Inhibition of neurite outgrowth by reduced level of NDRG4 protein in antisense transfected PC12 cells

Developmental Brain Research 135 (2002) 55–63 www.elsevier.com / locate / bres

Research report

Inhibition of neurite outgrowth by reduced level of NDRG4 protein in antisense transfected PC12 cells Takeshi Ohki, Shigeki Hongo*, Noriyuki Nakada, Akihiko Maeda, Minoru Takeda Department of Biochemistry, Showa University School of Medicine, 1 -5 -8 Hatanodai, Shinagawa-ku, Tokyo 142 -8555, Japan Accepted 31 January 2002

Abstract NDRG4, a member of the new NDRG gene family, was originally cloned as a gene that was expressed predominantly in the early postnatal rat brain. To determine whether the NDRG4 protein contributes to differentiation of neural cells, the effect of lowering the cellular NDRG4 protein level on the nerve growth factor (NGF)-induced neurite formations and transcription factor activations in PC12 cells was examined. An antisense construct of rat NDRG4 cDNA was made and transfected to PC12 cells, which constitutively express a basal level of the NDRG4 protein. Of the stably transfected antisense cell clones that expressed exogenous NDRG4 antisense RNA, six clones showed reduced levels of the NDRG4 protein, but unexpectedly two clones showed quite higher levels of NDRG4 protein than the control cells. The clones having decreased levels of the NDRG4 protein extended shorter neurites than control cells in response to NGF or dibutyryl cAMP. In contrast, the NDRG4 protein-highly expressing clones did not show suppressed neurite outgrowth induced by NGF. NGF-mediated activation of the transcription factor AP-1 was found to be suppressed in the NDRG4 protein-diminished clone and enhanced in the NDRG4 protein-upregulated clone as compared with those in the control cells. These results suggest that NDRG4 plays a role in neurite outgrowth and has an influence on an NGF-stimulated AP-1 activation by an undefined mechanism in PC12 cells.  2002 Elsevier Science B.V. All rights reserved. Theme: Development and regeneration Topic: Process outgrowth, growth cones, and sprouting Keywords: NDRG4 protein; Antisense RNA; Neurite outgrowth; Nerve growth factor; PC12 cell; AP-1

1. Introduction NDRG4 was first cloned as a gene that was expressed predominantly in the early postnatal brain and originally named Bdm1 in rats [29]. The NDRG gene family includes to date members NDRG1–4. The message for NDRG4 is shown to be widely distributed in the brain by in situ hybridization [29]. NDRG4 mRNA is upregulated during nerve growth factor (NGF)-induced neuronal differentiation of rat pheochromocytoma PC12 cells and retinoic acid-dependent differentiation of murine embryonal carcinoma P19 cells, but not detected in the nonneural cell lines examined [29]. NDRG4 protein is expressed as four isoforms with molecular masses 38, 39, 41, and 45 kDa, *Corresponding author. Tel.: 181-3-3784-8116; fax: 181-3-37842346. E-mail address: [email protected] (S. Hongo).

which are differentially regulated during brain development. In PC12 cells the 45-kDa species is a majorly expressed form before and during cellular differentiation by NGF. In rat cerebra, the NDRG4 protein was shown to be localized mainly in the mitochondria and endoplasmic reticulum. Recently, it was reported that the expression of NDRG4 mRNA is decreased in the Alzheimer’s diseased brain as compared with normal human adult brain [33]. Thus, the NDRG4 might play a role in the differentiation and cellular activity of neural cells. As for NDRG1, regulated patterns of expression of NDRG1 at mRNA and protein levels under a variety of biological conditions suggest that NDRG1 has at least two biological roles, in cell differentiation [10,15,20,22,24,25,28] and in response to some types of stress on cells [13,19,32]. Forced expression of NDRG1 was reported to reduce cell growth in human cancer cells. In a field of study for a nervous system, it was reported

0165-3806 / 02 / $ – see front matter  2002 Elsevier Science B.V. All rights reserved. PII: S0165-3806( 02 )00300-0

