Inhibition of osteoclasts differentiation by CDC2-induced NFATc1 phosphorylation

Journal Pre-proof Inhibition of osteoclasts differentiation by CDC2-induced NFATc1 phosphorylation

Hye-min Kim, Long He, Sangku Lee, Chanmi Park, Dong Hyun Kim, Ho-Jin Han, Junyeol Han, Joonsung Hwang, Hyunjoo ChaMolstad, Kyung Ho Lee, Sung-Kyun Ko, Jae-Hyuk Jang, In-Ja Ryoo, John Blenis, Hee Gu Lee, Jong Seog Ahn, Yong Tae Kwon, Nak-Kyun Soung, Bo Yeon Kim PII:

S8756-3282(19)30447-8

DOI:

https://doi.org/10.1016/j.bone.2019.115153

Reference:

BON 115153

To appear in:

Bone

Received date:

30 July 2019

Revised date:

18 October 2019

Accepted date:

11 November 2019

Please cite this article as: H.-m. Kim, L. He, S. Lee, et al., Inhibition of osteoclasts differentiation by CDC2-induced NFATc1 phosphorylation, Bone(2019), https://doi.org/ 10.1016/j.bone.2019.115153

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

© 2019 Published by Elsevier.

Journal Pre-proof

Inhibition of osteoclasts differentiation by CDC2-induced NFATc1 phosphorylation

Hye-min Kim1, §, Long He1, 2, §, Sangku Lee1, §, Chanmi Park1, Dong Hyun Kim1, 5, Ho-Jin Han1, 5, Junyeol Han1, 5, Joonsung Hwang1, Hyunjoo Cha-Molstad1, Kyung Ho Lee1, SungKyun Ko1, Jae-Hyuk Jang1, In-Ja Ryoo1, John Blenis2, Hee Gu Lee3, Jong Seog Ahn1, 5, Yong

Anticancer Agent Research Center, Korea Research Institute of Bioscience and

ro

1

of

Tae Kwon4,*, Nak-Kyun Soung1,5, *, and Bo Yeon Kim1, 5, *

Biotechnology (KRIBB), Ochang, Cheongju, 28116, Korea.

Meyer Cancer Center, Weill Cornell Medicine, New York, NY, 10021, USA.

3

Immunotherapy Convergence Research Center, Korea Research Institute of Bioscience and

4

lP

Biotechnology, Daejeon 34141, Korea

re

-p

2

Protein Metabolism Medical Research Center, Department of Biomedical Sciences, College

5

na

of Medicine, Seoul National University, Seoul, 03080, Korea Department of Biomolecular Science, University of Science and Technology, Daejeon,

Jo ur

34113, Korea.

Key words: Ostecoclast, NFATc1, Cdc2, Zebrafish Running title: Cdc2-mediated NFATc1 regulation of osteoclasts differentiation §

The first three authors contributed equally.

*

Correspondence: Nak-Kyun Soung ([email protected]; Tel.: +82-43-240-6165; Fax:

+82-43-240-6259), Yong Tae Kwon ([email protected]; Tel.: +82-2-740-8547; Fax: +82-2-

1

Journal Pre-proof

3673-2167), Bo Yeon Kim ([email protected]; Tel.: +82-43-240-6100; Fax: +82-43-240-

Jo ur

na

lP

re

-p

ro

of

6259),

2

Journal Pre-proof

Abstract Bone homeostasis is regulated by a balance of bone formation and bone resorption; dysregulation of bone homeostasis may cause bone-related diseases (eg, osteoporosis, osteopetrosis, bone fracture). Members of the nuclear factor of activated T cells (NFAT) family of transcription factors play crucial roles in the regulation of immune system, inflammatory responses, cardiac formation, skeletal muscle development, and bone

of

homeostasis. Of these, NFATc1 is a key transcription factor mediating osteoclast

ro

differentiation, which is regulated by phosphorylation by distinct NFAT kinases including

-p

casein kinase 1 (CK1), glycogen synthase kinase 3 (GSK3), and dual-specificity tyrosine-

re

phosphorylation-regulated kinases (DYRKs). In this study, we report that cell division control protein 2 homolog (cdc2) is a novel NFAT protein kinase that inhibits NFATc1 activation by

lP

direct phosphorylation of the NFATc1 S263 residue. Cdc2 inhibitors such as Roscovitine and

na

BMI-1026 induce reduction of phosphorylation of NFATc1, and this process leads to the inhibition of NFATc1 translocation from the nucleus to the cytoplasm, consequently

Jo ur

increasing the nuclear pool of NFATc1. Additionally, the inhibition of cdc2-mediated NFATc1 phosphorylation causes an elevation of osteoclast differentiation or TRAP-positive staining in zebrafish scales. Our results suggest that cdc2 is a novel NFAT protein kinase that negatively regulates osteoclast differentiation.

