- Email: [email protected]
Inhibition of Influenza Virus RNA Polymerase and Nucleoprotein Genes Expression by Unmodified, Phosphorothioated, and Liposomally Encapsulated Oligonucleotides
JOBNAME: BBRC 223#2 PAGE: 1 SESS: 8 OUTPUT: Wed Jun 19 13:45:48 1996 /xypage/worksmart/tsp000/72170k/25
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS ARTICLE NO.
223, 341–346 (1996)
0896
Inhibition of Influenza Virus RNA Polymerase and Nucleoprotein Genes Expression by Unmodified, Phosphorothioated, and Liposomally Encapsulated Oligonucleotides Toshifumi Hatta,* Yasushi Nakagawa,† Kazuyuki Takai,* Susumu Nakada,‡ Tomoyuki Yokota,§ and Hiroshi Takaku* *Department of Industrial Chemistry, Chiba Institute of Technology, Tsudanuma, Narashino, Chiba 275, Japan; †Department of Biological Science and Technology, Science University of Tokyo, Noda, Chiba 278, Japan; ‡Institute for Drug Discovery Research, Yamanouchi Pharmaceutical Co., Ltd., Miyukigaoka, Tsukuba, Ibaraki 305, Japan; and §Rational Drug Design Laboratories, Hikarigaoka, Fukushima 960-12, Japan Received April 10, 1996 We have demonstrated that antisense phosphodiester (ODNs) and phosphorothioate oligonucleotides (SODNs) inhibit CAT (chloramphenicol acetyltransferase) protein expression in the clone 76 cell line, which is a derivative of the murine C127 cell line. This cell line expresses the influenza virus RNA polymerase and nucleoprotein (NP) genes in response to treatment with dexamethasone. Phosphodiester, phosphorothioate, and liposomally encapsulated oligonucleotides with four target sites (PB1, PB2, PA, and NP) were synthesized and tested for inhibitory effects by a CAT-ELISA assay using the clone 76 cell line. The ODNs and S-ODNs complementary to the sites of the PB2-AUG and PA-AUG initiation codons showed highly inhibitory effects. On the other hand, the inhibitory effect of the S-ODNs targeted to PB1 was considerably decreased in comparison with the other three target sites. Liposome encapsulation afforded oligomer protection in serumcontaining medium and substantially improved cellular accumulation. The liposomally encapsulated oligonucleotides exhibited higher inhibitory activity than the free oligonucleotides. The activities of the unmodified oligonucleotides are effectively enhanced by using the liposomal carrier. © 1996 Academic Press, Inc.
The use of antisense oligonucleotides as therapeutic tools in modulating gene expression represents a newly established strategy for treating diseases (1). Such oligonucleotides may be designed to complement a region of a particular gene or messenger RNA. Using this approach, oligonucleotides can serve as potential blockers of transcription or translation through sequencespecific hybridization with targeted genetic segments. Antisense oligonucleotides have potential roles in the treatment of AIDS, cancer, influenza virus, herpes simplex virus, and other diseases (2–13). Although viral replication could be inhibited by unmodified oligonucleotides, the problems of nuclease sensitivity and low cellular uptake limit in vivo applications (14, 15). Investigations have been focused on designing more stable oligonucleotide derivatives, such as methylphosphonates (16), phosphorothioates (17), and phosphoramidites (18). Several reports have been published on the development of phosphorothioate oligonucleotides as potential anti-viral therapeutic agents. Although extensive studies of their on molecular mechanisms have highlighted the potential value of this novel therapeutic strategy, very little is known about the in vivo pharmacokinetics and metabolism of these compounds. In this report, we present a detailed analysis of the inhibition of influenza virus RNA polymerase and nucleoprotein gene expression by antisense oligonucleotides (ODNS and S-ODNs), as determined by CAT protein expression (CAT-activity) in the clone 76 cell line (19, 20). We also describe the potential of liposome encapsulation (21). MATERIALS AND METHODS Oligonucleotide synthesis. The oligonucleotides were synthesized by the phosphoramidite method using an Applied Biosystems Model 392 DNA/RNA synthesizer on the 1 mM scale, with controlled pore glass supports. For the oligonucleotides containing a phosphorothioate bond in the two hairpin loops at the 39- and 59-ends, the oxidation step was substituted with a sulfurization procedure using Beaucage’s reagent (22). The oligonucleotide derivatives were purified by 341 0006-291X/96 $18.00 Copyright © 1996 by Academic Press, Inc. All rights of reproduction in any form reserved.
JOBNAME: BBRC 223#2 PAGE: 2 SESS: 8 OUTPUT: Wed Jun 19 13:45:48 1996 /xypage/worksmart/tsp000/72170k/25
Vol. 223, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
reverse phase HPLC on a YMCA column. Extinction coefficients of the oligonucleotides were determined by calculating the theoretical extinction coefficients as the sum of the nucleosides and multiplying with the experimentally determined enzymatic hypochromicity (23). Cells. The murine C127 derivative cell line, clone 76 (19,20), was grown in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal calf serum (FCS). In vitro RNA synthesis. The plasmid pOUMS101 contains the CAT gene sandwiched between the 59- and 39-terminal sequences of the cDNA encoding RNA segment 8 of influenza virus A/PR/8/34 in the antisense orientation of the T7 RNA polymerase (24). Transcription of Mbo II-digested pOUMS101 by T7 RNA polymerase results in the synthesis of the antisense CAT RNA. The template DNA was removed by treatment with DNase I. The RNA transcript was purified by TBE/7 M urea, 5% polyacrylamide gel electrophoresis, elution, and ethanol precipitation in the presence of 3 M sodium acetate. RNA transcription of clone 76 cells. Clone 76 cells, grown in 60 mm dishes and approximately 50% confluent, were treated with 10−6 M dexamethasone in DMEM containing 10% FCS at 37°C. After 24 h, the cells were washed with PBS, a mixture of oligonucleotides and 5 mg of lipofection reagent (N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammoniummethylsulfate, DOTAP, Boehringer Mannheim) in DMEM was added, and the cells were incubated for 4 h at 37°C. The cells were washed with PBS, 100 ng of RNA was mixed with 5 mg of DOTAP in DMEM, and the mixture was incubated for 4 h at 37°C. The medium was changed to fresh DMEM containing 10% FCS and the cells were incubated for a further 20 h. The amount of CAT protein in the cells was monitored by the CAT assay kit (anti-CAT-DIG, Boehringer Mannheim).
