Inhibition of macrophage inflammatory cytokine secretion by chylomicron remnants is dependent on their uptake by the low density lipoprotein receptor

Biochimica et Biophysica Acta 1811 (2011) 209–220

Contents lists available at ScienceDirect

Biochimica et Biophysica Acta j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / b b a l i p

Inhibition of macrophage inflammatory cytokine secretion by chylomicron remnants is dependent on their uptake by the low density lipoprotein receptor Valerie S. Graham, Paola Di Maggio, Sandra Armengol, Charlotte Lawson, Caroline P.D. Wheeler-Jones, Kathleen M. Botham ⁎ Department of Veterinary Basic Sciences, The Royal Veterinary College, Royal College St., London NW1 0TU, UK

a r t i c l e

i n f o

Article history: Received 28 May 2010 Received in revised form 18 November 2010 Accepted 29 November 2010 Available online 8 December 2010 Keywords: Chylomicron remnant Pro-inflammatory cytokine Lipoprotein oxidation Low density lipoprotein receptor Low density lipoprotein receptor-related protein Macrophage

a b s t r a c t Secretion of pro-inflammatory chemokines and cytokines by macrophages is a contributory factor in the pathogenesis of atherosclerosis. In this study, the effects of chylomicron remnants (CMR), the lipoproteins which transport dietary fat in the blood, on the production of pro-inflammatory chemokine and cytokine secretion by macrophages was investigated using CMR-like particles (CRLPs) together with THP-1 macrophages or primary human macrophages (HMDM). Incubation of CRLPs or oxidized CRLPs (oxCRLPs) with HMDM or THP-1 macrophages for up to 24 h led to a marked decrease in the secretion of the proinflammatory chemokine monocyte chemoattractant protein-1 (MCP-1) and the pro-inflammatory cytokines tumour necrosis factor-α (TNF-α), interleukin (IL)-6 and IL-1β (− 50–90%), but these effects were reduced or abolished when CRLPs protected from oxidation by incorporation of the antioxidant drug, probucol, (pCRLPs) were used. In macrophages transfected with siRNA targeted to the low density lipoprotein receptor (LDLr), neither CRLPs nor pCRLPs had any significant effect on chemokine/cytokine secretion, but in cells transfected with siRNA targeted to the LDLr-related protein 1 (LRP1) both types of particles inhibited secretion to a similar extent to that observed with CRLPs in mock transfected cells. These findings demonstrate that macrophage pro-inflammatory chemokine/cytokine secretion is down-regulated by CMR, and that these effects are positively related to the lipoprotein oxidative state. Furthermore, uptake via the LDLr is required for the down-regulation, while uptake via LRP1 does not bring about this effect. Thus, the receptor-mediated route of uptake of CMR plays a crucial role in modulating their effects on inflammatory processes in macrophages. © 2010 Elsevier B.V. All rights reserved.

1. Introduction The formation of macrophage foam cells in the artery wall caused by excessive intracellular accumulation of lipid taken up in lipoproteins from the subendothelial space is an early event in the development of atherosclerosis [1,2]. It has been known for many years that low density lipoprotein (LDL) plays a major role in foam cell generation, and that oxidation of the particles, a process which occurs Abbreviations: Apo, apolipoprotein; CMR, chylomicron remnants; CRLPs, chylomicron remnant-like particles; DiI, 1′1′-dioctadecyl-3,3-3′,3′-tetramethylindo-carbocyanide perchlorate; IL, interleukin; LDL, low density lipoprotein; LDLr, low density lipoprotein receptor; LRP1, low density receptor-related protein 1; MCP-1, monocyte chemoattractant protein-1; oxCRLPs, oxidized chylomicron remnant-like particles; pCRLPs, chylomicron remnant-like particles containing probucol; TBARS, thiobarbituric acid reacting substances; TG, triacylglycerol; TGF-β, transforming growth factor-β; TNF-α, tumour necrosis factor-α; TRL, triglyceride-rich lipoprotein; siRNA, small interfering RNA ⁎ Corresponding author. Tel.: +44 207 468 5274; fax: +44 207 468 5204. E-mail addresses: [email protected] (V.S. Graham), [email protected] (P. Di Maggio), [email protected] (S. Armengol), [email protected] (C. Lawson), [email protected] (C.P.D. Wheeler-Jones), [email protected] (K.M. Botham). 1388-1981/$ – see front matter © 2010 Elsevier B.V. All rights reserved. doi:10.1016/j.bbalip.2010.11.008

within the vessel wall, is necessary before extensive lipid accumulation is induced [3]. More recently, however, evidence has accumulated to indicate that chylomicron remnants (CMR), the lipoproteins which carry dietary lipids from the gut to the liver [4], are also atherogenic. It has been demonstrated that they are taken up into the artery wall as efficiently as smaller particles such as LDL [5–7]; lipoproteins of intestinal origin have been isolated from human aortic intima and atherosclerotic plaque [8,9]; and delayed clearance of CMR from the circulation has been found to correlate with lesion development [10,11]. In addition, we and others have shown that CMR induce foam cell formation in primary human macrophages [12,13], and in human and murine macrophage cell lines [12,14,15]. In marked contrast to LDL, it is clear that CMR do not require prior oxidation to cause foam formation [12–15]. Furthermore, our studies have demonstrated that protection of the particles from oxidation by incorporation of lipophilic antioxidants (e.g. lycopene and probucol) increases, rather than inhibits, their uptake and induction of lipid accumulation in macrophages [16,17], while oxidized CMR (oxCMR) cause less lipid to accumulate in the cells [18]. Thus, the oxidative state of CMR is inversely related to their ability to induce foam cell formation. Oxidation of CMR mediated by the cell-associated

210

V.S. Graham et al. / Biochimica et Biophysica Acta 1811 (2011) 209–220

lipoxygenase and myeloperoxidase enzymes which oxidize LDL may occur when the particles are trapped in the artery wall. In addition, oxidized lipids from the diet, which are present after fat is cooked at high temperatures, have been shown to be transported in CMR [19,20]. Extensive studies have established that CMR are taken up and degraded by primary macrophages and macrophage cell lines [12]. The LDL receptor (LDLr) is the major route for the clearance of CMR by the liver, and evidence from our studies and others indicates that it also plays a role in their uptake by macrophages [4,18,21]. However, since macrophages from animals lacking the LDLr or treated with an antibody against the LDLr are still able to take up CMR, it is clear that other mechanisms are also involved [12], and it is these, rather than the LDLr, which are believed to be mainly responsible for the unregulated uptake which results in foam cell formation [4,12,22,23]. LDLr related protein 1 (LRP1), the second receptor implicated in hepatic CMR uptake [24], is also expressed in macrophages [18,23,25], and in the presence of receptor associated protein, a specific inhibitor of LRP1, CMR uptake by mouse peritoneal macrophages is markedly decreased [23]. In agreement with this, our recent experiments have indicated that LRP1 is an important receptor-mediated route for the uptake of CMR by human macrophages, although the LDLr also has a significant role [18]. Our studies showed that uptake occurs mainly via these two apolipoprotein (apo) E-dependent receptors regardless of the oxidative state of the particles, contrasting sharply with LDL uptake, which is switched from the LDLr to scavenger receptors on oxidation [3]. Inflammation is now known to be a critical factor in atherosclerosis development [26], and macrophages are a major source of proinflammatory chemokines and cytokines involved in the pathogenesis of the disease [27]. Recent work in our laboratory has shown that they down-regulate the secretion of pro-inflammatory chemokines and cytokines by macrophages, and that these effects are modulated by the fatty acid composition of the particles [28]. These findings suggest that, although CMR are pro-atherogenic in inducing foam cell formation, they may also have some anti-inflammatory effects which are modulated by their lipid content. The influence of the oxidative state of CMR on their suppression of macrophage cytokine secretion, however, is not known. The initial aim of this study was to investigate the effects of the oxidative state of CMR on their suppression of pro-inflammatory chemokine (monocyte chemoattractant protein-1 (MCP-1)) and cytokine (tumour necrosis factor-α (TNF-α), interleukin (IL)-6 and IL-1β) secretion by macrophages. This was achieved using CMR-like particles (CRLPs) in three different oxidative states (CRLPs, oxidized CRLPs (oxCRLPs) and CRLPs containing the antioxidant probucol (pCRLPs)) and macrophages derived from the human monocyte cell line, THP-1 and primary human monocyte-derived macrophages (HMDM). Since the results indicated that the down-regulation of chemokine/cytokine secretion was positively related to the oxidative state of the CRLPs, our second aim was to determine whether the differential effects of the CMR in different oxidative states were related to the receptor-mediated route of uptake of the particles. This was investigated by selective inhibition of the expression of the LDLr and LRP1 genes in THP-1 macrophages using small interfering RNA (siRNA). 2. Materials and methods Fetal bovine serum (FBS), L-alanyl-L-glutamine (glutamax) penicillin/streptomycin and β-mercaptoethanol were obtained from Gibco (Paisley, UK). FBS was heat inactivated (56 °C, 30 min) before use. RPMI 1640 medium, Trypan blue, fatty acid-free bovine serum albumin (BSA), phospholipids, cholesterol, cholesteryl oleate, phorbol 12-myristate 13-acetate (PMA), Oil red O, RNA extraction kits, SYBR green and probucol were supplied by Sigma (Poole, UK). 1′1′-