3

Journal Pre-proof

1. Introduction Bone homeostasis is an important aspect of bone health and regulated by a balance between osteoblast-derived bone formation and osteoclast-derived bone resorption; an imbalance of bone regulation may lead to metabolic bone diseases such as osteoporosis, osteopetrosis, arthritis, and bone fracture [1, 2]. In osteoclasts, two haematopoietic factors [ie,

of

macrophage colony-stimulation factor (M-CSF) and receptor activator of nuclear factor-κB (RANKL)] are necessary and sufficient for osteoclast differentiation and required for

ro

proliferation and differentiation of the monocyte/macrophage lineage cells. RANKL-induced

-p

osteoclast differentiation is activated via calcium signaling, a process that leads to the

re

activation of calcineurin, a well-known phosphatase. Calcineurin dephosphorylates the

lP

transcription factor nuclear activated T cells cytosolic isoform 1 (NFATc1), a key regulator of RANKL-induced osteoclast differentiation belonging to the NFAT family of proteins.

na

Therefore, NFATc1 is translocated to the nucleus and activates osteoclast target genes (eg,

Jo ur

NFATc1, TARP, Cathepsin K, and OSCAR) [3, 4]. NFAT proteins were initially identified as inducible nuclear factor in activated T cells; five members have been identified to data [ie, NFAT1 (NFATc2), NFAT2 (NFATc1), NFAT3 (NFATc4), NFAT4 (NFATc3) and NFAT5 (TonEBP)] [5, 6]. These proteins evolved alongside the evolution of vertebrates and are involved in immune responses and other biological systems (eg, cardiac, muscle, pancreas, skin, bone) [7-10]. NFAT proteins contain three conserved domains: i) a regulatory domain, ii) a DNA binding domain, and iii) a cterminal domain. The regulatory domain contains many serine-rich motifs that are 4

Journal Pre-proof

phosphorylated by various kinases such as casein kinase 1 (CK1), glycogen synthase kinase 3 (GSK3), dual-specificity tyrosine-phosphorylation-regulated kinase (DYRK), and IκB kinase (IKK)-related kinase (IKKε) [11-14]. NFATc1 (NFAT2) is a key transcription factor regulating osteoclast differentiation and phosphorylated in the cytoplasm under resting conditions. NFATc1 is activated by calcium signaling; calcineurin phosphatase directly dephosphorylates NFATc1, leading to its translocation to the nucleus where it acts as a

of

transcription factor.

ro

Cell differentiation correlates with a lengthening of G1 phase, a process controlled by a

-p

family of cyclins and cyclin-dependent kinases (CDKs). During osteoclast differentiation, RANKL-induced cell cycle was arrested in G0-G1 phases, a process associated with the up-

re

regulation of the cyclin-dependent kinase inhibitors p27kip1 and p21cip1 [15]. Additionally,

lP

CDK6 is known to be a critical regulator of RANKL-induced osteoclast differentiation [16].

na

However, the precise mechanism of cell cycle progression to differentiation remains unclear in osteoclast.

Jo ur

Cdc2 is a member of the Ser/Thr protein kinase family it regulated cell cycle progression [17]. Cdc2 is a major enzyme to promote G2/M phase transition at cell cycle [18]. Activation of a Cdc2 requires association with specific cyclin subunit, such as Cdc2-cyclin B [19]. Thereby activated, Cdc2 facilitates mitotic entry through phosphorylation of its substrates. In cancer cells, cdc2 activity related with cell survival so which has been studied as a cancer therapeutic target and thus some inhibitors have been applied to the clinic to verify its effectiveness [20, 21].

