
MS (m/z)
Laaa
Number of Laas
Positive Charges
Yield (%)
1 2 3 4 5 6 7 8 9
C44H89O6N10 C68H137O10N18 C80H160O11N19 C72H145O10N18 C86H172O11N19 C62H123O7N11 C56H112O6N10 C80H161O10N18 C98H196O11N19
854$20 1366$08 1563$25 1422$14 1648$58 1135$0 1021$78 1535$6 1817$1
853$8 (zZ1), 427$4 (zZ2), 285$4 (zZ3) 683$8 (zZ2), 456$2 (zZ3), 342$4 (zZ4) 782$6 (zZ2), 522$0 (zZ3), 391$8 (zZ4) 711$8 (zZ2), 474$8 (zZ3), 356$4 (zZ4) 1648$8 (zZ1), 825$0 (zZ2), 550$2 (zZ3) 1135$4 (zZ1), 568$2 (zZ2), 1022$2 (zZ1), 512$0 (zZ2), 768$2 (zZ2), 512$4 (zZ3) 908$8(zZ2), 606$6 (zZ3)
C12 C12 C12 C14 C14 C14 C18 C18 C18
2 2 3 2 3 3 2 2 3
4 8 8 8 8 4 4 8 8
81 75 70 76 75 73 55 60 47
a
C12 Laa, 2-aminododecanoic acid; C14 Laa, 2-aminotetradecanoic acid; C18 Laa, 2-amino octadecanoic acid.
Analytical RP-HPLC was performed on a Shimadzu instrument that was controlled using a SCL-10A system controller, the solvent was delivered by a LC-10AT liquid chromatograph pump, and detection was performed using a SPD-6A UV detector; samples were introduced using a SIL-6B auto injector; separations were performed on 25 cm!4$6 mm, 5 hm pore size Vydac C4 or C18 columns. Preparative chromatography of the crude peptides (1–9, 100 mg) was performed using a Waters HPLC system; the system was controlled with a Model 600 controller; solvent was delivered with a 600F pump; detection was done using a 490E UV-visible detector; and separations were performed on either a TSK-GEL C4 or C18 column with 10 hm particle size and 2$5 cm internal diameter, using an acetonitrile/water gradient. The fractions collected were characterised by positive-ion electrospray-MS (Perkin Elmer API 3000 instrument). The resulting peptide was used as diastereomeric mixture. 2.2. Complex formation To prepare complexes with the required molar charge ratio, ODN-1 (0$5 mg mlK1) was added to each dendrimer (1$5 mg mlK1) mixed for 15 min, diluted with 250 ml sterile water and lyophilised. Isothermal titration calorimetry experiments (Freire et al., 1990; Tame et al., 1998; Lobo et al., 2001) were performed in a MicroCal VP-ITC microcalorimeter at 308C to determine the optimal conjugation ratio between the cationic dendrimers and ODN-1. ODN-1 and the dendrimers were dissolved in 10 mM PBS, and the oligonucleotide (2 mM) was placed in the sample cell and the dendrimer (243 mM) was placed in the syringe. The dendrimer was then added to the oligonucleotide solution as 25!4 ml injections, each injection was 4 min apart. Complex formation was considered complete when no further release of heat was observed. 2.3. Cell culture and transfection The human RPE cell line, D407, was cultured in Dulbeco’s Modified Eagles Medium (DMEM) supplemented
with 10% foetal bovine serum (FBS). Cells were maintained at 378C in a humidified atmosphere in 5% CO2 in 25 ml tissue culture vessels and passaged when cell density reached 70–80% confluency. For transfection studies, the cells were seeded equally into 24-well plates and grown overnight under the same conditions in DMEM–FBS. The oligonucleotide–peptide complexes were reconstituted in sterile double-distilled H2O to a final concentration of 50 mM, relative to the concentration of the oligonucleotide. P-ODN-1 was complexed to the transfection agent cytofectine (Glen Scientific) as per the manufactures instructions and used as a standard. The complexes were then added to pre-warmed DMEM-FBS (3 ml) to a final concentration of 0$5 mM (1 in 100 dilution). The overnight growth media was aspirated from the each well and replaced with 700 ml of media containing the dendrimer/ODN-1 complexes. The transfection of each complex was performed in quadruplet sets for statistical analysis. Following the addition of the complexes, the cells were further incubated at 378C under hypoxic conditions (2% O2, 5% CO2) to induce hyper-expression of VEGF. At 24 hr posttransfection the media from each well was removed to a microfuge tube and replaced with 700 ml of fresh DMEMFBS and incubated under hypoxic conditions for a further 24 hr at which time the media was again removed to a microfuge tube for ELISA and protein concentration assays. Transfection efficiencies of dendrimers with different positive charges were determined by transfecting with dendrimers 1–9 conjugated to ODN-1 possessing a 5 0 fluorescein tag. Cells were incubated for 24 hr at 378C under 5% CO2. After this time the cells were removed from the culture vessel by trypsinisation and pelleted by centrifugation at 2000g for 5 min. The growth media was aspirated and the cell pellet was resuspended gently in 200 ml of PBS. The number of transfected cells was then counted by fluorescent activated cell sorting (FACS) on a FACS calibur cell counter (ABI systems, USA) for 3 independent samples. The means and standard deviations were calculated and the results statistically analysed using a Student’s t-test. Controls consisting of cells transfected with dendrimer alone, at a concentration equal to that used in the VEGF
528
R.J. Marano et al. / Experimental Eye Research 79 (2004) 525–535
reduction study, were prepared to investigate the toxicity and or placebo effects of the dendrimers. The incubation times and temperatures were identical to those of the dendrimer/ODN-1 transfected cells. 2.4. VEGF Elisa and protein assay CYTELISAe human VEGF ELISA plates (CYTIMMUNE, MD, USA) were used to determine the concentration of VEGF in the growth media. For each sample, 500 ml of media was concentrated by filtration through a microconw YM-30 protein concentrator (Millipore, USA) to a final volume of 10 ml. The volume was adjusted to 110 ml and 100 ml was used in the ELISA, which was performed as per the manufactures instructions and the results were read using a Spectramax 250 microplate spectrophotometer (Molecular Devices, Sunnyvale, CA, USA). The remaining 10 ml of concentrated media was used to determine the total protein concentration using a modified Bradfords method (Micro BCAw Protein Assay Reagent Kit, Pierce, Rockford, IL, USA) as per manufactures instructions. The concentration of VEGF was normalised against the total protein concentration and the results tabulated. Statistical analysis was performed using a one-way ANOVA with a post-hoc Tukey’s test with 95% confidence limits. 2.5. Quantitative PCR Representatives of the various dendrimer chain lengths (12, 14, and 18 amino acids) and charge ratio’s (4C and 8C) were chosen for real time quantitative PCR (RT-PCR) analysis and consisted of dendrimer complexes 1, 4, 6, and 7. Cells were grown and transfected as described previously, however, 24 hr post-transfection the cells were harvested by trypsinization to detach them from the culture vessel. The cell suspensions were centrifuged at 2000 g to form pellets and the total mRNA was extracted using a QIAGEN mRNA extraction kit. Single stranded cDNA was created using Omniscripte reverse transcriptase as per the manufactures instructions (QIAGEN). This was used as a template in a real time (RT) PCR reaction using a Rotor-Gene thermocycler (Corbett Research, Australia), human VEGF specific primers (accession #: AY047581; 5 0 : 369–388, 3 0 : 459–443) and the stain SYBR green I. A standard curve derived from the serial dilution of a single stranded synthetic DNA standard designed to represent the 96 bp fragment of VEGF was used to obtain relative quantisation data. The cDNA was amplified in a 20 ml volume reaction using AmpliTaq Gold PCR master-mix (Applied Biosystems, Roche, USA) with primers at 1 hmol mlK1 under the following thermocycling conditions: 10 min activation at 958C followed by 45 cycles of 958C for 15 sec, 558C for 15 sec and 728C for 15 sec. This result was normalized against the total concentration of mRNA in each sample.
2.6. Injections All animal experiments were performed in accordance with ARVO Statement of the Use of Animals in Vision and Ophthalmic Research. Pre-injection, animals were anaesthetised with a mixture of ketamine (50 mg kgK1 body weight) and xylazine (8 mg kgK1 body weight). Tears Naturalew (Alcon, Frenches Forrest, NSW, Australia) were applied topically to prevent eyes from drying during the injection process. Two microliters of a 75 mM concentration of the dendrimer/ODN-1 complex (relative to ODN-1) was injected into the vitreous of the right eye of 8 week old pigmented DA rats. In addition, 2 ml of an equivalent amount dendrimer without ODN-1 was injected into the vitreous of the left eye. The injection technique used has been previously described (Garrett et al., 2001). A total of 8 rats were injected for each of the dendrimers to be studied. 2.7. Induction of choroidal neovascularisation (CNV) by krypton laser photocoagulation Rats were divided into 2 groups for laser induction of CNV whereby group 1 was laser ablated 7 days postinjection (dpi) and group 2 were laser ablated 2 months postinjection (mpi). In addition, group 1 consisted of four rats injected using dendrimer 4 and four rats injected using dendrimer 7 while group 2 consisted of dendrimer 4 injected rats only. Rats were anaesthetized and their pupils dilated by the topical application of 1% tropicamide and 2$5% phenylephrine hydrochloride drops. Krypton laser irradiation (647$1 nm, coherent Radiation System, CA, USA) was delivered to both the left dendrimer/ODN-1 injected eye and the contralateral dendrimer without ODN-1 injected eye of each animal through a Zeiss slit lamp with a hand-held coverslip serving as a contact lens. A total of 8–10 laser burns were applied in each eye surrounding the optic nerve at the posterior pole at a setting of 100 mM diameter, 0$1 sec duration and 150 mW intensity. 2.8. Quantitation of choroidal neovascularisation The formation and extent of CNV in the eye using this model was monitored using fluorescein angiography (FA). For group 1 rats, FA was performed 1 week, 21 days, 1 month and 2 months post-lasering. For group 2 rats laser photocoagulated at 2 mpi, FA was performed at 14 and 30 days post-lasering. The animals were injected intraperitoneally with 0$3–0$4 ml of 10% sodium fluorescein and the eyes were photographed using fluorescent fundus photography. Three independent observers using reference angiograms graded the extent of fluorescein leakage for each eye as follows: 0, no leakage observed; 1, slight leakage; 2, moderate leakage; 3, strong leakage. The score for each eye was averaged from the three observations and the score per lesion was calculated for each animal and then averaged to
R.J. Marano et al. / Experimental Eye Research 79 (2004) 525–535
529
obtain a mean score per eye. The mean score between paired dendrimer/ODN-1 complexes and dendrimer without ODN1 were compared by ANOVA with a post-hoc Tukey’s test. Differences were considered significant at P!0$05.
