- Email: [email protected]
Inhibition of LOX-1 prevents inflammation and photoreceptor cell death in retinal degeneration
International Immunopharmacology 80 (2020) 106190
Contents lists available at ScienceDirect
International Immunopharmacology journal homepage: www.elsevier.com/locate/intimp
Inhibition of LOX-1 prevents inflammation and photoreceptor cell death in retinal degeneration Xinran Gao, Ruilin Zhu, Jiantong Du, Wenbo Zhang, Wenna Gao, Liu Yang
T
⁎
Department of Ophthalmology, Peking University First Hospital, Beijing 100034, China
A R T I C LE I N FO
A B S T R A C T
Keywords: LOX-1 Inflammation Photoreceptor cell death Retinal degeneration Light damage
Purpose: To explore the expression and role of lectin-like oxidized low-density lipoprotein receptor 1 (LOX-1) in retinal degeneration. Methods: The retinal degeneration of BALB/c mice was induced by light exposure. BV2 cells were activated by LPS stimulation. Retinas or BV2 cells were pretreated with LOX-1 neutralizing antibody or Polyinosinic acid (PolyI) (the inhibitor of LOX-1) before light damage (LD) or LPS stimulation. LOX-1, TNF-α, IL-1β, CCL2 and NFκB expression were detected in retinas or BV2 cells by real-time RT-PCR, western blot or ELISA. Histological analyses of retinas were performed. Photoreceptor cell death was assessed by TUNEL assay in retinas or by flow cytometry in 661W cells cultured in microglia-conditioned medium. Results: Photoreceptor cell death and elevated expression of LOX-1 were induced by LD in retinas of BALB/c mice. LOX-1 neutralizing antibody or PolyI pretreatment significantly reduced the elevated expression of LOX-1, TNF-α, IL-1β, CCL2 and p-NF-κB caused by LD in retinas. Inhibition of LOX-1 by LOX-1 neutralizing antibody or PolyI significantly reduced photoreceptor cell death induced by LD in retinas. Elevated levels of TNF-α, IL-1β and CCL2 caused by LPS were down-regulated by inhibition of LOX-1 in BV2 cells. Inhibition of LOX-1 reduces microglial neurotoxicity on photoreceptors. Conclusions: LOX-1 expression is increased in light induced retinal degeneration, what’s more, inhibition of LOX1 prevents inflammation and photoreceptor cell death in retinal degeneration and reduces microglial neurotoxicity on photoreceptors. Therefore, LOX-1 can be used as a potential therapeutic target for such retinal degeneration diseases.
1. Introduction Photoreceptor degeneration is an important cause of blindness in many eye diseases such as age-related macular degeneration (AMD), but its pathogenesis and therapy remain unclear. Light is very important for the formation of vision; however, retinal degeneration can be induced by excessive light exposure [1]. Photoreceptor cell death and inflammation are important features of light-induced retinal degeneration [1,2]. Retinal inflammation plays an essential role in the pathogenesis of photoreceptor cell death [3–5]. Up-regulated inflammatory mediators such as tumor necrosis factor alpha (TNF-α), Interleukin-1 beta (IL-1β) and CCL2 have been detected in the retinal tissues of AMD patients and retinal degeneration mice [6–9], excessive inflammatory mediators can cause secondary damage to photoreceptors and exacerbate photoreceptor cell death [10,11]. Therefore, it is necessary to further study the mechanism of retinal inflammation in photoreceptor cell death and to find an effective way to reduce
⁎
inflammation and cell death. Damage-associated molecular patterns (DAMPs), the endogenous risk signals released by injured neurons, such as phosphatidylserine [12], HSP60 [13], alarmins (oxidized low-density lipoproteins, etc.) and exogenous pathogen-associated molecular patterns (PAMPs) such as lipopolysaccharides (LPS) can be immediately identified by immune cells through pattern recognition receptors (PRRs) [14]. PRRs identify the corresponding ligands resulting in the production of numerous proinflammatory cytokines through activating cellular signaling pathways such as nuclear factor-κB (NF-κB) pathway [15]. As a member of PRRs, lectin-like oxidized low-density lipoprotein receptor 1 (LOX-1) is a type II transmembrane receptor and belongs to scavenger receptors (SRs) with a C-type lectin-like receptors (CLRs) structure [16,17]. Emerging as a vital player in inflammatory immune responses, LOX-1 has been reported to be involved in inflammatory responses in a variety of diseases. LOX-1 can induce vascular inflammation and recruit leukocyte in cardiovascular diseases [18]; LOX-1 is up-regulated in the monocytes of
Corresponding author at: Department of Ophthalmology, Peking University First Hospital, No. 8 Xishiku Street, Xicheng District, Beijing 100034, China. E-mail address: [email protected] (L. Yang).
https://doi.org/10.1016/j.intimp.2020.106190 Received 12 November 2019; Received in revised form 10 December 2019; Accepted 3 January 2020 1567-5769/ © 2020 Elsevier B.V. All rights reserved.
International Immunopharmacology 80 (2020) 106190
X. Gao, et al.
Diego, CA, USA) containing 10% fetal bovine serum (FBS) (Gibco) under a humidified atmosphere of 5% CO2 and 37 °C. The BV2 cells were stimulated with LPS (Sigma, St. Louis, MO) (1 μg/mL) for 4 h, then harvested after another 24 h for analysis. BV2 cells were pretreated with goat anti-mouse LOX-1 neutralizing antibody (R&D Systems) (10 μg/mL) or control goat IgG (R&D Systems) (10 μg/mL); PolyI (Sigma) (250 μg/mL) or control vehicle for 2 h before LPS stimulation. These concentrations were adapted from manufacturer's instruction and previously published experiments [16,27–29].
patients with coronary artery disease and triggers pro-inflammatory responses [19]; microvascular inflammation is induced by up-regulation of LOX-1 in atherosclerotic diseases and microvascular disorders [20]. In addition, previous studies have shown that LOX-1 is involved in neuroinflammation and neural injury diseases [21–24]. LOX-1 participates and plays a role in the association between neurodegenerative disease and cardiovascular risk factors [23]. As confirmed in another report, LOX-1 promotes microglia-mediated neuroinflammation by increasing pro-inflammatory mediators and induces neuronal death indirectly via inflammation [22]. All these above findings demonstrate that LOX-1 may play an important role in neurodegeneration. However, the expression and function of LOX-1 have not been reported in the photoreceptor degeneration. In the present study, we investigated the expression and role of LOX1 in light induced photoreceptor degeneration. LPS-activated BV2 cells as a classical way to activate microglia in vitro has been widely used in the study of neuroinflammation and neurodegeneration [25,26]. Therefore, we used LPS-activated BV2 cells to explore effect of LOX-1 on the neurotoxicity of microglia. We intend to find effective photoreceptor protective therapies.
2.4. TUNEL analysis Eyes were enucleated (n = 3/group) from BALB/c mice, immersed in 0.01 M PBS, embedded in tissue freezing medium (Leica, Richmond, IL), and frozen in liquid nitrogen. Cryosections were cut in the sagittal plane through the optic nerve head (ONH). Immediate cell death was detected by the DeadEnd™ Fluorometric TUNEL System (Promega, Madison, WI), according to the manufacturer’s instructions. DAPI was used to label all nuclei. Images were collected by fluorescence microcopy. TUNEL-positive cells were defined as cells with green color staining.
2. Materials and methods 2.5. Histologic analysis
2.1. Animals and light damage (LD)
Sections were cut through the ONH of each eye in the sagittal plane, and stained with hematoxylin and eosin (HE) for the morphological analysis. Light microscope images were photographed, and the thickness of outer nuclear layer (ONL) was measured in three sections at 200 μm intervals from the ONH on the photographs.
Eight-week-old female BALB/c mice were purchased from SPF Biotechnology Co., LTD. (Beijing, China). All mice were kept under temperature and light controlled conditions (23 °C to 25 °C; 12-hour:12hour light-dark photoperiod). After dark adaptation for 24 h, the pupils of mice were dilated with a topical application of 0.5% tropicamide (Santen Pharmaceuticals Co. Ltd., Osaka, Japan) and 0.5% phenylephrine hydrochloride (Santen Pharmaceuticals Co. Ltd.) at 30 min before exposure to light. Mice were exposed to 15,000 lux of cool white light for 4 h. After the exposure, all mice were placed in the dark for 24 h and then returned to the previous 12 h:12 h light–dark cycle. Eyes were enucleated immediately after sacrifice 0 h, 1 day, 2 days, 3 days and 7 days after LD for analysis by real-time RT-PCR, western blot and TUNEL. All animal experiments were performed in accordance with the Association for Research in Vision and Ophthalmology (ARVO) Statement for the Use of Animals in Ophthalmic and Vision Research and the Institutional Animal Care and Use Committee of Peking University. All protocols were approved by the Animal Care and Use Committee of Peking University First Hospital.
2.6. Real-time reverse transcriptase polymerase chain reaction (RT-PCR) After sacrifice, retinas were removed from BALB/c mice (n = 6/ group). Total RNA was extracted by using TRIzol reagent (Invitrogen, Carlsbad, CA) and quantified by spectrophotometry (260 nM). The cDNA template was produced by RNA (2 μg) through reverse transcription for PCR reaction and a 2 μL cDNA aliquot was used for realtime RT-PCR (20 μL total reaction volume). Real-Time SYBR® Green (TaKaRa, Dalian, China) was used for the PCR reaction with primer concentrations of 10 μM. All reactions were performed with the following cycling parameters: 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s, 60 °C for 30 s, and a final stage of 95 °C for 15 s, 60 °C for 30 s, and 95 °C for 15 s. Relative mRNA levels of LOX-1, TNF-α, IL-1β and CCL2 were tested by real-time RT-PCR. β-actin was used as an internal control. The primer pair sequences are shown in Table 1.
2.2. LOX-1 neutralizing antibody and PolyI treatment Mice were anesthetized with saturated tribromoethanol (Sigma, St. Louis, MO) (315 mg/kg). Goat anti-mouse LOX-1 neutralizing antibody (R&D Systems, Minneapolis, MN) (5 μg/2 μL) or control goat IgG (R&D Systems) (5 μg/2 μL) were injected into the vitreous chamber by puncturing the eye at the corneal–scleral junction using a syringe equipped with a 33-gauge needle the day before LD. On 1 day after LD, an additional 2 μg/100 μL was injected intraperitoneally; controls were similarly injected with IgG. Polyinosinic acid (PolyI) (Sigma) (5 μg/2 μL) or control vehicle (sterile water) were injected into the vitreous chamber the day before LD. On 1 day after LD, an additional 2 μg/ 100 μL was injected intraperitoneally; controls were similarly injected with vehicle. Eyes were enucleated immediately after sacrifice 2 days after LD for analysis by real-time RT-PCR, western blot, TUNEL and histologic analysis.
2.7. Western blotting Retinas were lysed in radioimmunoprecipitation assay (RIPA; Solarbio, Beijing, China) lysis buffer containing Phenylmethanesulfonyl fluoride (PMSF) (100:1) for 1 h, then the lysate was centrifuged and the Table 1 Nucleotide sequences of mouse primers for real-time RT-PCR. Gene
GenBank No.