5

Journal Pre-proof

In this study, we observed that the expression level and the kinase activity of cdc2 are dynamically regulated during RANKL-induced osteoclast differentiation. Of particular, cyclin-dependent kinase 1 (CDK1) or cell division cycle protein 2 (Cdc2) hyperphosphorylates NFATc1 and regulates its subcellular localization. Our results suggest that regulation of Cdc2 mediated NFATc1 phosphorylation might be a potential target for the

Jo ur

na

lP

re

-p

ro

of

treatment of osteoporosis.

6

Journal Pre-proof

2. Materials and Methods 2.1. Reagents and Antibodies α-MEM, DMEM, fetal bovine serum, and penicillin were purchased from Invitrogen (Carlsbad, CA), and roscovitine and FK506 from Selleck Chemical (Houston, TX) (Darmstadt, GERMANY). TRAP staining solution, A23187 and nocodazole were obtained

of

from Sigma Aldrich (St. Louis, MO). Recombinant human soluble M-CSF and mouse

ro

RANKL were purchased from PeproTech EC (London, United Kingdom). Specific

-p

antibodies against GST, cyclin B1, cyclin A2, HA, Histone H3, α-tubulin, NFATc1 and GAPDH were obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Specific

re

antibodies against phospho-cdc2 and cdc2 were obtained from Cell Signaling Technology

lP

(Danvers, MA).

Jo ur

differentiation

na

2.2. Primary bone marrow-derived macrophages (BMMs) isolation and Osteoclast

All experiments with mice were approved by the Ethics committee of Korea Research Institute of Bioscience & Biotechnology (Approval No. KRIBB-AEC-14124; Daejeon, Korea). Mouse bone marrow cells were obtained from femurs and tibias of 8-week-old ICR mice and incubated in α-MEM complete media containing 10% fetal bovine serum, 100 U/ml penicillin in 10-cm petri-dishes in the presence of MCSF (30 ng/ml) for 3days. Adherent cells were used as bone marrow macrophages (BMMs), osteoclast precursors, after non-adherent cells were removed. To generate osteoclasts, BMMs (4 × 104 cells/well) were cultured for 4 7

Journal Pre-proof

days with MCSF (30 ng/ml) and RANKL (25 ng/ml) in 48-well (1 ml/well) tissue culture plates. The cells were fixed with 10% formalin (for 10 min), permeabilized with 0.1% Triton X-100, and then stained for tartrate-resistant acid phosphatase (TRAP) by using the Leukocyte Acid Phosphatase Assay Kit (Sigma-Aldrich).

2.3. Preparation of the GST-fusion proteins and GST pull-down assay

of

Sf9 cells were co-infected with GST-cyclin B1/cdc2 complex expressing baculovirus (a

ro

gift of Dr. Kyung S Lee, NCI, Bethesda, MD) and proteins were purified from the cell lysate using GSH-Sepharose 4B beads. After washing, the bound GST fusion proteins were used for

-p

GST pull-down assay or eluted with elution buffer (10 mM GSH in 50 mM Tris-HCl, pH 8.0).

re

For the GST pull-down assay, the GFP-NFATc1 cell lysates were incubated with bound GST

2.4. In Vitro Kinase Assay

na

with the antibodies indicated.

lP

proteins; after 3hr, precipitates were washed 5 times and subjected to western blot analysis

Jo ur

In vitro kinase assays for cdc2 were carried out as described previously [22], using histone H1 (Takara) or purified NFATc1 as substrates. Briefly, to measure cdc2 kinase activity during osteoclast differentiation, equal amounts of cell lysates prepared from BMM cells at the time points indicated were assayed for 15 min using 50 µM ATP and 1 µCi of [γ-32P] ATP/reaction. The kinase cocktail contained 50 mM Tris-Cl (pH 7.5), 10 mM MgCl2, 5 mM dithiothreitol, 2 mM EGTA, 0.5 mM Na3VO4, and 20 mM p-nitrophenyl phosphate. To determine cdc2 kinase activity against NFATc1, cdc2/GST-cyclin B1 complex was purified from Sf9 cells, whereas NFATc1 was purified from Escherichia coli. All reactions were 8

Journal Pre-proof

conducted at 30 °C for 1 min and terminated by adding sodium dodecyl sulfate (SDS) sample buffer. Proteins were separated on 10% polyacrylamide gels, detected by coomassie blue staining, western blotting with the antibody indicated, or autoradiography