3. Results 3.1. Dendrimer synthesis and complex formation A series of 9 dendrimers were synthesised containing the core structure and functional groups illustrated in Fig. 1. Isothermal titration calorimetry (ITC) performed for a 4C charged (1) and an 8C charged dendrimer (3) are illustrated in Figs. 2(a) and (b), respectively, and show the sequential release of heat (mcal sK1) as the dendrimers were titrated into the ODN-1 solutions. The ITC data indicated that complex formation was complete at a molar ratio (dendrimer:ODN-1) of 10:1 for dendrimer 1 (Fig. 2(a)) and 6:1 for dendrimer 3 (Fig. 2(b)). To examine the reproducibility between the optimal binding ratio and the number of positive charges, another 4 dendrimers (1, 4, 5 and 8) possessing 8C charges were measured. ITC curves for these dendrimers (data not shown) were similar to those of dendrimer 3, which demonstrates a dose reproducible correlation between the number of positive charges and the optimal binding ratio. 3.2. Transfection efficiency The mean percentage of cells transfected by dendrimers that were conjugated to fluorescein tagged ODN-1 was measured using FACS analysis (Fig. 3). Cytofectin, along with dendrimers possessing 8C charges (2, 4, and 9) were able to achieve high levels of transfection (80–100%) while dendrimers possessing 4C charges (1, 7 and 8) achieved moderate levels of transfection (60–80%). Dendrimer 6, which also has 4C charges, gave a relatively low level of transfection of 38% of living cells. The mean transfection percentages between groups of dendrimers that possessed 8C and 4C charges were 81$51 and 56$8%, respectively, which represented a significant (PZ0$0036) difference in transfection efficiencies, which indicates that dendrimers possessing higher charges are more efficient at penetrating the cell membrane.
Fig. 2. Isothermal titration calorimetry (ITC) curves for the titration of ODN-1 with dendrimers 1 (4C charges) (2a) and 3 (8C charges) (2b).
3.3. Regulation of VEGF expression The relative reduction of VEGF expression in transfected D407 cells (compared to a non-transfected control) was measured using ELISA (Fig. 4). Statistical analysis using ANOVA with a post-hoc Tukey’s test revealed VEGF concentrations in cells transfected with unconjugated dendrimers were not significantly different (PO0$05) to non-transfected controls (data not shown). Analysis of VEGF concentrations in cells transfected with cytofectin/ODN-1
and dendrimers 1–9/ODN-1 revealed a significant reduction (P!0$001) in the mean concentration of VEGF in the first 24 hr post-transfection (Fig. 4). However, at 48 hr posttransfection, inhibition of VEGF was not sustained in cells transfected with cytofectin/ODN-1 and dendrimer/ODN-1 complexes 1, 2 and 9 where VEGF concentrations were similar to those of non-transfected controls. Statistical analysis revealed no significant difference between the non-transfected control, cytofectin/ODN-1 (PZ0$9)
530
R.J. Marano et al. / Experimental Eye Research 79 (2004) 525–535
Fig. 3. Comparative transfection efficacies of cytofectin (Cyt) and representative dendrimers containing 4C (1, 6 and 7) and 8C (2, 4, 8 and 9) charges.
and dendrimers 1, 2/ODN-1 (PZ0$92 and PZ1, respectively). Conversely, dendrimer/ODN-1 complexes 3–8 did maintain inhibition of VEGF expression even at 48 hr and no statistically significant increase in the concentration of VEGF was found over the course of the experiment. The quantity of VEGF mRNA transcript was measured using RT-PCR for cells transfected with dendrimers/ODN-1 complexes that possess a range of charge ratio’s, transfection efficacies and protein inhibition abilities and included dendrimer/ODN-1 complexes 1, 4, 6 and 7. Samples of mRNA were successfully extracted from transfected and
non-transfected cells 24 hr post-transfection, and RT-PCR subsequently demonstrated that amount of VEGF mRNA was reduced by 20–50% by the dendrimer/ODN-1 complexes (Fig. 5). Dendrimer 1/ODN-1 resulted in strong inhibition of VEGF protein in the initial 24 hr but this was not reflected by a proportional reduction in the level of mRNA. By contrast, the reduction of mRNA in cells transfected with dendrimer 4/ODN-1 closely paralleled the reduction of VEGF protein expression. This was also seen for dendrimer 6/ODN-1, which mediated a strong reduction in both the levels of VEGF mRNA and protein in contrast to
Fig. 4. Relative reduction of VEGF protein expression by ODN-1 in cultured D407 cells. VEGF concentrations were measured at 24 and 48 hr post-transfection with ODN-1 using the commercial transfection agent cytofectin (first column) and dendrimers 1–9 (column 1–9, respectively). Percentages were calculated by comparing concentrations to a non-transfected control group (last column).
R.J. Marano et al. / Experimental Eye Research 79 (2004) 525–535
531
Fig. 5. Relative levels of VEGF mRNA in cultured D407 cells 24 hr post-transfection dendrimer/ODN-1 complexes 1, 4, 6 and 7. Control consists of mRNA levels of non-transfected cells.
3.4. In vivo suppression of CNV
pronounced in eyes injected with dendrimer 7 without ODN-1 compared to eyes injected with dendrimer 7/ODN-1 for up to 2 months after laser photocoagulation (photograph not shown). In addition, analysis of CNV leakage showed a significant reduction (P!0$01) in lesion scores for eyes injected with dendrimer 7/ODN-1 (Table 2).
Three independent observers using reference angiograms (Fig. 6(a)–(d)) graded and scored the extent of fluorescein leakage for each eye as follows: 0, no leakage observed; 1, slight leakage; 2, moderate leakage; 3, strong leakage. Group 1 rats injected with dendrimer without ODN-1 showed large areas of CNV 7 days after laser-induced rupture of the Bruch’s membrane as indicated by moderate to strong leakage of the new blood vessels (Fig. 7(a.2)). Pretreatment of rat eyes by injecting with dendrimer 4/ODN-1 resulted in CNV lesions that appeared to be diffuse and exhibit less leakage (Fig. 7(b.2)) compared to eyes treated with dendrimer without ODN-1. Measurement of CNV by using the lesion scores showed that treatment with dendrimer/ODN-1 significantly reduced (P!0$01) the severity of leakage compared to eyes treated with dendrimer without ODN-1 (Table 2). In addition, further monitoring of the lesions demonstrated that CNV induced vascular leakage remained high for dendrimer without ODN-1 injected eyes (Fig. 7(a.3–5)) compared to dendrimer/ ODN-1 injected eyes (Fig. 7(b.3–5)). Analysis of leakage scores showed that dendrimers 4/ODN-1 maintained a significant reduction (P!0$01) in vascular leakage for up to 2 months post-laser photocoagulation (Table 2). A similar result was recorded for group 1 rats whose eyes were injected with dendrimer 7 with and without ODN-1. FA revealed the development of CNV lesions were more
Fig. 6. Representative fluorescein angiograms of laser lesions. The intensity of fluorescein leakage of other lesions was graded according to this panel: (a) score 0, no leakage; (b) score 1, slight leakage; (c) score 2, moderated leakage and (d) score 3, strong leakage.
its poor transfection efficacy. Dendrimer 7/ODN-1 showed strong and sustained inhibition of VEGF protein but produced only a moderate reduction in the levels of mRNA.
532
R.J. Marano et al. / Experimental Eye Research 79 (2004) 525–535
Fig. 7. Inhibition of CNV by dendrimer4/ODN-1 injected rat eyes that were laser photocoagulated 1 week post-injection. Colour fundus photography showing location of laser lesions (black arrows) in dendrimer 4 without ODN-1 (a.1) and dendrimer 4/ODN-1 (b.1) injected eyes. Corresponding fluorescein angiograms of representative eyes are depicted below at various time points post-laser photocoagulation, (a.2, b.2), 7 days; (a.3, b.3), 21 days; (a.4, b.4) 1 month; (a.5, b.5) 2 months. In eyes treated with dendrimer only (A), strong leakage was detected while eyes treated with dendrimer/ODN-1 (B) leakage remained diffuse and difficult to distinguish.
To explore the potential contribution of wound healing in reducing the severity of CNV a follow up experiment was performed on group 2 rats, whose eyes were pre-injected 2 months before laser induction of CNV. FA angiography performed 14 days after laser photocoagulation showed CNV lesions to be greater in eyes injected with dendrimer 4 without ODN-1 (Fig. 8(a.2)) compared to the contralateral eyes injected with the dendrimer 4/ODN-1 complex (Fig. 8(b.2)). Measurement of lesion scores showed that dendrimer 4/ODN-1 mediated a significant reduction (P! 0$01) in the severity of the CNV lesions (Table 3). Further monitoring by FA 30 days post-laser photocoagulation again showed more pronounced leakage in eyes injected with dendrimer 4 without ODN-1 (Fig. 8(a.3)) compared to the dendrimer 4/ODN-1 injected eyes (Fig. 8(b.3)). Measurement of the leakage also showed the reduction in leakage severity to be significant 30 days after laser photocoagulation (Table 3).
4. Discussion Oligonucleotide gene therapy (OGT) is an attractive alternative to gene transfer therapy. However, limitations associated with OGT include inefficient and or toxic delivery systems in addition to poor longevity of native oligonucleotides. While problems of longevity can be addressed by chemical and structural modifications of the ODN (Urban and Noe, 2003), these approaches have led to separate concerns such as non-specific binding and inhibition of cellular processes (Cohen, 1991; Stein and Cheng, 1993). The use of native ODN’s would be ideal for in vivo use, therefore a delivery agent is required that possesses low toxicity, enhances cellular uptake and provides protection from nuclease. Several types of peptide based delivery systems have been developed and tested for their ability to transport DNA into living cells (Gait, 2003). Binding ODN’s to cationic
Table 2 Measurements of CNV in the eyes of group 1 rats laser ablated 7 days after injection with dendrimer/ODN-1 complexes and dendrimer without ODN-1 Time post-laser (days) 7 21 30 60
Mean scores Dendrimer 4
Dendrimer 4/ODN-1
Dendrimer 7
Dendrimer 7/ODN-1
2$0G0$7 2$66G0$47 2$83G0$37 2$75G0$43
0$25G0$4 0$34G0$05 0 0
1$75G0$08 2$25G0$8 2$75G0$59 2$83G0$37
0 0 0 0
Dendrimer/ODN-1 complexes mediated reductions in CNV severity were significant (P!0$01) for all time points.