RESULTS AND DISCUSSION Influenza virus is a negative strand RNA virus with a segmented genome. Essentially all studies of the transcription and replication of influenza virus have been carried out with A strain viruses, which contain eight virion RNA (vRNA) segments. Three types of virus-specific RNAs are synthesized in infected cells: (1) viral messenger RNAs (mRNAs); (2) full-length copies of the v-RNAs, which serve as templates for vRNA replication; and (3) vRNAs. There is more important information available about the synthetic mechanism of the viral mRNAs than about the synthesis of the template RNAs and vRNAs. Viral mRNA synthesis is catalyzed by viral nucleocapsids (25), which consist of the individual vRNAs associated with four viral proteins, the nucleocapsid (NP) protein, and the three P (PB1, PB2, and PA) proteins (26). The P proteins are responsible for viral mRNA synthesis, and some of their roles have been determined by analyses of in vitro reactions catalyzed by virion nucleocapsids (26–28). The three P proteins form a complex that starts at the 39-ends of the vRNA templates and moves down the templates in association with the elongating mRNA during transcription. The PB2 protein in this complex recognizes and binds to the cap of the primer RNA (26, 27). The PB1 protein, which was initially found at the first residue (a G residue) added onto the primer, moves as part of the P protein complex on the 39-ends of the growing viral mRNA chains, suggesting that it catalyzes nucleotide addition. In addition, the P protein(s) is an endonuclease and may function in viral mRNA synthesis (27). On the other hand, the NP protein is the viral protein required for antitermination (29). Consequently, NP acts by binding to the viral RNA transcript, rather than by binding to the P protein complex and catalyzing transcription. Viral mRNA synthesis is catalyzed by four viral proteins, the nucleocapsid (NP) protein, and the three P (PB1, PB2, and PA) proteins. The viral RNA polymerase (PB1, PB2, PA) and the nucleoprotein (NP) genes of influenza virus A are potential targets for antisense oligonucleotides. We recently developed an in vitro replication system for influenza virus using the clone 76 cell line, in which the viral RNA polymerase (PB1, PB2, PA) and nucleoprotein (NP) genes of influenza virus A can be expressed in response to dexamethasone (19,20). A chimeric NSchloramphenicol acetyltransferase (CAT) RNA, consisting of the full-length negative-strand RNA of the CAT gene positioned between the 59- and 39-terminal sequences of the influenza virus RNA segment 8, can be transcribed in the absence of RNA polymerase in this cell line following transfection (24). To clarify the sequence specificity, we tested the unmodified and modified oligonucleotides containing sense- and antisense sequences as targets of PB1, PB2, PA, and NP, and random 342
JOBNAME: BBRC 223#2 PAGE: 3 SESS: 8 OUTPUT: Wed Jun 19 13:45:48 1996 /xypage/worksmart/tsp000/72170k/25
Vol. 223, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
sequences with the same base composition as the four targets, on the expression of the RNA polymerase and nucleoprotein genes in clone 76 cells (Table 1). We also evaluated the inhibitory effects of free and liposome-encapsulated phosphodiester (ODN) and phosphorothioate (S-ODN) oligonucleotides on influenza virus RNA polymerase and NP genes expression. The in vitro activities of these oligonucleotides on the expression of the influenza virus RNA polymerase and nucleoprotein genes were assessed on the basis of their inhibition of CAT protein expression with the CAT-ELISA method. When we tested the endocapsulated antisense phosphorothioate oligonucleotides containing an AUG initiation codon sequence as the target of PB2 (S-ODN-PB2-as), the targeted AUG initiation codon had the highest inhibitory effect, causing more than 50% inhibition at a 0.03 mM concentration (Table 2). The antisense phosphorothioate oligonucleotides (S-ODN-NP-as), containing the AUG initiation codon sequence targeted to NP, had inhibitory effects similar to that of the AUG initiation codon targeted to PB2. The antisense phosphorothioate oligonucleotides (S-ODN-PA-as), containing the AUG initiation codon sequence targeted to PA, showed 18% inhibition of CAT protein expression at a 0.03 mM concentration, whereas at a 0.3 mM concentration, they had inhibitory effects similar to that of the AUG initiation codon targeted to PB2 and NP. On the other hand, the antisense phosphorothioate oligonucleotides (S-ODN-PB1-as), containing the AUG ini-
TABLE 1 The Targeted mRNA Sequences and Their Complementary DNA Sequences oligonucleotides PB2-mRNA ODN-PB2-as S-ODN-PB2-as ODN-PB2-sen S-ODN-PB2-sen ODN-PB2-ran S-ODN-PB2-ran PB1-mRNA ODN-PB1-as S-ODN-PB1-as S-ODN-PB1-ran PA-mRNA ODN-PA-as S-ODN-PA-as S-ODN-PA-ran NP-mRNA ODN-NP-as S-ODN-NP-as S-ODN-NP-ran
sequences 18 37 UAUAUUCAAUAUGGAAAGAA ATATAAGTTATACCTTTCTT ATATAAGTTATACCTTTCTT TATATTCAATATGGAAAGAA TATATTCAATATGGAAAGAA TATATTAGCATATATTCTTC TATATTAGCATATATTCTTC 15 34 AACCAUUUGAAUGGAUGUCA TTGGTAAACTTACCTACAGT TTGGTAAACTTACCTACAGT CCCATGTTGAGAAGTACGAG 15 34 CUGAUCCAAAAUGGAAGAUU GACTAGGTTTTACCTTCTAA GACTAGGTTTTACCTTCTAA ATGCTTTCAGCTTGAATACT 36 55 CAUCAAAAUCAUGGCGUCCC GTAGTTTTAGTACCGCAGGG GTAGTTTTAGTACCGCAGGG TGTCGCAACTGAGGTGGATT