2.5. Western Blot Analysis BMMs or osteoclasts were lysed in a buffer containing 50 mM Tris–HCl, 150 mM NaCl, 5

of

mM EDTA, 1% Triton X-100, 1 mM sodium fluoride, 1 mM sodium vanadate, 1%

ro

deoxycholate, and protease inhibitors. Lysates were centrifuged at 15,000 ×g for 30 min and supernatants were collected. After protein concentrations of supernatants were determined,

-p

cellular proteins (30 μg) were resolved by 8–10% sodium dodecyl sulfate-polyacrylamide gel

re

electrophoresis (SDS-PAGE) and transferred to a polyvinylidene difluoride membranes

lP

(Milipore, Bedford, MA, USA). Non-specific interactions were blocked with 5% non-fat dry milk for 1 h followed by incubation with the appropriate primary antibodies. Membranes

na

were incubated with the appropriate secondary antibodies attached to horseradish peroxidase,

Jo ur

and immune reactivity was detected with enhanced chemiluminescence reagents.

2.6. Quantitative PCR Analysis

Total RNA was prepared by using an RNeasy Mini kit (QIAGEN, Valencia, CA) according to the manufacturer’s instructions, and cDNA was synthesized from 3 μg of total RNA using reverse transcriptase (Superscript II Preamplification System; Invitrogen). Realtime PCR was performed on a CFX96TM Real-time system with SYBR FAST KAPA iCycler qPCR kit, by following the manufacturer’s protocols. The detector was programmed with the following PCR conditions: 40 cycles of 15 sec denaturation at 95 °C, and 1 min of 9

Journal Pre-proof

amplification at 60 °C. All reactions were run in triplicates and normalized to the housekeeping gene β-actin. Relative differences in PCR results were evaluated using the comparative cycle threshold method. The following primer sets were used: mouse NFATc1: forward,

5′-CCGTTGCTTCCAGAAAATAACA-3′;

reverse,

5′-

TGTGGGATGTGAACTCGGAA-3′; cdc2: forward, 5′-AGAAGGTACT TACGGTGTGG T -3′; reverse, 5′-GAGAGATTTC CCGAATTGCA GT -3′; cyclin B1: forward, 5′-

of

AAGGTGCCTG TGTGTGAACC -3′; reverse, 5′-GTCAGCCCCA TCATCTGCG -3′, cyclin

ro

A2: forward, 5′-GCCTTCACCA TTCATGTGGA T -3′; reverse, 5′-TTGCTGCGGG TAAAGAGACA G -3′; mouse β-actin: forward, 5′- TCTGCTGGAA GGTGGACAGT -3′;

re

-p

reverse, 5′- CCTCTATGCC AACACAGTGC -3′.

lP

2.7. Protein Purification

His-pET28a-NFATc1 wild type and mutants fusion proteins were expressed in E. Coli

na

BL21 DE3 and purified on Ni2+-NTA resion (Qiagen). Cells wee grewn in LB at 37 °C to an OD600 of 0.8 and induced by addition of IPTG to 100 μM. After 5 h of induction, cells were

Jo ur

harvested by centrifugation and resuspended in lysis buffer [50 mM Tris-HCl pH 8.0, 500 mM NaCl, 5 mM 2-Mercaptoethanol, 10 mM imidazole] and followed by sonication. A soluble fraction was made by 100,000Xg spin and was loaded on a 1 mL of Ni2+-NTA agarose (Qiagen) column equilibrated with lysis buffer. Bound protein was washed with lysis buffer containing 20 mM Imidazole and eluted in lysis buffer containing 120 mM Imidazole.

2.8. Transfection and Lentivirus generation and infection HA-Cdc2 WT and DN constructs were purchased by addgene (Cat. No. 1887, 1888) [23], 10

Journal Pre-proof

shCycB1 and shCycA2 were givend by another group [24]. –GFP or –HIS NFATc1 were made by insertion of NFATc1 CDS region to pEGFP-C1 or pET-28a vectors. Full length of mouse NFATc1 amplified with RT-PCR and digested with EcoRⅠ-XhoⅠ, respectively with primers: NFATc1-F; GGCC AGATCT ATGCCAAATACCAGCTTTCC, NFATc1-R; GC GAATTC GTAAAAACCTCCTCTCAGCTCAC. NFATc1 point-mutants were made by gene cloning replaced serine to alanine from –GFP or -His NFATc1 WT backbone. Transfections

of

were carried out using Lipofectamine 2000 (Invitrogen, Carlsbad, CA). For the production of

ro

sh-RNA lentiviruses, pHR'-CMVΔR8.2Δvpr and pHR'- CMV-VSV-G (protein G of vesicular stomatitis virus) were co-transfected into 293T cells with pLKO.1-puro-sh-Luciferase (sh-