R.J. Marano et al. / Experimental Eye Research 79 (2004) 525–535
533
Fig. 8. Inhibition of CNV by dendrimer 4/ODN-1 injected rat eyes that were laser photocoagulated 2 months post-injection. Colour fundus photography showing location of laser lesions (black arrows) in dendrimer 4 without ODN-1 (a.1) and dendrimer 4/ODN-1 (b.1) injected eyes. Corresponding fluorescein angiograms of representative eyes are depicted below at two time points post-laser photocoagulation, (a.2, b.2), 14 days and (a.3, b.3), 1 month. In eyes treated with dendrimer only, strong leakage was detected (white arrows), while in eyes treated with dendrimer 4/ODN-1, leakage remained minimal.
lipopeptides to form peptide/DNA complexes results in DNA condensation and this, in combination with the lipid coating, provides several benefits including enhanced adhesion to the cell surface, improved membrane permeability and protection against endogenous nucleases (Duzgunes and Felgner, 1993; Bloomfield, 1996; Wagner, 1999). We examined several lipid–lysine dendrimers in an attempt to find a structural configuration that provides optimal delivery efficacy and protection of the anti-VEGF oligonucleotide ODN-1 both in vitro and in vivo. The ability of the complexes to pass the cell membrane in vitro was confirmed by FACS analysis on cells transfected by dendrimers complexed with fluorescein tagged ODN-1. Previous studies (Kukowska-Latallo et al., 1996) have shown that dendrimers with a higher number of positive charges possess greater transfection efficacies and this property was also demonstrated by our investigation. ELISA subsequently showed that all of the dendrimers were able to penetrate the nuclear membrane of cultured cells and deliver ODN-1 to the target site on the dsDNA strand, as indicated by the significant inhibition (P!0$05) of VEGF expression in the initial 24 hr period. Inhibition of VEGF expression was further maintained by dendrimer/ODN1complexes 3–8, which indicated a greater protective quality as unprotected/unmodified ODN’s are rapidly degraded by nucleases (Gryaznov et al., 1996). This would lead to increased VEGF concentrations such as that observed for dendrimer/ODN-1 complexes 1–2 and cytofectin/ODN-1, which provides little or not protection. The variation in the reduction in VEGF expression (and hence the protective quality of the dendrimer) during the 24 hr transfection period and the extent to which this reduction was maintained during the 24 hr post-transfection was due, most likely, to differences in the length and number of lipid residues and the number of free amino functions on the polylysines in the structure of the dendrimers. Those dendrimers that contained two C12 Laas (dendrimers 1 and 2), when complexed to ODN-1,
were unable to inhibit VEGF expression during the second 24 hr period, but if that number was increased to three (e.g. dendrimer 3) the level of protection was increased. An inverse relationship was observed when the length of the carbon chains in the dendrimers was increased. Dendrimers 6 and 9 possess three C14 and C18 Laas, respectively. Complexes formed with these dendrimers offered reduced protection during the second 24 hr period, but when the number of Laas in each dendrimer was reduced to two, e.g. dendrimers 4, 7 and 8, the protective quality was restored. By extrapolation, optimal protection and transfection efficacy would be achieved if two C14 Laas and eight free amino groups were included in the structure of the dendrimer. This was the structure described for dendrimer 4 and the complex formed with this dendrimer supports this hypothesis. Cells transfected with dendrimer 4/ODN-1 complex resulted in sustained inhibition of VEGF greater than 50% over a 48 hr period (ELISA) in addition to possessing a relatively high transfection efficacy of 88$9%. This result was further supported by RT-PCR examination, which showed dendrimer 4/ODN-1 transfected cells had a significantly reduced level of VEGF mRNA (PZ0$03) when compared to non-transfected cells. It is important to note that the results described in this report relate only to Table 3 Measurements of CNV in the eyes of group 2 rats laser ablated 2 months after injection with dendrimer 4/ODN-1 and dendrimer 4 without ODN-1 14 days post-laser photocoagulation
30 days post-laser photocoagulation
Dendrimer
Dendrimer/ ODN-1
Dendrimer
Dendrimer/ ODN-1
2$58G0$49
0
2$91G0$27
0$5G0$9
CNV severity was significantly reduced in eyes injected with dendrimer 4 ODN-1 (P!0$01) compared to eyes injected with dendrimer without ODN-1.
534
R.J. Marano et al. / Experimental Eye Research 79 (2004) 525–535
the transfection of ODN-1 into the human RPE cell line D407; results may vary if different cell types are used (Kukowska-Latallo et al., 1996). We have previously demonstrated that unconjugated ODN-1 mediates a reduction in both VEGF protein and mRNA at either the pre or post-transcriptional stage (Garrett et al., 2001). We confirmed that a simmilar mode of action was maintained for dendrimer/ODN-1 complexes using RTPCR, which showed a reduction of VEGF mRNA. However, correlations between the reduction in VEGF expression and transfection efficacies were more difficult to explain. It was assumed that if 100% of the ODN’s reach their target site in the nucleus, then close to 100% inhibition of translation of mRNA should be observed. However, the data obtained from ELISA contradict this assumption. Interestingly, cytofectin achieved the highest transfection efficiency yet produced an equivalent reduction in the levels of expressed VEGF, whilst the complex formed with dendrimer 6 provided the lowest transfection efficiency but was able to produce the greatest reduction of both VEGF protein and mRNA. These variations may be due to either a difference in the dendrimers ability to pass the nuclear membrane in addition to the cellular membrane, or the ability of the dendrimer to present ODN-1 to the target site. In addition, dendrimer 1/ODN-1 resulted in a strong initial decrease in VEGF protein but only a moderate decrease of mRNA for the same period. This provides further evidence of the poor protective qualities of dendrimer 1. As unprotected ODN-1 becomes rapidly degraded by endogenous nucleases (stated above), the resulting effect would lead to and increase in mRNA transcript present for translation, which would occur previous to a detectable increase in the level of protein. This would result in comparatively higher levels of mRNA being present when sampled at 24 hr posttransfection. Similarly, based on ELISA, dendrimer 4 possessed excellent protective qualities, which is reflected in the comparatively lower levels of mRNA. It has been demonstrated in animal models that inhibition of VEGF in vivo leads to reduced levels of angiogenesis (Aiello et al., 1995; Shen and Rakoczy, 2001; Bainbridge et al., 2002). In addition, we have previously shown that intravitreous injections of the S-form of ODN-1 leads to a reduction in the severity of laser induced CNV (Garrett, 2001). Similar to this previous study, rat eyes injected with dendrimer 4 and 7/ODN-1 complexes were monitored for the incidence and severity CNV induced using laser photocoagulation. Eyes treated with both complexes showed zero to slight leakage for up to two months compared with contralateral eyes injected with dendrimer alone, which exhibited moderate to strong leakage for all time points tested. This indicated that dendrimers 4 and 7 successfully delivered ODN-1 to retinal cells and mediated a response similar to that found by Garrett et al. (2001). Inhibition of CNV was subsequently proven to occur through the presence of ODN-1and not due to wound healing after the initial effects of the dendrimer/ODN-1
complex by the rats in the group 2 study. Eyes laser photocoagulated 2 months post-injection and monitored by fluorescein angiography also showed a reduction in the severity of CNV. This evidence suggests that the dendrimer/ ODN-1 complexes persisted in the retinal tissue undergraded for at least the two-month period and maintained its anti-CNV activity. Furthermore, continual ophthalmological examinations of injected rat eyes revealed no observable sign of a toxicological effected caused by the dendrimers or their complexes. In summary we have used solid-phase methods to synthesize a series of lipid-lysine dendrimers that were used to form complexes with the therapeutic oligonucleotide ODN-1. Subsequent studies demonstrated that these synthetic lipophilic charged dendrimers could be used for gene delivery and maintain long-term modulation of gene expression in vivo, thus may become valuable tools for gene therapy.
Acknowledgements This project was supported by funds from the National Health and Medical Research Council (NH&MRC) of Australia and the Welcome Trust. I would also like to thank Matthew Wikstrom for his services on the FACS, Chris Stoddart for his assistance with the statistical analysis, Tammy Zaknich for the photography, Ben Rae for image analysis and Ann Wilson for help with the RT-PCR technique.
References Abe, T., Suzuki, S., et al., 1998. Specific inhibition of influenza virus RNA polymerase and nucleoprotein gene expression by liposomally encapsulated antisense phosphorothioate oligonucleotides in MDCK cells. Antivir. Chem. Chemother. 9, 253–262. Adamis, A.P., Miller, J.W., et al., 1994. Increased vascular endothelial growth factor levels in the vitreous of eyes with proliferative diabetic retinopathy. Am. J. Ophthalmol. 118, 445–450. Aiello, L.P., Pierce, E.A., et al., 1995. Suppression of retinal neovascularization in vivo by inhibition of vascular endothelial growth factor (VEGF) using soluble VEGF-receptor chimeric proteins. Proc. Natl. Acad. Sci. USA 92, 10457–10461. Akhtar, S., Hughes, M.D., et al., 2000. The delivery of antisense therapeutics. Adv. Drug Deliv. Rev. 44, 3–21. Alahari, S.K., Dean, N.M., et al., 1996. Inhibition of expression of the multidrug resistance-associated P-glycoprotein of by phosphorothioate and 5 0 cholesterol-conjugated phosphorothioate antisense oligonucleotides. Mol. Pharmacol. 50, 808–819. Bainbridge, J.W., Mistry, A., et al., 2002. Inhibition of retinal neovascularisation by gene transfer of soluble VEGF receptor sFlt-1. Gene Ther. 9, 320–326. Bloomfield, V.A., 1996. DNA condensation. Curr. Opin. Struct. Biol. 6, 334–341. Cohen, J.S., 1991. Oligonucleotides as therapeutic agents. Pharmacol. Ther. 52, 211–225. Crooke, S.T., 1993. Progress toward oligonucleotide therapeutics: pharmacodynamic properties. Fed. Am. Soc. Exp. Biol. J. 7, 533–539.