The oligonucleotide sequence corresponds to the 59 end of the respective mRNA and includes ten nucleotides present upstream of the initiation codon. The phosphorothioate derivatives are denoted by “S” (underlined). Targeted mRNA: 59 to 39 (Italic), Synthetic Oligonucleotides: 39 to 59. Abbreviations: as, antisense-sequence; sen, sense-sequence; ran, random-sequence. 343
JOBNAME: BBRC 223#2 PAGE: 4 SESS: 9 OUTPUT: Wed Jun 19 13:45:48 1996 /xypage/worksmart/tsp000/72170k/25
Vol. 223, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS TABLE 2 Inhibition of Influenza Virus RNA Polymerase and Nucleoprotein Genes Expression by Encapsulated Antisense Oligonucleotides Inhibitory effect (%)b) Oligomera)
0.03 mM
0.3 mM
ODN-PB2-as S-ODN-PB2-as ODN-PB2-sen S-ODN-PB2-sen ODN-PB2-ran S-OD-PB2-ran ODN-PB1-as S-ODN-PB1-as S-ODN-PB1-ran ODN-PA-as S-ODN-PA-as S-ODN-PA-ran ODN-NP-as S-ODN-NP-as S-ODN-NP-ran
46 50 18 <5 9 9 <5 14 <5 <5 18 <5 50 52 <5
51 59 <5 17 <5 <5 <5 14 <5 30 59 <5 55 58 <5
a)
The antisense sequences are described in Table 1. The inhibitory effects are given as the percentage of inhibition of CAT protein expression, and are compared and normalized to 100% CAT protein expression. b)
tiation codon targeted to PB1, showed lower anti-CAT-activity at 0.03-0.3 mM concentrations. The PB1 gene was not available as an antisense target. Of particular interest are the endocapsulated antisense phosphodiester oligonucleotides, which were found to have anti-CAT-activities of the same order as those for the endocapsulated antisense phosphorothioate oligonucleotides, probably due mainly to their relative nuclease resistance in culture medium (Table 2) (30, 31). For the senseand random-oligonucleotides, we could not detect any inhibitory effects on the target AUG initiation codon. These results suggest that the endocapsulated antisense phosphorothioate oligonucleotide conferred sequence specific inhibition (Table 2). Furthermore, S-ODN-PB2-as, S-ODN-PB1-as, and S-ODN-PA-as showed increased inhibition efficiency with an increase in the endocapsulated antisense phosphorothioate oligonucleotides (Fig. 1). However, S-ODN-NP-as exhibited the same inhibitory effect at different concentrations. Next, we investigated the inhibition of CAT protein expression by free antisense phosphorothioate oligonucleotides on RNA polymerase and nucleoprotein genes expression in clone 76 cells. Surprisingly, the free antisense phosphorothioate oligonucleotides had reduced effective dosages in clone 76 cells expressing the viral RNA polymerase and NP genes (Table 3). The free antisense phosphorothioate oligonucleotide had very poor delivery efficiency into the clone 76 cells. On the other hand, the antisense phosphodiester oligonucleotides had no detectable inhibitory effect in their free form, apparently because they were degraded in the culture medium (data not shown). These results suggest that the increased cell association of the oligonucleotides can explain the enhanced antisense oligonucleotide effect in the presence of DOTAP. Thus, in the presence of DOTAP, the oligonucleotide first enters the cytoplasm and then quickly accumulates in the nucleus (32). Moreover, DOTAP may also increase the activity of the antisense oligonucleotide by increasing the rate of association for specific binding to RNA or DNA. Pontius et al. (33) demonstrated that some cationic detergents can enhance DNA renaturation over 104 fold, and have DNA double-helix-stabilizing properties. 344
JOBNAME: BBRC 223#2 PAGE: 5 SESS: 9 OUTPUT: Wed Jun 19 13:45:48 1996 /xypage/worksmart/tsp000/72170k/25
Vol. 223, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 1. Inhibitory effects of encapsulated phosphorothioate oligonucleotides [S-ODNs-PB2-as (M), S-ODNs-PB1-as (r), S-ODNs-PA-as (m), and S-ODNs-NP-as (e)] on influenza virus RNA polymerase and nucleoprotein genes expression in clone 76 cells. The clone 76 cells were incubated with various concentrations of oligonucleotides. Data are given as percentage of inhibition of CAT expression, and are compared and normalized to 100% CAT expression.
In conclusion, the antisense oligonucleotides containing the AUG initiation codon targeted to the PB2 gene (the PB2 protein recognizes and binds to the cap-1 structure of the primer RNA) and the PA gene (the PA protein is present in the elongation complex with the PB1 and PB2 proteins during transcription) showed the greatest inhibition of influenza virus RNA polymerase and nucleoprotein of gene expression in clone 76 cells. Furthermore, the use of cationic lipids provides a simple and successful method for intracellular delivery of the oligonucleotides. Long-term vaccination approaches have failed mainly because of the high degree of antigenic variation among influenza viruses. Amantadine and its analogue rimantadine are useful drugs for prophylaxis against certain strains of influenza A virus, but acquisition of resistance is seen frequently and is not associated with attenuation. Consequently, these antisense oligonucleotides may be useful as antiviral agents.