dioctadecyl-3,3-3′,3′-tetramethylindo-carbocyanide perchlorate (DiI) was from Invitrogen Molecular Probes (Paisley, UK) and cholesterol oxidase from Merck Biosciences Ltd (Nottingham, UK). DuoSet ELISA development kits for human IL-1β, IL-6, IL-8, MCP-1, TGF-β and TNF-α were supplied by R&D Systems (Abington, UK). Validated siRNA and HiPerFect were obtained from Qiagen (Crawley, UK). 2.1. Preparation of lipoproteins To prepare CRLPs, a lipid mixture consisting of 70% trilinolein, 2% cholesterol, 3% cholesteryl ester and 25% phospholipids in Tricine Buffer (20 mM, pH 7.4) containing 0.9% (w/v) NaCl was sonicated at a power setting of 22–24 μm for 20 min at 56 °C then ultracentrifuged on a stepwise density gradient (2.5 ml d 1.065 g/ml, 2.5 ml d 1.020 g/ ml, 3 ml d 1.006 g/ml) at 17,000 ×g for 20 min at 20 °C [29]. The upper layer of grossly emulsified lipids was then removed and replaced with an equal volume of NaCl solution (d 1.020 g/ml), and the tubes were centrifuged for 1 h (70,000 ×g, 20 °C). To bind apoE, lipid particles were collected from the top layer and incubated with the dialysed (18 h, 4 °C) d 1.063–1.21 g/ml fraction of human plasma (National Blood Transfusion Service, North London Centre, UK) at 37 °C with shaking for 4 h (1:2 v:v). CRLPs containing apoE were then isolated by ultracentrifugation at d 1.006 g/ml (120,000 ×g, 12 h, 4 °C), and collected from the top layer. After purification by a second centrifugation at the same density (202,000 ×g, 4 h, 4 °C), they were stored at 4 °C under argon until required and used within 1 week. To prepare CRLPs labelled with the fluorescent probe, DiI or pCRLPs, probucol (1 mg) and/or DiI (1 mg) were added to the lipid mixture prior to sonication. CRLPs were oxidized by incubation with CuSO4 (20 μM) with shaking for 5 h at 37 °C and the CuSO4 was then removed by dialysis (0.9% NaCl, 24 h, 4 °C). The oxidation process had no effect on the fluorescent properties of the DiI label. Our previous studies have shown that CRLPs prepared using these methods contain apoE and no other detectable apolipoproteins or other proteins, except for a trace of albumin [15], and that the apoE content of the CRLPs was not significantly different in particles of different oxidative states [18]. To exclude the possibility that factors derived from the plasma were responsible for the observed effects of CRLPs, a sample of the top layer (equivalent to the volume of CRLPs used) from dialysed plasma incubated in the absence of lipid particles and centrifuged in a similar way (control preparation) was used in control incubations in all experiments. In all cases the data obtained with macrophages incubated with these control preparations were not significantly different from those derived from cells incubated in medium alone. To obtain triglyceride-rich lipoproteins (TRLs), after an overnight fast, twelve healthy men (age 23.5 ± 2.4 y, body mass index (BMI) 23.2 ± 1.3 kg/m2) were given a test meal consisting of brown bread (71 g) spread with 50 g virgin olive oil and skimmed yoghurt (125 g). Blood samples were taken 2 and 4 h postprandially and TRLs were isolated as described previously [30]. All procedures conformed to Institutional and National ethical standards for human experimentation and with the Helsinki Code of Ethics. The volunteers gave written informed consent to a protocol approved by the appropriate Institutional Committee on Human Research. 2.2. Cell culture THP-1 monocytes (cell density 2–4 × 105 cells/ml) were maintained in suspension in RPMI 1640 supplemented with fetal bovine serum (10% v/v), penicillin (100 U/ml), streptomycin (100 mg/ml) and 2-mercaptoethanol (50 μM) (culture medium) at 37 °C in 5% CO2:95% air. Differentiation into macrophages was induced by incubation with PMA (200 ng/ml) for 72 h after which time the cells had become adherent. The monolayers were washed with warm culture medium to remove the PMA and any undifferentiated cells. Cell viability as assessed by Trypan blue exclusion was N95% in all

V.S. Graham et al. / Biochimica et Biophysica Acta 1811 (2011) 209–220

experiments, and incubation of the cells with CRLPs at the maximum concentration used (15 μg cholesterol/ml) did not significantly affect viability over the time periods tested. HMDM were isolated from the blood of healthy adult volunteers in accordance with The Code of Ethics of the World Medical Association (Declaration of Helsinki) for experiments involving humans and with the approval of the East London Research Ethics Committee. Blood was collected in EDTA (0.3%, w:v), diluted with PBS (1:1, v:v), layered over Lymphoprep (Axis Shield, Oslo, Norway) and centrifuged at 800 ×g for 30 min at 20 °C. The mononuclear cell layer was collected, mixed with an equal volume of sterile ice-cold PBS-0.4% (w:v) trisodium citrate, and centrifuged at 800 ×g for 5 min at 4 °C. The supernatant was removed and contaminating red blood cells were lysed by suspension of the cell pellet in 0.2% (w:v) saline for 30 s on ice, followed by the addition of 1.6% (w:v) saline and immediate centrifugation as above. After 6 similar re-suspension and centrifugation steps, the pellet was finally re-suspended in RPMI-1640 media containing FBS (5% v:v) and penicillin/streptomycin (100 U/0.1 mg/ml). Cells were then incubated in 12 or 24-well plates at 37 °C in 5% CO2:95% air. After 7 days non adherent cells were removed by washing (×4) with PBS. Adherent cells had the morphological appearance of macrophages and their viability was N95% as assessed by Trypan blue exclusion.

211

β-2-microglobulin and the fold change in mRNA expression in treated as compared to control macrophages was determined by the method of Pfaffl [31]. 2.6. siRNA studies Small interfering RNA (siRNA) targeted against LRP1 (CCGGAGTGGTATTCTGGTATA) (LRP1 siRNA) or the LDLr (TTGGACAGATATCATCAACGA) (LDLr siRNA) was used to silence the two genes. 1 × 105 THP-1 macrophages/well were transfected with siRNA using HiPerfect transfection reagent (Qiagen). For each well, either 5 nM siRNA was added to 100 μl Opti-MEM© I Reduced Serum Medium, then either 12 μl (LDLr) or 18 μl (LRP1) HiPerFect was added directly to diluted siRNA and incubated for 10 min at RT to allow siRNA-HiPerfect complexes to form. 100 μl siRNA-HiPerFect complexes were then added directly to each well. In all experiments, control incubations with HiPerfect only (mock transfected cells) and with a nonsilencing scrambled siRNA (AllStars negative control, Qiagen, Crawley, UK), which has no known homology to any mammalian genes, were included. The cell medium was changed on day 2 after addition of siRNA and on day 4 CRLPs, oxCRLPs, pCRLPs or DiI-labelled CRLPs (15 μg cholesterol/ml) were added and the incubations continued for 16 h.

2.3. Assay of cytokine secretion 2.7. Immunoblotting THP-1 macrophages or HMDM (1.4 × 106 cells/well) were incubated with CRLPs, oxCRLPs or pCRLPs (15 or 30 μg cholesterol/ml) or TRLs (15 μg cholesterol/ml) for the time periods indicated, and the medium was then collected and centrifuged at 9000 ×g for 10 min and the resulting supernatant was stored at −80 °C until analysed. The concentration of IL-1β, IL-6, IL-8, TNF-α, TGF-β and MCP-1 in the samples was quantified by ELISA according to the manufacturers' instructions. 2.4. Oil red O staining HMDM were incubated with CRLPs, oxCRLPs or pCRLPs (15 μg cholesterol/ml) for 24 h. Cells were then washed with PBS (×2), fixed using 60% (v:v) isopropanol and incubated with Oil red O (0.25%, w:v) in 40% isopropanol (v:v) for 15 min at room temperature. After removal of staining solution, cells were washed with H2O, and 30% (v: v) glycerol was added. Cells were viewed at ×40 magnification using a Leica inverted DMIRB microscope, and images were taken with a Leica DC500 camera. Staining was quantified by density analysis using Quantity One software. Results were normalised to background and the number of cells in the field. 2.5. mRNA analysis THP-1 macrophages (0.7 × 106 cells/well) were incubated with CRLPs, oxCRLPs or pCRLPs (15 μg cholesterol/ml) for 16 h and total RNA was then extracted using an RNA easy Plus Mini Kit (Qiagen, Crawley, UK) with deoxyribonuclease I (DNAase I) treatment according to the manufacturers' instructions. Reverse transcription was carried out using Omniscript reverse transcriptase and oligo-(dT) (Qiagen). mRNA levels for MCP-1, IL-1β, IL-6, IL-8, TGF-β, TNF-α, LDLr, LRP1 and the housekeeping gene β-2-microglobulin were determined by real time polymerase chain reaction (qPCR) using SYBR green quantitative fluorescence. PCR was carried out in a Opticon 2 LightCycler system (MJ Research, Waltham, Massachusetts, USA) using the forward and reverse primers shown in Table 1 under the following conditions; denaturation at 94 °C for 2 min followed by 37 cycles of 94 °C for 15 s, specific annealing temperature (Table 1) 1 min and a final extension at 72 °C for 1 min. Ct values were determined by automated threshold analysis using Opticon Monitor 2 software. The data were normalised to values obtained for the housekeeping gene