-p

Luc), -sh-cdc2 or pLenti-puro-empty, -NFATc1, -cdc2. Lentiviruses expressing sh-Luc have

re

been described previously by another group [25]. After incubation in fresh medium for 24 h,

lP

culture supernatants of the lentivirus-producing cells were collected. For lentiviral infections, fresh 293T cells were exposed to supernatants of indicated lentivirus together with polybrene

na

(6 μg/ml); infected cells were selected with 4 μg/ml blasticidine or 2 μg/ml puromycin for 48

Jo ur

h before use. For BMMs, cells were cultured in MCSF (30 ng/ml) for 48 h, media were replaced with culture supernatants of indicated lentivirus as noted above and MCSF (30 ng/ml) for 12 h. Infected cells were cultured in the presence of MCSF for another 24 h before stimulation with RANKL.

2.9. Experimental animals and treatments All experimental procedures using zebrafish followed our previous study (30). In brief, wild-type adult zebrafish were maintained at 27.0 ± 1.0 °C under a 14:10 h light/dark cycle. 11

Journal Pre-proof

Six zebrafish were separated as a group into standard tanks and fed with live artemia stored in water. The fish were raised in the presence or absence of roscovitine for an additional 20 days. Half of the volume of water was replaced with or without of 25 μM roscovitine every day. 20 days later, the fish were anesthetized with 0.01% tricaine methanesulfonate (Sigma Aldrich), and then the scales were then carefully removed from either side of the body using forceps.

2.10. Measurement of calcium/phosphorus ratio in scales

of

The scales and vertebrae were prepared from each group of fish. The remaining body was

ro

removed from the head and then treated with 0.1 % trypsin for 10 min at 37 °C to collect the

-p

vertebrae. Scales and vertebrae were washed 2 times with distilled water. The weights of both

re

samples were determined after incubation in a dry oven overnight; samples were then subjected to atomic absorption spectrometry. Calcium/phosphorus (Ca:P) ratios in samples

lP

were measured by inductively coupled plasma mass spectrometry (VG PlasmaQuad, Fisons

na

Instruments, UK). All values were adjusted for minor deviations from standard calcium

Jo ur

solutions with accepted natural ratios (the ratio of Ca:P is roughly 2:1).

2.11. Statistical analysis

Values are presented as the mean ± S.D from three or more experiments. Data were analyzed with the Student’s t test for comparisons between two mean values. A value of P< 0.05 was considered significant.

12

Journal Pre-proof

3. Results 3.1. Cdc2 activity is inversely correlated with NFATc1 activation during osteoclast differentiation To examine the effect of cell cycle dependent kinases on osteoclast differentiation, we observed the expression of several cyclin dependent kinases (CDKs). Bone marrow

of

macrophage (BMM) cells isolated from mice were stimulated with M-CSF and RANKL for 3

ro

days, and the expression of several cyclin dependent kinases was assessed each time. During

-p

osteoclast differentiation, NFATc1 levels started to increase after 36 hours of RANKL stimulation. Interestingly, the expression of cell cycle division cycle protein 2 (cdc2) and

re

cyclin B1 increased within two days of RANKL stimulation; however, their levels decreased

lP

thereafter, correlating with the phosphorylation of cdc2. The mRNA levels of cdc2 related

(Fig. 1A and B).

na

kinases, cyclin B1 and cyclin A2 also increased within 24 to 36 hours of RANKL stimulation

Jo ur

In order to examine whether cdc2 kinase activity is related to osteoclast differentiation, an in vitro kinase assay was performed with Histone H1 as a cdc2 substrate. During osteoclast differentiation, cdc2 kinase activity was elevated 24 to 36 hours following RANKL treatment, and decreased thereafter (Fig. 1C and D). Concomitantly, the mRNA levels of other cyclin dependent mitotic kinases, cyclin B2 and cyclin E2 during RANKL-induced osteoclast differentiation were also found to be elevated (Fig. 1E). These results suggest that cdc2 activity is involved in RANKL-induced osteoclast differentiation.