56

T. Ohki et al. / Developmental Brain Research 135 (2002) 55 – 63

that NDRG1 mutation is responsible for hereditary motor and sensory neuropathy-Lom (HMSNL) [12], which shows features such as Schwann cell dysfunction, reduction in nerve conduction velocities, and progressive axonal loss. Mouse Ndr1 (an ortholog of human NDRG1) is shown to be the downstream gene repressed by N-myc, expressed in the areas of developing embryos where N-myc is once expressed and when N-myc begins to decline [22]. Mouse Ndr2 and Ndr3 (the counterparts of NDRG2 and 3) are expressed in the many specific sites of the developing embryonic tissues with temporal and spatial patterns different from those of NDRG1 [18], indicating that each member of the NDRG gene family plays a different role. However, functions and mechanisms of NDRG1–3 remain obscure. PC12 cells are a widely used model system for studying neuronal cell differentiation and signal transduction. Using antisense RNA methods, many workers have analyzed a variety of neural proteins including S100A1 [34], S100B [21], calmodulin [6], GAP-43 [11], and drebrin [31] in PC12 cells and other neural cell lines. This study was sought to determine the role of NDRG4 in cellular differentiation of nervous cells by an antisense RNA approach. PC12 cells were transfected with GFP-conjugated NDRG4 antisense and stable transfectants were cloned. Using these clones and control cells, we examined their neurite extensions after treatment with NGF or dibutyryl cAMP. The interaction of NGF with its receptors results in activations of several transcription factors, including AP-1 [8,14,17] and nuclear factor-kB (NF-kB) [7,27]. Therefore, activation of transcription factors by NGF is also compared among the different antisense transfectants, empty GFP vector transfected cells, and untransfected parental PC12 cells.

05no change (round); 15any extension of one or more neurites, each less than one body length; 25extension of one or more neurites between one or two cell body lengths; 35at least one neurite of more than two cell body lengths in size. Nine to 20 different fields containing 100 to 200 cells were scored.

2.2. Construction and transfection of NDRG4 antisense RNA expression vector The NDRG4 / Bdm1 cDNA region that contains the entire open reading frame (ORF) was amplified by polymerase chain reaction (PCR) with pBdm-1 [29] as a template and primers (GACGCGAATTCGCAGGACACCTCCATGGTG and GAACGCGTCGACATGCCGGAGTGCTGGGAT) that include restriction enzyme recognition sites. The PCR products were treated with EcoRI and SalI and cloned into pEGFP-C2 plasmid (Clontech, Palo Alto, CA) that had been digested with the same enzymes to generate an antisense NDRG4 RNA expression construct (pEGFP-asNDRG4). The EGFP plasmid was used to permit visualization of transfected cells as described by Grossman et al. [9]. The orientation of the inserted cDNA was ascertained by DNA sequencing. PC12 cells (1310 7 cells) were transfected with 5 mg of the antisense construct or an empty EGFP vector by electroporation in a total volume of 800 ml. The electroporation was performed in a BioRad GenePulser at 400 V and a capacitance of 960 mfarads. Electroporated cells were incubated for 48 h in 100-mm dishes, and stable transfectants were selected by 0.4 mg / ml G418 (Calbiochem, San Diego, CA). Three weeks after the transfection, single fluorescent colonies were treated with 0.05% trypsin and the dispersed cells were re-plated in 100-mm dishes. After 3 more weeks, single colonies were transferred to 24-well plates and expanded.

2. Materials and methods

2.3. Selection of antisense cell clone 2.1. Cell culture and induction of neuronal differentiation Rat pheochromocytoma PC12 cells were maintained in Dulbecco’s modified Eagle’s medium supplemented with 5% horse serum and 5% fetal bovine serum in a humidified air with 5% CO 2 at 37 8C. Untransfected PC12 cells and antisense-transfected cells were incubated with a medium containing 50 ng / ml mouse 2.5S NGF (Wako, Osaka, Japan) or 1 mM dibutyryl cAMP for the indicated time periods to induce neuronal differentiation. The cell culture medium containing NGF or dibutyryl cAMP was changed every third day. Monolayers of the cells were photographed under phase contrast microscopy. The degree of neurite extension was expressed by a differentiation score described by Bai and Weiss [3], which is based on the number of neurites per cell and on the relative lengths of the neurites. This evaluation system is defined as follows:

Stable transfectants were screened for the presence of exogenous NDRG4 antisense RNA by reverse transcription-polymerase chain reaction (RT-PCR) analysis. Total RNA was extracted from the cells by the guanidinium thiocyanate–phenol–chloroform extraction method [5]. The RNA was first transcribed into cDNA using an oligonucleotide primer whose sequence corresponds to the downstream part to the polylinker in pEGFP-C2 (AGCTGCAATAAACAAGTTAAC). After stopping the reaction by heating, the synthesized cDNA was amplified by PCR with the same primer and a primer whose sequence corresponds to the 39 region of the NDRG4 / Bdm1 cDNA ORF (GCTTGTGATTGAGACCCACATCGTG). The RT-PCR products were separated by electrophoresis on a 2.5% agarose gel and stained with ethidium bromide to be visualized with UV light. The integrity of the RT-PCR products was confirmed by

T. Ohki et al. / Developmental Brain Research 135 (2002) 55 – 63

amplification of a 983-bp glyceraldehydes 3-phosphate dehydrogenase (G3PDH) fragment corresponding to nucleotide 35–1017 of the G3PDH cDNA [23] using primers of Rat G3PDH Control Amplimer Set (Clontech).

2.4. Western blot analysis Cells were grown to near confluence, washed by Dulbecco’s phosphate buffered saline (PBS), scraped, and pelleted by centrifugation. Ten volumes of 62.5 mM Tris– HCl buffer (pH 6.8) containing 2% SDS were added to the cells and passed through 21 gauge needles to shear the DNA. Before loading, 2-mercaptoethanol and bromophenol blue were added to the lysates to 5% and 0.01%, respectively, and they were heated at 99 8C for 5 min. Proteins in the lysate were separated by 10% sodium dodecylsulfate–polyacrylamide gel electrophoresis (SDS– PAGE) [16] and transferred to polyvinylidene difluoride (PVDF) membranes by electroblotting. The membrane was blocked with bovine milk proteins and incubated with anti-NDRG4 protein polyclonal antibody as described in the preceding paper. The membrane was then incubated with horseradish peroxidase-conjugated anti-rabbit IgG antibody and the reaction product was visualized with a Lumi-Light PLUS Western Blotting Substrate (Roche Molecular Biochemicals, Mannheim, Germany) according to the manufacturer’s instructions.

2.5. Electrophoretic mobility shift assay ( EMSA) Cells in culture were rinsed, scraped with cold PBS, and sedimented by centrifugation. DNA-binding protein extracts were prepared by minor modifications of the method described by Andrews and Faller [1]. Briefly, cells were suspended in six volumes (v / w) of Buffer C containing 50 mM Hepes–KOH (pH 7.8), 420 mM KCl, 0.1 mM EDTA, 5 mM MgCl 2 , 20% glycerol, 1 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, and protease inhibitors cocktail CompleteE (Roche Molecular Biochemicals). The cells were lysed by freezing and thawing, a process which was repeated five times. The lysate was centrifuged at 20,0003g for 15 min at 4 8C, and the resulting supernatant was used as the extracted total proteins. The oligonucleotides from a commercially available kit (Promega, Madison, WI) were used as probes. The sequences were as follows: AP-1, CGCTTGATGAGTCAGCCGGAA; AP-2, GATCGAACTGACCGCCCGCGGCCCGT; NF-kB, AGTTGAGGGGACTTTCCCAGGC; Sp1, ATTCGATCGGGGCGGGGCGAGC; and CREB, AGAGATTGCCTGACGTCAGAGAGCTAG. The oligonucleotide sequences were labeled with T4 polynucleotide kinase and [g32 P]ATP (3000 Ci / mmol). Binding reactions (10 ml) consisted of 10 mM Tris–HCl (pH 7.5), 50 mM NaCl, 0.5 mM dithiothreitol, 0.5 mM EDTA, 1 mM MgCl 2 , 0.05 mg / ml polydeoxyinosinic-deoxycytidylic acid, 4% glycerol, 5 mg of the extracted protein, and the labeled

57

oligonucleotide. The reactions were incubated for 20 min at room temperature. DNA–protein complexes were electrophoresed in 4% gel (acrylamide / bisacrylamide 39:1) containing 2.5% glycerol in 0.53TBE (103TBE: 0.89 M Tris, 0.89 M boric acid, 0.02 M EDTA) at 260 V. Gels were dried and subjected to autoradiography.