TABLE 3 Inhibition of Influenza Virus RNA Polymerase and Nucleoprotein Genes Expression by Free Antisense Phosphorothioate Oligonucleotides Inhibitory effect (%)b) Oligomera)
0.03 mM
0.3 mM
S-ODN-PB2-as S-OD-PB2-ran S-ODN-PB1-as S-ODN-PB1-ran SODN-PA-as S-ODN-PA-ran S-ODN-NP-as S-ODN-NP-ran
<5 <5 <5 <5 <5 <5 11 <5
16 <5 <5 <5 19 <5 12 <5
a)
The antisense sequences are described in Table 1. The inhibitory effects are given as the percentage of inhibition of CAT protein expression, and are compared and normalized to 100% CAT protein expression. b)
345
JOBNAME: BBRC 223#2 PAGE: 6 SESS: 8 OUTPUT: Wed Jun 19 13:45:48 1996 /xypage/worksmart/tsp000/72170k/25
Vol. 223, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
ACKNOWLEDGMENTS This work was supported by a Grant-in-Aid for Scientific Research on Priority Areas from the Ministry of Education, Science and Culture, Japan, and by the Sasakawa Scientific Research Grant from The Japan Science Society.
REFERENCES 1. Rothenberg, M., Johnson, G., Laughlin, C., Green, I., Gradock, I., Sarver, N., and Chen, J. S. (1989) J. Natl. Cancer Inst. 81, 1538–1544. 2. Zamecnik, P. C., and Stephenson, M. L. (1978) Proc. Natl. Acad. Sci. USA 75, 280–28. 3. Zamecnik, P. C., Goodchild, J., Taguchi, Y., and Sarin, P. S. (1986) Proc. Natl. Acad. Sci. USA 83, 4143–4146. 4. Matsukura, M., Shinozuka, K., Zon, G., Mitsuya, H., Reit, M., Cohen, J. C., and Broder, S. (1987) Proc. Natl. Acad. Sci. USA 84, 7706–7710. 5. Kim, S.-G., Suzuki, Y., Nakashima, H., Yamamoto, N., and Takaku, H. (1991) Biochem. Biophys. Res. Commun. 179, 1614–1619. 6. Kim, S.-G., Kanbara, K., Nakashima, H., Yamamoto, N., Murakami, K., and Takaku, H. (1993) Bioorg. Med. Chem. Lett. 3, 1223–1228. 7. Whitesell, L., Rosolen, A, and Neckers, L. M. (1991) Prog. Clin. Biol. Res. 360, 45–54. 8. Simons, M., Edelman, E. R., DeKeyser, J.-L., Langer, R., and Rosenberg, R. D. (1992) Nature 359, 67–70. 9. Miller, P. S., Agris, C. H., Aurelian, L., Blake, K. R., Murakami, A., Reddy, M. P., Spitz, S. A., and Ts’o, P. O. P. (1985) Biochimie 67, 769–776. 10. Smith, C. C., Aurelian, L., Reddy, M. P., Miller, P. S., and Ts’o, P. O. P. (1986) Proc. Natl. Acad. Sci. USA 83, 2787–2791. 11. Zerial, A., Thuong, N. T., and Hélène, C. (1987) Nucleic Acids Res. 5, 9909–9919. 12. Leiter, J. M. E., Agrawal, S., Palese, P., and Zamecnik, P. C. (1990) Proc. Natl. Acad. Sci. USA 87, 3430–3434. 13. Storski, T., Nieborowska-Skorska, M., Nicolaides, N. C., Szczylik, C., and Iversen, P. (1994) Proc. Natl. Acad. Sci. USA 91, 4504–4508. 14. Hélène, C., and Toulmé, J. J. (1990) Biochem. Biophys. Acta 149, 99–125. 15. Erickson, R. P., and Izant, J. G. (1922) Gene Regulation: Biology of Antisense RNA and DNA Raven Press, London. 16. Miller, P. S., McParland, K. B., Yayaraman, N., and Ts’o, P. O. P. (1981) Biochim. 20, 1874–1880. 17. Stec, W., Zon, G., Egan, W., and Stec, B. (1984) J. Am. Chem. Soc. 106, 6077–6079. 18. Wickstroms, E. L., Bacon, T. A., Gonzalez, A., Freeman, D. L., Lyman, G. H., and Wickstrom, E. (1988) Proc. Natl. Acad. Sci. USA 85, 1028–1032. 19. Nakamura, Y., Oda, K., and Nakada, S. (1991) J. Biochem. 110, 395–401. 20. Kimura, N., Nishida, M., Nagata, K., Ishihama, A., Oda, K., and Nakada, S. (1992) J. General Virol. 73, 1321–1328. 21. Thierry, A. R., and Dritschilo, A. (1992) Nucleic Acids Res. 21, 5691–5698. 22. Iyer, R. P., Phillips, L. R., Egan, W., Regan, J. B., and Beaucage, S. L. (1990) J. Org. Chem. 55, 4693–4698. 23. Newman, P. C., Nwosu, V. U., Williams, D. M., Cosstick, R., Seela, F., and Connolly, B. A., Biochemistry 29, 9891–9901. 24. Yamanaka, K., Ogasawara, N., Yoshikawa, H., Ishihama, A., and Nagata, K. (1991) Proc. Natl. Acad. Sci. USA 88, 5369–5373. 25. Plotch, S. J., Bouloy, M., Ulmanen, I., and Krug, R. M. (1981) Cell 23, 847–858. 26. Ulmanen, I., Broni, B., and Krug, R. M. (1981) Proc. Natl. Acad. Sci. USA 78, 7355–7359. 27. Braam, J., Ulmanen, I., and Krug, R. M. (1983) Cell 34, 609–618. 28. Ulmanen, I., Broni, B., and Krug, R. M. (1981) J. Virol. 45, 27–35. 29. Beaton, A. R., and Krug, R. M. (1986) Proc. Natl. Acad. Sci. USA 83, 6282–6286. 30. Leonetti, J. P., Machy, P., Degols, G., Lebleu, B., and Leserman, L. (1990) Proc. Natl. Acad. Sci. USA 87, 2448–2451. 31. Thierry, A. R., and Dritschilo, A. (1992) Nucleic Acids Res. 20, 5691–5698. 32. Bennett, C. F., Chaing, M.-Y., Chang, H., Schoemaker, J. E., and Mirabelli, C. K. (1992) Mol. Pharmacol. 41, 1023– 1033. 33. Pontius, B., and Berg, P. (1991) Proc. Natl. Acad. Sci. USA 88, 8237–8241.