THP-1 macrophages were washed with 2× 1 ml PBS and then lysed with 100–250 μl lysis buffer containing 76.5 mM Tris (pH 6.8), 10% glycerol, 2% sodium dodecyl sulphate (SDS), 200 mM sodium orthovanadate and 10 mg/ml protease inhibitor for 5 min on ice. The lysates were collected, heated to 100 °C for 5 min, centrifuged at 9000 ×g for 10 min and mixed with sample buffer (240 mM Tris (pH 6.8), 40% glycerol, 8% SDS and 0.04% bromophenol blue (2:1, v:v)). 10% β-mercaptoethanol was then added. For the detection of LRP1, samples were processed under non-reducing conditions by the omission of β-mercaptoethanol. Lysates were heated to 100 °C for 5 min and electrophoresed in running buffer (25 mM Tris, 0.192 M glycine and 0.1% (w/v) SDS) at 80 mA for 1 h. Proteins were transferred onto polyvinylidene fluoride membranes using a wet transfer system (Bio-Rad, Hemel Hempstead, UK). Following transfer, membranes were blocked with 5% milk in Tris buffered saline (0.1% Tween) (TBST) for 1 h, then washed in 0.1% TBST (6 × 10 min) and incubated with primary antibodies (1:1000 v/v) specific for the LDLr, LRP1 or βactin in 0.1% TBST containing 10% BSA overnight at 4 °C. After washing with 0.1% TBST (6 × 10 min) membranes were incubated with antimouse antibodies conjugated with horseradish protein 1:10,000 (v:v) in 0.1% TBST containing 0.2% BSA for 1 h. Immunoreactive proteins were detected using enhanced chemiluminescence (GE Health Care, Bucks, UK). 2.8. CRLP uptake For assessment of CRLP uptake, DiI-labelled CRLPs (15 μg cholesterol/ml) were incubated for 24 h with THP-1 macrophages in the presence of increasing concentrations of unlabelled pCRLPs (0–20 μg cholesterol/ml) or vice versa (DiI-labelled pCRLPs and increasing concentrations of unlabelled CRLPs), or with THP-1 macrophages after transfection with LRP1 siRNA or LDLr siRNA. Cells were then fixed with formalin buffered saline and viewed on a confocal microscope (Zeiss LMS 510). Cell associated-fluorescence was quantified by density volume analysis. 2.9. Other analytical methods The total cholesterol and triacylglycerol (TG) content of CRLPs was determined by enzymatic analyses using commercially available kits

212

V.S. Graham et al. / Biochimica et Biophysica Acta 1811 (2011) 209–220

Table 1 Primer sequences and annealing temperatures for qPCR. Gene

Forward primer sequence

Reverse primer sequence

Annealing temperature

β-2 microglobulin IL-1β IL-6 MCP-1 TGF-β TNF-α LRP1 LDLr

GTGCTCGCGCTACTCTCTCT TTCCTGTTGTCTACACCAATGC AACAACCTGAACCTTCCAAAGA AGTGTCCCAAAGAAGCTGTGAT CCCACAACGAAATCTATGACAA TGTAGCCCATGTTGTAGCAAAC CTTTAATCGAGGGCAAAATGA CATCTTGGAGGATGAAAAGAGG

TCAATGTCGGATGGATGAAA CGGGCTTTAAGTGAGTAGGAGA TCAAACTCCAAAAGACCAGTGA ATTCTTGGGTTGTGGAGTGAGT ACGTGCTGCTCCACTTTTAACT TTGAAGAGGACCTGGGAGTAGA TGTCTTGGAGGTGACAAAGATG GGACAGTAGGTTTTCAGCCAAC

57.0 °C 59.4 °C 56.5 °C 59.4 °C 57.5 °C 59.5 °C 57.5 °C 59.4 °C

(Thermo Fisher Scientific, Waltham, UK) and the protein content of cell lysates was measured by the method of Lowry et al. [32]. The extent of oxidation of CRLPs was determined by measuring the level of thiobarbituric acid-reacting substances (TBARS) [33] and lipid hydroperoxides (Lipid hydroperoxide assay kit, Cayman Chemical Company, Ann Arbour, Michigan, USA) in the preparations. 2.10. Statistical analysis Data were analysed by one way ANOVA followed by Tukey's test or two-way ANOVA followed by Bonferroni's multiple comparison test as appropriate, except where indicated otherwise.

significant (pCRLPs vs CRLPs or oxCRLPs, P b 0.001; CRLPs vs oxCRLPs, P b 0.01). 3.3. Effect of the oxidative state of CRLPs on cytokine secretion in HMDM and THP-1 macrophages THP-1 macrophages were incubated with CRLPs, oxCRLPs or pCRLPs (15 μg cholesterol/ml) for 6, 16 or 24 h, and the effects on the secretion of pro-inflammatory chemokines (MCP-1 and IL-8) and cytokines (TNF-α, IL-6 and IL-1β) and the anti-inflammatory cytokine TGF-β were assessed (Fig. 2). Production of MCP-1, TNF-α and IL-6 was markedly reduced by CRLPs and oxCRLPs (N−80%), while pCRLPs had no significant effect, except for a decrease of approximately 30% in MCP-1

3. Results 3.1. Characteristics of CRLPs The lipid, TBARS and lipid hydroperoxide content of CRLPs, oxCRLPs and pCRLPs is shown in Table 2. The concentration of TG and TC in CRLPs and pCRLPs was similar, and although that of oxCRLPs was lower, this simply reflects the dilution of the preparations during the oxidation procedure. More importantly, the TG:TC ratio was not significantly different between the three CRLP types. Significant differences in the TBARS and lipid hydroperoxide content of the CRLPs in different oxidative states were apparent, with the values for oxCRLPs being significantly raised and those for pCRLPs significantly decreased as compared to those for CRLPs. 3.2. Effect of the oxidative state of CRLPs on their uptake by HMDM HMDM were incubated with CRLPs, oxCRLPs or pCRLPs (15 μg cholesterol/ml) for 24 h and lipid accumulation in the cells was then assessed by Oil red O staining (Fig. 1). Increased red staining was visible under light microscopy in macrophages exposed to all types of CRLPs (Fig. 1A–D), however, staining density was increased in cells incubated with pCRLPs (Fig. 1D) as compared to CRLPs (Fig. 1C) or oxCRLPs (Fig. 1B) and with CRLPs as compared to oxCRLPs. Quantitative analysis of the staining density showed that these changes were highly

Table 2 Lipid and TBARS content of CRLPs. CRLPs, oxCRLPs or pCRLPs were prepared as described in Materials and methods and the TG, total cholesterol (TC), TBARS and lipid hydroperoxide content were measured. Data are the mean from the number of preparations shown in parentheses. Significance limits; *P b 0.05, **P b 0.01, ***P b 0.001 vs CRLPs; ##P b 0.01, ###P b 0.01 vs pCRLPs. Parameter

CRLPs

oxCRLPs

pCRLPs

TC (μmol/ml) TG (μmol/ml) Ratio TG:TC TBARS (nmol MDA/μmol TG) Lipid hydroperoxides (nmol/μmol TG)

0.75 ± 0.07(23) 5.58 ± 0.45(23) 7.85 ± 0.33(23) 0.68 ± 0.18(15)

0.40 ± 0.06(8) 2.59 ± 0.46(8) 6.65 ± 0.66(8) 2.62 ± 0.77(6)**##

0.84 ± 0.06(23) 6.59 ± 0.46(23) 7.95 ± 0.38(23) 0.24 ± 0.07(13)**

47.0 ± 4.5(4)

87.9 ± 4.3(4)***### 25.6 ± 4.3(4)*

Fig. 1. HMDM were incubated with or without (Control) CRLPs, oxCRLPs or pCRLPs (15 μg cholesterol/ml) for 24 h and lipid accumulation was determined by Oil red O staining. A. Control; B. oxCRLPs; C. CRLPs; D. pCRLPs. Cells were viewed with a Leica inverted DMIRB microscope, and images were captured at ×40 magnification with a Leica DC500 camera. E. Staining quantified by density analysis using Quantity One software. Data shown are the mean from 3 experiments and error bars show the SEM. **P b 0.01, ***P b 0.001 vs Control; ###P b 0.001 vs pCRLPs; aaP b 0.01 vs CRLPs.