R.J. Marano et al. / Experimental Eye Research 79 (2004) 525–535 Duzgunes, N., Felgner, P.L., 1993. Intracellular delivery of nucleic acids and transcription factors by cationic liposomes. Methods Enzymol. 221, 303–306. Forsythe, J.A., Jiang, B.H., et al., 1996. Activation of vascular endothelial growth factor gene transcription by hypoxia-inducible factor 1. Mol. Cell Biol. 16, 4604–4613. Freire, E., Mayorga, O.L., Straume, M., 1990. Isothermal titration. Anal. Chem. 1990;, 950A–959A. Gait, M.J., 2003. Peptide-mediated cellular delivery of antisense oligonucleotides and their analogues. Cell. Mol. Life Sci. 60, 844–853. Garrett, K.L., Shen, W.Y., Rakoczy, P.E., 2001. In vivo use of oligonucleotides to inhibit choroidal neovascularisation in the eye. J. Gene Med. 3, 373–383. Gibbons, W.A., Hughes, R.A., et al., 1990. Synthesis, resolution and structural elucidation of lipidic amino acids and their homo- and heterooligomers. Liebigs Ann. Chem. 1990;, 1175–1183. Gryaznov, S., Skorski, T., et al., 1996. Oligonucleotide N3 0 /P5 0 phosphoramidates as antisense agents. Nucl. Acids Res. 24, 1508–1514. Kukowska-Latallo, J.F., Bielinska, A.U., et al., 1996. Efficient transfer of genetic material into mammalian cells using Starburst polyamidoamine dendrimers. Proc. Natl. Acad. Sci. USA 93, 4897–4902. Kvanta, A., Algvere, P.V., Berglin, L., Seregard, S., 1996. Subfoveal fibrovascular membranes in age-related macular degeneration express vascular endothelial growth factor. Invest. Ophthalmol. Vis. Sci. 37, 1929–1934. Leibowitz, H.M., Krueger, D.E., et al., 1980. The Framingham eye study monograph: an ophthalmological and epidemiological study of cataract, glaucoma, diabetic retinopathy, macular degeneration, and visual acuity in a general population of 2631 adults, 1973–1975. Surv. Ophthalmol. 24, 335–610. Levy, N.S., Goldberg, M.A., Levy, A.P., 1997. Sequencing of the human vascular endothelial growth factor (VEGF) 3 0 untranslated region (UTR): conservation of five hypoxia-inducible RNA-protein binding sites. Biochim. Biophys. Acta. 1352, 167–173.
535
Liu, L.X., Lu, H., et al., 2002. Stabilization of vascular endothelial growth factor mRNA by hypoxia-inducible factor 1. Biochem. Biophys. Res. Commun. 291, 908–914. Lobo, B.A., Rogers, S.A., et al., 2001. Characterisation of cationic vectorbased gene delivery using isothermal titration and differential scanning calorimetry. Methods Mol. Med. 65, 319–348. Merrifield, R.B., 1963. Solid-phase pepitide synthesis. 1. The synthesis of a tetrapeptide. J. Am. Chem. Soc. 85, 2149–2154. Miller, D.L., Dibbens, J.A., et al., 1998. The vascular endothelial growth factor mRNA contains an internal ribosome entry site. Fed. Eur. Biochem. Soc. Lett. 434, 417–420. Shah, D.S., Sakthivel, T., Toth, I., Florence, A.T., Wilderspin, A.F., 2000. DNA transfection and transfected cell viability using amphipathic asymmetric dendrimers. Int. J. Pharm. 208, 41–48. Shen, W.Y., Rakoczy, P.E., 2001. Uptake dynamics and retinal tolerance of phosphorothioate oligonucleotide and its direct delivery into the site of choroidal neovascularization through subretinal administration in the rat. Antisense Nucl. Acid Drug Dev. 11, 257–264. Sommer, A., Tielsch, J.M., et al., 1991. Racial differences in the causespecific prevalence of blindness in east Baltimore. N. Engl. J. Med. 325, 1412–1417. Stein, C.A., Cheng, Y.C., 1993. Antisense oligonucleotides as therapeutic agents—is the bullet really magical?. Science 261, 1004–1012. Tame, J.R.H., O’Brian, R., Ladbury, J.I., Chowdhry, B.Z., 1998. Isothermal titration calorimetry of biomolecules, in: Ladbury, J.I., Chowdhry, B.Z. (Eds.), Biocalorimetry, Applications of Calorimetry in the Biological Sciences. Wiley, Chichester, pp. 27–38. Urban, E., Noe, C.R., 2003. Structural modifications of antisense oligonucleotides. Il Farmaco 58, 243–258. Wagner, E., 1999. Application of membrane-active peptides for nonviral gene delivery. Adv. Drug Deliv. Rev. 38, 279–289. Wimmer, N., Marano, R.J., Kearns, P.S., Rakoczy, E.P., Toth, I., 2002. Syntheses of polycationic dendrimers on lipophilic peptide core for complexation and transport of oligonucleotides. Bioorg. Med. Chem. Lett. 12, 2635–2637.
Inhibition of in vitro VEGF expression and choroidal neovascularization by synthetic dendrimer peptide mediated delivery of a sense oligonucleotide Robert J. Maranoa, Norbert Wimmerb, Philip S. Kearnsb, Bradley G. Thomasb, Istvan Tothb, Meliha Brankova, P. Elizabeth Rakoczya,* a
Centre for Ophthalmology and Visual Science, Lions Eye Institute, University of Western Australia, 2 Verdun Street, Nedlands, WA 6009, Australia b School of Pharmacy, The University of Queensland, Steele Building, St. Lucia, QLD 4072, Australia Received 14 October 2003; accepted in revised form 22 June 2004 Available online 14 August 2004
Abstract Ocular neovascularisation is the leading cause of blindness in developed countries and the most potent angiogenic factor associated with neovascularisation is vascular endothelial growth factor (VEGF). We have previously described a sense oligonucleotide (ODN-1) that possesses anti-human and rat VEGF activity. This paper describes the synthesis of lipid–lysine dendrimers and their subsequent ability to delivery ODN-1 to its target and mediate a reduction in VEGF concentration both in vitro and in vivo. Positively charged dendrimers were used to deliver ODN-1 into the nucleus of cultured D407 cells. The effects on VEGF mRNA transcription and protein expression were analysed using RT-PCR and ELISA, respectively. The most effective dendrimers in vitro were further investigated in vivo using an animal model of choroidal neovascularisation (CNV). All dendrimer/ODN-1 complexes mediated in a significant reduction in VEGF expression during an initial 24 hr period (40–60%). Several complexes maintained this level of VEGF reduction during a subsequent, second 24 hr period, which indicated protection of ODN-1 from the effects of endogenous nucleases. In addition, the transfection efficiency of dendrimers that possessed 8 positive charges (xZ81$51%) was significantly better (PZ0$0036) than those that possessed 4 positive charges (xZ 56$8%). RT-PCR revealed a correlation between levels of VEGF protein mRNA. These results indicated that the most effective structural combination was three branched chains of intermediate length with 8 positive charges such as that found for dendrimer 4. Dendrimer 4 and 7/ODN-1 complexes were subsequently chosen for in vivo analysis. Fluorescein angiography demonstrated that both dendrimers significantly (P!0$0001) reduced the severity of laser mediated CNV for up to two months post-injection. This study demonstrated that lipophilic, charged dendrimer mediated delivery of ODN-1 resulted in the down-regulation of in vitro VEGF expression. In addition, in vivo delivery of ODN-1 by two of the dendrimers resulted in significant inhibition of CNV in an inducible rat model. Time course studies showed that the dendrimer/ODN-1 complexes remained active for up to two months indicating the dendrimer compounds provided protection against the effects of nucleases. q 2004 Elsevier Ltd. All rights reserved. Keywords: VEGF; dendrimer; oligonucleotide; lipidic polyamide; lipoamino acids; cationic lipids; choroid; laser photocoagulation; transfection
1. Introduction The formation of new blood vessels (neovascularization) is essential for normal eye development; however, in severe * Corresponding author. Dr P. Elizabeth Rakoczy, Department of Molecular Ophthalmology, Lions Eye Institute, University of Western Australia, 2 Verdun Street, Nedlands, Perth, WA 6009 Australia. E-mail address: [email protected] (P.E. Rakoczy). 0014-4835/$ - see front matter q 2004 Elsevier Ltd. All rights reserved. DOI:10.1016/j.exer.2004.06.023
ocular diseases, like age-related macular degeneration (AMD) and diabetic retinopathy, this process is uncontrolled. In developed countries AMD is the most common cause of blindness in patients over 60 years of age (Leibowitz et al., 1980; Sommer et al., 1991). One of the main angiogenic factors involved in intraocular neovascularization is vascular endothelial growth factor (VEGF), a protein that is secreted by retinal pigment epithelial (RPE) cells under both physiological and pathological conditions
526
R.J. Marano et al. / Experimental Eye Research 79 (2004) 525–535
(Adamis et al., 1994; Aiello et al., 1995; Kvanta et al., 1996). Under hypoxic conditions, the expression of VEGF is regulated by hypoxia-inducible factor 1 (HIF-1), which binds to the hypoxia response element on the VEGF promoter (Forsythe et al., 1996). HIF-1 is also functions to stabilise VEGF mRNA by binding to sites on both the 5 0 and 3 0 untranslated region (UTR) resulting in greater amounts of VEGF expression (Levy et al., 1997; Liu et al., 2002). In addition, it has been postulated that during periods of cellular starvation, internal ribosomal entry sites (IRES) located on the 5 0 UTR facilitate the continued expression of VEGF by allowing ribosomal binding without involving the 5 0 cap (Miller et al., 1998). Recently, we reported the use of a particular oligonucleotide: (ODN-1: GAGCCGGAGAGGGAGCGCGA) that targets the 5 0 UTR of the VEGF operon to inhibit choroidal neovascularization (CNV) in an animal model (Garrett et al., 2001). However, if this oligonucleotide is to be used as a therapeutic agent, delivery efficacy must be maximized. The formation of complexes between ODN’s and cationic lipids, called lipoplexes, is the most common strategy used to enhance gene delivery. These lipoplexes are positively charged and have a high affinity for cell membranes, which are negatively charged under physiological conditions, and enter cells by adsorptive endocytosis (Akhtar et al., 2000). Many commercial transfection agents contain a helper lipid, such as dioelylphosphatidylethanolamine (DOPE) to aid in the release of the ODNs from the endosomal/lysosomal compartments. Studies have shown that once internalized within the cell or nucleus the lipoplexes dissociate (Alahari et al., 1996; Abe et al., 1998). As a consequence of this, it is necessary to protect the ODNs from the effects of nucleases. This may be achieved by the replacement of the phosphodiester backbone of ODN with a phoshorothioate (S) backbone (Crooke, 1993; Stein and Cheng, 1993). However, S-oligonucleotides form poor hybrids with the target mRNA and inhibit several non-related cellular enzymes (Stein and Cheng, 1993). We have designed and developed lipid–lysine dendrimers in an attempt to improve the delivery of the P form of ODN-1 into the nuclei of retinal cells (Wimmer et al., 2002). These dendrimers contain a tail of lipidic a-aminocarboxylic acids (Laas) and a poly-lysine head, and are, therefore, amphiphilic. Laas, their homo-oligomers and lipidic peptides represent a class of compounds that combines the structural features of lipids with those of amino acids (Shah et al., 2000). These lipid–lysine dendrimers facilitate transmembrane transportation, act as lipid solubilizers and protect the labile DNA from nuclease digestion. In this study, we have tested the effectiveness of synthetic lipid–lysine dendrimers to deliver ODN-1 into cultured D407 cells and mediate a reduction of VEGF expression. Based upon the outcome of the in vitro study, the most effective dendrimer/ODN-1 complexes were chosen for in vivo analysis. Using a laser induced rat model of CNV, we examined the anti-angiogenic effect
and longevity of a dendrimer mediated delivery of ODN-1 into retinal cells by intravitreal injection.