Primer Sequence (5′ − 3′)
Size (bp)
β-Actin
NM_007393.5
147
LOX-1
NM_138648.2
TNF-α
NM_013693.2
IL-1β
NM_008361.3
CCL2
NM_011333.3
F - GAT TAC TGC TCT GGC TCC TAG C R - GAC TCA TCG TAC TCC TGC TTG C F - AGG TCC TTG TCC ACA AGA CTG G R - ACG CCC CTG GTC TTA AAG AAT TG F - ACC CTC ACA CTC AGA TCA TCT T R - GGT TGT CTT TGA GAT CCA TGC F - CGC AGC AGC ACA TCA ACA AGA GC R - TGT CCT CAT CCT GGA AGG TCC ACG F - AGCTGTAGTTTTTGTCACCAAGC R - GTGCTGAAGACCTTAGGGCA
2.3. Cell culture and stimulation The 661W photoreceptor-like cells and BV2 microglia-like cells (purchased from China Infrastructure of Cell Line Resource) were cultured in Dulbecco's Modified Eagle's Medium (DMEM; Gibco, San 2
273 148 111 155
International Immunopharmacology 80 (2020) 106190
X. Gao, et al.
supernatant was used for this study. Adding SDS sample buffer and boiling after testing the protein concentration. Total protein was separated on 10% or 12% acrylamide SDS-PAGE and transferred onto polyvinylidene difluoride (PVDF) membrane. The membranes were blocked with 5% milk in PBS at room temperature for 1 h, and then were incubated with a primary antibody to β-actin (1:20000; Abclonal, Wuhan, China), and primary antibody to LOX-1 (1:500; Bioss, Beijing, China) or primary antibody to TNF-α (1:300; Bioss, Beijing, China) or primary antibody to IL-1β (1:500; Abclonal, Wuhan, China) or primary antibody to CCL2 (1:300; Bioss, Beijing, China) or primary antibody to total NF-κB (t-NF-κB) (1:300; Bioss) or primary antibody to phosphorNF-κB (p-NF-κB) (1:300; Bioss) at room temperature for 2 h. After washing in PBS containing 0.5% Tween 20 for three times, membranes were incubated with corresponding peroxidase-conjugated secondary antibodies at room temperature for 1 h. Then the blots were developed by using chemiluminescence (ECL; Thermo Fisher Scientific, Waltham, MA, USA).
3.2. The expression of LOX-1 in light induced retinal degeneration To investigate whether LOX-1 is involved in photoreceptor cell death caused by LD, we detected mRNA and protein levels of LOX-1 in normal and light damaged retinas of BALB/c mice by real-time RT-PCR and western blot. Results showed that mRNA levels of LOX-1 (Fig. 2A) were notably increased in retinas of BALB/c mice at 0 h, 1 day, 2 days and 3 days after LD compared with normal retinas (p < 0.05, p < 0.001, p < 0.001, p < 0.001, respectively). There was a slight increase at 7 days after LD, but it was not statistically significant. To confirm these data, LOX-1 protein was examined by western blot. Results showed that protein levels of LOX-1 (Fig. 2B) were elevated in retinas at 0 h, 1 day, 2 days, 3 days after LD compared with normal retinas. The expression of LOX-1 raised gradually from 0 h to 2 days after LD, then reduced gradually from 2 days to 7 days after LD. The expression level of LOX-1 was highest at 2 days after LD. Therefore, the following functional experiments of LOX-1 were tested in retinas at 2 days after LD. All these results indicated that elevated expression of LOX-1 was induced by LD in a time-dependent manner.
2.8. Enzyme-linked immunosorbent assay (ELISA) The concentrations of TNF-α (CUSABIO, Wuhan, China), IL-1β (Elabscience, Wuhan, China) and CCL2 (Elabscience) in BV2 cells culture supernatants were analyzed using ELISA kit following the manufacturer's instructions.
3.3. Effect of LOX-1 neutralizing antibody on inflammatory factors in light induced retinal degeneration To explore the effects of LOX-1 on inflammation in retinal degeneration, LOX-1 neutralizing antibody was treated with mice, and expression levels of LOX-1, TNF-α, IL-1β and CCL2 were tested in retinas of BALB/c mice by real-time RT-PCR and western blot. Relative mRNA (Fig. 3A, p < 0.01) and protein (Fig. 3B) levels of LOX-1 were significantly decreased in LOX-1 neutralizing antibody compared with IgG control. Elevated mRNA and protein levels of TNF-α (Fig. 3C, 3D), IL-1β (Fig. 3E, 3F) and CCL2 (Fig. 3G, H) induced by LD (p < 0.001, p < 0.01, p < 0.001, respectively) were significantly inhibited by LOX-1 neutralizing antibody compared with IgG control (p < 0.001, p < 0.01, p < 0.001, respectively). The t-NF-κB is the total NF-κB in cells, and p-NF-κB as a phosphorylated form represents activated NF-κB. After LOX-1 neutralizing antibody treatment, protein level of p-NF-κB (Fig. 3I) induced by LD was significantly decreased, but no obvious alterations of t-NF-κB expression were observed. All these results indicated that inflammation was inhibited by LOX-1 neutralizing antibody in light induced retinal degeneration.
2.9. Flow cytometry analysis 661W cells were incubated for 48 h either in their own normal medium or in microglia-conditioned medium (cultured supernatants from normal, LPS, IgG + LPS, LOX-1Ab + LPS, vehicle + LPS and PolyI + LPS treated BV2 cells). The 661W cell death was evaluated by using FITC Annexin V Apoptosis Detection Kit (BD Biosciences, San Diego, CA, USA) according to the manufacturer's protocol. Briefly, after washing in cold PBS twice, cells were resuspended in 1× binding buffer. FITC Annexin V and PI were added, and cells were incubated at room temperature for 15 min in dark. Stained cells were analyzed immediately using a flow cytometer (FACSCalibur; BD Biosciences). 2.10. Statistical analysis We used ANOVA with post hoc pairwise comparisons using the Tukey method to correct for multiple comparisons. P < 0.05 was considered statistically significant. All statistical analysis was performed with GraphPad Prism version 5. All experiments were repeated three times to ensure reproducibility and data from a representative experiment are shown as mean ± standard error of the mean (SEM).
3.4. Effect of PolyI on inflammatory factors in light induced retinal degeneration In order to fully verify the function of LOX-1 on inflammation in retinal degeneration, mice were treated with PolyI (the inhibitor of LOX-1), and expression levels of LOX-1, TNF-α, IL-1β and CCL2 were tested. The up-regulation of mRNA (Fig. 4A, p < 0.001) and protein (Fig. 4B) levels of LOX-1 induced by LD was significantly inhibited by PolyI. Elevated mRNA and protein levels of TNF-α (Fig. 4C, D), IL-1β (Fig. 4E, F) and CCL2 (Fig. 4G, H) induced by LD (p < 0.001, p < 0.01, p < 0.001, respectively) were significantly inhibited by PolyI compared with vehicle control (p < 0.001, p < 0.05, p < 0.001, respectively). PolyI significantly inhibited p-NF-κB protein production induced by LD compared with vehicle control (Fig. 4I), but no obvious alterations of t-NF-κB expression were observed. All these results indicated that inflammation was inhibited by PolyI in light induced retinal degeneration.
3. Results 3.1. Photoreceptor cell death after light damage in retinas of BALB/c mice In order to observe the photoreceptor cell death after LD in retinas of BALB/c mice, the TUNEL staining was performed. Staining results showed that there were no TUNEL-positive photoreceptors in normal retinas (Fig. 1A). TUNEL-positive staining began to appear in the retina at 0 h (Fig. 1B) after LD, but there was no significant cell death in the outer nuclear layer (ONL). At 1 day (Fig. 1C), 2 days (Fig. 1D), 3 days (Fig. 1E) and 7 days (Fig. 1F) after LD, TUNEL-positive photoreceptors were present in the ONL of retinas. TUNEL-positive photoreceptors at 2 days after LD were more than at 1 day after LD in the retina. The number of TUNEL-positive photoreceptors decreased gradually from 2 to 7 days after LD. There was highest number of TUNEL-positive photoreceptors at 2 days after LD. The ONL was markedly thinned at 7 days after LD compared with normal retinas. All these results indicated that photoreceptor cell death was induced by LD, and this occurred in a time-dependent manner.
3.5. The role of LOX-1 in light induced retinal morphological change. To investigate the role of LOX-1 in light induced retinal morphological change, histological analysis was performed. Representative photomicrographs of HE staining of retinal sections (Fig. 5A) and measurements of the thickness of ONL indicated that the thickness of ONL was significantly decreased in LD retinas compared with normal 3
International Immunopharmacology 80 (2020) 106190
X. Gao, et al.
Fig. 1. (A–F). Fluorescence photomicrographs showing TUNEL label in retinas of BALB/c mice. TUNEL-positive photoreceptor nuclei (green) were present in retinas of 1 day (C), 2 days (D), 3 days (E) and 7 days (F) after LD but not in 0 h (B) after LD and normal control (A). There is highest number of TUNEL-positive photoreceptor nuclei at 2 days after LD. All nuclei were labeled with DAPI (blue). GCL, ganglion cell layer; INL, inner nuclear layer; ONL, outer nuclear layer. Scale bars represent 100 μm.
ONL.
control (Fig. 5B). However, the thickness of ONL was significantly increased in LD retinas pretreated with LOX-1 neutralizing antibody (Fig. 5C) or PolyI (Fig. 5D) compared with their control. These results indicated that inhibition of LOX-1 rescued the light induced thinning of 4
International Immunopharmacology 80 (2020) 106190
X. Gao, et al.
3.6. Effect of LOX-1 on photoreceptor cell death induced by light damage To investigate whether inhibition of LOX-1 can reduce photoreceptor cell death induced by LD, we tested photoreceptor cell death in retinas of BALB/c mice treated with LOX-1 neutralizing antibody or PolyI by TUNEL. Staining results showed that there were lots of TUNELpositive photoreceptors in retinas at 2 days after LD (Fig. 6B) but not in normal control (Fig. 6A). TUNEL-positive photoreceptors were significantly decreased in LD retinas treated with LOX-1 neutralizing antibody (Fig. 6D) compared with LD retinas treated with IgG (Fig. 6C). The PolyI-treated retinas had significantly fewer TUNEL-positive photoreceptors (Fig. 6F) than vehicle control (Fig. 6E). All these results indicated that inhibition of LOX-1 reduced photoreceptor cell death induced by LD. 3.7. Effect of LOX-1 on inflammatory factors in BV2 cells In order to fully verify the function of LOX-1 on inflammation, expression levels of LOX-1, TNF-α, IL-1β and CCL2 were tested by realtime RT-PCR, western blot or ELISA in BV2 cells. The elevated relative mRNA (Fig. 7A; p < 0.001) and protein (Fig. 7B) levels of LOX-1 induced by LPS were significantly inhibited by LOX-1 neutralizing antibody (p < 0.001) or PolyI (p < 0.001) compared with their controls in BV2 cells. Relative mRNA and protein levels of TNF-α (Fig. 7C, p < 0.001; Fig. 7D, p < 0.001), IL-1β (Fig. 7E, p < 0.001; Fig. 7F, p < 0.001) and CCL2 (Fig. 7G, p < 0.001; Fig. 7H, p < 0.001) were
Fig. 2. (A–B). Relative mRNA and protein levels of LOX-1 in retinas of BALB/c mice. Relative mRNA level of LOX-1 (A) was significantly greater in retinas of BALB/c mice at 0 h, 1, 2 and 3 days after LD than in normal. Protein level of LOX-1 (B) was significantly increased in retinas of BALB/c mice at 0 h, 1, 2 and 3 days after LD than in normal. No significant difference was detected at 7 days after LD.
Fig. 3. (A–H). LOX-1 neutralizing antibody treatment inhibits expression of inflammatory cytokines in retinas of BALB/c mice. Relative mRNA and protein levels of LOX-1 (A, B), TNF-α (C, D), IL-1β (E, F) and CCL2 (G, H) were significantly decreased in LOX-1 neutralizing antibody compared with IgG controls. Protein level of pNF-κB (I) was significantly decreased after LOX-1 neutralizing antibody treatment, but no obvious alterations of t-NF-κB expression were observed. 5
International Immunopharmacology 80 (2020) 106190
X. Gao, et al.
Fig. 4. (A–H). PolyI treatment inhibits expression of inflammatory cytokines in retinas of BALB/c mice. Relative mRNA and protein levels of LOX-1 (A, B), TNF-α (C, D), IL-1β (E, F) and CCL2 (G, H) were significantly decreased in PolyI compared with vehicle controls. Protein level of p-NF-κB (I) was significantly decreased in Poly (I), but no obvious alterations of t-NF-κB expression were observed.
However, the cell death was significantly decreased in 661W cells incubated with the supernatant of LPS activated BV2 microglia cells pretreated with LOX-1 neutralizing antibody (p < 0.001) or PolyI (p < 0.001) compared with their controls. All these results indicated that inhibition of LOX-1 attenuates the neurotoxicity of microglia on photoreceptors.
obviously up-regulated in BV2 cells stimulated by LPS compared with normal cells. However, these up-regulations of TNF-α (Fig. 7C, p < 0.001, p < 0.001; Fig. 7D, p < 0.001, p < 0.001), IL-1β (Fig. 7E, p < 0.01, p < 0.001; Fig. 7F, p < 0.001, p < 0.001) and CCL2 (Fig. 7G, p < 0.01, p < 0.001; Fig. 7H, p < 0.001, p < 0.001) were significantly inhibited by LOX-1 neutralizing antibody or PolyI compared with their controls. All these results indicated that inflammation was down-regulated by inhibition of LOX-1 in activated BV2 microglia cells.