3. Results

3.1. Isolation of transfectants expressing antisense NDRG4 RNA An entire coding region of rat NDRG4 cDNA was cloned into the pEGFP-C2 vector in the antisense orientation (Fig. 1A). Transcription of the inserted DNA in this vector is under the control of the cytomegalovirus (CMV) promotor. PC12 cells were transfected with pEGFPasNDRG4 or an empty GFP vector by electroporation. Twenty stable and fluorescent clonal transfectants were selected by resistance to G418 and were screened for the presence of transcribed RNA by RT-PCR analysis which potentially amplifies an insert–vector boundary region with an expected size of 301 bp. The parental PC12 cells and the PC12 cells transfected with the empty vector (C1 cells) were used as control cells. All the antisense transfected cell lines designated AS1-q, AS2-q, AS3, AS6, AS12, AS13, AS15, AS16, and AS18 yielded the PCR products with the predicted size (301 bp), but not control PC12 (data not shown) and C1 cells (Fig. 1B). The integrity of RT reactions were verified by amplification of the 983-bp G3PDH fragment (Fig. 1B).

3.2. NDRG4 protein levels in antisense clones The transfectants were then examined for reduction of cellular NDRG4 protein level. Western blot analysis of PC12 cell lysates by anti NDRG4 protein antibody revealed a major band migrating at 45-kDa as previously reported. AS3, AS12, AS13, AS16, and AS18 cells showed appreciably reduced levels of NDRG4 protein and AS15 slightly, as compared with control PC12 cells and C1 cells (Fig. 2). Unexpectedly, AS1-q and AS2-q cell lines revealed oppositely equal or slightly higher levels of NDRG4 protein than the control cells. These two cell lines were also used in the subsequent experiments for comparison. These upregulations might be brought about by a compensatory mechanism that was proposed to explain the increases in the level of message and the processing of the translated product in the case of the antisense proenkephalin transfection [2]. All lanes contained similar amounts of actin analyzed by Western blotting except lane 5 from the left which contained an amount of actin somewhat lower than other lanes (Fig. 2).

58

T. Ohki et al. / Developmental Brain Research 135 (2002) 55 – 63

Fig. 1. Detection of recombinant antisense NDRG4 RNA in transfectants. To detect EGFP-antisense NDRG4 RNA in transfectants, RT-PCR that potentially amplifies the insert–vector boundary region (301 bp) was performed. (A) A part of EGFP-conjugated NDRG4 antisense vector is depicted. The shaded rectangle denotes the entire coding region of rat NDRG4 cDNA inserted into the EcoRI–SalI site in the antisense orientation to the human cytomegalovirus immediate early promotor (CMV ) and EGFP site (EGFP). The SV40 early mRNA polyadenylation signal is designated SV40 polyA. The horizontal arrowheads indicate, while not to scale, the position of the primers used in RT-PCR, and the connecting line indicates the expected RT-PCR product. (B) The total RNA was prepared from neomycin (G418)-resistant and fluorescent cell clones and reverse transcribed into cDNA. The cDNAs were then subjected to PCR using primers shown in A and size-fractionated by electrophoresis on 2.5% agarose gels. The arrow indicates the position of the 301-bp RT-PCR product. Lane 1, molecular size markers; lane 2, RT-PCR using glyceraldehyde 3-phosphate dehydrogenase primers, in which the expected 983-bp fragment was produced; lanes 3–11, RT-PCR products from potential antisense (AS) clones (AS6 cells were not used in the subsequent experiment); lane 12, RT-PCR with the RNA from empty GFP vector-transfected C1 clone.

3.3. Inhibition of NGF-induced neurite outgrowth in antisense clones To study the role of the NDRG4 protein in cellular differentiation and processes, the antisense transfected cell lines, C1 cells, and parental PC12 cells were examined for neurite outgrowth after treatment with NGF. Fig. 3 shows that neurite outgrowth was greatly impaired in AS3, AS12, and AS18 cell lines, extending very short processes or none at all during 6 days NGF-treatment as compared with those in C1 cells or parental PC12 cells. In contrast,

NGF-induced neurite outgrowth in AS2-q cells carrying unreduced levels of NDRG4 protein was not inhibited, but rather increased as compared with those of the control cell lines. Fig. 4 shows the time courses of change in differentiation score of antisense cell lines and control cell lines after treatment with NGF. The differentiation scores were increased in all cell lines on day 2 after the addition of NGF by 0.4–0.9 and subsequently increased from day 2 to day 9 in C1 and PC12 cell lines. However, the differentiation scores remained almost unchanged in the five antisense transfected cell lines from day 2 to day 9 (Fig. 4A).