2. Materials and methods 2.1. Dendrimers and oligonucleotide 2-Aminododecanoic acid (C12 Laa), 2-aminotetradecanoic acid (C14 Laa) and 2-aminooctadecanoic acid (C18 Laa), and their Boc-protected analogues, were synthesised using previously described methods (Gibbons et al., 1990). Standard solid-phase synthetic methods were used (Merrifield, 1963) and dendrimers 1–9 were synthesised by varying the length and number of the lipid residues, and the number of free amino functions on the poly-lysine head (Fig. 1 and Table 1). The general experimental procedure for the synthesis of compounds 1–9 was: MBHA resin [4-methyl benzhydrylamine, substitution ratio, 0$62 mmol/g, 1 g resin (0$62 mmol) for 1–5 and 500 mg resin (0$31 mmol) for 6–9] was placed in a sintered glass peptide synthesis vessel and allowed to swell DMF for 90 min. A mixture containing the Boc-protected amino acid (3 eq), HBTU (2-(1H benzotriazole-1-yl)-1,3,3-tetramethyluronium hexafluoro phosphate, 0$5 M in DMF, 3 eq) and DIEA (0$442 ml for peptides 1–5, 0$221 ml for peptides 6–9, 4 eq) was then added to the resin and shaken for 12 min. The progress of the reaction was monitored by a qualitative ninhydrin assay. A negative ninhydrin reaction showed nearly quantitative coupling (R99$98%) after a single coupling reaction. The Boc-protecting group was then removed using neat TFA. The resin was washed intensively with DMF after all manipulations. All other coupling reactions and deprotections were done in an analogous manner. After the last coupling the terminal Boc group was removed and the resin was washed with DMF, DCM and methanol, respectively. The resin was then dried to a constant weight over KOH under vacuum. The peptide was cleaved from the resin using the high HF method. The cleaved peptide was precipitated by diethyl ether, re-dissolved in 2$5% aqueous acetic acid and lyophilised to afford an amorphous powder.
Fig. 1. Chemical structure of dendrimers 1–9 illustrating their respective side chains. 1, R1ZC10H21, R2ZNH2, nZ2; 2, R1ZC10H21, R2ZLys(NH2)2, nZ2; 3, R1ZC10H21, R2ZLys-(NH2)2, nZ3; 4, R1ZC12H25, R2ZLys-(NH2)2, nZ2; 5, R1ZC12H25, R2ZLys-(NH2)2, nZ3; 6, R1Z C12H25, R2ZNH2, nZ3; 7, R1ZC16H33, R2ZNH2, nZ2; 8, R1ZC16H33, R2ZLys-(NH2)2, nZ2; 9, R1ZC16H33, R2ZLys-(NH2)2, nZ3.
R.J. Marano et al. / Experimental Eye Research 79 (2004) 525–535
527
Table 1 Chemical and analytical data of the dendrimers Dendrimer
Formula
Mass
MS (m/z)
Laaa
Number of Laas
Positive Charges
Yield (%)
1 2 3 4 5 6 7 8 9
C44H89O6N10 C68H137O10N18 C80H160O11N19 C72H145O10N18 C86H172O11N19 C62H123O7N11 C56H112O6N10 C80H161O10N18 C98H196O11N19
854$20 1366$08 1563$25 1422$14 1648$58 1135$0 1021$78 1535$6 1817$1
853$8 (zZ1), 427$4 (zZ2), 285$4 (zZ3) 683$8 (zZ2), 456$2 (zZ3), 342$4 (zZ4) 782$6 (zZ2), 522$0 (zZ3), 391$8 (zZ4) 711$8 (zZ2), 474$8 (zZ3), 356$4 (zZ4) 1648$8 (zZ1), 825$0 (zZ2), 550$2 (zZ3) 1135$4 (zZ1), 568$2 (zZ2), 1022$2 (zZ1), 512$0 (zZ2), 768$2 (zZ2), 512$4 (zZ3) 908$8(zZ2), 606$6 (zZ3)
C12 C12 C12 C14 C14 C14 C18 C18 C18
2 2 3 2 3 3 2 2 3
4 8 8 8 8 4 4 8 8
81 75 70 76 75 73 55 60 47
a
C12 Laa, 2-aminododecanoic acid; C14 Laa, 2-aminotetradecanoic acid; C18 Laa, 2-amino octadecanoic acid.
Analytical RP-HPLC was performed on a Shimadzu instrument that was controlled using a SCL-10A system controller, the solvent was delivered by a LC-10AT liquid chromatograph pump, and detection was performed using a SPD-6A UV detector; samples were introduced using a SIL-6B auto injector; separations were performed on 25 cm!4$6 mm, 5 hm pore size Vydac C4 or C18 columns. Preparative chromatography of the crude peptides (1–9, 100 mg) was performed using a Waters HPLC system; the system was controlled with a Model 600 controller; solvent was delivered with a 600F pump; detection was done using a 490E UV-visible detector; and separations were performed on either a TSK-GEL C4 or C18 column with 10 hm particle size and 2$5 cm internal diameter, using an acetonitrile/water gradient. The fractions collected were characterised by positive-ion electrospray-MS (Perkin Elmer API 3000 instrument). The resulting peptide was used as diastereomeric mixture. 2.2. Complex formation To prepare complexes with the required molar charge ratio, ODN-1 (0$5 mg mlK1) was added to each dendrimer (1$5 mg mlK1) mixed for 15 min, diluted with 250 ml sterile water and lyophilised. Isothermal titration calorimetry experiments (Freire et al., 1990; Tame et al., 1998; Lobo et al., 2001) were performed in a MicroCal VP-ITC microcalorimeter at 308C to determine the optimal conjugation ratio between the cationic dendrimers and ODN-1. ODN-1 and the dendrimers were dissolved in 10 mM PBS, and the oligonucleotide (2 mM) was placed in the sample cell and the dendrimer (243 mM) was placed in the syringe. The dendrimer was then added to the oligonucleotide solution as 25!4 ml injections, each injection was 4 min apart. Complex formation was considered complete when no further release of heat was observed. 2.3. Cell culture and transfection The human RPE cell line, D407, was cultured in Dulbeco’s Modified Eagles Medium (DMEM) supplemented
with 10% foetal bovine serum (FBS). Cells were maintained at 378C in a humidified atmosphere in 5% CO2 in 25 ml tissue culture vessels and passaged when cell density reached 70–80% confluency. For transfection studies, the cells were seeded equally into 24-well plates and grown overnight under the same conditions in DMEM–FBS. The oligonucleotide–peptide complexes were reconstituted in sterile double-distilled H2O to a final concentration of 50 mM, relative to the concentration of the oligonucleotide. P-ODN-1 was complexed to the transfection agent cytofectine (Glen Scientific) as per the manufactures instructions and used as a standard. The complexes were then added to pre-warmed DMEM-FBS (3 ml) to a final concentration of 0$5 mM (1 in 100 dilution). The overnight growth media was aspirated from the each well and replaced with 700 ml of media containing the dendrimer/ODN-1 complexes. The transfection of each complex was performed in quadruplet sets for statistical analysis. Following the addition of the complexes, the cells were further incubated at 378C under hypoxic conditions (2% O2, 5% CO2) to induce hyper-expression of VEGF. At 24 hr posttransfection the media from each well was removed to a microfuge tube and replaced with 700 ml of fresh DMEMFBS and incubated under hypoxic conditions for a further 24 hr at which time the media was again removed to a microfuge tube for ELISA and protein concentration assays. Transfection efficiencies of dendrimers with different positive charges were determined by transfecting with dendrimers 1–9 conjugated to ODN-1 possessing a 5 0 fluorescein tag. Cells were incubated for 24 hr at 378C under 5% CO2. After this time the cells were removed from the culture vessel by trypsinisation and pelleted by centrifugation at 2000g for 5 min. The growth media was aspirated and the cell pellet was resuspended gently in 200 ml of PBS. The number of transfected cells was then counted by fluorescent activated cell sorting (FACS) on a FACS calibur cell counter (ABI systems, USA) for 3 independent samples. The means and standard deviations were calculated and the results statistically analysed using a Student’s t-test. Controls consisting of cells transfected with dendrimer alone, at a concentration equal to that used in the VEGF
528
R.J. Marano et al. / Experimental Eye Research 79 (2004) 525–535
reduction study, were prepared to investigate the toxicity and or placebo effects of the dendrimers. The incubation times and temperatures were identical to those of the dendrimer/ODN-1 transfected cells. 2.4. VEGF Elisa and protein assay CYTELISAe human VEGF ELISA plates (CYTIMMUNE, MD, USA) were used to determine the concentration of VEGF in the growth media. For each sample, 500 ml of media was concentrated by filtration through a microconw YM-30 protein concentrator (Millipore, USA) to a final volume of 10 ml. The volume was adjusted to 110 ml and 100 ml was used in the ELISA, which was performed as per the manufactures instructions and the results were read using a Spectramax 250 microplate spectrophotometer (Molecular Devices, Sunnyvale, CA, USA). The remaining 10 ml of concentrated media was used to determine the total protein concentration using a modified Bradfords method (Micro BCAw Protein Assay Reagent Kit, Pierce, Rockford, IL, USA) as per manufactures instructions. The concentration of VEGF was normalised against the total protein concentration and the results tabulated. Statistical analysis was performed using a one-way ANOVA with a post-hoc Tukey’s test with 95% confidence limits. 2.5. Quantitative PCR Representatives of the various dendrimer chain lengths (12, 14, and 18 amino acids) and charge ratio’s (4C and 8C) were chosen for real time quantitative PCR (RT-PCR) analysis and consisted of dendrimer complexes 1, 4, 6, and 7. Cells were grown and transfected as described previously, however, 24 hr post-transfection the cells were harvested by trypsinization to detach them from the culture vessel. The cell suspensions were centrifuged at 2000 g to form pellets and the total mRNA was extracted using a QIAGEN mRNA extraction kit. Single stranded cDNA was created using Omniscripte reverse transcriptase as per the manufactures instructions (QIAGEN). This was used as a template in a real time (RT) PCR reaction using a Rotor-Gene thermocycler (Corbett Research, Australia), human VEGF specific primers (accession #: AY047581; 5 0 : 369–388, 3 0 : 459–443) and the stain SYBR green I. A standard curve derived from the serial dilution of a single stranded synthetic DNA standard designed to represent the 96 bp fragment of VEGF was used to obtain relative quantisation data. The cDNA was amplified in a 20 ml volume reaction using AmpliTaq Gold PCR master-mix (Applied Biosystems, Roche, USA) with primers at 1 hmol mlK1 under the following thermocycling conditions: 10 min activation at 958C followed by 45 cycles of 958C for 15 sec, 558C for 15 sec and 728C for 15 sec. This result was normalized against the total concentration of mRNA in each sample.