V.S. Graham et al. / Biochimica et Biophysica Acta 1811 (2011) 209–220

A

MCP-1 secretion (pg/ml)

1000

***

800 600 400

*** ###

200 0

0

6

12

*** ###

18

oxCRLPs pCRLPs

TNF-α secretion (pg/ml)

Control CRLPs

B

5000 4000 3000 2000

*** ###

1000

24

0

0

6

C

IL-6 secretion (pg/ml)

600

** ##

** ##

400 200 0

0

6

12

18

24

IL-8 secretion (ng/ml)

TGF-β secretion (pg/ml)

E

500

0

6

12

24

600 400

# ##

200 0

0

6

12

18

24

18

24

Time (h)

1000

0

18

D

800

Time (h) 1500

12

*** ###

Time (h) IL-1β secretion (pg/ml)

Time (h) 800

213

18

200 150 100 50 0

24

F

250

0

6

Time (h)

12

Time (h)

Fig. 2. THP-1 macrophages were incubated in the presence of CRLPs, oxCRLPs or pCRLPs (15 μg cholesterol/ml) or with an equal volume of control preparation (Control) for time periods up to 24 h and the secretion of; A. MCP-1; B. TNF-α; C. IL-6; D. IL-1β; E. IL-8; and F. TGF-β was determined by ELISA. Data shown are the mean from 3 (MCP-1, TNF-α, IL-6) or 4 (IL-1β, IL-8, TGF-β) experiments and error bars show the SEM. **P b 0.01, ***P b 0.001 vs Control; #P b 0.05, ##P b 0.01 ###P b 0.001 vs pCRLPs.

secretion after 24 h (Fig. 2A). Highly significant differences between incubations with CRLPs or oxCRLPs as compared to control incubations without CRLPs or with pCRLPs were apparent at 16 and 24 h (Fig. 2A–C). In the case of IL-1β, similar, although less marked, effects were observed, with secretion in pCRLP-treated cells being similar to that in control cells, but significantly higher than that in CRLP- or oxCRLP-treated cells (Fig. 2D). In contrast, production of IL-8 and TGF-β was unaffected by CRLPs, regardless of their oxidative state (Fig. 2E,F). Fig. 3 shows the effects of CRLPs, oxCRLPs and pCRLPs (30 μg cholesterol/ml) on the secretion of MCP-1 (Fig. 3A) and TNF-α (Fig. 3B) by HMDM. The mean from 2 experiments with cells from 2 individuals are presented. As observed with THP-1 macrophages, the secretion of both cytokines was decreased by CRLPs (MCP-1, −75%;

TNF-α, − 66%) and oxCRLPs (MCP-1, −76.4%; TNF-α, −92.8%), while pCRLPs caused a smaller decrease in TNF-α release (−27.5%, Fig. 3B) and had no suppressive effect on that of MCP-1 (Fig. 3A). 3.4. Effect of the oxidative state of CRLPs on cytokine mRNA levels in THP-1 macrophages Fig. 4 shows the changes in mRNA levels for MCP-1, TNF-α, IL-6, IL1β and TGF-β in THP-1 macrophages after a 16 h incubation with CRLPs, oxCRLPs or pCRLPs (15 μg cholesterol/ml). mRNA abundance for MCP-1, IL-6 and IL-1β was significantly decreased by CRLPs and oxCRLPs, but not by pCRLPs (Fig. 4A,C,D). TNF-α mRNA levels were significantly decreased after treatment with all three CRLP types (Fig. 4B), but

CRLPs pCRLPs

1200 800 400 0

A

TNF-α secretion (pg/ml)

MCP-1 secretion (pg/ml)

Control oxCRLPs

900

B

600 300 0

Fig. 3. HMDM were incubated in the presence of CRLPs, oxCRLPs or pCRLPs (30 μg cholesterol/ml) or with an equal volume of control preparation (Control) for 24 h and the secretion of; A. MCP-1; and B. TNF-α was determined by ELISA. Data shown are the mean from 2 experiments and error bars show the range.

V.S. Graham et al. / Biochimica et Biophysica Acta 1811 (2011) 209–220

MCP-1 mRNA (fold change)

1.5

Control

oxCRLPs

CRLPs

pCRLPs 1.5

A

TNF-α mRNA (fold change)

214

1.0

*

*

0.5

C

** 0.5

*** ###

*** ###

D

1.5

IL-1β mRNA (fold change)

IL-6 mRNA (fold change)

1.0

0.0

0.0 1.5

B

1.0

*#

0.5

** ## 0.0

1.0

*** ###

0.5

*** ###

0.0

TGF-β mRNA (fold change)

1.5

E

1.0

*** ### aaa

0.5 0.0

Fig. 4. THP-1 macrophages were incubated in the presence of CRLPs, oxCRLPs or pCRLPs (15 μg cholesterol/ml) or with an equal volume of control preparation (Control) for 16 h and the abundance of transcripts for; A. MCP-1; B. TNF-α; C. IL-6; D. IL-1β; E. TGF-β was determined. Data shown are the mean from 3 (TNF-α, IL-1β, TGF-β) or 4 (MCP-1, IL-6) experiments and error bars show the SEM. *P b 0.05, **P b 0.01, ***P b 0.001 vs Control; #P b 0.05, ##P b 0.01 ###P b 0.001 vs pCRLPs; aaaP b 0.001 vs CRLPs.

significantly greater reductions were observed in experiments with CRLPs (−78%) and oxCRLPs (−85%) as compared to pCRLPs (−30%). Concentrations of mRNA for TGF-β, on the other hand, were not significantly changed by incubation with CRLPs or pCRLPs, but showed a small decrease after incubation with oxCRLPs in comparison to control, CRLP- and pCRLP-treated cells (Fig. 4E). 3.5. Influence of pCRLPs on the suppression of cytokine secretion by CRLPs in THP-1 macrophages In order to test whether pCRLPs or probucol actively reverses the effects of CRLPs on the suppression of cytokine secretion in macrophages, THP-1 macrophages were incubated with CRLPs for 16 h, pCRLPs, probucol or probucol + CRLPs were then added, the incuba-

Control CRLPs pCRLPs 2500

tions were continued for a further 8 h and the secretion of MCP-1 or TNF-α was determined. The results are shown in Fig. 5. The addition of pCRLPs, probucol alone or probucol + CRLPs to the cells had no significant effect on either MCP-1 (Fig. 5A) or TNF-α (Fig. 5B) secretion, with values in all cases being similar to those observed with CRLPs and significantly lower than those seen with pCRLPs after 24 h incubation. Similar results were obtained when the levels of IL-6 and IL-1β secreted were measured (data not shown). In a second set of experiments, CRLPs and pCRLPs were added to THP-1 macrophages simultaneously and the cells were then incubated for 16 or 24 h. In these conditions, MCP-1 secretion in CRLP- as compared to pCRLP-treated cells was significantly decreased at both time points, while secretion in the presence of CRLPs + pCRLPs was not significantly affected (Table 3). TNF-α production showed a similar

CRLPs + pCRLPs CRLPs + probucol CRLPs + probucol and CRLPs 5000

A

**

* ## ## ##

*

3000 2000

##

##

##

*

1000

500 0

TNF-α (pg/ml)

MCP-1 (pg/ml)

1500 1000

B

4000

2000

16h

24h

16h + 8h

0

16h

24h

16h + 8h

Fig. 5. THP-1 macrophages were incubated in the presence of CRLPs, oxCRLPs or pCRLPs (15 μg cholesterol/ml) or with an equal volume of control preparation (Control) for 16 h. pCRLPs (15 μg cholesterol/ml), probucol (8 mg/ml) or probucol (8 mg/ml) + CRLPs (15 μg cholesterol/ml) or an equal volume of control preparation was then added and the incubations continued for a further 8 h. The secretion of; A. MCP-1; B. TNF-α was then determined by ELISA. Data shown are the mean from 5 (MCP-1) or 4 (TNF-α) experiments and error bars show the SEM. *P b 0.05, **P b 0.01 vs corresponding Control; ##P b 0.01 vs incubation with pCRLPs only for 24 h.