4. Discussion Light is essential in our daily life and is very important for the formation of vision, but excessive light exposure can lead to retinal inflammation and degeneration [30–32]. In the present study, the BALB/c mice model of light-induced retinal degeneration was used to observe the photoreceptor cell death at different time points after LD. Our results showed that there were no TUNEL-positive photoreceptors in normal retinas without LD, but lots of TUNEL-positive photoreceptors appeared after LD. The number of photoreceptor cell death gradually increased from 0 h to 2 days after LD and then that decreased gradually from 2 to 7 days after LD. Photoreceptor cell death was present in highest number at 2 days after LD. In addition, the ONL was extremely thinned at 7 days after LD compared with normal retinas. These indicate that photoreceptor cell death will be induced by LD, and this occurs in a time-dependent manner. These findings are consistent with previous studies showing that more cell death appear with increasing time after light exposure, and photoreceptor cells are mostly cleared from the retina at 10 days following light exposure [1].
3.8. Inhibition of LOX-1 attenuates microglial neurotoxicity on photoreceptors To further investigate the role of LOX-1 in photoreceptor cell death, and to test whether LOX-1 influence the neurotoxicity of microglia on photoreceptors, flow cytometry analysis was performed. The 661W photoreceptor cells were cultured in their own normal medium or cultured supernatants from normal, LPS-treated, IgG + LPS-treated, LOX-1Ab + LPS-treated, Vehicle + LPS-treated and PolyI + LPStreated BV2 cells, respectively. The cell death of 661W was measured by flow cytometry after staining with FITC conjugated Annexin V and PI. Representative flow cytometry output (Fig. 8A), quantitative comparison of late apoptotic or necrotic cells (Fig. 8B) from the flow cytometry results showed that the 661W photoreceptor cell death was obviously increased by the supernatant of LPS activated BV2 microglia cells compared with the supernatant of normal BV2 cells (p < 0.001). 6
International Immunopharmacology 80 (2020) 106190
X. Gao, et al.
Fig. 5. (A–D). The role of LOX-1 in light induced retinal morphological change. Representative photomicrographs showing HE staining (A) of retinal sections from normal, LD, IgG + LD, LOX-1Ab + LD, Vehicle + LD and PolyI + LD mice. GCL, ganglion cell layer; INL, inner nuclear layer; ONL, outer nuclear layer. Scale bars represent 100 μm. Measurements of the thickness of ONL. The thickness of ONL was significantly decreased in LD retinas compared with normal control (B). Inhibition of LOX-1 by LOX-1 neutralizing antibody (C) or PolyI (D) rescued the light induced thinning of ONL compared with IgG or vehicle control. Data are shown as mean ± SEM (n = 3). *P < 0.05, **P < 0.01.
shown that activated microglia secrete many pro-inflammatory factors, such as TNF-α, IL-1β and CCL2, which are traditionally considered to cause neurodegeneration [9,36]. In the present study, we found that the mRNA and protein levels of TNF-α, IL-1β and CCL2 were increased in retinas of BALB/c mice after LD. However, these up-regulations were significantly suppressed by LOX-1 neutralizing antibody. NF-κB has been considered a key regulator of neuroinflammatory response and it is phosphorylated, activated and bonded to a specific target gene to modulate the transcription and release of pro-inflammatory cytokines [37,38]. LOX-1 deletion in LDLR-null mice reduced macrophage accumulation by decreasing the activation of NF-κB [39]. To further investigate how LOX-1 regulates pro-inflammatory cytokines in light damaged retinas of BALB/c mice, we tested the expression of NF-κB. Our results indicated that LOX-1 neutralizing antibody significantly inhibited p-NF-κB protein production induced by LD. These are consistent with previous studies showing that inhibition of LOX-1 decreases the production of inflammatory factors through the NF-κB pathway [40,41]. In order to fully verify our results, as a chemical inhibitor of LOX-1 [16,27,28], PolyI was given to BALB/c mice to inhibit LOX-1, and the results showed that elevated levels of TNF-α, IL-1β, CCL2 and p-NF-κB induced by LD were significantly decreased by PolyI. These
Previous studies have shown that LOX-1 is involved in neurodegeneration diseases [33,34]. Atherogenic L5 likely creates a neurotoxic stress and contributes to neurodegenerative disorders via LOX-1 in neuron-like PC12 cells [24]. Neuronal damaging stress releases DAMPs after LD in retinas. As a member of PRRs, LOX-1 activated by neuronal injury signals leads to the inflammatory cascade response and the production of inflammatory factors, exacerbating neuronal damage [22]. Our results revealed that LOX-1 was expressed in retina of BALB/c mice, and elevated expression of LOX-1 was induced by LD in a timedependent manner. The mRNA and protein level of LOX-1 was increased at 0 h after LD. Although the photoreceptor cells have not yet died at 0 h, they have already suffered damage stress, which may cause LOX-1 to be activated by injury signals. The expression level of LOX-1 was highest at 2 days after LD. Similarly, photoreceptor cell death was also present in highest number at 2 days after LD. These findings are consistent with previous studies showing that the elevated expression of LOX-1 was detected in hypertension-induced neuronal apoptosis [35]. All above suggested that LOX-1 was involved in photoreceptor cell death. Inflammatory response has been shown to play a key role in the pathogenesis of photoreceptor cell death [9,15]. Previous studies have 7
International Immunopharmacology 80 (2020) 106190
X. Gao, et al.
Fig. 6. (A–F). The role of LOX-1 on light induced photoreceptors cell death in retinas of BALB/c mice. Representative fluorescence photomicrographs showing TUNEL label retinal sections. There were many TUNEL-positive photoreceptors (green) in retinas at 2 days after LD (B) but none of in normal control (A). TUNELpositive photoreceptors were significantly decreased in LOX-1 neutralizing antibody (D) or PolyI (F) compared with IgG (C) or vehicle (E) control. All nuclei were labeled with DAPI (blue). GCL, ganglion cell layer; INL, inner nuclear layer; ONL, outer nuclear layer. Scale bars represent 100 μm.
neuronal cell death in the HN33 neuronal cell line [23]. Our results showed that the thinning of ONL and photoreceptor cell death were induced by LD in retinas. However, the light induced thinning of ONL and photoreceptor cell death were rescued by inhibition of LOX-1 by LOX-1 neutralizing antibody or PolyI treatment. These findings are consistent with previous studies showing that anti-LOX-1 monoclonal antibody inhibits inflammatory response and reduces apoptosis in
results are consistent with the results of neutralizing antibody treatment described above. All above our data suggested that pro-inflammatory cytokines down-regulated by inhibition of LOX-1 may be through the NF-κB pathway in retinal degeneration. LOX-1 promotes generation of proinflammatory cytokines that induce neurodegeneration by recognizing neuronal injury signals [22]. Previous studies have shown that the activation of LOX-1 leads to 8
International Immunopharmacology 80 (2020) 106190
X. Gao, et al.
Fig. 7. (A–H). The role of LOX-1 on expression of inflammatory cytokines in BV2 cells. The elevated relative mRNA and protein levels of LOX-1 (A, B), TNF-α (C, D), IL-1β (E, F) and CCL2 (G, H) induced by LPS were significantly inhibited by LOX-1 neutralizing antibody or PolyI compared with IgG or vehicle control in BV2 cells.
activated BV2 microglia cells and 661W photoreceptor cells co-culture in microglia-conditioned medium were used to explore effect of LOX-1 on the neurotoxicity of microglia. LOX-1 is crucial in microglia for promoting an inflammatory
vascular smooth muscle cells [42,43]. All above results indicate that LOX-1 plays an essential role in retinal degeneration. Inhibition of LOX-1 prevents retinal inflammation and photoreceptor cell death. To further prove the role of LOX-1, LPS9
International Immunopharmacology 80 (2020) 106190
X. Gao, et al.
Fig. 8. (A–B). Inhibition of LOX-1 reduces microglial neurotoxicity on photoreceptors. (A) The supernatant from normal, LPS-treated, IgG + LPS-treated, LOX1Ab + LPS-treated, Vehicle + LPS-treated and PolyI + LPS-treated BV2 cells was added to 661W photoreceptor cells, respectively. The cell death of 661W was measured by flow cytometry after staining with FITC conjugated Annexin V and PI. Cells in the bottom left quadrant represent viable cells (low annexin V and PI staining), cells in the bottom right quadrant represent early apoptotic cells (high annexin V but low PI staining), cells in the top right quadrant represent late apoptotic or necrotic cells (high annexin V and PI staining). The percentage of cells in each quadrant is indicated within the quadrant. (B) Quantitative comparison of late apoptotic or necrotic cells from the flow cytometry results. Data are shown as mean ± SEM (n = 3).
induced by LD are significantly decreased by inhibition of LOX-1. Moreover, inhibition of LOX-1 can rescue photoreceptor cell death. In addition, inhibition of LOX-1 attenuates the neurotoxicity of microglia on photoreceptors. In view of its essential role in retinal degeneration, LOX-1 could become a novel target for preventing photoreceptor cell death in such photoreceptor degeneration diseases as well as AMD. However, for more and in-depth research, knock-out or overexpression of LOX-1 is worthy of further research. In addition, further research is needed to be done to investigate the specific mechanism and other pathway of LOX-1 in retinal degeneration.
response, and elevated level of LOX-1 is detected in microglia in response to heat shock protein 60 (HSP60) or LPS [21,22]. Our results indicated that expression levels of LOX-1, TNF-α, IL-1β and CCL2 were obviously up-regulated in BV2 cells stimulated by LPS. LPS as PAMPs can bind and activate LOX-1 in LPS-stimulated BV2 [21]. However, these up-regulations were significantly inhibited by LOX-1 neutralizing antibody or PolyI. These findings are consistent with previous studies showing that LOX-1 knockdown attenuated pro-inflammatory factors expression in activated microglia [21]. Activated microglia secrete large amounts of inflammatory factors that are cytotoxic and can induce photoreceptor cell death [44]. In the present study, the 661W photoreceptor cell death was obviously increased by the supernatant of LPS activated BV2 microglia cells compared with the supernatant of normal BV2 cells. However, the cell death was significantly decreased in 661W cells incubated with the supernatant of LPS activated BV2 microglia cells pretreated with LOX-1 neutralizing antibody or PolyI. All these results indicated inhibition of LOX-1 attenuates the neurotoxicity of microglia on photoreceptors. In summary, the data presented herein indicate that the expression level of LOX-1 is up-regulated in light induced retinal degeneration. We provide evidence that elevated levels of pro-inflammatory factors
CRediT authorship contribution statement Xinran Gao: Conceptualization, Methodology, Investigation, Formal analysis, Writing - original draft, Visualization. Ruilin Zhu: Resources, Formal analysis, Writing - review & editing. Jiantong Du: Methodology, Visualization. Wenbo Zhang: Resources, Formal analysis. Wenna Gao: Resources, Validation. Liu Yang: Conceptualization, Writing - review & editing, Supervision, Project administration.