2.6. Injections All animal experiments were performed in accordance with ARVO Statement of the Use of Animals in Vision and Ophthalmic Research. Pre-injection, animals were anaesthetised with a mixture of ketamine (50 mg kgK1 body weight) and xylazine (8 mg kgK1 body weight). Tears Naturalew (Alcon, Frenches Forrest, NSW, Australia) were applied topically to prevent eyes from drying during the injection process. Two microliters of a 75 mM concentration of the dendrimer/ODN-1 complex (relative to ODN-1) was injected into the vitreous of the right eye of 8 week old pigmented DA rats. In addition, 2 ml of an equivalent amount dendrimer without ODN-1 was injected into the vitreous of the left eye. The injection technique used has been previously described (Garrett et al., 2001). A total of 8 rats were injected for each of the dendrimers to be studied. 2.7. Induction of choroidal neovascularisation (CNV) by krypton laser photocoagulation Rats were divided into 2 groups for laser induction of CNV whereby group 1 was laser ablated 7 days postinjection (dpi) and group 2 were laser ablated 2 months postinjection (mpi). In addition, group 1 consisted of four rats injected using dendrimer 4 and four rats injected using dendrimer 7 while group 2 consisted of dendrimer 4 injected rats only. Rats were anaesthetized and their pupils dilated by the topical application of 1% tropicamide and 2$5% phenylephrine hydrochloride drops. Krypton laser irradiation (647$1 nm, coherent Radiation System, CA, USA) was delivered to both the left dendrimer/ODN-1 injected eye and the contralateral dendrimer without ODN-1 injected eye of each animal through a Zeiss slit lamp with a hand-held coverslip serving as a contact lens. A total of 8–10 laser burns were applied in each eye surrounding the optic nerve at the posterior pole at a setting of 100 mM diameter, 0$1 sec duration and 150 mW intensity. 2.8. Quantitation of choroidal neovascularisation The formation and extent of CNV in the eye using this model was monitored using fluorescein angiography (FA). For group 1 rats, FA was performed 1 week, 21 days, 1 month and 2 months post-lasering. For group 2 rats laser photocoagulated at 2 mpi, FA was performed at 14 and 30 days post-lasering. The animals were injected intraperitoneally with 0$3–0$4 ml of 10% sodium fluorescein and the eyes were photographed using fluorescent fundus photography. Three independent observers using reference angiograms graded the extent of fluorescein leakage for each eye as follows: 0, no leakage observed; 1, slight leakage; 2, moderate leakage; 3, strong leakage. The score for each eye was averaged from the three observations and the score per lesion was calculated for each animal and then averaged to
R.J. Marano et al. / Experimental Eye Research 79 (2004) 525–535
529
obtain a mean score per eye. The mean score between paired dendrimer/ODN-1 complexes and dendrimer without ODN1 were compared by ANOVA with a post-hoc Tukey’s test. Differences were considered significant at P!0$05.
3. Results 3.1. Dendrimer synthesis and complex formation A series of 9 dendrimers were synthesised containing the core structure and functional groups illustrated in Fig. 1. Isothermal titration calorimetry (ITC) performed for a 4C charged (1) and an 8C charged dendrimer (3) are illustrated in Figs. 2(a) and (b), respectively, and show the sequential release of heat (mcal sK1) as the dendrimers were titrated into the ODN-1 solutions. The ITC data indicated that complex formation was complete at a molar ratio (dendrimer:ODN-1) of 10:1 for dendrimer 1 (Fig. 2(a)) and 6:1 for dendrimer 3 (Fig. 2(b)). To examine the reproducibility between the optimal binding ratio and the number of positive charges, another 4 dendrimers (1, 4, 5 and 8) possessing 8C charges were measured. ITC curves for these dendrimers (data not shown) were similar to those of dendrimer 3, which demonstrates a dose reproducible correlation between the number of positive charges and the optimal binding ratio. 3.2. Transfection efficiency The mean percentage of cells transfected by dendrimers that were conjugated to fluorescein tagged ODN-1 was measured using FACS analysis (Fig. 3). Cytofectin, along with dendrimers possessing 8C charges (2, 4, and 9) were able to achieve high levels of transfection (80–100%) while dendrimers possessing 4C charges (1, 7 and 8) achieved moderate levels of transfection (60–80%). Dendrimer 6, which also has 4C charges, gave a relatively low level of transfection of 38% of living cells. The mean transfection percentages between groups of dendrimers that possessed 8C and 4C charges were 81$51 and 56$8%, respectively, which represented a significant (PZ0$0036) difference in transfection efficiencies, which indicates that dendrimers possessing higher charges are more efficient at penetrating the cell membrane.
Fig. 2. Isothermal titration calorimetry (ITC) curves for the titration of ODN-1 with dendrimers 1 (4C charges) (2a) and 3 (8C charges) (2b).
3.3. Regulation of VEGF expression The relative reduction of VEGF expression in transfected D407 cells (compared to a non-transfected control) was measured using ELISA (Fig. 4). Statistical analysis using ANOVA with a post-hoc Tukey’s test revealed VEGF concentrations in cells transfected with unconjugated dendrimers were not significantly different (PO0$05) to non-transfected controls (data not shown). Analysis of VEGF concentrations in cells transfected with cytofectin/ODN-1
and dendrimers 1–9/ODN-1 revealed a significant reduction (P!0$001) in the mean concentration of VEGF in the first 24 hr post-transfection (Fig. 4). However, at 48 hr posttransfection, inhibition of VEGF was not sustained in cells transfected with cytofectin/ODN-1 and dendrimer/ODN-1 complexes 1, 2 and 9 where VEGF concentrations were similar to those of non-transfected controls. Statistical analysis revealed no significant difference between the non-transfected control, cytofectin/ODN-1 (PZ0$9)
530
R.J. Marano et al. / Experimental Eye Research 79 (2004) 525–535
Fig. 3. Comparative transfection efficacies of cytofectin (Cyt) and representative dendrimers containing 4C (1, 6 and 7) and 8C (2, 4, 8 and 9) charges.
and dendrimers 1, 2/ODN-1 (PZ0$92 and PZ1, respectively). Conversely, dendrimer/ODN-1 complexes 3–8 did maintain inhibition of VEGF expression even at 48 hr and no statistically significant increase in the concentration of VEGF was found over the course of the experiment. The quantity of VEGF mRNA transcript was measured using RT-PCR for cells transfected with dendrimers/ODN-1 complexes that possess a range of charge ratio’s, transfection efficacies and protein inhibition abilities and included dendrimer/ODN-1 complexes 1, 4, 6 and 7. Samples of mRNA were successfully extracted from transfected and
non-transfected cells 24 hr post-transfection, and RT-PCR subsequently demonstrated that amount of VEGF mRNA was reduced by 20–50% by the dendrimer/ODN-1 complexes (Fig. 5). Dendrimer 1/ODN-1 resulted in strong inhibition of VEGF protein in the initial 24 hr but this was not reflected by a proportional reduction in the level of mRNA. By contrast, the reduction of mRNA in cells transfected with dendrimer 4/ODN-1 closely paralleled the reduction of VEGF protein expression. This was also seen for dendrimer 6/ODN-1, which mediated a strong reduction in both the levels of VEGF mRNA and protein in contrast to
Fig. 4. Relative reduction of VEGF protein expression by ODN-1 in cultured D407 cells. VEGF concentrations were measured at 24 and 48 hr post-transfection with ODN-1 using the commercial transfection agent cytofectin (first column) and dendrimers 1–9 (column 1–9, respectively). Percentages were calculated by comparing concentrations to a non-transfected control group (last column).