Table 3 Effect of pCRLPs on the suppression of MCP-1 and TNF-α secretion by CRLPs. THP-1 macrophages were incubated in the presence of CRLPs + pCRLPs (15 μg cholesterol/ml) or with an equal volume of control preparation (Control) for 16 or 24 h and the secretion of MCP-1 and TNF-α was determined by ELISA. Data shown are the mean ± SEM from 3 experiments. Significance limits; *P b 0.05 vs control; #P b 0.05, ##P b 0.01 vs pCRLPs. Additions

MCP-1

Control CRLPs pCRLPs CRLPs + pCRLPs

TNF-α

16 h

24 h

16 h

24 h

1438 ± 130 825 ± 327# 1820 ± 266 1091 ± 91

1716 ± 195 879 ± 319*## 1960 ± 183 1246 ± 191

2359 ± 309 1541 ± 294 2870 ± 450 3077 ± 938

2575 ± 289 1431 ± 262 3090 ± 676 3206 ± 1027

pattern of changes, and in this case the effects of CRLPs appeared to be abolished completely after incubation with CRLPs + pCRLPs, although because of the high variability of the values in the individual experiments, the changes did not reach significance (Table 3). Similar results were obtained with IL-6 and IL-1β (data not shown). The partial reversal of the effects of CRLPs on macrophage cytokine secretion when pCRLPs were added simultaneously suggests that the two types of particles compete for uptake by the cells. To test this, DiIlabelled CRLPs (15 μg cholesterol/ml) were incubated with increasing concentrations of pCRLPs (0–20 μg cholesterol/ml), or vice versa. As expected from our previous work [17,18], cell-associated fluorescence was greater when DiI-labelled pCRLPs as compared to DiI-labelled CRLPs were used (Fig. 6). However, in both sets of conditions, fluorescence decreased with increasing concentrations of unlabelled CRLPs, indicating that there was competition for uptake between CRLPs and pCRLPs. 3.6. Effects of TRLs on cytokine secretion in THP-1 macrophages To determine whether a TRL fraction containing CMR had similar effects to CRLPs on macrophage chemokine/cytokine secretion, TRLs (15 μg cholesterol/ml) isolated from healthy human volunteers 2 or 4 h after a test meal containing olive oil were incubated with THP-1 macrophages for 16 h and the secretion of MCP-1 and IL-6 was measured (Fig. 7). The results showed that the secretion of both MCP1 and IL-6 was suppressed by 50–60% by TRLs isolated at both time points. 3.7. Influence of the route of uptake of CRLPs on their suppression of cytokine secretion in THP-1 macrophages

Fluorescence/mm 2

The role played by uptake of CRLPs via LRP1 or the LDLr on their down-regulation of cytokine secretion was investigated using siRNA

1200

DiI CRLPs DiI pCRLPs

800 400 0

0

5

10

15

20

competing CRLP concentration (μg cholesterol/ml) Fig. 6. THP-1 macrophages were incubated with DiI-labelled CRLPs (10 μg cholesterol/ ml) and varying concentrations of unlabelled pCRLPs (0–30 μg cholesterol/ml) or DiIlabelled pCRLPs (10 μg cholesterol/ml) and varying concentrations of unlabelled CRLPs (0–30 μg cholesterol/ml) for 24 h. The cells were fixed with formalin buffered saline and viewed by confocal microscopy. Uptake of the DiI-labelled particles was quantified by density volume analysis. Data shown are the mean from 3 experiments and error bars show the SEM.

MCP-1/IL-6 secretion (% control value)

V.S. Graham et al. / Biochimica et Biophysica Acta 1811 (2011) 209–220

215

Control + 2h TRLs + 4h TRLs

100 80 60

***

***

***

***

40 20 0

MCP-1

IL-6

Fig. 7. THP-1 macrophages were incubated with or without (Control) TRLs (15 μg cholesterol/ml) isolated from healthy volunteers 2 or 4 h after a test meal containing olive oil for 16 h and the secretion of MCP-1 and IL-6 was determined by ELISA. Data shown are the mean from 10 (MCP-1) or 12 (IL-6) experiments with TRLs from separate subjects. Error bars show the SEM. ***P b 0.001 vs Control.

to selectively inhibit gene expression for the two receptors. One day after transfection with siRNA, mRNA abundance for LRP1 was reduced by 75% and that for the LDLr by 40% (Fig. 8A,B), and after 5 days, no LRP1 or LDLr protein could be detected by immunoblotting (Fig. 8C,D). Initial experiments in which macrophages were incubated with DiIlabelled CRLPs and cell-associated fluorescence assessed by confocal microscopy confirmed that uptake of CRLPs was inhibited in cells transfected with siRNA targeting either LRP1 or the LDLr. As expected, greater inhibition was observed when LRP1 expression was downregulated, and the scrambled siRNA sequence had no effect (Fig. 9). To evaluate the effects of siRNA inhibition of expression of LRP1 or the LDLr on macrophage chemokine/cytokine secretion, CRLPs or pCRLPs (15 μg cholesterol/ml) were incubated with THP-1 macrophages transfected with LRP1 siRNA, LDLr siRNA or with mocktransfected cells and the secretion of MCP-1, TNF-α, IL-6 and IL-1β was determined after 16 h (Figs. 8, 9). In mock-transfected cells (Figs. 9, 10A–D) or those transfected with a scrambled siRNA sequence (data not shown), secretion of all the chemokine/cytokines tested showed a similar pattern to that observed in non-transfected cells (Fig. 2), with CRLPs causing a decrease while pCRLPs had no effect. In marked contrast, however, in LRP1 siRNA-transfected macrophages, both pCRLPs and CRLPs caused significant decreases in MCP-1, TNF-α and IL-6 secretion which were comparable to those found with CRLPs in mock-transfected cells (Fig. 10A–C). There was also a trend towards a decrease in the IL-1β secretion in pCRLPtreated transfected as compared to mock-transfected macrophages, but in this case the change did not reach significance (Fig. 10D). When macrophages were transfected with LDLr siRNA, however, strikingly different results were obtained (Fig. 11). In these conditions, neither CRLPs nor pCRLPs had any significant effect on the production of MCP1 (Fig. 11A), TNF-α (Fig. 11B), IL-6 (Fig. 11C) or IL-1β (Fig. 11D), and the amounts secreted were not significantly different from those found in mock-transfected cells incubated in the absence of CRLPs in all cases. Thus, inhibition of CRLP uptake via the LRP1 enhances the effects of pCRLPs on the suppression of chemokine/cytokine secretion, while inhibition of uptake via the LDLr reduces or abolishes the suppressive effects of the particles. 4. Discussion Both foam cell formation and inflammation are known to play important roles in atherosclerosis development [1,2,26,27]. There is now considerable evidence to indicate that CMR cause foam cell formation without prior oxidation, and furthermore, that their induction of lipid accumulation is inversely related to their oxidative state [12–18,34]. In addition, however, we have shown previously that these lipoproteins have a potentially beneficial influence on inflammatory processes in macrophages by down-regulating the

216

V.S. Graham et al. / Biochimica et Biophysica Acta 1811 (2011) 209–220

Fig. 8. THP-1 macrophages were either mock transfected (no siRNA) or transfected with either non-silencing siRNA (scrambled) or siRNA (5 or 10 nM) targeted against LRP1 or the LDLr using HiPerFect transfection reagent. After 24 h the abundance of mRNA transcripts for LRP1 (A) and the LDLr (B) was measured by qPCR and after 5 days LRP1 (C) and LDLr (D) protein levels were assessed by immunoblotting.

secretion of pro-inflammatory chemokines and cytokines [28]. It is known that CMR carry oxidized lipids from the diet and may also be oxidized within the artery wall by similar processes to those that act on LDL [19,20,35]. Moreover, it has been suggested that relatively large, polyunsaturated fatty acid-rich lipoproteins such as CMR deliver a greater oxidant load to the cell wall than LDL [36]. Thus, it is important to establish how oxidation of the particles influences

CRLP uptake CRLP uptake (Fluorescence/mm2) (Fluorescence/mm2)

No siRNA 5nM siRNA 600

scrRNA 10nM siRNA

A

400 200 0 500

B

400 300 200 100 0

Fig. 9. THP-1 macrophages were either mock transfected (no siRNA) or transfected with either non-silencing siRNA (scrambled) or siRNA (5 nM) targeted against LRP1 (A) or the LDLr (B) using HiPerFect transfection reagent. After 4 days, the cells were incubated with DiI-labelled CRLPs (15 μg cholesterol/ml) for 24 h and the cells were then fixed with formalin buffered saline and viewed by confocal microscopy. The fluorescence associated with the cells was quantified by density volume analysis.

their potential atherogenicity. The first aim of the present study, therefore, was to determine how the inhibition of macrophage chemokine/cytokine secretion by CMR is influenced by changes in their oxidative state. Because of the difficulty in separating plasma CMR from other TGrich lipoproteins which are present postprandially, such as chylomicrons and very low density lipoprotein, CRLPs containing human apoE were used. We and others have established that these model CRLPs resemble physiological CMR and are metabolised in a similar way in vivo and in cultured cells [15,29,37–39], and we have also demonstrated that they cause comparable lipid accumulation in macrophages to that found when rat CMR and the murine macrophage cell line, J774 was used [14,15]. Although the particles lack apoB48 and an apoB48 receptor has been reported to be expressed in macrophages, there is little evidence to suggest that significant uptake of CMR occurs by this route [12]. In the present study, the use of CRLPs enabled us to manipulate the oxidative state of the particles either by exposing them to oxidizing conditions similar to those generally used in studies with oxLDL (oxCRLPs) [3], or by incorporation of the lipophilic antioxidant drug, probucol [17,18]. Thus, we tested CRLPs in 3 different oxidative states, normal CRLPs, oxCRLPs and pCRLPs. Differences in the oxidation levels of the three types of particles were confirmed by measurement of their TBARS and lipid hydroperoxide content (Table 2), and our earlier studies have demonstrated that they contain similar levels of apoE [18], making them a suitable model for our studies. THP-1 macrophages have been widely used in the study of atherosclerosis, In extensive previous work, we have demonstrated that CRLPs induce THP-1 macrophages to accumulate large amounts of lipid and suppress their secretion of inflammatory cytokines [12,16–18,28]. For these reasons, the cell line was used as the main experimental model for the current investigation. However, in order to confirm that they mimic the behaviour of primary macrophages in the aspects of their function under study, some experiments were also carried out using HMDM. Since the influence of the oxidative state of CMR on their uptake by primary cells has not been reported