346
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS ARTICLE NO.
223, 341–346 (1996)
0896
Inhibition of Influenza Virus RNA Polymerase and Nucleoprotein Genes Expression by Unmodified, Phosphorothioated, and Liposomally Encapsulated Oligonucleotides Toshifumi Hatta,* Yasushi Nakagawa,† Kazuyuki Takai,* Susumu Nakada,‡ Tomoyuki Yokota,§ and Hiroshi Takaku* *Department of Industrial Chemistry, Chiba Institute of Technology, Tsudanuma, Narashino, Chiba 275, Japan; †Department of Biological Science and Technology, Science University of Tokyo, Noda, Chiba 278, Japan; ‡Institute for Drug Discovery Research, Yamanouchi Pharmaceutical Co., Ltd., Miyukigaoka, Tsukuba, Ibaraki 305, Japan; and §Rational Drug Design Laboratories, Hikarigaoka, Fukushima 960-12, Japan Received April 10, 1996 We have demonstrated that antisense phosphodiester (ODNs) and phosphorothioate oligonucleotides (SODNs) inhibit CAT (chloramphenicol acetyltransferase) protein expression in the clone 76 cell line, which is a derivative of the murine C127 cell line. This cell line expresses the influenza virus RNA polymerase and nucleoprotein (NP) genes in response to treatment with dexamethasone. Phosphodiester, phosphorothioate, and liposomally encapsulated oligonucleotides with four target sites (PB1, PB2, PA, and NP) were synthesized and tested for inhibitory effects by a CAT-ELISA assay using the clone 76 cell line. The ODNs and S-ODNs complementary to the sites of the PB2-AUG and PA-AUG initiation codons showed highly inhibitory effects. On the other hand, the inhibitory effect of the S-ODNs targeted to PB1 was considerably decreased in comparison with the other three target sites. Liposome encapsulation afforded oligomer protection in serumcontaining medium and substantially improved cellular accumulation. The liposomally encapsulated oligonucleotides exhibited higher inhibitory activity than the free oligonucleotides. The activities of the unmodified oligonucleotides are effectively enhanced by using the liposomal carrier. © 1996 Academic Press, Inc.
The use of antisense oligonucleotides as therapeutic tools in modulating gene expression represents a newly established strategy for treating diseases (1). Such oligonucleotides may be designed to complement a region of a particular gene or messenger RNA. Using this approach, oligonucleotides can serve as potential blockers of transcription or translation through sequencespecific hybridization with targeted genetic segments. Antisense oligonucleotides have potential roles in the treatment of AIDS, cancer, influenza virus, herpes simplex virus, and other diseases (2–13). Although viral replication could be inhibited by unmodified oligonucleotides, the problems of nuclease sensitivity and low cellular uptake limit in vivo applications (14, 15). Investigations have been focused on designing more stable oligonucleotide derivatives, such as methylphosphonates (16), phosphorothioates (17), and phosphoramidites (18). Several reports have been published on the development of phosphorothioate oligonucleotides as potential anti-viral therapeutic agents. Although extensive studies of their on molecular mechanisms have highlighted the potential value of this novel therapeutic strategy, very little is known about the in vivo pharmacokinetics and metabolism of these compounds. In this report, we present a detailed analysis of the inhibition of influenza virus RNA polymerase and nucleoprotein gene expression by antisense oligonucleotides (ODNS and S-ODNs), as determined by CAT protein expression (CAT-activity) in the clone 76 cell line (19, 20). We also describe the potential of liposome encapsulation (21). MATERIALS AND METHODS Oligonucleotide synthesis. The oligonucleotides were synthesized by the phosphoramidite method using an Applied Biosystems Model 392 DNA/RNA synthesizer on the 1 mM scale, with controlled pore glass supports. For the oligonucleotides containing a phosphorothioate bond in the two hairpin loops at the 39- and 59-ends, the oxidation step was substituted with a sulfurization procedure using Beaucage’s reagent (22). The oligonucleotide derivatives were purified by 341 0006-291X/96 $18.00 Copyright © 1996 by Academic Press, Inc. All rights of reproduction in any form reserved.
JOBNAME: BBRC 223#2 PAGE: 2 SESS: 8 OUTPUT: Wed Jun 19 13:45:48 1996 /xypage/worksmart/tsp000/72170k/25
Vol. 223, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
reverse phase HPLC on a YMCA column. Extinction coefficients of the oligonucleotides were determined by calculating the theoretical extinction coefficients as the sum of the nucleosides and multiplying with the experimentally determined enzymatic hypochromicity (23). Cells. The murine C127 derivative cell line, clone 76 (19,20), was grown in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal calf serum (FCS). In vitro RNA synthesis. The plasmid pOUMS101 contains the CAT gene sandwiched between the 59- and 39-terminal sequences of the cDNA encoding RNA segment 8 of influenza virus A/PR/8/34 in the antisense orientation of the T7 RNA polymerase (24). Transcription of Mbo II-digested pOUMS101 by T7 RNA polymerase results in the synthesis of the antisense CAT RNA. The template DNA was removed by treatment with DNase I. The RNA transcript was purified by TBE/7 M urea, 5% polyacrylamide gel electrophoresis, elution, and ethanol precipitation in the presence of 3 M sodium acetate. RNA transcription of clone 76 cells. Clone 76 cells, grown in 60 mm dishes and approximately 50% confluent, were treated with 10−6 M dexamethasone in DMEM containing 10% FCS at 37°C. After 24 h, the cells were washed with PBS, a mixture of oligonucleotides and 5 mg of lipofection reagent (N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammoniummethylsulfate, DOTAP, Boehringer Mannheim) in DMEM was added, and the cells were incubated for 4 h at 37°C. The cells were washed with PBS, 100 ng of RNA was mixed with 5 mg of DOTAP in DMEM, and the mixture was incubated for 4 h at 37°C. The medium was changed to fresh DMEM containing 10% FCS and the cells were incubated for a further 20 h. The amount of CAT protein in the cells was monitored by the CAT assay kit (anti-CAT-DIG, Boehringer Mannheim).