10
International Immunopharmacology 80 (2020) 106190
X. Gao, et al.
Acknowledgements [22]
This work was supported by National Natural Science Foundation of China (81470650); National Natural Science Foundation of China (81670841); Natural Science Foundation of Beijing (7172218), China. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
[23] [24]
References
[25]
[1] A. Wenzel, C. Grimm, M. Samardzija, C.E. Reme, Molecular mechanisms of lightinduced photoreceptor apoptosis and neuroprotection for retinal degeneration, Prog. Retin. Eye Res. 24 (2) (2005) 275–306. [2] D. Jiang, R.C. Ryals, S.J. Huang, K.K. Weller, H.E. Titus, B.M. Robb, F.W. Saad, R.A. Salam, H. Hammad, P. Yang, D.L. Marks, M.E. Pennesi, Monomethyl fumarate protects the retina from light-induced retinopathy, Invest. Ophthalmol. Vis. Sci. 60 (4) (2019) 1275–1285. [3] M. Chen, H. Xu, Parainflammation, chronic inflammation, and age-related macular degeneration, J. Leukoc. Biol. 98 (5) (2015) 713–725. [4] H. Kohno, Y. Chen, B.M. Kevany, E. Pearlman, M. Miyagi, T. Maeda, K. Palczewski, A. Maeda, Photoreceptor proteins initiate microglial activation via Toll-like receptor 4 in retinal degeneration mediated by all-trans-retinal, J. Biol. Chem. 288 (21) (2013) 15326–15341. [5] H. Jiao, R. Natoli, K. Valter, J.M. Provis, M. Rutar, Spatiotemporal Cadence of Macrophage Polarisation in a Model of Light-Induced Retinal Degeneration, PLoS ONE 10 (12) (2015) e0143952. [6] J. Xie, R. Zhu, Y. Peng, W. Gao, J. Du, L. Zhao, Y. Chi, L. Yang, Tumor necrosis factor-alpha regulates photoreceptor cell autophagy after retinal detachment, Sci. Rep. 7 (1) (2017) 17108. [7] N. Yoshida, Y. Ikeda, S. Notomi, K. Ishikawa, Y. Murakami, T. Hisatomi, H. Enaida, T. Ishibashi, Laboratory evidence of sustained chronic inflammatory reaction in retinitis pigmentosa, Ophthalmology 120 (1) (2013) e5–e12. [8] H. Zeng, M. Ding, X.X. Chen, Q. Lu, Microglial NADPH oxidase activation mediates rod cell death in the retinal degeneration in rd mice, Neuroscience 275 (2014) 54–61. [9] C. Feng, X. Wang, T. Liu, M. Zhang, G. Xu, Y. Ni, Expression of CCL2 and its receptor in activation and migration of microglia and monocytes induced by photoreceptor apoptosis, Mol. Vis. 23 (2017) 765–777. [10] A.A. Herzlich, X. Ding, D. Shen, R.J. Ross, J. Tuo, C.C. Chan, Peroxisome proliferator-activated receptor expression in murine models and humans with age-related macular degeneration, Open Biol. J. 2 (2009) 141–148. [11] E. Colak, N. Majkic-Singh, L. Zoric, A. Radosavljevic, N. Kosanovic-Jakovic, The impact of inflammation to the antioxidant defense parameters in AMD patients, Aging. Clin. Exp. Res. 24 (6) (2012) 588–594. [12] J.E. Murphy, D. Tacon, P.R. Tedbury, J.M. Hadden, S. Knowling, T. Sawamura, M. Peckham, S.E. Phillips, J.H. Walker, S. Ponnambalam, LOX-1 scavenger receptor mediates calcium-dependent recognition of phosphatidylserine and apoptotic cells, Biochem. J. 393 (Pt 1) (2006) 107–115. [13] L. Zhou, J. Xie, Y. Ruan, H. Zhu, W. Wang, X. Yun, L. Guo, H. Gan, L. Sun, M. Yu, J. Gu, Expression and purification of secreted recombinant hsp60 from eukaryotic cells, Protein Expr. Purif. 72 (2) (2010) 179–183. [14] V. Rai, D.K. Agrawal, The role of damage- and pathogen-associated molecular patterns in inflammation-mediated vulnerability of atherosclerotic plaques, Can. J. Physiol. Pharmacol. 95 (10) (2017) 1245–1253. [15] C.P. Ardeljan, D. Ardeljan, M. Abu-Asab, C.C. Chan, Inflammation and cell death in age-related macular degeneration: an immunopathological and ultrastructural model, J. Clin. Med. 3 (4) (2014) 1542–1560. [16] X. Gao, G. Zhao, C. Li, J. Lin, N. Jiang, Q. Wang, L. Hu, Q. Xu, X. Peng, K. He, G. Zhu, LOX-1 and TLR4 affect each other and regulate the generation of ROS in A. fumigatus keratitis, Int. Immunopharmacol. 40 (2016) 392–399. [17] M. Yan, J.L. Mehta, W. Zhang, C. Hu, LOX-1, oxidative stress and inflammation: a novel mechanism for diabetic cardiovascular complications, Cardiovasc. Drugs Ther. 25 (5) (2011) 451–459. [18] Z. Ding, S. Liu, X. Wang, Y. Dai, M. Khaidakov, X. Deng, Y. Fan, D. Xiang, J.L. Mehta, LOX-1, mtDNA damage, and NLRP3 inflammasome activation in macrophages: implications in atherogenesis, Cardiovasc. Res. 103 (4) (2014) 619–628. [19] S.H. Chan, C.H. Hung, J.Y. Shih, P.M. Chu, Y.H. Cheng, H.C. Lin, K.L. Tsai, SIRT1 inhibition causes oxidative stress and inflammation in patients with coronary artery disease, Redox Biol. 13 (2017) 301–309. [20] V. Lubrano, S. Balzan, Roles of LOX-1 in microvascular dysfunction, Microvasc. Res. 105 (2016) 132–140. [21] X. Ge, D.M. Zhang, M.M. Li, Y. Zhang, X.Y. Zhu, Y. Zhou, X. Peng, A.G. Shen,
[26]
[27]
[28]
[29] [30] [31] [32]
[33]
[34]
[35]
[36]
[37]
[38] [39]
[40]
[41]
[42]
[43]
[44]
11
Microglial LOX-1/MAPKs/NF-kappaB positive loop promotes the vicious cycle of neuroinflammation and neural injury, Int. Immunopharmacol. 70 (2019) 187–200. D. Zhang, L. Sun, H. Zhu, L. Wang, W. Wu, J. Xie, J. Gu, Microglial LOX-1 reacts with extracellular HSP60 to bridge neuroinflammation and neurotoxicity, Neurochem. Int. 61 (7) (2012) 1021–1035. X. Mao, L. Xie, D.A. Greenberg, LOX-1 expression and oxidized LDL uptake and toxicity in the HN33 neuronal cell line, Neurosci. Lett. 580 (2014) 182–185. J.Y. Wang, C.L. Lai, C.T. Lee, C.Y. Lin, Electronegative Low-Density Lipoprotein L5 Impairs Viability and NGF-Induced Neuronal Differentiation of PC12 Cells via LOX1, Int. J. Mol. Sci. 18 (8) (2017). R. Scholz, M. Sobotka, A. Caramoy, T. Stempfl, C. Moehle, T. Langmann, Minocycline counter-regulates pro-inflammatory microglia responses in the retina and protects from degeneration, J. Neuroinflammation 12 (2015) 209. Y. Wang, Z. Yin, L. Gao, D. Sun, X. Hu, L. Xue, J. Dai, Y. Zeng, S. Chen, B. Pan, M. Chen, J. Xie, H. Xu, Curcumin delays retinal degeneration by regulating microglia activation in the retina of rd1 mice, Cell. Physiol. Biochem. 44 (2) (2017) 479–493. D. Li, J.L. Mehta, Upregulation of endothelial receptor for oxidized LDL (LOX-1) by oxidized LDL and implications in apoptosis of human coronary artery endothelial cells: evidence from use of antisense LOX-1 mRNA and chemical inhibitors, Arterioscler. Thromb. Vasc. Biol. 20 (4) (2000) 1116–1122. R. Wang, G. Ding, W. Liang, C. Chen, H. Yang, Role of LOX-1 and ROS in oxidized low-density lipoprotein induced epithelial-mesenchymal transition of NRK52E, Lipids Health Dis. 9 (2010) 120. Q. Zhang, J. Liu, L. Ma, N. Bai, H. Xu, Wnt5a is involved in LOX-1 and TLR4 induced host inflammatory response in peri-implantitis, J. Periodontal Res. (2019). W.K. Noell, V.S. Walker, B.S. Kang, S. Berman, Retinal damage by light in rats, Invest. Ophthalmol. 5 (5) (1966) 450–473. A. Luckoff, R. Scholz, F. Sennlaub, H. Xu, T. Langmann, Comprehensive analysis of mouse retinal mononuclear phagocytes, Nat. Protoc. 12 (6) (2017) 1136–1150. A. Krigel, M. Berdugo, E. Picard, R. Levy-Boukris, I. Jaadane, L. Jonet, M. Dernigoghossian, C. Andrieu-Soler, A. Torriglia, F. Behar-Cohen, Light-induced retinal damage using different light sources, protocols and rat strains reveals LED phototoxicity, Neuroscience 339 (2016) 296–307. A. Lo Castro, M. Murdocca, S. Pucci, A. Zaratti, C. Greggi, F. Sangiuolo, V. Tancredi, C. Frank, G. D'Arcangelo, Early Hippocampal i-LTP and LOX-1 Overexpression Induced by Anoxia: A Potential Role in Neurodegeneration in NPC Mouse Model, Int. J. Mol. Sci. 18 (7) (2017). Z. Hoyk, M.E. Toth, N. Lenart, D. Nagy, B. Dukay, A. Csefova, A. Zvara, G. Seprenyi, A. Kincses, F.R. Walter, S. Veszelka, J. Vigh, B. Barabasi, A. Harazin, A. Kittel, L.G. Puskas, B. Penke, L. Vigh, M.A. Deli, M. Santha, Cerebrovascular Pathology in Hypertriglyceridemic APOB-100 Transgenic Mice, Front. Cell. Neurosci. 12 (2018) 380. Y. Li, Z. Duan, D. Gao, S. Huang, H. Yuan, X. Niu, The new role of LOX-1 in hypertension induced neuronal apoptosis, Biochem. Biophys. Res. Commun. 425 (4) (2012) 735–740. C.C. Chao, S. Hu, L. Ehrlich, P.K. Peterson, Interleukin-1 and tumor necrosis factoralpha synergistically mediate neurotoxicity: involvement of nitric oxide and of Nmethyl-D-aspartate receptors, Brain Behav. Immun. 9 (4) (1995) 355–365. F. Xu, L. Chen, X. Zhao, H. Zhong, L. Cui, L. Jiang, H. Huang, L. Li, S. Zeng, M. Li, Interaction of Wip1 and NF-kappaB regulates neuroinflammatory response in astrocytes, Inflamm. Res. 66 (11) (2017) 1011–1019. A.S. Baldwin Jr., The NF-kappa B and I kappa B proteins: new discoveries and insights, Annu. Rev. Immunol. 14 (1996) 649–683. J.L. Mehta, N. Sanada, C.P. Hu, J. Chen, A. Dandapat, F. Sugawara, H. Satoh, K. Inoue, Y. Kawase, K. Jishage, H. Suzuki, M. Takeya, L. Schnackenberg, R. Beger, P.L. Hermonat, M. Thomas, T. Sawamura, Deletion of LOX-1 reduces atherogenesis in LDLR knockout mice fed high cholesterol diet, Circ. Res. 100 (11) (2007) 1634–1642. P. Wang, L.Y. He, G.D. Shen, R.L. Li, J.L. Yang, Inhibitory effects of Dioscin on atherosclerosis and foam cell formation in hyperlipidemia rats, Inflammopharmacology 25 (6) (2017) 633–642. Q. Li, W. Zhao, X. Zeng, Z. Hao, Ursolic Acid Attenuates Atherosclerosis in ApoE (-/-) Mice: Role of LOX-1 Mediated by ROS/NF-kappaB Pathway, Molecules 23 (5) (2018). M. Akagi, A. Ueda, T. Teramura, S. Kanata, T. Sawamura, C. Hamanishi, Oxidized LDL binding to LOX-1 enhances MCP-1 expression in cultured human articular chondrocytes, Osteoarthritis Cartilage 17 (2) (2009) 271–275. H. Kataoka, N. Kume, S. Miyamoto, M. Minami, M. Morimoto, K. Hayashida, N. Hashimoto, T. Kita, Oxidized LDL modulates Bax/Bcl-2 through the lectinlike Ox-LDL receptor-1 in vascular smooth muscle cells, Arterioscler. Thromb. Vasc. Biol. 21 (6) (2001) 955–960. M. Karlstetter, E. Lippe, Y. Walczak, C. Moehle, A. Aslanidis, M. Mirza, T. Langmann, Curcumin is a potent modulator of microglial gene expression and migration, J. Neuroinflammation 8 (2011) 125.