Fig. 2. Western blot analysis of NDRG4 protein level in antisense transfected cells and control cells. Antisense transfected cells (AS1-q, AS2-q, AS3–AS18) and control cells (parental PC12 and empty GFP-transfected C1 cells) were lysed in SDS sample buffer and cell extracts (30 mg total protein) were electrophoresed on a 10% acrylamide gel. The separated proteins were transferred to PVDF membrane and NDRG4 protein was detected using anti-NDRG4 polyclonal antibody and a Lumi-Light PLUS substrate. The arrow indicates the position of 45-kDa NDRG4 isoform. The same membrane was reprobed with an anti-actin antibody to compare the protein amounts loaded per lane (below).

T. Ohki et al. / Developmental Brain Research 135 (2002) 55 – 63

59

Fig. 3. Morphology of antisense NDRG4-transfected cells and control cells after treatment with nerve growth factor. Phase contrast micrographs of different transfectants and parental PC12 cells which were exposed to 50 ng / ml NGF for 6 days. AS3 (B), AS12 (C), and AS18 cells (D) that were reduced in levels of NDRG4 protein extended shorter neurites or none at all than control C1 (E) and PC12 cells (F). In contrast, AS2-q cells (A) that had an increased level of NDRG4 protein extended longer neurites than the NDRG4 protein-reduced clones and even control C1 and PC12 cells. Scale bars550 mm.

60

T. Ohki et al. / Developmental Brain Research 135 (2002) 55 – 63

In contrast, the differentiation score in AS2-q cells was slightly but significantly higher than those in control cell lines 4 and 6 days after the treatment with NGF (Fig. 4B). PC12 cells terminally differentiate to neurons when exposed to cAMP [4]. We further examined whether cAMP-stimulated neurite extension is related to intracellular NDRG4 protein levels. The neurite extensions were extensive in AS2-q cells, moderate in C1 and PC12 cells, but minor or absent in AS3 cells (Fig. 5).

3.4. Electrophoretic mobility shift assay of transcription factor activation in antisense PC12 cells NGF induces many changes in cellular signaling systems in PC12 cells, including the activations of transcription factors AP-1 and NF-kB. To further gain insight into the mechanisms whereby the NDRG4 protein participates in the neuronal differentiation and neurite outgrowth of PC12 cells, AP-1 activations following exposure of antisense and control cells to NGF were assessed by electrophoretic mobility shift assay. Increases of DNA-binding activity of AP-1 during 1-h and 4-h incubations with NGF in AS3 cells (low level NDRG4 protein) were found to be smaller than those in parental PC12 cells and C1 cells (Fig. 6A). On the contrary, enhancements of AP-1 activity by 1-h and 4-h NGF treatments in AS2-q cells were markedly greater than those in C1 and PC12 cells. The specificity of DNA binding was verified for each transcription factor by competition experiments, using a 50-fold excess of the corresponding unlabelled specific consensus sequence. By comparison, DNA binding activities of other transcription factors, NF-kB, Sp1, AP-2, and CREB were similar among AS2-q, AS3, C1, and PC12 cells after 1-h NGF treatments (Fig. 6B).

4. Discussion

Fig. 4. Quantitative analysis of NGF-induced neuronal differentiation of antisense NDRG4-transfected clones. (A) Cells were seeded at a density of 5310 4 cells / cm 2 in six-well plates and cultured for 2 days and then treated with 50 ng / ml NGF for 0, 2, 5, and 9 days. (B) AS1-q, AS2-q cells and control cells were treated in a way similar to (A). To quantitate the differentiation, a set of differentiation scores as described in the Materials and methods was applied. Six to nine random fields consisting of 100–200 cells were photographed from different cultures and scored. Similar results were repeated in separate experiments. **P,0.01 compared to corresponding values in parental PC12 cells and empty vector transfected C1 cells.