RESULTS AND DISCUSSION Influenza virus is a negative strand RNA virus with a segmented genome. Essentially all studies of the transcription and replication of influenza virus have been carried out with A strain viruses, which contain eight virion RNA (vRNA) segments. Three types of virus-specific RNAs are synthesized in infected cells: (1) viral messenger RNAs (mRNAs); (2) full-length copies of the v-RNAs, which serve as templates for vRNA replication; and (3) vRNAs. There is more important information available about the synthetic mechanism of the viral mRNAs than about the synthesis of the template RNAs and vRNAs. Viral mRNA synthesis is catalyzed by viral nucleocapsids (25), which consist of the individual vRNAs associated with four viral proteins, the nucleocapsid (NP) protein, and the three P (PB1, PB2, and PA) proteins (26). The P proteins are responsible for viral mRNA synthesis, and some of their roles have been determined by analyses of in vitro reactions catalyzed by virion nucleocapsids (26–28). The three P proteins form a complex that starts at the 39-ends of the vRNA templates and moves down the templates in association with the elongating mRNA during transcription. The PB2 protein in this complex recognizes and binds to the cap of the primer RNA (26, 27). The PB1 protein, which was initially found at the first residue (a G residue) added onto the primer, moves as part of the P protein complex on the 39-ends of the growing viral mRNA chains, suggesting that it catalyzes nucleotide addition. In addition, the P protein(s) is an endonuclease and may function in viral mRNA synthesis (27). On the other hand, the NP protein is the viral protein required for antitermination (29). Consequently, NP acts by binding to the viral RNA transcript, rather than by binding to the P protein complex and catalyzing transcription. Viral mRNA synthesis is catalyzed by four viral proteins, the nucleocapsid (NP) protein, and the three P (PB1, PB2, and PA) proteins. The viral RNA polymerase (PB1, PB2, PA) and the nucleoprotein (NP) genes of influenza virus A are potential targets for antisense oligonucleotides. We recently developed an in vitro replication system for influenza virus using the clone 76 cell line, in which the viral RNA polymerase (PB1, PB2, PA) and nucleoprotein (NP) genes of influenza virus A can be expressed in response to dexamethasone (19,20). A chimeric NSchloramphenicol acetyltransferase (CAT) RNA, consisting of the full-length negative-strand RNA of the CAT gene positioned between the 59- and 39-terminal sequences of the influenza virus RNA segment 8, can be transcribed in the absence of RNA polymerase in this cell line following transfection (24). To clarify the sequence specificity, we tested the unmodified and modified oligonucleotides containing sense- and antisense sequences as targets of PB1, PB2, PA, and NP, and random 342
JOBNAME: BBRC 223#2 PAGE: 3 SESS: 8 OUTPUT: Wed Jun 19 13:45:48 1996 /xypage/worksmart/tsp000/72170k/25
Vol. 223, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
sequences with the same base composition as the four targets, on the expression of the RNA polymerase and nucleoprotein genes in clone 76 cells (Table 1). We also evaluated the inhibitory effects of free and liposome-encapsulated phosphodiester (ODN) and phosphorothioate (S-ODN) oligonucleotides on influenza virus RNA polymerase and NP genes expression. The in vitro activities of these oligonucleotides on the expression of the influenza virus RNA polymerase and nucleoprotein genes were assessed on the basis of their inhibition of CAT protein expression with the CAT-ELISA method. When we tested the endocapsulated antisense phosphorothioate oligonucleotides containing an AUG initiation codon sequence as the target of PB2 (S-ODN-PB2-as), the targeted AUG initiation codon had the highest inhibitory effect, causing more than 50% inhibition at a 0.03 mM concentration (Table 2). The antisense phosphorothioate oligonucleotides (S-ODN-NP-as), containing the AUG initiation codon sequence targeted to NP, had inhibitory effects similar to that of the AUG initiation codon targeted to PB2. The antisense phosphorothioate oligonucleotides (S-ODN-PA-as), containing the AUG initiation codon sequence targeted to PA, showed 18% inhibition of CAT protein expression at a 0.03 mM concentration, whereas at a 0.3 mM concentration, they had inhibitory effects similar to that of the AUG initiation codon targeted to PB2 and NP. On the other hand, the antisense phosphorothioate oligonucleotides (S-ODN-PB1-as), containing the AUG ini-
TABLE 1 The Targeted mRNA Sequences and Their Complementary DNA Sequences oligonucleotides PB2-mRNA ODN-PB2-as S-ODN-PB2-as ODN-PB2-sen S-ODN-PB2-sen ODN-PB2-ran S-ODN-PB2-ran PB1-mRNA ODN-PB1-as S-ODN-PB1-as S-ODN-PB1-ran PA-mRNA ODN-PA-as S-ODN-PA-as S-ODN-PA-ran NP-mRNA ODN-NP-as S-ODN-NP-as S-ODN-NP-ran
sequences 18 37 UAUAUUCAAUAUGGAAAGAA ATATAAGTTATACCTTTCTT ATATAAGTTATACCTTTCTT TATATTCAATATGGAAAGAA TATATTCAATATGGAAAGAA TATATTAGCATATATTCTTC TATATTAGCATATATTCTTC 15 34 AACCAUUUGAAUGGAUGUCA TTGGTAAACTTACCTACAGT TTGGTAAACTTACCTACAGT CCCATGTTGAGAAGTACGAG 15 34 CUGAUCCAAAAUGGAAGAUU GACTAGGTTTTACCTTCTAA GACTAGGTTTTACCTTCTAA ATGCTTTCAGCTTGAATACT 36 55 CAUCAAAAUCAUGGCGUCCC GTAGTTTTAGTACCGCAGGG GTAGTTTTAGTACCGCAGGG TGTCGCAACTGAGGTGGATT
The oligonucleotide sequence corresponds to the 59 end of the respective mRNA and includes ten nucleotides present upstream of the initiation codon. The phosphorothioate derivatives are denoted by “S” (underlined). Targeted mRNA: 59 to 39 (Italic), Synthetic Oligonucleotides: 39 to 59. Abbreviations: as, antisense-sequence; sen, sense-sequence; ran, random-sequence. 343