Contents lists available at ScienceDirect
International Immunopharmacology journal homepage: www.elsevier.com/locate/intimp
Inhibition of LOX-1 prevents inflammation and photoreceptor cell death in retinal degeneration Xinran Gao, Ruilin Zhu, Jiantong Du, Wenbo Zhang, Wenna Gao, Liu Yang
T
⁎
Department of Ophthalmology, Peking University First Hospital, Beijing 100034, China
A R T I C LE I N FO
A B S T R A C T
Keywords: LOX-1 Inflammation Photoreceptor cell death Retinal degeneration Light damage
Purpose: To explore the expression and role of lectin-like oxidized low-density lipoprotein receptor 1 (LOX-1) in retinal degeneration. Methods: The retinal degeneration of BALB/c mice was induced by light exposure. BV2 cells were activated by LPS stimulation. Retinas or BV2 cells were pretreated with LOX-1 neutralizing antibody or Polyinosinic acid (PolyI) (the inhibitor of LOX-1) before light damage (LD) or LPS stimulation. LOX-1, TNF-α, IL-1β, CCL2 and NFκB expression were detected in retinas or BV2 cells by real-time RT-PCR, western blot or ELISA. Histological analyses of retinas were performed. Photoreceptor cell death was assessed by TUNEL assay in retinas or by flow cytometry in 661W cells cultured in microglia-conditioned medium. Results: Photoreceptor cell death and elevated expression of LOX-1 were induced by LD in retinas of BALB/c mice. LOX-1 neutralizing antibody or PolyI pretreatment significantly reduced the elevated expression of LOX-1, TNF-α, IL-1β, CCL2 and p-NF-κB caused by LD in retinas. Inhibition of LOX-1 by LOX-1 neutralizing antibody or PolyI significantly reduced photoreceptor cell death induced by LD in retinas. Elevated levels of TNF-α, IL-1β and CCL2 caused by LPS were down-regulated by inhibition of LOX-1 in BV2 cells. Inhibition of LOX-1 reduces microglial neurotoxicity on photoreceptors. Conclusions: LOX-1 expression is increased in light induced retinal degeneration, what’s more, inhibition of LOX1 prevents inflammation and photoreceptor cell death in retinal degeneration and reduces microglial neurotoxicity on photoreceptors. Therefore, LOX-1 can be used as a potential therapeutic target for such retinal degeneration diseases.
1. Introduction Photoreceptor degeneration is an important cause of blindness in many eye diseases such as age-related macular degeneration (AMD), but its pathogenesis and therapy remain unclear. Light is very important for the formation of vision; however, retinal degeneration can be induced by excessive light exposure [1]. Photoreceptor cell death and inflammation are important features of light-induced retinal degeneration [1,2]. Retinal inflammation plays an essential role in the pathogenesis of photoreceptor cell death [3–5]. Up-regulated inflammatory mediators such as tumor necrosis factor alpha (TNF-α), Interleukin-1 beta (IL-1β) and CCL2 have been detected in the retinal tissues of AMD patients and retinal degeneration mice [6–9], excessive inflammatory mediators can cause secondary damage to photoreceptors and exacerbate photoreceptor cell death [10,11]. Therefore, it is necessary to further study the mechanism of retinal inflammation in photoreceptor cell death and to find an effective way to reduce
⁎
inflammation and cell death. Damage-associated molecular patterns (DAMPs), the endogenous risk signals released by injured neurons, such as phosphatidylserine [12], HSP60 [13], alarmins (oxidized low-density lipoproteins, etc.) and exogenous pathogen-associated molecular patterns (PAMPs) such as lipopolysaccharides (LPS) can be immediately identified by immune cells through pattern recognition receptors (PRRs) [14]. PRRs identify the corresponding ligands resulting in the production of numerous proinflammatory cytokines through activating cellular signaling pathways such as nuclear factor-κB (NF-κB) pathway [15]. As a member of PRRs, lectin-like oxidized low-density lipoprotein receptor 1 (LOX-1) is a type II transmembrane receptor and belongs to scavenger receptors (SRs) with a C-type lectin-like receptors (CLRs) structure [16,17]. Emerging as a vital player in inflammatory immune responses, LOX-1 has been reported to be involved in inflammatory responses in a variety of diseases. LOX-1 can induce vascular inflammation and recruit leukocyte in cardiovascular diseases [18]; LOX-1 is up-regulated in the monocytes of
Corresponding author at: Department of Ophthalmology, Peking University First Hospital, No. 8 Xishiku Street, Xicheng District, Beijing 100034, China. E-mail address: [email protected] (L. Yang).
https://doi.org/10.1016/j.intimp.2020.106190 Received 12 November 2019; Received in revised form 10 December 2019; Accepted 3 January 2020 1567-5769/ © 2020 Elsevier B.V. All rights reserved.
International Immunopharmacology 80 (2020) 106190
X. Gao, et al.
Diego, CA, USA) containing 10% fetal bovine serum (FBS) (Gibco) under a humidified atmosphere of 5% CO2 and 37 °C. The BV2 cells were stimulated with LPS (Sigma, St. Louis, MO) (1 μg/mL) for 4 h, then harvested after another 24 h for analysis. BV2 cells were pretreated with goat anti-mouse LOX-1 neutralizing antibody (R&D Systems) (10 μg/mL) or control goat IgG (R&D Systems) (10 μg/mL); PolyI (Sigma) (250 μg/mL) or control vehicle for 2 h before LPS stimulation. These concentrations were adapted from manufacturer's instruction and previously published experiments [16,27–29].
patients with coronary artery disease and triggers pro-inflammatory responses [19]; microvascular inflammation is induced by up-regulation of LOX-1 in atherosclerotic diseases and microvascular disorders [20]. In addition, previous studies have shown that LOX-1 is involved in neuroinflammation and neural injury diseases [21–24]. LOX-1 participates and plays a role in the association between neurodegenerative disease and cardiovascular risk factors [23]. As confirmed in another report, LOX-1 promotes microglia-mediated neuroinflammation by increasing pro-inflammatory mediators and induces neuronal death indirectly via inflammation [22]. All these above findings demonstrate that LOX-1 may play an important role in neurodegeneration. However, the expression and function of LOX-1 have not been reported in the photoreceptor degeneration. In the present study, we investigated the expression and role of LOX1 in light induced photoreceptor degeneration. LPS-activated BV2 cells as a classical way to activate microglia in vitro has been widely used in the study of neuroinflammation and neurodegeneration [25,26]. Therefore, we used LPS-activated BV2 cells to explore effect of LOX-1 on the neurotoxicity of microglia. We intend to find effective photoreceptor protective therapies.
2.4. TUNEL analysis Eyes were enucleated (n = 3/group) from BALB/c mice, immersed in 0.01 M PBS, embedded in tissue freezing medium (Leica, Richmond, IL), and frozen in liquid nitrogen. Cryosections were cut in the sagittal plane through the optic nerve head (ONH). Immediate cell death was detected by the DeadEnd™ Fluorometric TUNEL System (Promega, Madison, WI), according to the manufacturer’s instructions. DAPI was used to label all nuclei. Images were collected by fluorescence microcopy. TUNEL-positive cells were defined as cells with green color staining.
2. Materials and methods 2.5. Histologic analysis
2.1. Animals and light damage (LD)
Sections were cut through the ONH of each eye in the sagittal plane, and stained with hematoxylin and eosin (HE) for the morphological analysis. Light microscope images were photographed, and the thickness of outer nuclear layer (ONL) was measured in three sections at 200 μm intervals from the ONH on the photographs.
Eight-week-old female BALB/c mice were purchased from SPF Biotechnology Co., LTD. (Beijing, China). All mice were kept under temperature and light controlled conditions (23 °C to 25 °C; 12-hour:12hour light-dark photoperiod). After dark adaptation for 24 h, the pupils of mice were dilated with a topical application of 0.5% tropicamide (Santen Pharmaceuticals Co. Ltd., Osaka, Japan) and 0.5% phenylephrine hydrochloride (Santen Pharmaceuticals Co. Ltd.) at 30 min before exposure to light. Mice were exposed to 15,000 lux of cool white light for 4 h. After the exposure, all mice were placed in the dark for 24 h and then returned to the previous 12 h:12 h light–dark cycle. Eyes were enucleated immediately after sacrifice 0 h, 1 day, 2 days, 3 days and 7 days after LD for analysis by real-time RT-PCR, western blot and TUNEL. All animal experiments were performed in accordance with the Association for Research in Vision and Ophthalmology (ARVO) Statement for the Use of Animals in Ophthalmic and Vision Research and the Institutional Animal Care and Use Committee of Peking University. All protocols were approved by the Animal Care and Use Committee of Peking University First Hospital.
2.6. Real-time reverse transcriptase polymerase chain reaction (RT-PCR) After sacrifice, retinas were removed from BALB/c mice (n = 6/ group). Total RNA was extracted by using TRIzol reagent (Invitrogen, Carlsbad, CA) and quantified by spectrophotometry (260 nM). The cDNA template was produced by RNA (2 μg) through reverse transcription for PCR reaction and a 2 μL cDNA aliquot was used for realtime RT-PCR (20 μL total reaction volume). Real-Time SYBR® Green (TaKaRa, Dalian, China) was used for the PCR reaction with primer concentrations of 10 μM. All reactions were performed with the following cycling parameters: 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s, 60 °C for 30 s, and a final stage of 95 °C for 15 s, 60 °C for 30 s, and 95 °C for 15 s. Relative mRNA levels of LOX-1, TNF-α, IL-1β and CCL2 were tested by real-time RT-PCR. β-actin was used as an internal control. The primer pair sequences are shown in Table 1.
2.2. LOX-1 neutralizing antibody and PolyI treatment Mice were anesthetized with saturated tribromoethanol (Sigma, St. Louis, MO) (315 mg/kg). Goat anti-mouse LOX-1 neutralizing antibody (R&D Systems, Minneapolis, MN) (5 μg/2 μL) or control goat IgG (R&D Systems) (5 μg/2 μL) were injected into the vitreous chamber by puncturing the eye at the corneal–scleral junction using a syringe equipped with a 33-gauge needle the day before LD. On 1 day after LD, an additional 2 μg/100 μL was injected intraperitoneally; controls were similarly injected with IgG. Polyinosinic acid (PolyI) (Sigma) (5 μg/2 μL) or control vehicle (sterile water) were injected into the vitreous chamber the day before LD. On 1 day after LD, an additional 2 μg/ 100 μL was injected intraperitoneally; controls were similarly injected with vehicle. Eyes were enucleated immediately after sacrifice 2 days after LD for analysis by real-time RT-PCR, western blot, TUNEL and histologic analysis.
2.7. Western blotting Retinas were lysed in radioimmunoprecipitation assay (RIPA; Solarbio, Beijing, China) lysis buffer containing Phenylmethanesulfonyl fluoride (PMSF) (100:1) for 1 h, then the lysate was centrifuged and the Table 1 Nucleotide sequences of mouse primers for real-time RT-PCR. Gene
GenBank No.