NDRG4, a member of the NDRG gene family, was first identified as a gene that is predominantly expressed in postnatal brain and originally named rat Bdm1 [29]. To further elucidate a functional role of NDRG4 in cellular differentiation and processes, the effect of ablated expression of the NDRG4 protein on NGF-induced neurite outgrowth and transcription factor activations was examined in PC12 cells. A construct that expresses antisense RNA for NDRG4 was transfected to PC12 cells, and cell lines that stably express antisense RNA for NDRG4 were selected. A reduction of the level of endogenous NDRG4 protein in the transfected cells was observed in six antisense clones of the eight clones examined. These clones exhibited suppressions of NGF- and dibutyryl cAMP-induced neurite formations. Conversely, two clones (AS1-q and AS2-q) exhibited equal or slightly higher expressions of NDRG4 protein than parental PC12 cells or empty vector transfected cells. Correspondingly, AS2-q

T. Ohki et al. / Developmental Brain Research 135 (2002) 55 – 63

61

Fig. 5. Phase contrast micrographs of antisense NDRG4-transfected clones after treatment with dibutyryl cAMP. AS2-q (A), AS3 (B), C1 (C), and PC12 cells (D) were treated with 1 mM dibutyryl cAMP for 6 days. Scale bars550 mm.

clones showed, on average, more extended neurites than control cells. These results may possibly indicate that the NDRG4 protein closely correlates to the neuronal differentiation and / or neurite formation. The suppressions of both NGF- and dibutyryl cAMP-dependent process formations in the NDRG4 protein-depleted cells might mean that the NDRG4 protein directly or indirectly interplays with common signaling components that are activated by the two stimulants and are associated with terminal neurite outgrowth. As transcription factors have been shown to play an essential role in the control of cellular differentiation, we measured the DNA binding activity of AP-1 in AS2-q, AS3, C1, and parental PC12 cell lines. NGF signaling activates AP-1, an immediate early gene product and transcription factor, in PC12 cells [8,14,17]. In the NDRG4 protein-attenuated cell line (AS3 cells) the activation of

AP-1 DNA binding activity by NGF was markedly suppressed as compared with the control C1 cells and PC12, suggesting that the NDRG4 protein deeply correlates to the activation of AP-1. The NDRG4 protein or signaling intermediates upstream or downstream of the NDRG4 protein might inhibit AP-1 activation in a feedback-like manner. Neurite process formation has also been reported to be promoted by NGF-dependent activation of NF-kB via TrkA in PC12 cells [7,27]. Furthermore, NGF activates the p21 promotor by stimulating the transactivation domain of Sp1 in PC12 cells [30]. PC12 cells terminally differentiate into neurons when exposed to cAMP [4,26], though participation of CREB in the differentiation of PC12 cells is not known. On the basis of these data, we examined whether there are differences in activation of such transcription factors among different antisense NDRG4-trans-

62

T. Ohki et al. / Developmental Brain Research 135 (2002) 55 – 63

support the proposal that there is a specific correlation between the AP-1 activation and the amount of cellular NDRG4 protein. In summary, the NDRG4 protein may participate in regulating processes that lead to cellular differentiation and neurite formation in PC12 cells. Studies of the further specific events caused by NDRG4 protein ablation would clarify the role of this protein in the nervous system.

Acknowledgements This work was supported in part by the High-Technology Research Center Project from the Ministry of Education, Culture, Sports, Science, and Technology of Japan.

References

Fig. 6. Electrophoretic mobility shift assay of activations of transcription factors in antisense NDRG4 transfected cells. AS2-q (increased in NDRG4 protein level), AS3 (decreased in NDRG4 protein level), C1 (empty vector transfected), and PC12 cells were exposed to 50 ng / ml NGF for the indicated time periods. Cell were lysed and the extracted protein (5 mg) was incubated with labeled oligonucleotide for AP-1 (A) or those for other transcription factors (B) with and without competitor DNAs. Protein–DNA complexes were then resolved by PAGE in 0.53 TBE. The arrow indicates the position of AP-1 specific bands. Lane 1, AS2-q cell extract; lane 2, AS3 cell extract; lane 3, C1 cell extract; lane 4, PC12 cell extract; lane 5, PC12 cell extract with 503 unlabeled oligonucleotide.

fected cell lines and control cell lines. As a result, the activations of these transcription factors were similar among the cell lines examined. These results further