V.S. Graham et al. / Biochimica et Biophysica Acta 1811 (2011) 209–220

A

80

**

*** ***

40 0 120

No siRNA

LRP siRNA

C

80

*

40 0

No siRNA

IL-1β secretion (% control value)

MCP-1 secretion (% control value) IL-6 secretion (% control value)

120

TNF-α secretion (% control value)

CRLPs

Control

pCRLPs 120

B

80

*

*

**

No siRNA

LRP siRNA

40 0 120

D

80

* 40 0

LRP siRNA

217

No siRNA

LRP siRNA

Fig. 10. THP-1 macrophages were either mock transfected (no siRNA) or transfected with siRNA (5 nM) targeted against LRP1 using HiPerFect transfection reagent. Four days posttransfection the cells were incubated with CRLPs or pCRLPs (15 μg cholesterol/ml) or an equal volume of control preparation for 16 h and the secretion of; A. MCP-1; B. TNF-α; C. IL-6; D. IL-1β was determined by ELISA. Data are expressed as % Control value and are the mean from 3 experiments. Error bars show the SEM. *P b 0.05, **P b 0.01, ***P b 0.001 vs corresponding Control.

previously, initial experiments investigated effects of CRLPs, oxCRLPs and pCRLPs on the induction of lipid accumulation in these cells. The results showed that, in good agreement with our findings with THP-1 macrophages [18], the amount of lipid accumulated in HMDM was inversely related to the oxidative state of the particles. As we have reported previously [29], in the present study incubation of THP-1 macrophages with CRLPs led to significant decreases in the secretion of the pro-inflammatory chemokine, MCP-1, and the pro-inflammatory cytokines TNF-α and IL-6 and there was a similar, but smaller effect on that of IL-1β, while production of IL-8 and the anti-inflammatory cytokine, TGF-β, was unaffected (Fig. 2). Moreover, these changes were paralleled by down-regulation of the expression

200 100 0

IL-6 secretion (% control value)

A

TNF-α secretion (% control value)

300

150

* No siRNA

C

50

No siRNA

pCRLPs 250

LDLr siRNA

B

200 150 100

**

50 0

LDLr siRNA

100

0

CRLPs

IL-1β secretion (% control value)

MCP-1 secretion (% control value)

Control

of mRNA for MCP-1, TNF-α, IL-6 and IL-1β, but not TGF-β (Fig. 4), suggesting that CRLPs exert their effects at the transcriptional level. In addition, CRLPs were found to suppress the secretion of MCP-1 and TNF-α in HMDM (Fig. 3), and a human TRL fraction containing CMR obtained 2 and 4 h postprandially from healthy volunteers after a test meal containing virgin olive oil decreased MCP-1 and IL-6 secretion by 50–60% in THP-1 macrophages (Fig. 7). Few earlier studies have investigated the effects of CMR on macrophage cytokine synthesis, but we have found that CRLPs inhibit MCP-1 production in primary human monocytes [40]. Moreover, recent experiments by Napolitano and Bravo [41] have also shown inhibition of TNF-α secretion by CRLPs in primary human macrophages. The present work clearly adds

150

No siRNA

LDLr siRNA

D

100

*** 50 0

No siRNA

LDLr siRNA

Fig. 11. THP-1 macrophages were either mock transfected (no siRNA) or transfected with siRNA (5 nM) targeted against the LDLr using HiPerFect transfection reagent. Four days post-transfection the cells were incubated with CRLPs or pCRLPs (15 μg cholesterol/ml) or an equal volume of control preparation for 16 h and the secretion of; A. MCP-1; B. TNF-α; C. IL-6; D. IL-1β was determined by ELISA. Data are expressed as % Control value and are the mean from 3 experiments. Error bars show the SEM. *P b 0.05, **P b 0.01, ***P b 0.001 vs corresponding Control.

218

V.S. Graham et al. / Biochimica et Biophysica Acta 1811 (2011) 209–220

significantly to these findings by demonstrating that the oxidative state of CRLPs plays an important role in their suppressive effects on chemokine/cytokine secretion in both THP-1 macrophages and HMDM. Protection of the particles from oxidation by incorporation of antioxidant caused a marked attenuation (THP-1 cells, Fig. 2A) or complete abolition (HMDM, Fig. 3A) of their ability to down-regulate MCP-1 secretion and also reduced or abolished their effects on TNF-α, IL-6 and IL-1β secretion (Figs. 2C–D, 3B). oxCRLPs, on the other hand, had similar effects to CRLPs, but since cytokine secretion in the presence of CRLPs is already low, it may be difficult to demonstrate a further decrease. Alternatively, it is possible that the changes in cytokine secretion are due to the presence of oxidized lipids in the particles, and that the small amount delivered by CRLPs is sufficient to cause a near maximal effect. The pattern of effects of CRLPs on cytokine secretion was reflected in the influence of the three types of particles on mRNA expression for the chemokine/cytokines in THP-1 macrophages, with CRLPs and oxCRLPs causing a strong down-regulation, while pCRLPs had a lesser effect (TNF-α, Fig. 3B) or no discernable effect (Fig. 3A,C,D). TGF-β mRNA expression also showed a small, but significant decrease in cells incubated with oxCRLPs as compared to CRLPs, pCRLPs or control cells (Fig. 3E). This may be due to the uptake of oxidized lipid, since oxLDL has been reported to have a similar effect [42]. Overall, our findings indicate that CMR inhibit pro-inflammatory chemokine/cytokine secretion by macrophages, that this change occurs at the transcriptional level, and that the suppressive effects are greater when the oxidative state of the particles is increased. Our previous work has demonstrated that the rate of uptake of CRLPs by THP-1 macrophages and the subsequent induction of lipid accumulation are inversely related to their oxidative state, so that oxCRLPs are taken up more slowly than CRLPs and cause less lipid accumulation, while particles protected from oxidation are taken up more rapidly and cause enhanced lipid accumulation [16–18]. In contrast, the results of the current study indicate that the inhibition of chemokine/cytokine secretion by CRLPs is positively related to their oxidative state, so that protection of the particles from oxidation reduces or abolishes their effects (Figs. 2, 3). Thus, the CRLP type (pCRLPs) taken up the most rapidly and causing the greatest intracellular lipid accumulation has the smallest effect on cytokine secretion. The second aim of our study, therefore, was to investigate the mechanistic basis for this apparently paradoxical finding. The differential effects of CRLPs in different oxidative states on macrophage chemokine/cytokine secretion may be directly related to the content of the particles. It is possible that pCRLPs contain a component which positively reverses the effects of CRLPs, or they may lack or be low in the component present in CRLPs which causes the inhibition. Alternatively, however, the observed effects may be related to differences in the uptake of the different types of particles. We investigated, therefore, firstly whether pCRLPs (or probucol) are able to reverse the inhibition of chemokine/cytokine secretion by CRLPs, and secondly how selective inhibition of uptake of the particles via the main receptor-mediated routes, LRP1 and the LDLr, influences these effects. To test the hypothesis that the content of the particles is responsible for the differential effects of CRLPs in different oxidative states on chemokine/cytokine secretion, THP-1 macrophages were pre-incubated with CRLPs for 16 h to suppress cytokine secretion before addition of the pCRLPs/probucol. In these conditions, inhibition of chemokine/cytokine secretion was unaffected, regardless of whether or not probucol was incorporated into the CRLPs (Fig. 5). We conclude, therefore, that pCRLPs do not contain a component that actively reverses the downregulation of macrophage chemokine/cytokine secretion by CRLPs, but lack or are low in the active component present in CRLPs. Since the two types of particles differ in their oxidative state, it is possible that this component may be oxidized lipid, but further work is needed for clear identification of the active factor.