JOBNAME: BBRC 223#2 PAGE: 4 SESS: 9 OUTPUT: Wed Jun 19 13:45:48 1996 /xypage/worksmart/tsp000/72170k/25
Vol. 223, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS TABLE 2 Inhibition of Influenza Virus RNA Polymerase and Nucleoprotein Genes Expression by Encapsulated Antisense Oligonucleotides Inhibitory effect (%)b) Oligomera)
0.03 mM
0.3 mM
ODN-PB2-as S-ODN-PB2-as ODN-PB2-sen S-ODN-PB2-sen ODN-PB2-ran S-OD-PB2-ran ODN-PB1-as S-ODN-PB1-as S-ODN-PB1-ran ODN-PA-as S-ODN-PA-as S-ODN-PA-ran ODN-NP-as S-ODN-NP-as S-ODN-NP-ran
46 50 18 <5 9 9 <5 14 <5 <5 18 <5 50 52 <5
51 59 <5 17 <5 <5 <5 14 <5 30 59 <5 55 58 <5
a)
The antisense sequences are described in Table 1. The inhibitory effects are given as the percentage of inhibition of CAT protein expression, and are compared and normalized to 100% CAT protein expression. b)
tiation codon targeted to PB1, showed lower anti-CAT-activity at 0.03-0.3 mM concentrations. The PB1 gene was not available as an antisense target. Of particular interest are the endocapsulated antisense phosphodiester oligonucleotides, which were found to have anti-CAT-activities of the same order as those for the endocapsulated antisense phosphorothioate oligonucleotides, probably due mainly to their relative nuclease resistance in culture medium (Table 2) (30, 31). For the senseand random-oligonucleotides, we could not detect any inhibitory effects on the target AUG initiation codon. These results suggest that the endocapsulated antisense phosphorothioate oligonucleotide conferred sequence specific inhibition (Table 2). Furthermore, S-ODN-PB2-as, S-ODN-PB1-as, and S-ODN-PA-as showed increased inhibition efficiency with an increase in the endocapsulated antisense phosphorothioate oligonucleotides (Fig. 1). However, S-ODN-NP-as exhibited the same inhibitory effect at different concentrations. Next, we investigated the inhibition of CAT protein expression by free antisense phosphorothioate oligonucleotides on RNA polymerase and nucleoprotein genes expression in clone 76 cells. Surprisingly, the free antisense phosphorothioate oligonucleotides had reduced effective dosages in clone 76 cells expressing the viral RNA polymerase and NP genes (Table 3). The free antisense phosphorothioate oligonucleotide had very poor delivery efficiency into the clone 76 cells. On the other hand, the antisense phosphodiester oligonucleotides had no detectable inhibitory effect in their free form, apparently because they were degraded in the culture medium (data not shown). These results suggest that the increased cell association of the oligonucleotides can explain the enhanced antisense oligonucleotide effect in the presence of DOTAP. Thus, in the presence of DOTAP, the oligonucleotide first enters the cytoplasm and then quickly accumulates in the nucleus (32). Moreover, DOTAP may also increase the activity of the antisense oligonucleotide by increasing the rate of association for specific binding to RNA or DNA. Pontius et al. (33) demonstrated that some cationic detergents can enhance DNA renaturation over 104 fold, and have DNA double-helix-stabilizing properties. 344
JOBNAME: BBRC 223#2 PAGE: 5 SESS: 9 OUTPUT: Wed Jun 19 13:45:48 1996 /xypage/worksmart/tsp000/72170k/25
Vol. 223, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 1. Inhibitory effects of encapsulated phosphorothioate oligonucleotides [S-ODNs-PB2-as (M), S-ODNs-PB1-as (r), S-ODNs-PA-as (m), and S-ODNs-NP-as (e)] on influenza virus RNA polymerase and nucleoprotein genes expression in clone 76 cells. The clone 76 cells were incubated with various concentrations of oligonucleotides. Data are given as percentage of inhibition of CAT expression, and are compared and normalized to 100% CAT expression.
In conclusion, the antisense oligonucleotides containing the AUG initiation codon targeted to the PB2 gene (the PB2 protein recognizes and binds to the cap-1 structure of the primer RNA) and the PA gene (the PA protein is present in the elongation complex with the PB1 and PB2 proteins during transcription) showed the greatest inhibition of influenza virus RNA polymerase and nucleoprotein of gene expression in clone 76 cells. Furthermore, the use of cationic lipids provides a simple and successful method for intracellular delivery of the oligonucleotides. Long-term vaccination approaches have failed mainly because of the high degree of antigenic variation among influenza viruses. Amantadine and its analogue rimantadine are useful drugs for prophylaxis against certain strains of influenza A virus, but acquisition of resistance is seen frequently and is not associated with attenuation. Consequently, these antisense oligonucleotides may be useful as antiviral agents.
TABLE 3 Inhibition of Influenza Virus RNA Polymerase and Nucleoprotein Genes Expression by Free Antisense Phosphorothioate Oligonucleotides Inhibitory effect (%)b) Oligomera)
0.03 mM
0.3 mM
S-ODN-PB2-as S-OD-PB2-ran S-ODN-PB1-as S-ODN-PB1-ran SODN-PA-as S-ODN-PA-ran S-ODN-NP-as S-ODN-NP-ran
<5 <5 <5 <5 <5 <5 11 <5
16 <5 <5 <5 19 <5 12 <5
a)
The antisense sequences are described in Table 1. The inhibitory effects are given as the percentage of inhibition of CAT protein expression, and are compared and normalized to 100% CAT protein expression. b)
345
JOBNAME: BBRC 223#2 PAGE: 6 SESS: 8 OUTPUT: Wed Jun 19 13:45:48 1996 /xypage/worksmart/tsp000/72170k/25
Vol. 223, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
ACKNOWLEDGMENTS This work was supported by a Grant-in-Aid for Scientific Research on Priority Areas from the Ministry of Education, Science and Culture, Japan, and by the Sasakawa Scientific Research Grant from The Japan Science Society.