Primer Sequence (5′ − 3′)
Size (bp)
β-Actin
NM_007393.5
147
LOX-1
NM_138648.2
TNF-α
NM_013693.2
IL-1β
NM_008361.3
CCL2
NM_011333.3
F - GAT TAC TGC TCT GGC TCC TAG C R - GAC TCA TCG TAC TCC TGC TTG C F - AGG TCC TTG TCC ACA AGA CTG G R - ACG CCC CTG GTC TTA AAG AAT TG F - ACC CTC ACA CTC AGA TCA TCT T R - GGT TGT CTT TGA GAT CCA TGC F - CGC AGC AGC ACA TCA ACA AGA GC R - TGT CCT CAT CCT GGA AGG TCC ACG F - AGCTGTAGTTTTTGTCACCAAGC R - GTGCTGAAGACCTTAGGGCA
2.3. Cell culture and stimulation The 661W photoreceptor-like cells and BV2 microglia-like cells (purchased from China Infrastructure of Cell Line Resource) were cultured in Dulbecco's Modified Eagle's Medium (DMEM; Gibco, San 2
273 148 111 155
International Immunopharmacology 80 (2020) 106190
X. Gao, et al.
supernatant was used for this study. Adding SDS sample buffer and boiling after testing the protein concentration. Total protein was separated on 10% or 12% acrylamide SDS-PAGE and transferred onto polyvinylidene difluoride (PVDF) membrane. The membranes were blocked with 5% milk in PBS at room temperature for 1 h, and then were incubated with a primary antibody to β-actin (1:20000; Abclonal, Wuhan, China), and primary antibody to LOX-1 (1:500; Bioss, Beijing, China) or primary antibody to TNF-α (1:300; Bioss, Beijing, China) or primary antibody to IL-1β (1:500; Abclonal, Wuhan, China) or primary antibody to CCL2 (1:300; Bioss, Beijing, China) or primary antibody to total NF-κB (t-NF-κB) (1:300; Bioss) or primary antibody to phosphorNF-κB (p-NF-κB) (1:300; Bioss) at room temperature for 2 h. After washing in PBS containing 0.5% Tween 20 for three times, membranes were incubated with corresponding peroxidase-conjugated secondary antibodies at room temperature for 1 h. Then the blots were developed by using chemiluminescence (ECL; Thermo Fisher Scientific, Waltham, MA, USA).
3.2. The expression of LOX-1 in light induced retinal degeneration To investigate whether LOX-1 is involved in photoreceptor cell death caused by LD, we detected mRNA and protein levels of LOX-1 in normal and light damaged retinas of BALB/c mice by real-time RT-PCR and western blot. Results showed that mRNA levels of LOX-1 (Fig. 2A) were notably increased in retinas of BALB/c mice at 0 h, 1 day, 2 days and 3 days after LD compared with normal retinas (p < 0.05, p < 0.001, p < 0.001, p < 0.001, respectively). There was a slight increase at 7 days after LD, but it was not statistically significant. To confirm these data, LOX-1 protein was examined by western blot. Results showed that protein levels of LOX-1 (Fig. 2B) were elevated in retinas at 0 h, 1 day, 2 days, 3 days after LD compared with normal retinas. The expression of LOX-1 raised gradually from 0 h to 2 days after LD, then reduced gradually from 2 days to 7 days after LD. The expression level of LOX-1 was highest at 2 days after LD. Therefore, the following functional experiments of LOX-1 were tested in retinas at 2 days after LD. All these results indicated that elevated expression of LOX-1 was induced by LD in a time-dependent manner.
2.8. Enzyme-linked immunosorbent assay (ELISA) The concentrations of TNF-α (CUSABIO, Wuhan, China), IL-1β (Elabscience, Wuhan, China) and CCL2 (Elabscience) in BV2 cells culture supernatants were analyzed using ELISA kit following the manufacturer's instructions.
3.3. Effect of LOX-1 neutralizing antibody on inflammatory factors in light induced retinal degeneration To explore the effects of LOX-1 on inflammation in retinal degeneration, LOX-1 neutralizing antibody was treated with mice, and expression levels of LOX-1, TNF-α, IL-1β and CCL2 were tested in retinas of BALB/c mice by real-time RT-PCR and western blot. Relative mRNA (Fig. 3A, p < 0.01) and protein (Fig. 3B) levels of LOX-1 were significantly decreased in LOX-1 neutralizing antibody compared with IgG control. Elevated mRNA and protein levels of TNF-α (Fig. 3C, 3D), IL-1β (Fig. 3E, 3F) and CCL2 (Fig. 3G, H) induced by LD (p < 0.001, p < 0.01, p < 0.001, respectively) were significantly inhibited by LOX-1 neutralizing antibody compared with IgG control (p < 0.001, p < 0.01, p < 0.001, respectively). The t-NF-κB is the total NF-κB in cells, and p-NF-κB as a phosphorylated form represents activated NF-κB. After LOX-1 neutralizing antibody treatment, protein level of p-NF-κB (Fig. 3I) induced by LD was significantly decreased, but no obvious alterations of t-NF-κB expression were observed. All these results indicated that inflammation was inhibited by LOX-1 neutralizing antibody in light induced retinal degeneration.
2.9. Flow cytometry analysis 661W cells were incubated for 48 h either in their own normal medium or in microglia-conditioned medium (cultured supernatants from normal, LPS, IgG + LPS, LOX-1Ab + LPS, vehicle + LPS and PolyI + LPS treated BV2 cells). The 661W cell death was evaluated by using FITC Annexin V Apoptosis Detection Kit (BD Biosciences, San Diego, CA, USA) according to the manufacturer's protocol. Briefly, after washing in cold PBS twice, cells were resuspended in 1× binding buffer. FITC Annexin V and PI were added, and cells were incubated at room temperature for 15 min in dark. Stained cells were analyzed immediately using a flow cytometer (FACSCalibur; BD Biosciences). 2.10. Statistical analysis We used ANOVA with post hoc pairwise comparisons using the Tukey method to correct for multiple comparisons. P < 0.05 was considered statistically significant. All statistical analysis was performed with GraphPad Prism version 5. All experiments were repeated three times to ensure reproducibility and data from a representative experiment are shown as mean ± standard error of the mean (SEM).
3.4. Effect of PolyI on inflammatory factors in light induced retinal degeneration In order to fully verify the function of LOX-1 on inflammation in retinal degeneration, mice were treated with PolyI (the inhibitor of LOX-1), and expression levels of LOX-1, TNF-α, IL-1β and CCL2 were tested. The up-regulation of mRNA (Fig. 4A, p < 0.001) and protein (Fig. 4B) levels of LOX-1 induced by LD was significantly inhibited by PolyI. Elevated mRNA and protein levels of TNF-α (Fig. 4C, D), IL-1β (Fig. 4E, F) and CCL2 (Fig. 4G, H) induced by LD (p < 0.001, p < 0.01, p < 0.001, respectively) were significantly inhibited by PolyI compared with vehicle control (p < 0.001, p < 0.05, p < 0.001, respectively). PolyI significantly inhibited p-NF-κB protein production induced by LD compared with vehicle control (Fig. 4I), but no obvious alterations of t-NF-κB expression were observed. All these results indicated that inflammation was inhibited by PolyI in light induced retinal degeneration.
3. Results 3.1. Photoreceptor cell death after light damage in retinas of BALB/c mice In order to observe the photoreceptor cell death after LD in retinas of BALB/c mice, the TUNEL staining was performed. Staining results showed that there were no TUNEL-positive photoreceptors in normal retinas (Fig. 1A). TUNEL-positive staining began to appear in the retina at 0 h (Fig. 1B) after LD, but there was no significant cell death in the outer nuclear layer (ONL). At 1 day (Fig. 1C), 2 days (Fig. 1D), 3 days (Fig. 1E) and 7 days (Fig. 1F) after LD, TUNEL-positive photoreceptors were present in the ONL of retinas. TUNEL-positive photoreceptors at 2 days after LD were more than at 1 day after LD in the retina. The number of TUNEL-positive photoreceptors decreased gradually from 2 to 7 days after LD. There was highest number of TUNEL-positive photoreceptors at 2 days after LD. The ONL was markedly thinned at 7 days after LD compared with normal retinas. All these results indicated that photoreceptor cell death was induced by LD, and this occurred in a time-dependent manner.
3.5. The role of LOX-1 in light induced retinal morphological change. To investigate the role of LOX-1 in light induced retinal morphological change, histological analysis was performed. Representative photomicrographs of HE staining of retinal sections (Fig. 5A) and measurements of the thickness of ONL indicated that the thickness of ONL was significantly decreased in LD retinas compared with normal 3
International Immunopharmacology 80 (2020) 106190
X. Gao, et al.
Fig. 1. (A–F). Fluorescence photomicrographs showing TUNEL label in retinas of BALB/c mice. TUNEL-positive photoreceptor nuclei (green) were present in retinas of 1 day (C), 2 days (D), 3 days (E) and 7 days (F) after LD but not in 0 h (B) after LD and normal control (A). There is highest number of TUNEL-positive photoreceptor nuclei at 2 days after LD. All nuclei were labeled with DAPI (blue). GCL, ganglion cell layer; INL, inner nuclear layer; ONL, outer nuclear layer. Scale bars represent 100 μm.
ONL.
control (Fig. 5B). However, the thickness of ONL was significantly increased in LD retinas pretreated with LOX-1 neutralizing antibody (Fig. 5C) or PolyI (Fig. 5D) compared with their control. These results indicated that inhibition of LOX-1 rescued the light induced thinning of 4
International Immunopharmacology 80 (2020) 106190
X. Gao, et al.
3.6. Effect of LOX-1 on photoreceptor cell death induced by light damage To investigate whether inhibition of LOX-1 can reduce photoreceptor cell death induced by LD, we tested photoreceptor cell death in retinas of BALB/c mice treated with LOX-1 neutralizing antibody or PolyI by TUNEL. Staining results showed that there were lots of TUNELpositive photoreceptors in retinas at 2 days after LD (Fig. 6B) but not in normal control (Fig. 6A). TUNEL-positive photoreceptors were significantly decreased in LD retinas treated with LOX-1 neutralizing antibody (Fig. 6D) compared with LD retinas treated with IgG (Fig. 6C). The PolyI-treated retinas had significantly fewer TUNEL-positive photoreceptors (Fig. 6F) than vehicle control (Fig. 6E). All these results indicated that inhibition of LOX-1 reduced photoreceptor cell death induced by LD. 3.7. Effect of LOX-1 on inflammatory factors in BV2 cells In order to fully verify the function of LOX-1 on inflammation, expression levels of LOX-1, TNF-α, IL-1β and CCL2 were tested by realtime RT-PCR, western blot or ELISA in BV2 cells. The elevated relative mRNA (Fig. 7A; p < 0.001) and protein (Fig. 7B) levels of LOX-1 induced by LPS were significantly inhibited by LOX-1 neutralizing antibody (p < 0.001) or PolyI (p < 0.001) compared with their controls in BV2 cells. Relative mRNA and protein levels of TNF-α (Fig. 7C, p < 0.001; Fig. 7D, p < 0.001), IL-1β (Fig. 7E, p < 0.001; Fig. 7F, p < 0.001) and CCL2 (Fig. 7G, p < 0.001; Fig. 7H, p < 0.001) were
Fig. 2. (A–B). Relative mRNA and protein levels of LOX-1 in retinas of BALB/c mice. Relative mRNA level of LOX-1 (A) was significantly greater in retinas of BALB/c mice at 0 h, 1, 2 and 3 days after LD than in normal. Protein level of LOX-1 (B) was significantly increased in retinas of BALB/c mice at 0 h, 1, 2 and 3 days after LD than in normal. No significant difference was detected at 7 days after LD.
Fig. 3. (A–H). LOX-1 neutralizing antibody treatment inhibits expression of inflammatory cytokines in retinas of BALB/c mice. Relative mRNA and protein levels of LOX-1 (A, B), TNF-α (C, D), IL-1β (E, F) and CCL2 (G, H) were significantly decreased in LOX-1 neutralizing antibody compared with IgG controls. Protein level of pNF-κB (I) was significantly decreased after LOX-1 neutralizing antibody treatment, but no obvious alterations of t-NF-κB expression were observed. 5
International Immunopharmacology 80 (2020) 106190
X. Gao, et al.
Fig. 4. (A–H). PolyI treatment inhibits expression of inflammatory cytokines in retinas of BALB/c mice. Relative mRNA and protein levels of LOX-1 (A, B), TNF-α (C, D), IL-1β (E, F) and CCL2 (G, H) were significantly decreased in PolyI compared with vehicle controls. Protein level of p-NF-κB (I) was significantly decreased in Poly (I), but no obvious alterations of t-NF-κB expression were observed.
However, the cell death was significantly decreased in 661W cells incubated with the supernatant of LPS activated BV2 microglia cells pretreated with LOX-1 neutralizing antibody (p < 0.001) or PolyI (p < 0.001) compared with their controls. All these results indicated that inhibition of LOX-1 attenuates the neurotoxicity of microglia on photoreceptors.
obviously up-regulated in BV2 cells stimulated by LPS compared with normal cells. However, these up-regulations of TNF-α (Fig. 7C, p < 0.001, p < 0.001; Fig. 7D, p < 0.001, p < 0.001), IL-1β (Fig. 7E, p < 0.01, p < 0.001; Fig. 7F, p < 0.001, p < 0.001) and CCL2 (Fig. 7G, p < 0.01, p < 0.001; Fig. 7H, p < 0.001, p < 0.001) were significantly inhibited by LOX-1 neutralizing antibody or PolyI compared with their controls. All these results indicated that inflammation was down-regulated by inhibition of LOX-1 in activated BV2 microglia cells.