Our finding that the inhibition was partially prevented when pCRLPs were added to the cells simultaneously with CRLPs at time 0, (Table 3), however, suggests that the two types of particles may compete for uptake, and this was subsequently confirmed in experiments with DiI-labelled CRLPs/pCRLPs and confocal microscopy (Fig. 6). Although we cannot completely rule out the possibility that exchange of material between CRLPs and pCRLPs is responsible for the reduced effect of CRLPs on cytokine secretion when the two types of particles are added simultaneously, the lack of effect of pCRLPs in reversing the changes caused by CRLPs together with the finding that secretion in the presence of CRLPs + pCRLPs was similar to that observed with CRLPs + probucol and CRLPs + probucol + CRLPs (Fig. 5) suggests that this is not the case. Moreover, competition for uptake between CRLPs and pCRLPs is consistent with our earlier work, which indicated that CRLPs are taken up by macrophages mainly by apoE-dependent receptors, regardless of their oxidative state [18]. It is clear from previous work that the LDLr plays a part in the uptake of CMR by macrophages [4,12,18,21,43], but it is also clear that it is responsible for only a relatively minor proportion of the lipid internalised [4,12,22,23]. Studies in our laboratory have established that receptor mediated uptake via LRP1, which, like the LDLr, is apoEdependent, is the main receptor-mediated route by which CRLPs enter THP-1 macrophages, with entry via the LDLr having a lesser role in quantitative terms [18]. To investigate the role played by the uptake pathway in the differential effects of CRLPs of different oxidative states on macrophage chemokine/cytokine secretion, we used siRNA to selectively down-regulate expression of LRP1 or the LDLr. Since we found little difference in the effects of CRLPs and oxCRLPs in our initial studies (Fig. 2), for these experiments CRLPs and pCRLPs were compared. Transfection of THP-1 macrophages with the sequences targeted to LRP1 or the LDLr, but not a scrambled sequence, depressed the levels of mRNA and protein for the corresponding receptor (Fig. 8), and markedly decreased the uptake of CRLPs by the cells (Fig. 9), confirming that expression of the genes was inhibited and that this had the expected functional outcome. LRP1 is a multifunctional receptor which is known to influence signal transduction through multiple pathways and has roles in regulating cellular responses to a variety of extracellular mediators including TGF-β and platelet derived growth factor [44,45]. We hypothesized, therefore, that LRP1 was the most likely mediator of the effects of CRLPs on macrophage cytokine secretion. Surprisingly, however, when LRP1 expression was down-regulated, the suppression of chemokine/cytokine secretion by the cells was enhanced rather than attenuated (Fig. 10). Moreover, the consequences of LRP1 down-regulation were particularly striking in experiments with pCRLPs. In non-transfected cells, pCRLPs had little or no effect on chemokine/cytokine secretion (Fig. 3), but after LRP1 knock down, they caused a decrease similar to that observed with CRLPs (Fig. 10), even though CRLP uptake was substantially reduced in these conditions. Thus, uptake of CMR via LRP1 does not appear to be required for their suppression of chemokine/cytokine secretion, suggesting either that the effects are not dependent on entry of the particles into the cells, or that they are mediated by uptake via a different receptor, with the main candidate being the LDLr. When LDLr expression was reduced in macrophages by transfection with LDLr siRNA, strikingly different results from those observed with LRP1 knock down were obtained. In this case, neither CRLPs nor pCRLPs significantly altered the secretion of any of the proinflammatory chemokine and cytokines tested (Fig. 11). Thus, when LDLr expression in macrophage is reduced, the inhibitory effects of CRLPs are abolished. In general the role of the LDLr in signal transduction appears to be more limited than that of LRP1. Previous work in platelets has shown that binding of LDL to the LDLr causes activation of p38 mitogen-activated protein kinase and focal adhesion kinase [46], but this is mainly due to the binding of apoB100, with binding of apoE-containing lipoproteins having a much weaker effect

V.S. Graham et al. / Biochimica et Biophysica Acta 1811 (2011) 209–220

[47]. Nevertheless, our results clearly demonstrate that the suppression of macrophage chemokine/cytokine secretion by CMR requires their uptake via the LDLr and is not triggered after uptake via LRP1, suggesting that in this case the signal to down-regulate cytokine secretion is LDLr-dependent. Thus, although uptake of CMR by macrophages via the LDLr is quantitatively less important than uptake via other routes, it has a crucial role in their modulation of inflammatory cytokine secretion. The findings from our siRNA studies also provide an explanation for the puzzling finding that pCRLPs only suppress macrophage chemokine/cytokine secretion when their uptake is markedly decreased by down regulation of the expression of LRP1. In normal conditions, CRLPs are able to enter macrophages via both LRP1 and the LDLr [4,18,21,23,43], but when one receptor is blocked it is likely that there will be greater uptake via the alternative route. When LRP1 is down regulated, therefore, uptake via the LDLr is increased, thus more pCRLPs are taken up via this receptor and an inhibitory effect on cytokine secretion becomes apparent. Knock down of the LDLr, on the other hand, leads to a greater uptake via the LRP1, and CRLPs no longer suppress the secretory function. These findings also suggest that when CRLPs are protected from oxidation they are normally taken up mainly via the LRP1, since pCRLPs have little effect on chemokine/cytokine secretion in non-transfected cells. Importantly, however, it is uptake via the LDLr that is required for their inhibitory effect, since when uptake via LRP1 is blocked the particles suppress cytokine secretion to a similar extent regardless of their oxidative state (Fig. 10). In summary, the results of this study demonstrate that macrophage pro-inflammatory chemokine/cytokine secretion is downregulated by CMR at the transcriptional level, and that these effects are positively related to the lipoprotein oxidative state. The differential effects of CMR in different oxidative states, however, are not related to the content of the particles, but rather to their receptormediated route of uptake by the cells. Thus, CMR protected from oxidation are taken up mainly via the LRP1, but the proportion taken up via the LDLr increases with increasing oxidation. CRLPs entering the cells via the LDLr, however, inhibit cytokine secretion regardless of their oxidative state. These findings indicate that the receptormediated route of uptake of CMR plays a crucial role in modulating their effects on inflammatory processes in macrophages and provide the basis for the elucidation of the signalling pathways involved. Acknowledgements VSG was supported by a studentship from the Royal Veterinary College. We should like to thank Dr J.S. Perona (Instituto de la Grasa, Seville, Spain), for the preparation of human TRLs. References [1] N.R. Webb NR, K.J. Moore, Macrophage-derived foam cells in atherosclerosis: lessons from murine models and implications for therapy, Curr. Drug Targets 8 (2007) 1249–1263. [2] H.S. Kruth, Macrophage foam cells and atherosclerosis, Front. Biosci. 6 (2001) D429–D455. [3] R. Albertini, R. Moratti, G. DeLuca, Oxidation of low-density lipoprotein in atherosclerosis from basic biochemistry to clinical studies, Curr. Mol. Med. 2 (2002) 579–592. [4] K.C. Yu, A.D. Cooper AD, Postprandial lipoproteins and atherosclerosis, Front. Biosci. 6 (2001) D332–D354. [5] S.D. Proctor, D.F. Vine, J.C. Mamo, Arterial retention of apolipoprotein B(48)- and B (100)-containing lipoproteins in atherogenesis, Curr. Opin. Lipidol. 13 (2002) 461–470. [6] D.J. Grieve, M.A. Avella, J. Elliott, K.M. Botham, Influence of chylomicron remnants on endothelial cell function in the isolated perfused rat aorta, Atherosclerosis 139 (1998) 273–281. [7] J.C.L. Mamo, J.R. Wheeler, Chylomicrons or their remnants penetrate rabbit thoracic aorta as efficiently as do smaller macromolecules, including low density lipoprotein, high density lipoprotein and albumin, Coron. Artery Dis. 5 (1994) 695–705.