R.J. Marano et al. / Experimental Eye Research 79 (2004) 525–535
531
Fig. 5. Relative levels of VEGF mRNA in cultured D407 cells 24 hr post-transfection dendrimer/ODN-1 complexes 1, 4, 6 and 7. Control consists of mRNA levels of non-transfected cells.
3.4. In vivo suppression of CNV
pronounced in eyes injected with dendrimer 7 without ODN-1 compared to eyes injected with dendrimer 7/ODN-1 for up to 2 months after laser photocoagulation (photograph not shown). In addition, analysis of CNV leakage showed a significant reduction (P!0$01) in lesion scores for eyes injected with dendrimer 7/ODN-1 (Table 2).
Three independent observers using reference angiograms (Fig. 6(a)–(d)) graded and scored the extent of fluorescein leakage for each eye as follows: 0, no leakage observed; 1, slight leakage; 2, moderate leakage; 3, strong leakage. Group 1 rats injected with dendrimer without ODN-1 showed large areas of CNV 7 days after laser-induced rupture of the Bruch’s membrane as indicated by moderate to strong leakage of the new blood vessels (Fig. 7(a.2)). Pretreatment of rat eyes by injecting with dendrimer 4/ODN-1 resulted in CNV lesions that appeared to be diffuse and exhibit less leakage (Fig. 7(b.2)) compared to eyes treated with dendrimer without ODN-1. Measurement of CNV by using the lesion scores showed that treatment with dendrimer/ODN-1 significantly reduced (P!0$01) the severity of leakage compared to eyes treated with dendrimer without ODN-1 (Table 2). In addition, further monitoring of the lesions demonstrated that CNV induced vascular leakage remained high for dendrimer without ODN-1 injected eyes (Fig. 7(a.3–5)) compared to dendrimer/ ODN-1 injected eyes (Fig. 7(b.3–5)). Analysis of leakage scores showed that dendrimers 4/ODN-1 maintained a significant reduction (P!0$01) in vascular leakage for up to 2 months post-laser photocoagulation (Table 2). A similar result was recorded for group 1 rats whose eyes were injected with dendrimer 7 with and without ODN-1. FA revealed the development of CNV lesions were more
Fig. 6. Representative fluorescein angiograms of laser lesions. The intensity of fluorescein leakage of other lesions was graded according to this panel: (a) score 0, no leakage; (b) score 1, slight leakage; (c) score 2, moderated leakage and (d) score 3, strong leakage.
its poor transfection efficacy. Dendrimer 7/ODN-1 showed strong and sustained inhibition of VEGF protein but produced only a moderate reduction in the levels of mRNA.
532
R.J. Marano et al. / Experimental Eye Research 79 (2004) 525–535
Fig. 7. Inhibition of CNV by dendrimer4/ODN-1 injected rat eyes that were laser photocoagulated 1 week post-injection. Colour fundus photography showing location of laser lesions (black arrows) in dendrimer 4 without ODN-1 (a.1) and dendrimer 4/ODN-1 (b.1) injected eyes. Corresponding fluorescein angiograms of representative eyes are depicted below at various time points post-laser photocoagulation, (a.2, b.2), 7 days; (a.3, b.3), 21 days; (a.4, b.4) 1 month; (a.5, b.5) 2 months. In eyes treated with dendrimer only (A), strong leakage was detected while eyes treated with dendrimer/ODN-1 (B) leakage remained diffuse and difficult to distinguish.
To explore the potential contribution of wound healing in reducing the severity of CNV a follow up experiment was performed on group 2 rats, whose eyes were pre-injected 2 months before laser induction of CNV. FA angiography performed 14 days after laser photocoagulation showed CNV lesions to be greater in eyes injected with dendrimer 4 without ODN-1 (Fig. 8(a.2)) compared to the contralateral eyes injected with the dendrimer 4/ODN-1 complex (Fig. 8(b.2)). Measurement of lesion scores showed that dendrimer 4/ODN-1 mediated a significant reduction (P! 0$01) in the severity of the CNV lesions (Table 3). Further monitoring by FA 30 days post-laser photocoagulation again showed more pronounced leakage in eyes injected with dendrimer 4 without ODN-1 (Fig. 8(a.3)) compared to the dendrimer 4/ODN-1 injected eyes (Fig. 8(b.3)). Measurement of the leakage also showed the reduction in leakage severity to be significant 30 days after laser photocoagulation (Table 3).
4. Discussion Oligonucleotide gene therapy (OGT) is an attractive alternative to gene transfer therapy. However, limitations associated with OGT include inefficient and or toxic delivery systems in addition to poor longevity of native oligonucleotides. While problems of longevity can be addressed by chemical and structural modifications of the ODN (Urban and Noe, 2003), these approaches have led to separate concerns such as non-specific binding and inhibition of cellular processes (Cohen, 1991; Stein and Cheng, 1993). The use of native ODN’s would be ideal for in vivo use, therefore a delivery agent is required that possesses low toxicity, enhances cellular uptake and provides protection from nuclease. Several types of peptide based delivery systems have been developed and tested for their ability to transport DNA into living cells (Gait, 2003). Binding ODN’s to cationic
Table 2 Measurements of CNV in the eyes of group 1 rats laser ablated 7 days after injection with dendrimer/ODN-1 complexes and dendrimer without ODN-1 Time post-laser (days) 7 21 30 60
Mean scores Dendrimer 4
Dendrimer 4/ODN-1
Dendrimer 7
Dendrimer 7/ODN-1
2$0G0$7 2$66G0$47 2$83G0$37 2$75G0$43
0$25G0$4 0$34G0$05 0 0
1$75G0$08 2$25G0$8 2$75G0$59 2$83G0$37
0 0 0 0
Dendrimer/ODN-1 complexes mediated reductions in CNV severity were significant (P!0$01) for all time points.
R.J. Marano et al. / Experimental Eye Research 79 (2004) 525–535
533
Fig. 8. Inhibition of CNV by dendrimer 4/ODN-1 injected rat eyes that were laser photocoagulated 2 months post-injection. Colour fundus photography showing location of laser lesions (black arrows) in dendrimer 4 without ODN-1 (a.1) and dendrimer 4/ODN-1 (b.1) injected eyes. Corresponding fluorescein angiograms of representative eyes are depicted below at two time points post-laser photocoagulation, (a.2, b.2), 14 days and (a.3, b.3), 1 month. In eyes treated with dendrimer only, strong leakage was detected (white arrows), while in eyes treated with dendrimer 4/ODN-1, leakage remained minimal.
lipopeptides to form peptide/DNA complexes results in DNA condensation and this, in combination with the lipid coating, provides several benefits including enhanced adhesion to the cell surface, improved membrane permeability and protection against endogenous nucleases (Duzgunes and Felgner, 1993; Bloomfield, 1996; Wagner, 1999). We examined several lipid–lysine dendrimers in an attempt to find a structural configuration that provides optimal delivery efficacy and protection of the anti-VEGF oligonucleotide ODN-1 both in vitro and in vivo. The ability of the complexes to pass the cell membrane in vitro was confirmed by FACS analysis on cells transfected by dendrimers complexed with fluorescein tagged ODN-1. Previous studies (Kukowska-Latallo et al., 1996) have shown that dendrimers with a higher number of positive charges possess greater transfection efficacies and this property was also demonstrated by our investigation. ELISA subsequently showed that all of the dendrimers were able to penetrate the nuclear membrane of cultured cells and deliver ODN-1 to the target site on the dsDNA strand, as indicated by the significant inhibition (P!0$05) of VEGF expression in the initial 24 hr period. Inhibition of VEGF expression was further maintained by dendrimer/ODN1complexes 3–8, which indicated a greater protective quality as unprotected/unmodified ODN’s are rapidly degraded by nucleases (Gryaznov et al., 1996). This would lead to increased VEGF concentrations such as that observed for dendrimer/ODN-1 complexes 1–2 and cytofectin/ODN-1, which provides little or not protection. The variation in the reduction in VEGF expression (and hence the protective quality of the dendrimer) during the 24 hr transfection period and the extent to which this reduction was maintained during the 24 hr post-transfection was due, most likely, to differences in the length and number of lipid residues and the number of free amino functions on the polylysines in the structure of the dendrimers. Those dendrimers that contained two C12 Laas (dendrimers 1 and 2), when complexed to ODN-1,
were unable to inhibit VEGF expression during the second 24 hr period, but if that number was increased to three (e.g. dendrimer 3) the level of protection was increased. An inverse relationship was observed when the length of the carbon chains in the dendrimers was increased. Dendrimers 6 and 9 possess three C14 and C18 Laas, respectively. Complexes formed with these dendrimers offered reduced protection during the second 24 hr period, but when the number of Laas in each dendrimer was reduced to two, e.g. dendrimers 4, 7 and 8, the protective quality was restored. By extrapolation, optimal protection and transfection efficacy would be achieved if two C14 Laas and eight free amino groups were included in the structure of the dendrimer. This was the structure described for dendrimer 4 and the complex formed with this dendrimer supports this hypothesis. Cells transfected with dendrimer 4/ODN-1 complex resulted in sustained inhibition of VEGF greater than 50% over a 48 hr period (ELISA) in addition to possessing a relatively high transfection efficacy of 88$9%. This result was further supported by RT-PCR examination, which showed dendrimer 4/ODN-1 transfected cells had a significantly reduced level of VEGF mRNA (PZ0$03) when compared to non-transfected cells. It is important to note that the results described in this report relate only to Table 3 Measurements of CNV in the eyes of group 2 rats laser ablated 2 months after injection with dendrimer 4/ODN-1 and dendrimer 4 without ODN-1 14 days post-laser photocoagulation
30 days post-laser photocoagulation
Dendrimer
Dendrimer/ ODN-1
Dendrimer
Dendrimer/ ODN-1
2$58G0$49
0
2$91G0$27
0$5G0$9
CNV severity was significantly reduced in eyes injected with dendrimer 4 ODN-1 (P!0$01) compared to eyes injected with dendrimer without ODN-1.