REFERENCES 1. Rothenberg, M., Johnson, G., Laughlin, C., Green, I., Gradock, I., Sarver, N., and Chen, J. S. (1989) J. Natl. Cancer Inst. 81, 1538–1544. 2. Zamecnik, P. C., and Stephenson, M. L. (1978) Proc. Natl. Acad. Sci. USA 75, 280–28. 3. Zamecnik, P. C., Goodchild, J., Taguchi, Y., and Sarin, P. S. (1986) Proc. Natl. Acad. Sci. USA 83, 4143–4146. 4. Matsukura, M., Shinozuka, K., Zon, G., Mitsuya, H., Reit, M., Cohen, J. C., and Broder, S. (1987) Proc. Natl. Acad. Sci. USA 84, 7706–7710. 5. Kim, S.-G., Suzuki, Y., Nakashima, H., Yamamoto, N., and Takaku, H. (1991) Biochem. Biophys. Res. Commun. 179, 1614–1619. 6. Kim, S.-G., Kanbara, K., Nakashima, H., Yamamoto, N., Murakami, K., and Takaku, H. (1993) Bioorg. Med. Chem. Lett. 3, 1223–1228. 7. Whitesell, L., Rosolen, A, and Neckers, L. M. (1991) Prog. Clin. Biol. Res. 360, 45–54. 8. Simons, M., Edelman, E. R., DeKeyser, J.-L., Langer, R., and Rosenberg, R. D. (1992) Nature 359, 67–70. 9. Miller, P. S., Agris, C. H., Aurelian, L., Blake, K. R., Murakami, A., Reddy, M. P., Spitz, S. A., and Ts’o, P. O. P. (1985) Biochimie 67, 769–776. 10. Smith, C. C., Aurelian, L., Reddy, M. P., Miller, P. S., and Ts’o, P. O. P. (1986) Proc. Natl. Acad. Sci. USA 83, 2787–2791. 11. Zerial, A., Thuong, N. T., and Hélène, C. (1987) Nucleic Acids Res. 5, 9909–9919. 12. Leiter, J. M. E., Agrawal, S., Palese, P., and Zamecnik, P. C. (1990) Proc. Natl. Acad. Sci. USA 87, 3430–3434. 13. Storski, T., Nieborowska-Skorska, M., Nicolaides, N. C., Szczylik, C., and Iversen, P. (1994) Proc. Natl. Acad. Sci. USA 91, 4504–4508. 14. Hélène, C., and Toulmé, J. J. (1990) Biochem. Biophys. Acta 149, 99–125. 15. Erickson, R. P., and Izant, J. G. (1922) Gene Regulation: Biology of Antisense RNA and DNA Raven Press, London. 16. Miller, P. S., McParland, K. B., Yayaraman, N., and Ts’o, P. O. P. (1981) Biochim. 20, 1874–1880. 17. Stec, W., Zon, G., Egan, W., and Stec, B. (1984) J. Am. Chem. Soc. 106, 6077–6079. 18. Wickstroms, E. L., Bacon, T. A., Gonzalez, A., Freeman, D. L., Lyman, G. H., and Wickstrom, E. (1988) Proc. Natl. Acad. Sci. USA 85, 1028–1032. 19. Nakamura, Y., Oda, K., and Nakada, S. (1991) J. Biochem. 110, 395–401. 20. Kimura, N., Nishida, M., Nagata, K., Ishihama, A., Oda, K., and Nakada, S. (1992) J. General Virol. 73, 1321–1328. 21. Thierry, A. R., and Dritschilo, A. (1992) Nucleic Acids Res. 21, 5691–5698. 22. Iyer, R. P., Phillips, L. R., Egan, W., Regan, J. B., and Beaucage, S. L. (1990) J. Org. Chem. 55, 4693–4698. 23. Newman, P. C., Nwosu, V. U., Williams, D. M., Cosstick, R., Seela, F., and Connolly, B. A., Biochemistry 29, 9891–9901. 24. Yamanaka, K., Ogasawara, N., Yoshikawa, H., Ishihama, A., and Nagata, K. (1991) Proc. Natl. Acad. Sci. USA 88, 5369–5373. 25. Plotch, S. J., Bouloy, M., Ulmanen, I., and Krug, R. M. (1981) Cell 23, 847–858. 26. Ulmanen, I., Broni, B., and Krug, R. M. (1981) Proc. Natl. Acad. Sci. USA 78, 7355–7359. 27. Braam, J., Ulmanen, I., and Krug, R. M. (1983) Cell 34, 609–618. 28. Ulmanen, I., Broni, B., and Krug, R. M. (1981) J. Virol. 45, 27–35. 29. Beaton, A. R., and Krug, R. M. (1986) Proc. Natl. Acad. Sci. USA 83, 6282–6286. 30. Leonetti, J. P., Machy, P., Degols, G., Lebleu, B., and Leserman, L. (1990) Proc. Natl. Acad. Sci. USA 87, 2448–2451. 31. Thierry, A. R., and Dritschilo, A. (1992) Nucleic Acids Res. 20, 5691–5698. 32. Bennett, C. F., Chaing, M.-Y., Chang, H., Schoemaker, J. E., and Mirabelli, C. K. (1992) Mol. Pharmacol. 41, 1023– 1033. 33. Pontius, B., and Berg, P. (1991) Proc. Natl. Acad. Sci. USA 88, 8237–8241.
346