[1] N.C. Andrews, D.V. Faller, A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells, Nucl. Acids Res. 19 (1991) 2499. [2] I. Arany, X. Zhang, H.H. Loh, N.M. Lee, Antisense proenkephalin cDNA transfection decreases opioid binding in NG 108-15 cells, Mol. Brain Res. 16 (1992) 295–302. [3] G. Bai, B. Weiss, The increase of calmodulin in PC12 cells induced by NGF is caused by differential expression of multiple mRNAs for calmodulin, J. Cell. Physiol. 149 (1991) 414–421. [4] S. Cassano, A.D. Lieto, R. Cerillo, E.V. Avvedimento, Membranebound cAMP-dependent protein kinase controls cAMP-induced differentiation in PC12 cells, J. Biol. Chem. 274 (1999) 32574– 32579. [5] P. Chomczynski, N. Sacchi, Single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction, Anal. Biochem. 162 (1987) 156–159. [6] G. Davidkova, S.P. Zhang, R.A. Nichols, B. Weiss, Reduced level of calmodulin in PC12 cells induced by stable expression of calmodulin antisense RNA inhibits cell proliferation and induces neurite outgrowth, Neuroscience 75 (1996) 1003–1019. [7] E.D. Foehr, X. Lin, A. O’Mahony, R. Geleziunas, R.A. Bradshaw, W.C. Greene, NF-kB signaling promotes both cell survival and neurite process formation in nerve growth factor-stimulated PC12 cells, J. Neurosci. 20 (2000) 7556–7563. [8] K. Furukawa, Q. Guo, G.D. Schellenberg, M.P. Mattson, Presenilin1 mutation alters NGF-induced neurite outgrowth, calcium homeostasis, and transcription factor (AP-1) activation in PC12 cells, J. Neurosci. Res. 52 (1998) 618–624. [9] D. Grossman, J.M. McNiff, F. Li, D.C. Altieri, Expression of the apoptosis inhibitor, surviving, in nonmelanoma skin cancer and gene targeting in a keratinocyte cell line, Lab. Invest. 79 (1999) 1121– 1126. [10] R.J. Guan, H.L. Ford, Y. Fu, Y. Li, L.M. Shaw, A.B. Pardee, Drg-1 as a differentiation-related, putative metastatic suppressor gene in human colon cancer, Cancer Res. 60 (2000) 749–755. [11] K.J. Ivins, K.A. Neve, D.J. Feller, S.A. Fidel, R.L. Neve, Antisense GAP-43 inhibits the evoked release of dopamine from PC12 cells, J. Neurochem. 60 (1993) 626–633. [12] L. Kalaydjieva, D. Gresham, R. Gooding, L. Heather, F. Baas, R. de Jonge, K. Blechschmidt, D. Angelicheva, D. Chandler, P. Worsley, A. Rosenthal, R.H.M. King, P.K. Thomas, N-myc downstreamregulated gene 1 is mutated in hereditary motor and sensory neuropathy-Lom, Am. J. Hum. Genet. 67 (2000) 47–58. [13] K. Kokame, H. Kato, T. Miyata, Homocysteine-respondent genes in

T. Ohki et al. / Developmental Brain Research 135 (2002) 55 – 63

[14]

[15]

[16] [17]

[18]

[19]

[20]

[21]

[22]

[23]