219

[8] J.H. Rapp, A. Lespine, R.L. Hamilton, N. Colyvas, A.H. Chaumeton, J. TweedieHarman, L. Kotite, S.T. Kunitake, R.J. Havel, K.P. Kane, Triglyceride-rich lipoproteins isolated by selective affinity anti-apolipoprotein B immunosorption from human atherosclerotic plaque, Arterioscler. Thromb. 14 (1994) 1767–1774. [9] S. Pal, K. Semorine, G.F. Watts, J. Mamo, Identification of lipoproteins of intestinal origin in human atherosclerotic plaque, Clin. Chem. Lab. Med. 41 (2003) 792–795. [10] P. Benlian, P.L. De Gennes, L. Foubert, H. Zhang, S.E. Gagne, M. Hayden, Premature atherosclerosis in patients with familial chylomicronemia caused by mutations in the lipoprotein lipase gene, New Engl. J. Med. 335 (1996) 848–854. [11] P.H.E. Groot, W.A.H. van Stiphout, X.H. Krauss, H. Jansen, A. van Tol, E. van Ramshorst, S. Chin-On, A. Hofmann, S.R. Cresswell, L. Havekes, Postprandial lipoprotein metabolism in normolipidemic men with and without coronary heart disease, Arterioscler. Thromb. 11 (1991) 653–662. [12] K.M. Botham, E. Bravo, J. Elliott, C.P.D. Wheeler-Jones, Direct interaction of dietary lipids carried in chylomicron remnants with cells of the artery wall: implications for atherosclerosis development, Curr. Pharmaceut. Des. 11 (2005) 3681–3695. [13] K.C. Yu, J.C.L. Mamo, Chylomicron remnant-induced foam cell formation and cytotoxicity: a possible mechanism for cell death in atherosclerosis, Clin. Sci. 98 (2000) 183–192. [14] M. Napolitano, R. Rivabene, M. Avella, K.M. Botham, E. Bravo, The internal redox balance of the cells influences the metabolism of lipids of dietary origin by J774 macrophages: implications for foam cell formation, J. Vasc. Res. 38 (2001) 350–360. [15] K.V. Batt, M. Avella, E.H. Moore, B. Jackson, K.E. Suckling, K.M. Botham, Differential effects of low density lipoprotein and chylomicron remnants on lipid accumulation in human macrophages, Exp. Biol. Med. 229 (2004) 528–537. [16] E.H. Moore, M. Napolitano, A. Prosperi, M. Avella, K.E. Suckling, E. Bravo, K.M. Botham, Incorporation of lycopene into chylomicron remnant-like particles enhances their induction of lipid accumulation in macrophages, Biochem. Biophys. Res. Commun. 312 (2003) 1216–1219. [17] E.H. Moore, M. Napolitano, M. Avella, F. Bejta, K.E. Suckling, E. Bravo, K.M. Botham, Protection of chylomicron remnants from oxidation by incorporation of probucol into the particles enhances their uptake by human macrophages and increases lipid accumulation in the cells, Eur. J. Biochem. 271 (2004) 2417–2427. [18] F. Bejta, E.H. Moore, M. Avella, P.J. Gough, K.E. Suckling, K.M. Botham, Oxidation of chylomicron remnant-like particles inhibits their uptake by THP-1 macrophages by apolipoprotein E dependent processes, Biochim. Biophys. Acta 1771 (2007) 901–910. [19] I. Staprans, X.M. Pan, M. Miller, J.H. Rapp, The effect of oxidation on the chylomicron metabolism in rats, Am. J. Physiol. 27 (1993) G561–G568. [20] R. Wilson, K. Lyall, L. Smyth, C.E. Fernie, R.A. Riemersma, Dietary hydroxy fatty acids are absorbed in humans: implications for the measurement of ‘oxidative stress’ in vivo, Free Radic. Biol. Med. 32 (2002) 162–168. [21] J.L. Ellsworth, F.B. Kraemer, A.D. Cooper, Transport of β-very low density lipoproteins and chylomicron remnants by macrophages is mediated by the low density lipoprotein receptor pathway, J. Biol. Chem. 262 (1987) 2316–2325. [22] C.L. Elsegood, S. Pal, P.D. Roach, J.C.L. Mamo, Binding and uptake of chylomicron remnants by primary and THP-1 human macrophages: determination of binding proteins, Clin. Sci. (Lond) 101 (2001) 111–119. [23] Y. Fujioka, A.D. Cooper, L.G. Fong, Multiple processes are involved in the uptake of chylomicron remnants by mouse peritoneal macrophages, J. Lipid Res. 39 (1998) 2339–2349. [24] A. Rohlmann, M. Gotthardt, R.E. Hammer, J. Herz, Inducible inactivation of hepatic LRP gene by cre-mediated recombination confirms role of LRP in clearance of chylomicron remnants, J. Clin. Invest. 101 (1998) 689–695. [25] K.V. Batt, L. Patel, K.M. Botham, K.E. Suckling KE, Chylomicron remnants and low density lipoprotein have differential effects on the expression of mRNA for genes involved in human macrophage formation, J. Mol. Med. 82 (2004) 449–458. [26] H. Schuett, M. Luchtefeld, C. Grosthusen, K. Grote, B. Schieffer, How much is too much? Interleukin-6 and its signalling in atherosclerosis, Thromb. Haemost. 102 (2009) 215–222. [27] A. Tedgui, Z. Mallat, Cytokines in atherosclerosis: pathogenic and regulatory pathways, Physiol. Rev. 86 (2006) 515–581. [28] C. De Pascale, V. Graham, R.C. Fowkes, C.P.D. Wheeler-Jones, K.M. Botham, Suppression of nuclear factor-κB activity in macrophages by chylomicron remnants: modulation by the fatty acid composition of the particles, FEBS J. 276 (2009) 5689–5702. [29] P. Diard, M.I. Malewiak, D. Lagrange, S. Griglio, Hepatic lipase may act as a ligand in the uptake of artificial chylomicron remnant-like particles by isolated rat hepatocytes, Biochem. J. 299 (1994) 889–894. [30] J.S. Perona, M. Avella, K.M. Botham, V. Ruiz-Gutierrez, Differential modulation of hepatic VLDL secretion by triglyceride-rich lipoproteins derived from different oleic acid rich dietary oils, Br. J. Nutr. 99 (2008) 29–36. [31] M.W. Pfaffl, A new mathematical model for relative quantification in real-time RTPCR, Nucleic Acids Res. 29 (2001) 2002–2007. [32] O.H. Lowry, N.J. Rosebrough, A.L. Farr, R.J. Randall, Protein measurement with Folin phenol reagent, J. Biol. Chem. 193 (1951) 265–275. [33] U.P. Steinbrecher, S. Parthasarathy, D.S. Leake, J.L. Witzum, D. Steinberg, Modification of low density lipoprotein by endothelial cells involves lipid peroxidation and degradation of low density lipoprotein phospholipids, Proc. Natl Acad. Sci. USA 81 (1984) 3883-722. [34] K.M. Botham, Oxidation of chylomicron remnants and vascular dysfunction, Atheroscler. Suppl. 9 (2008) 57–61. [35] H. Doi, K. Kugiyama, H. Oka, S. Sugiyama, N. Ogata, S.I. Koide, S.I. Nakamura, H. Yasue, Remnant lipoproteins induce proatherothrombogenic molecules in endothelial cells through a redox-sensitive mechanism, Circulation 102 (2000) 670–676.

220

V.S. Graham et al. / Biochimica et Biophysica Acta 1811 (2011) 209–220

[36] I.S. Young, C. McFarlane, J. Mceneny, Oxidative modification of triacylglycerol-rich lipoproteins, Biochem. Soc. Trans. (2003) 1062–1065. [37] A.B. Goulter, M.A. Avella, J. Elliott, K.M. Botham, Chylomicron remnant-like particles inhibit receptor-mediated endothelium-dependent vasorelaxation in porcine coronary arteries, Clin. Sci. 103 (2002) 450–460. [38] T.G. Redgrave, H.L. Ly, E.C. Quintao, C.F. Rambergh, R.C. Boston, Clearance from plasma of triacylglycerol and cholesteryl ester after intravenous injection of chylomicron-like lipid emulsions in rats and man, Biochem. J. 290 (1993) 843–847. [39] R.C. Maranhao, M.C. Feres, M.T. Martins, C.H. Mesquita, O. Toffoletto, C.G. Vinagre, S.D. Gianinni, F. Pileggi, Plasma kinetics of a chylomicron-like emulsion in patients with coronary artery disease, Atherosclerosis 126 (1996) 15–25. [40] C. Bentley, N. Hathaway, J. Widdows, F. Bejta, C. De Pascale, M. Avella, C.P.D. WheelerJones, K.M. Botham, C. Lawson, Influence of chylomicron remnants on human monocyte activation in vitro, Nutr. Metab. Cardiovasc. Dis. 2010 July 29 [Epub ahead of print]. [41] M. Napolitano, E. Bravo, Lipid metabolism and TNF-alpha secretion in response to dietary sterols in human monocyte derived macrophages, Eur. J. Clin. Invest. 35 (2005) 482–490.

[42] J. Dulak, M. Polus, I. Guevara, J. Hartwich, I. Wybranska, R. Krzesz, A. Dembinska-Kiec, Oxidized low density lipoprotein inhibits inducible nitric oxide synthase, GTP cyclohydrolase and transforming growth factor beta gene expression in rat macrophages, J. Physiol. Pharmacol. 50 (1999) 429–441. [43] C.H. Floren, A.T. Chait, Uptake of chylomicron remnants by the native LDL receptor in human monocyte-derived macrophages, Biochim. Biophys. Acta 665 (1981) 608–611. [44] A.P. Lillis, L.B. Van Duyn, J.E. Murphy-Ullrich, D.K. Strickland, LDL receptor-related protein 1: unique tissue-specific functions revealed by selective gene knock out studies, Physiol. Rev. 88 (2008) 887–918. [45] R.A. Fuentealba, Q. Liu, T. Kanekiyo, J. Zhang, G. Bu, Low density lipoprotein receptor-related protein 1 promotes anti-apoptotic signaling in neurons by activating Akt survival pathway, J. Biol. Chem. 284 (2009) 34045–34053. [46] J.W. Akkerman, From low-density lipoprotein to platelet activation, Int. J. Biochem. Cell Biol. 40 (2008) 2374–2378. [47] A.M. Relou, G. Gorter, H.J. van Rijn, J.W. Akkerman, Platelet activation by the apoB/ E receptor-binding domain of LDL, Thromb. Haemost. 87 (2002) 880–887.