4. Discussion Light is essential in our daily life and is very important for the formation of vision, but excessive light exposure can lead to retinal inflammation and degeneration [30–32]. In the present study, the BALB/c mice model of light-induced retinal degeneration was used to observe the photoreceptor cell death at different time points after LD. Our results showed that there were no TUNEL-positive photoreceptors in normal retinas without LD, but lots of TUNEL-positive photoreceptors appeared after LD. The number of photoreceptor cell death gradually increased from 0 h to 2 days after LD and then that decreased gradually from 2 to 7 days after LD. Photoreceptor cell death was present in highest number at 2 days after LD. In addition, the ONL was extremely thinned at 7 days after LD compared with normal retinas. These indicate that photoreceptor cell death will be induced by LD, and this occurs in a time-dependent manner. These findings are consistent with previous studies showing that more cell death appear with increasing time after light exposure, and photoreceptor cells are mostly cleared from the retina at 10 days following light exposure [1].
3.8. Inhibition of LOX-1 attenuates microglial neurotoxicity on photoreceptors To further investigate the role of LOX-1 in photoreceptor cell death, and to test whether LOX-1 influence the neurotoxicity of microglia on photoreceptors, flow cytometry analysis was performed. The 661W photoreceptor cells were cultured in their own normal medium or cultured supernatants from normal, LPS-treated, IgG + LPS-treated, LOX-1Ab + LPS-treated, Vehicle + LPS-treated and PolyI + LPStreated BV2 cells, respectively. The cell death of 661W was measured by flow cytometry after staining with FITC conjugated Annexin V and PI. Representative flow cytometry output (Fig. 8A), quantitative comparison of late apoptotic or necrotic cells (Fig. 8B) from the flow cytometry results showed that the 661W photoreceptor cell death was obviously increased by the supernatant of LPS activated BV2 microglia cells compared with the supernatant of normal BV2 cells (p < 0.001). 6
International Immunopharmacology 80 (2020) 106190
X. Gao, et al.
Fig. 5. (A–D). The role of LOX-1 in light induced retinal morphological change. Representative photomicrographs showing HE staining (A) of retinal sections from normal, LD, IgG + LD, LOX-1Ab + LD, Vehicle + LD and PolyI + LD mice. GCL, ganglion cell layer; INL, inner nuclear layer; ONL, outer nuclear layer. Scale bars represent 100 μm. Measurements of the thickness of ONL. The thickness of ONL was significantly decreased in LD retinas compared with normal control (B). Inhibition of LOX-1 by LOX-1 neutralizing antibody (C) or PolyI (D) rescued the light induced thinning of ONL compared with IgG or vehicle control. Data are shown as mean ± SEM (n = 3). *P < 0.05, **P < 0.01.
shown that activated microglia secrete many pro-inflammatory factors, such as TNF-α, IL-1β and CCL2, which are traditionally considered to cause neurodegeneration [9,36]. In the present study, we found that the mRNA and protein levels of TNF-α, IL-1β and CCL2 were increased in retinas of BALB/c mice after LD. However, these up-regulations were significantly suppressed by LOX-1 neutralizing antibody. NF-κB has been considered a key regulator of neuroinflammatory response and it is phosphorylated, activated and bonded to a specific target gene to modulate the transcription and release of pro-inflammatory cytokines [37,38]. LOX-1 deletion in LDLR-null mice reduced macrophage accumulation by decreasing the activation of NF-κB [39]. To further investigate how LOX-1 regulates pro-inflammatory cytokines in light damaged retinas of BALB/c mice, we tested the expression of NF-κB. Our results indicated that LOX-1 neutralizing antibody significantly inhibited p-NF-κB protein production induced by LD. These are consistent with previous studies showing that inhibition of LOX-1 decreases the production of inflammatory factors through the NF-κB pathway [40,41]. In order to fully verify our results, as a chemical inhibitor of LOX-1 [16,27,28], PolyI was given to BALB/c mice to inhibit LOX-1, and the results showed that elevated levels of TNF-α, IL-1β, CCL2 and p-NF-κB induced by LD were significantly decreased by PolyI. These
Previous studies have shown that LOX-1 is involved in neurodegeneration diseases [33,34]. Atherogenic L5 likely creates a neurotoxic stress and contributes to neurodegenerative disorders via LOX-1 in neuron-like PC12 cells [24]. Neuronal damaging stress releases DAMPs after LD in retinas. As a member of PRRs, LOX-1 activated by neuronal injury signals leads to the inflammatory cascade response and the production of inflammatory factors, exacerbating neuronal damage [22]. Our results revealed that LOX-1 was expressed in retina of BALB/c mice, and elevated expression of LOX-1 was induced by LD in a timedependent manner. The mRNA and protein level of LOX-1 was increased at 0 h after LD. Although the photoreceptor cells have not yet died at 0 h, they have already suffered damage stress, which may cause LOX-1 to be activated by injury signals. The expression level of LOX-1 was highest at 2 days after LD. Similarly, photoreceptor cell death was also present in highest number at 2 days after LD. These findings are consistent with previous studies showing that the elevated expression of LOX-1 was detected in hypertension-induced neuronal apoptosis [35]. All above suggested that LOX-1 was involved in photoreceptor cell death. Inflammatory response has been shown to play a key role in the pathogenesis of photoreceptor cell death [9,15]. Previous studies have 7
International Immunopharmacology 80 (2020) 106190
X. Gao, et al.
Fig. 6. (A–F). The role of LOX-1 on light induced photoreceptors cell death in retinas of BALB/c mice. Representative fluorescence photomicrographs showing TUNEL label retinal sections. There were many TUNEL-positive photoreceptors (green) in retinas at 2 days after LD (B) but none of in normal control (A). TUNELpositive photoreceptors were significantly decreased in LOX-1 neutralizing antibody (D) or PolyI (F) compared with IgG (C) or vehicle (E) control. All nuclei were labeled with DAPI (blue). GCL, ganglion cell layer; INL, inner nuclear layer; ONL, outer nuclear layer. Scale bars represent 100 μm.
neuronal cell death in the HN33 neuronal cell line [23]. Our results showed that the thinning of ONL and photoreceptor cell death were induced by LD in retinas. However, the light induced thinning of ONL and photoreceptor cell death were rescued by inhibition of LOX-1 by LOX-1 neutralizing antibody or PolyI treatment. These findings are consistent with previous studies showing that anti-LOX-1 monoclonal antibody inhibits inflammatory response and reduces apoptosis in
results are consistent with the results of neutralizing antibody treatment described above. All above our data suggested that pro-inflammatory cytokines down-regulated by inhibition of LOX-1 may be through the NF-κB pathway in retinal degeneration. LOX-1 promotes generation of proinflammatory cytokines that induce neurodegeneration by recognizing neuronal injury signals [22]. Previous studies have shown that the activation of LOX-1 leads to 8
International Immunopharmacology 80 (2020) 106190
X. Gao, et al.
Fig. 7. (A–H). The role of LOX-1 on expression of inflammatory cytokines in BV2 cells. The elevated relative mRNA and protein levels of LOX-1 (A, B), TNF-α (C, D), IL-1β (E, F) and CCL2 (G, H) induced by LPS were significantly inhibited by LOX-1 neutralizing antibody or PolyI compared with IgG or vehicle control in BV2 cells.
activated BV2 microglia cells and 661W photoreceptor cells co-culture in microglia-conditioned medium were used to explore effect of LOX-1 on the neurotoxicity of microglia. LOX-1 is crucial in microglia for promoting an inflammatory
vascular smooth muscle cells [42,43]. All above results indicate that LOX-1 plays an essential role in retinal degeneration. Inhibition of LOX-1 prevents retinal inflammation and photoreceptor cell death. To further prove the role of LOX-1, LPS9
International Immunopharmacology 80 (2020) 106190
X. Gao, et al.
Fig. 8. (A–B). Inhibition of LOX-1 reduces microglial neurotoxicity on photoreceptors. (A) The supernatant from normal, LPS-treated, IgG + LPS-treated, LOX1Ab + LPS-treated, Vehicle + LPS-treated and PolyI + LPS-treated BV2 cells was added to 661W photoreceptor cells, respectively. The cell death of 661W was measured by flow cytometry after staining with FITC conjugated Annexin V and PI. Cells in the bottom left quadrant represent viable cells (low annexin V and PI staining), cells in the bottom right quadrant represent early apoptotic cells (high annexin V but low PI staining), cells in the top right quadrant represent late apoptotic or necrotic cells (high annexin V and PI staining). The percentage of cells in each quadrant is indicated within the quadrant. (B) Quantitative comparison of late apoptotic or necrotic cells from the flow cytometry results. Data are shown as mean ± SEM (n = 3).
induced by LD are significantly decreased by inhibition of LOX-1. Moreover, inhibition of LOX-1 can rescue photoreceptor cell death. In addition, inhibition of LOX-1 attenuates the neurotoxicity of microglia on photoreceptors. In view of its essential role in retinal degeneration, LOX-1 could become a novel target for preventing photoreceptor cell death in such photoreceptor degeneration diseases as well as AMD. However, for more and in-depth research, knock-out or overexpression of LOX-1 is worthy of further research. In addition, further research is needed to be done to investigate the specific mechanism and other pathway of LOX-1 in retinal degeneration.
response, and elevated level of LOX-1 is detected in microglia in response to heat shock protein 60 (HSP60) or LPS [21,22]. Our results indicated that expression levels of LOX-1, TNF-α, IL-1β and CCL2 were obviously up-regulated in BV2 cells stimulated by LPS. LPS as PAMPs can bind and activate LOX-1 in LPS-stimulated BV2 [21]. However, these up-regulations were significantly inhibited by LOX-1 neutralizing antibody or PolyI. These findings are consistent with previous studies showing that LOX-1 knockdown attenuated pro-inflammatory factors expression in activated microglia [21]. Activated microglia secrete large amounts of inflammatory factors that are cytotoxic and can induce photoreceptor cell death [44]. In the present study, the 661W photoreceptor cell death was obviously increased by the supernatant of LPS activated BV2 microglia cells compared with the supernatant of normal BV2 cells. However, the cell death was significantly decreased in 661W cells incubated with the supernatant of LPS activated BV2 microglia cells pretreated with LOX-1 neutralizing antibody or PolyI. All these results indicated inhibition of LOX-1 attenuates the neurotoxicity of microglia on photoreceptors. In summary, the data presented herein indicate that the expression level of LOX-1 is up-regulated in light induced retinal degeneration. We provide evidence that elevated levels of pro-inflammatory factors
CRediT authorship contribution statement Xinran Gao: Conceptualization, Methodology, Investigation, Formal analysis, Writing - original draft, Visualization. Ruilin Zhu: Resources, Formal analysis, Writing - review & editing. Jiantong Du: Methodology, Visualization. Wenbo Zhang: Resources, Formal analysis. Wenna Gao: Resources, Validation. Liu Yang: Conceptualization, Writing - review & editing, Supervision, Project administration.