vascular endothelial cells identified by differential display analysis. GRP78 / BiP and novel genes, J. Biol. Chem. 271 (1996) 29659– 29665. E. Kontny, F. Ciruela, P. Svenningsson, C.F. Ibanez, B.B. Fredholm, On the role of the low-affinity neurotrophin receptor p75LNTR in nerve growth factor induction of differentiation and AP 1 binding activity in PC12 cells, J. Mol. Neurosci. 8 (1997) 29–44. S.K. Kurdistani, P. Arizti, C.L. Reimer, M.M. Sugrue, S.A. Aaronson, S.W. Lee, Inhibition of tumor cell growth by RTP/rit42 and its responsiveness to p53 and DNA damage, Cancer Res. 58 (1998) 4439–4444. U.K. Laemmli, Cleavage of structural proteins during the assembly of the head of bacteriophage T4, Nature 227 (1970) 680–685. S. Lappa, R. Saffrich, W. Ansorge, D. Bohmann, Differential regulation of c-Jun by ERK and JNK during PC12 cell differentiation, EMBO J. 17 (1998) 4404–4413. T. Okuda, H. Kondoh, Identification of new genes Ndr2 and Ndr3 which are related to Ndr1 /RTP/Drg1 but show tissue specificity and response to N-myc, Biochem. Biophys. Res. Commun. 266 (1999) 208–215. H. Park, M.A. Adams, P. Lachat, F. Bosman, S.C. Pang, C.H. Graham, Hypoxia induces the expression of a 43-kDa protein (PROXY-1) in normal and malignant cells, Biochem. Biophys. Res. Commun. 276 (2000) 321–328. D. Piquemal, D. Joulia, P. Balaguer, A. Basset, J. Marti, T. Commes, Differential expression of the RTP/Drg1 /Ndr1 gene product in proliferating and growth arrested cells, Biochim. Biophys. Acta 1450 (1999) 364–373. R.H. Selinfreund, S.W. Barger, M.J. Welsh, L.J. Van Eldik, Antisense inhibition of glial S100 production results in alterations in cell morphology, cytoskeletal organization, and cell proliferation, J. Cell Biol. 111 (1990) 2021–2028. A. Shimono, T. Okuda, H. Kondoh, N-myc-dependent repression of Ndr1, a gene identified by direct subtraction of whole mouse embryo cDNA between wild type and N-myc mutant, Mech. Dev. 83 (1999) 39–52. J.Y. Tso, X.-H. Sun, T.-h. Kao, K.S. Reece, R. Wu, Isolation and characterization of rat and human glyceraldehyde-3-phosphate dehydrogenase cDNAs: genomic complexity and molecular evolution of the gene, Nucl. Acid Res. 13 (1985) 2485–2502.

63

[24] W. Ulrix, J.V. Swinnen, W. Heyns, G. Verhoeven, The differentiationrelated gene1, Drg1, is markedly upregulated by androgens in LNCap prostatic adenocarcinoma cells, FEBS Lett. 455 (1999) 23–26. [25] N. van Belzen, W.N.M. Dinjens, M.P.G. Diesveld, N.A. Groen, A.C.J. van der Made, Y. Nozawa, R. Vlietstra, J. Trapman, F.T. Bosman, A novel gene which is up-regulated during colon epithelial cell differentiation and down-regulated in colorectal neoplasms, Lab. Invest. 77 (1997) 85–92. [26] M.R. Vossler, H. Yao, R.D. York, M.-G. Pan, C.S. Rim, P.J.S. Stork, cAMP activates MAP kinase and Elk-1 through a B-Raf- and Rap1-dependent pathway, Cell 89 (1997) 73–82. [27] J.N. Wood, Regulation of NF-kB activity in rat dorsal root ganglia and PC12 cells by tumor necrosis factor and nerve growth factor, Neurosci. Lett. 192 (1995) 41–44. [28] B. Xu, L. Lin, N.S. Rote, Identification of a stress-induced protein during human trophoblast differentiation by differential display analysis, Biol. Reprod. 61 (1999) 681–686. [29] Y. Yamauchi, S. Hongo, T. Ohashi, S. Shioda, C. Zhou, Y. Nakai, N. Nishinaka, R. Takahashi, F. Takeda, M. Takeda, Molecular cloning and characterization of a novel developmentally regulated gene, Bdm1, showing predominant expression in postnatal rat brain, Mol. Brain Res. 68 (1999) 149–158. [30] G.-Z. Yan, E.B. Ziff, Nerve growth factor induces transcription of the p21 WAF1 / CIP1 and cyclin D1 genes in PC12 cells by activating the Sp1 transcription factor, J. Neurosci. 17 (1997) 6122–6132. [31] M. Yoda, T. Shirao, K. Uyemura, Suppression of an actin-binding protein, drebrin, by antisense transfection attenuates neurite outgrowth in neuroblastoma B104 cells, Dev. Brain Res. 114 (1999) 193–200. [32] D. Zhou, K. Salnikow, M. Costa, Cap43, a novel gene specifically induced by Ni 21 compounds, Cancer Res. 58 (1998) 2182–2189. [33] R.-H. Zhou, K. Kokame, Y. Tsukamoto, C. Yutani, H. Kato, T. Miyata, Characterization of the human NDRG gene family: a newly identified member, NDRG4, is specifically expressed in brain and heart, Genomics 73 (2001) 86–97. [34] D.B. Zimmer, E.H. Cornwall, P.D. Reynolds, C.M. Donald, S100A1 regulates neurite organization, tubulin levels, and proliferation in PC12 cells, J. Biol. Chem. 273 (1998) 4705–4711.