534
R.J. Marano et al. / Experimental Eye Research 79 (2004) 525–535
the transfection of ODN-1 into the human RPE cell line D407; results may vary if different cell types are used (Kukowska-Latallo et al., 1996). We have previously demonstrated that unconjugated ODN-1 mediates a reduction in both VEGF protein and mRNA at either the pre or post-transcriptional stage (Garrett et al., 2001). We confirmed that a simmilar mode of action was maintained for dendrimer/ODN-1 complexes using RTPCR, which showed a reduction of VEGF mRNA. However, correlations between the reduction in VEGF expression and transfection efficacies were more difficult to explain. It was assumed that if 100% of the ODN’s reach their target site in the nucleus, then close to 100% inhibition of translation of mRNA should be observed. However, the data obtained from ELISA contradict this assumption. Interestingly, cytofectin achieved the highest transfection efficiency yet produced an equivalent reduction in the levels of expressed VEGF, whilst the complex formed with dendrimer 6 provided the lowest transfection efficiency but was able to produce the greatest reduction of both VEGF protein and mRNA. These variations may be due to either a difference in the dendrimers ability to pass the nuclear membrane in addition to the cellular membrane, or the ability of the dendrimer to present ODN-1 to the target site. In addition, dendrimer 1/ODN-1 resulted in a strong initial decrease in VEGF protein but only a moderate decrease of mRNA for the same period. This provides further evidence of the poor protective qualities of dendrimer 1. As unprotected ODN-1 becomes rapidly degraded by endogenous nucleases (stated above), the resulting effect would lead to and increase in mRNA transcript present for translation, which would occur previous to a detectable increase in the level of protein. This would result in comparatively higher levels of mRNA being present when sampled at 24 hr posttransfection. Similarly, based on ELISA, dendrimer 4 possessed excellent protective qualities, which is reflected in the comparatively lower levels of mRNA. It has been demonstrated in animal models that inhibition of VEGF in vivo leads to reduced levels of angiogenesis (Aiello et al., 1995; Shen and Rakoczy, 2001; Bainbridge et al., 2002). In addition, we have previously shown that intravitreous injections of the S-form of ODN-1 leads to a reduction in the severity of laser induced CNV (Garrett, 2001). Similar to this previous study, rat eyes injected with dendrimer 4 and 7/ODN-1 complexes were monitored for the incidence and severity CNV induced using laser photocoagulation. Eyes treated with both complexes showed zero to slight leakage for up to two months compared with contralateral eyes injected with dendrimer alone, which exhibited moderate to strong leakage for all time points tested. This indicated that dendrimers 4 and 7 successfully delivered ODN-1 to retinal cells and mediated a response similar to that found by Garrett et al. (2001). Inhibition of CNV was subsequently proven to occur through the presence of ODN-1and not due to wound healing after the initial effects of the dendrimer/ODN-1
complex by the rats in the group 2 study. Eyes laser photocoagulated 2 months post-injection and monitored by fluorescein angiography also showed a reduction in the severity of CNV. This evidence suggests that the dendrimer/ ODN-1 complexes persisted in the retinal tissue undergraded for at least the two-month period and maintained its anti-CNV activity. Furthermore, continual ophthalmological examinations of injected rat eyes revealed no observable sign of a toxicological effected caused by the dendrimers or their complexes. In summary we have used solid-phase methods to synthesize a series of lipid-lysine dendrimers that were used to form complexes with the therapeutic oligonucleotide ODN-1. Subsequent studies demonstrated that these synthetic lipophilic charged dendrimers could be used for gene delivery and maintain long-term modulation of gene expression in vivo, thus may become valuable tools for gene therapy.
Acknowledgements This project was supported by funds from the National Health and Medical Research Council (NH&MRC) of Australia and the Welcome Trust. I would also like to thank Matthew Wikstrom for his services on the FACS, Chris Stoddart for his assistance with the statistical analysis, Tammy Zaknich for the photography, Ben Rae for image analysis and Ann Wilson for help with the RT-PCR technique.
References Abe, T., Suzuki, S., et al., 1998. Specific inhibition of influenza virus RNA polymerase and nucleoprotein gene expression by liposomally encapsulated antisense phosphorothioate oligonucleotides in MDCK cells. Antivir. Chem. Chemother. 9, 253–262. Adamis, A.P., Miller, J.W., et al., 1994. Increased vascular endothelial growth factor levels in the vitreous of eyes with proliferative diabetic retinopathy. Am. J. Ophthalmol. 118, 445–450. Aiello, L.P., Pierce, E.A., et al., 1995. Suppression of retinal neovascularization in vivo by inhibition of vascular endothelial growth factor (VEGF) using soluble VEGF-receptor chimeric proteins. Proc. Natl. Acad. Sci. USA 92, 10457–10461. Akhtar, S., Hughes, M.D., et al., 2000. The delivery of antisense therapeutics. Adv. Drug Deliv. Rev. 44, 3–21. Alahari, S.K., Dean, N.M., et al., 1996. Inhibition of expression of the multidrug resistance-associated P-glycoprotein of by phosphorothioate and 5 0 cholesterol-conjugated phosphorothioate antisense oligonucleotides. Mol. Pharmacol. 50, 808–819. Bainbridge, J.W., Mistry, A., et al., 2002. Inhibition of retinal neovascularisation by gene transfer of soluble VEGF receptor sFlt-1. Gene Ther. 9, 320–326. Bloomfield, V.A., 1996. DNA condensation. Curr. Opin. Struct. Biol. 6, 334–341. Cohen, J.S., 1991. Oligonucleotides as therapeutic agents. Pharmacol. Ther. 52, 211–225. Crooke, S.T., 1993. Progress toward oligonucleotide therapeutics: pharmacodynamic properties. Fed. Am. Soc. Exp. Biol. J. 7, 533–539.
R.J. Marano et al. / Experimental Eye Research 79 (2004) 525–535 Duzgunes, N., Felgner, P.L., 1993. Intracellular delivery of nucleic acids and transcription factors by cationic liposomes. Methods Enzymol. 221, 303–306. Forsythe, J.A., Jiang, B.H., et al., 1996. Activation of vascular endothelial growth factor gene transcription by hypoxia-inducible factor 1. Mol. Cell Biol. 16, 4604–4613. Freire, E., Mayorga, O.L., Straume, M., 1990. Isothermal titration. Anal. Chem. 1990;, 950A–959A. Gait, M.J., 2003. Peptide-mediated cellular delivery of antisense oligonucleotides and their analogues. Cell. Mol. Life Sci. 60, 844–853. Garrett, K.L., Shen, W.Y., Rakoczy, P.E., 2001. In vivo use of oligonucleotides to inhibit choroidal neovascularisation in the eye. J. Gene Med. 3, 373–383. Gibbons, W.A., Hughes, R.A., et al., 1990. Synthesis, resolution and structural elucidation of lipidic amino acids and their homo- and heterooligomers. Liebigs Ann. Chem. 1990;, 1175–1183. Gryaznov, S., Skorski, T., et al., 1996. Oligonucleotide N3 0 /P5 0 phosphoramidates as antisense agents. Nucl. Acids Res. 24, 1508–1514. Kukowska-Latallo, J.F., Bielinska, A.U., et al., 1996. Efficient transfer of genetic material into mammalian cells using Starburst polyamidoamine dendrimers. Proc. Natl. Acad. Sci. USA 93, 4897–4902. Kvanta, A., Algvere, P.V., Berglin, L., Seregard, S., 1996. Subfoveal fibrovascular membranes in age-related macular degeneration express vascular endothelial growth factor. Invest. Ophthalmol. Vis. Sci. 37, 1929–1934. Leibowitz, H.M., Krueger, D.E., et al., 1980. The Framingham eye study monograph: an ophthalmological and epidemiological study of cataract, glaucoma, diabetic retinopathy, macular degeneration, and visual acuity in a general population of 2631 adults, 1973–1975. Surv. Ophthalmol. 24, 335–610. Levy, N.S., Goldberg, M.A., Levy, A.P., 1997. Sequencing of the human vascular endothelial growth factor (VEGF) 3 0 untranslated region (UTR): conservation of five hypoxia-inducible RNA-protein binding sites. Biochim. Biophys. Acta. 1352, 167–173.
535
Liu, L.X., Lu, H., et al., 2002. Stabilization of vascular endothelial growth factor mRNA by hypoxia-inducible factor 1. Biochem. Biophys. Res. Commun. 291, 908–914. Lobo, B.A., Rogers, S.A., et al., 2001. Characterisation of cationic vectorbased gene delivery using isothermal titration and differential scanning calorimetry. Methods Mol. Med. 65, 319–348. Merrifield, R.B., 1963. Solid-phase pepitide synthesis. 1. The synthesis of a tetrapeptide. J. Am. Chem. Soc. 85, 2149–2154. Miller, D.L., Dibbens, J.A., et al., 1998. The vascular endothelial growth factor mRNA contains an internal ribosome entry site. Fed. Eur. Biochem. Soc. Lett. 434, 417–420. Shah, D.S., Sakthivel, T., Toth, I., Florence, A.T., Wilderspin, A.F., 2000. DNA transfection and transfected cell viability using amphipathic asymmetric dendrimers. Int. J. Pharm. 208, 41–48. Shen, W.Y., Rakoczy, P.E., 2001. Uptake dynamics and retinal tolerance of phosphorothioate oligonucleotide and its direct delivery into the site of choroidal neovascularization through subretinal administration in the rat. Antisense Nucl. Acid Drug Dev. 11, 257–264. Sommer, A., Tielsch, J.M., et al., 1991. Racial differences in the causespecific prevalence of blindness in east Baltimore. N. Engl. J. Med. 325, 1412–1417. Stein, C.A., Cheng, Y.C., 1993. Antisense oligonucleotides as therapeutic agents—is the bullet really magical?. Science 261, 1004–1012. Tame, J.R.H., O’Brian, R., Ladbury, J.I., Chowdhry, B.Z., 1998. Isothermal titration calorimetry of biomolecules, in: Ladbury, J.I., Chowdhry, B.Z. (Eds.), Biocalorimetry, Applications of Calorimetry in the Biological Sciences. Wiley, Chichester, pp. 27–38. Urban, E., Noe, C.R., 2003. Structural modifications of antisense oligonucleotides. Il Farmaco 58, 243–258. Wagner, E., 1999. Application of membrane-active peptides for nonviral gene delivery. Adv. Drug Deliv. Rev. 38, 279–289. Wimmer, N., Marano, R.J., Kearns, P.S., Rakoczy, E.P., Toth, I., 2002. Syntheses of polycationic dendrimers on lipophilic peptide core for complexation and transport of oligonucleotides. Bioorg. Med. Chem. Lett. 12, 2635–2637.