10
International Immunopharmacology 80 (2020) 106190
X. Gao, et al.
Acknowledgements [22]
This work was supported by National Natural Science Foundation of China (81470650); National Natural Science Foundation of China (81670841); Natural Science Foundation of Beijing (7172218), China. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
[23] [24]
References
[25]
[1] A. Wenzel, C. Grimm, M. Samardzija, C.E. Reme, Molecular mechanisms of lightinduced photoreceptor apoptosis and neuroprotection for retinal degeneration, Prog. Retin. Eye Res. 24 (2) (2005) 275–306. [2] D. Jiang, R.C. Ryals, S.J. Huang, K.K. Weller, H.E. Titus, B.M. Robb, F.W. Saad, R.A. Salam, H. Hammad, P. Yang, D.L. Marks, M.E. Pennesi, Monomethyl fumarate protects the retina from light-induced retinopathy, Invest. Ophthalmol. Vis. Sci. 60 (4) (2019) 1275–1285. [3] M. Chen, H. Xu, Parainflammation, chronic inflammation, and age-related macular degeneration, J. Leukoc. Biol. 98 (5) (2015) 713–725. [4] H. Kohno, Y. Chen, B.M. Kevany, E. Pearlman, M. Miyagi, T. Maeda, K. Palczewski, A. Maeda, Photoreceptor proteins initiate microglial activation via Toll-like receptor 4 in retinal degeneration mediated by all-trans-retinal, J. Biol. Chem. 288 (21) (2013) 15326–15341. [5] H. Jiao, R. Natoli, K. Valter, J.M. Provis, M. Rutar, Spatiotemporal Cadence of Macrophage Polarisation in a Model of Light-Induced Retinal Degeneration, PLoS ONE 10 (12) (2015) e0143952. [6] J. Xie, R. Zhu, Y. Peng, W. Gao, J. Du, L. Zhao, Y. Chi, L. Yang, Tumor necrosis factor-alpha regulates photoreceptor cell autophagy after retinal detachment, Sci. Rep. 7 (1) (2017) 17108. [7] N. Yoshida, Y. Ikeda, S. Notomi, K. Ishikawa, Y. Murakami, T. Hisatomi, H. Enaida, T. Ishibashi, Laboratory evidence of sustained chronic inflammatory reaction in retinitis pigmentosa, Ophthalmology 120 (1) (2013) e5–e12. [8] H. Zeng, M. Ding, X.X. Chen, Q. Lu, Microglial NADPH oxidase activation mediates rod cell death in the retinal degeneration in rd mice, Neuroscience 275 (2014) 54–61. [9] C. Feng, X. Wang, T. Liu, M. Zhang, G. Xu, Y. Ni, Expression of CCL2 and its receptor in activation and migration of microglia and monocytes induced by photoreceptor apoptosis, Mol. Vis. 23 (2017) 765–777. [10] A.A. Herzlich, X. Ding, D. Shen, R.J. Ross, J. Tuo, C.C. Chan, Peroxisome proliferator-activated receptor expression in murine models and humans with age-related macular degeneration, Open Biol. J. 2 (2009) 141–148. [11] E. Colak, N. Majkic-Singh, L. Zoric, A. Radosavljevic, N. Kosanovic-Jakovic, The impact of inflammation to the antioxidant defense parameters in AMD patients, Aging. Clin. Exp. Res. 24 (6) (2012) 588–594. [12] J.E. Murphy, D. Tacon, P.R. Tedbury, J.M. Hadden, S. Knowling, T. Sawamura, M. Peckham, S.E. Phillips, J.H. Walker, S. Ponnambalam, LOX-1 scavenger receptor mediates calcium-dependent recognition of phosphatidylserine and apoptotic cells, Biochem. J. 393 (Pt 1) (2006) 107–115. [13] L. Zhou, J. Xie, Y. Ruan, H. Zhu, W. Wang, X. Yun, L. Guo, H. Gan, L. Sun, M. Yu, J. Gu, Expression and purification of secreted recombinant hsp60 from eukaryotic cells, Protein Expr. Purif. 72 (2) (2010) 179–183. [14] V. Rai, D.K. Agrawal, The role of damage- and pathogen-associated molecular patterns in inflammation-mediated vulnerability of atherosclerotic plaques, Can. J. Physiol. Pharmacol. 95 (10) (2017) 1245–1253. [15] C.P. Ardeljan, D. Ardeljan, M. Abu-Asab, C.C. Chan, Inflammation and cell death in age-related macular degeneration: an immunopathological and ultrastructural model, J. Clin. Med. 3 (4) (2014) 1542–1560. [16] X. Gao, G. Zhao, C. Li, J. Lin, N. Jiang, Q. Wang, L. Hu, Q. Xu, X. Peng, K. He, G. Zhu, LOX-1 and TLR4 affect each other and regulate the generation of ROS in A. fumigatus keratitis, Int. Immunopharmacol. 40 (2016) 392–399. [17] M. Yan, J.L. Mehta, W. Zhang, C. Hu, LOX-1, oxidative stress and inflammation: a novel mechanism for diabetic cardiovascular complications, Cardiovasc. Drugs Ther. 25 (5) (2011) 451–459. [18] Z. Ding, S. Liu, X. Wang, Y. Dai, M. Khaidakov, X. Deng, Y. Fan, D. Xiang, J.L. Mehta, LOX-1, mtDNA damage, and NLRP3 inflammasome activation in macrophages: implications in atherogenesis, Cardiovasc. Res. 103 (4) (2014) 619–628. [19] S.H. Chan, C.H. Hung, J.Y. Shih, P.M. Chu, Y.H. Cheng, H.C. Lin, K.L. Tsai, SIRT1 inhibition causes oxidative stress and inflammation in patients with coronary artery disease, Redox Biol. 13 (2017) 301–309. [20] V. Lubrano, S. Balzan, Roles of LOX-1 in microvascular dysfunction, Microvasc. Res. 105 (2016) 132–140. [21] X. Ge, D.M. Zhang, M.M. Li, Y. Zhang, X.Y. Zhu, Y. Zhou, X. Peng, A.G. Shen,
[26]
[27]
[28]
[29] [30] [31] [32]
[33]
[34]
[35]
[36]
[37]
[38] [39]
[40]
[41]
[42]
[43]
[44]
11
Microglial LOX-1/MAPKs/NF-kappaB positive loop promotes the vicious cycle of neuroinflammation and neural injury, Int. Immunopharmacol. 70 (2019) 187–200. D. Zhang, L. Sun, H. Zhu, L. Wang, W. Wu, J. Xie, J. Gu, Microglial LOX-1 reacts with extracellular HSP60 to bridge neuroinflammation and neurotoxicity, Neurochem. Int. 61 (7) (2012) 1021–1035. X. Mao, L. Xie, D.A. Greenberg, LOX-1 expression and oxidized LDL uptake and toxicity in the HN33 neuronal cell line, Neurosci. Lett. 580 (2014) 182–185. J.Y. Wang, C.L. Lai, C.T. Lee, C.Y. Lin, Electronegative Low-Density Lipoprotein L5 Impairs Viability and NGF-Induced Neuronal Differentiation of PC12 Cells via LOX1, Int. J. Mol. Sci. 18 (8) (2017). R. Scholz, M. Sobotka, A. Caramoy, T. Stempfl, C. Moehle, T. Langmann, Minocycline counter-regulates pro-inflammatory microglia responses in the retina and protects from degeneration, J. Neuroinflammation 12 (2015) 209. Y. Wang, Z. Yin, L. Gao, D. Sun, X. Hu, L. Xue, J. Dai, Y. Zeng, S. Chen, B. Pan, M. Chen, J. Xie, H. Xu, Curcumin delays retinal degeneration by regulating microglia activation in the retina of rd1 mice, Cell. Physiol. Biochem. 44 (2) (2017) 479–493. D. Li, J.L. Mehta, Upregulation of endothelial receptor for oxidized LDL (LOX-1) by oxidized LDL and implications in apoptosis of human coronary artery endothelial cells: evidence from use of antisense LOX-1 mRNA and chemical inhibitors, Arterioscler. Thromb. Vasc. Biol. 20 (4) (2000) 1116–1122. R. Wang, G. Ding, W. Liang, C. Chen, H. Yang, Role of LOX-1 and ROS in oxidized low-density lipoprotein induced epithelial-mesenchymal transition of NRK52E, Lipids Health Dis. 9 (2010) 120. Q. Zhang, J. Liu, L. Ma, N. Bai, H. Xu, Wnt5a is involved in LOX-1 and TLR4 induced host inflammatory response in peri-implantitis, J. Periodontal Res. (2019). W.K. Noell, V.S. Walker, B.S. Kang, S. Berman, Retinal damage by light in rats, Invest. Ophthalmol. 5 (5) (1966) 450–473. A. Luckoff, R. Scholz, F. Sennlaub, H. Xu, T. Langmann, Comprehensive analysis of mouse retinal mononuclear phagocytes, Nat. Protoc. 12 (6) (2017) 1136–1150. A. Krigel, M. Berdugo, E. Picard, R. Levy-Boukris, I. Jaadane, L. Jonet, M. Dernigoghossian, C. Andrieu-Soler, A. Torriglia, F. Behar-Cohen, Light-induced retinal damage using different light sources, protocols and rat strains reveals LED phototoxicity, Neuroscience 339 (2016) 296–307. A. Lo Castro, M. Murdocca, S. Pucci, A. Zaratti, C. Greggi, F. Sangiuolo, V. Tancredi, C. Frank, G. D'Arcangelo, Early Hippocampal i-LTP and LOX-1 Overexpression Induced by Anoxia: A Potential Role in Neurodegeneration in NPC Mouse Model, Int. J. Mol. Sci. 18 (7) (2017). Z. Hoyk, M.E. Toth, N. Lenart, D. Nagy, B. Dukay, A. Csefova, A. Zvara, G. Seprenyi, A. Kincses, F.R. Walter, S. Veszelka, J. Vigh, B. Barabasi, A. Harazin, A. Kittel, L.G. Puskas, B. Penke, L. Vigh, M.A. Deli, M. Santha, Cerebrovascular Pathology in Hypertriglyceridemic APOB-100 Transgenic Mice, Front. Cell. Neurosci. 12 (2018) 380. Y. Li, Z. Duan, D. Gao, S. Huang, H. Yuan, X. Niu, The new role of LOX-1 in hypertension induced neuronal apoptosis, Biochem. Biophys. Res. Commun. 425 (4) (2012) 735–740. C.C. Chao, S. Hu, L. Ehrlich, P.K. Peterson, Interleukin-1 and tumor necrosis factoralpha synergistically mediate neurotoxicity: involvement of nitric oxide and of Nmethyl-D-aspartate receptors, Brain Behav. Immun. 9 (4) (1995) 355–365. F. Xu, L. Chen, X. Zhao, H. Zhong, L. Cui, L. Jiang, H. Huang, L. Li, S. Zeng, M. Li, Interaction of Wip1 and NF-kappaB regulates neuroinflammatory response in astrocytes, Inflamm. Res. 66 (11) (2017) 1011–1019. A.S. Baldwin Jr., The NF-kappa B and I kappa B proteins: new discoveries and insights, Annu. Rev. Immunol. 14 (1996) 649–683. J.L. Mehta, N. Sanada, C.P. Hu, J. Chen, A. Dandapat, F. Sugawara, H. Satoh, K. Inoue, Y. Kawase, K. Jishage, H. Suzuki, M. Takeya, L. Schnackenberg, R. Beger, P.L. Hermonat, M. Thomas, T. Sawamura, Deletion of LOX-1 reduces atherogenesis in LDLR knockout mice fed high cholesterol diet, Circ. Res. 100 (11) (2007) 1634–1642. P. Wang, L.Y. He, G.D. Shen, R.L. Li, J.L. Yang, Inhibitory effects of Dioscin on atherosclerosis and foam cell formation in hyperlipidemia rats, Inflammopharmacology 25 (6) (2017) 633–642. Q. Li, W. Zhao, X. Zeng, Z. Hao, Ursolic Acid Attenuates Atherosclerosis in ApoE (-/-) Mice: Role of LOX-1 Mediated by ROS/NF-kappaB Pathway, Molecules 23 (5) (2018). M. Akagi, A. Ueda, T. Teramura, S. Kanata, T. Sawamura, C. Hamanishi, Oxidized LDL binding to LOX-1 enhances MCP-1 expression in cultured human articular chondrocytes, Osteoarthritis Cartilage 17 (2) (2009) 271–275. H. Kataoka, N. Kume, S. Miyamoto, M. Minami, M. Morimoto, K. Hayashida, N. Hashimoto, T. Kita, Oxidized LDL modulates Bax/Bcl-2 through the lectinlike Ox-LDL receptor-1 in vascular smooth muscle cells, Arterioscler. Thromb. Vasc. Biol. 21 (6) (2001) 955–960. M. Karlstetter, E. Lippe, Y. Walczak, C. Moehle, A. Aslanidis, M. Mirza, T. Langmann, Curcumin is a potent modulator of microglial gene expression and migration, J. Neuroinflammation 8 (2011) 125.