13

Journal Pre-proof

3.2. Cdc2 is required for NFATc1 phosphorylation Cyclin-dependent kinases (CDKs) are a family of multifunctional enzymes that can modify various protein substrates involved in cell cycle progression [26]. Several CDKs form complex with cyclins, controling kinase activity and the cell cycle. Moreover, diverse CDKs and CDK inhibitors are known to be regulators of cell differentiation [27]. Previous results suggested that the mitotic kinase cdc2 (CDK1) is involved in osteoclast differentiation.

of

Introducing several reagents known to induce cell-cycle arrest, nocodazole and taxol as

ro

mitotic inhibitors was found to increase NFATc1 phosphorylation, while the effect of other

-p

cell cycle inhibitors etoposide and cytochalasin D was comparable to that of DMSO control

re

(Fig. 2A). Moreover, the effect of nocodazole on NFATc1 phosphorylation could be diminished following treatment with roscotivine (a CDK1 inhibitor) (Fig. 2B), emphasizing

lP

the pivotal role of cdc2 on NFATc1 phosphorylation.

na

Given that CDK1, known as cdc2, interacts with Cyclin B1 and Cyclin A2 during mitosis

Jo ur

[28], we examined whether the effect of cyclin B1 or Cyclin A2 is involved in NFATc1 phosphorylation. Knockdown of cyclin B1 and Cyclin A2 resulted in de-phosphorylation of the phosphorylated NFATc1 following nocodazole treatment (Fig. 2C). Moreover, while exogenous expression of cdc2 increased NFATc1 phosphorylation, the dominant negative cdc2 failed to up-regulate NFATc1 (Fig. 2D). All these results suggest that cdc2 activity is required for NFATc1 phosphorylation.

3.3. Cdc2 inhibition blocks cytosolic translocation of NFATc1 from the nucleus 14

Journal Pre-proof

NFAT translocation is regulated by Ca2+ mediated calcineurin signaling pathway, various kinases are also associated with the prevention of NFAT translocation [29]. To verify the Ca2+/calcineurin signaling pathway in our NFATc1 translocation model, cells were treated with other phosphatase inhibitors, such as salubrinal (eIF2α phosphatase inhibitor), cantharidin (protein phosphatase 2A (PP2A) inhibitor), or FK506 (calcineurin inhibitor). Nocodazole-induced NFATc1 phosphorylation (lane 2, Fig 3A) was significantly diminished

of

by challenging with a fresh medium (lane 3, Fig 3A), and the decrease of NFATc1

ro

phosphorylation could still be seen regardless of the presence of salubrinal or cantharidin in the new medium (lanes 4 & 6, Fig 3A). However, NFATc1 phosphorylation was remained

-p

high in the presence of FK506 (lane 5, Fig. 3A), implicating the involvement of

re

Ca2+/calcineurin signaling pathway in NFATc1 phosphorylation.

lP

Since the phosphorylation status of NFATc1 regulates its subcellular localization, we next

na

assessed the subcellular localization of NFATc1 by using several kinase inhibitors. To visualize NFATc1 protein, GFP-NFATc1-expressing HEK293 cells were established. The

Jo ur

cells were treated with A23187 (calcium ionophore) for 30 min, then followed by changing to a new medium containing the kinase inhibitors (Fig. 3B). DMSO treated control cells after changing to a fresh medium showed re-translocation of nuclear NFATc1 to the cytosol. It was of note that while MAPK kinases inhibitors (PD98059, SB203580, and SB600125) and a Wee1 inhibitor (PD166285) did not show accumulation of NFATc1 in the nucleus, inactivation of Cdc2 with roscovitine or BMI-1026 affected most of NFATc1 to remain in the nucleus even after the medium change (Fig. 3C). On the other hand, the GSK3 inhibitor moderately affected the re-translocation of NFATc1 to the cytosol (42%), although there 15

Journal Pre-proof

could be seen only a marginal effect on NFATc1 phosphorylation by the GSK3 inhibitor (Fig. 3D). In support of NFATc1 translocation data, cdc2 kinase inhibitors, roscovitine and BMI1026 only showed inhibition of nocodazole-induced NFATc1 phosphorylation while others could not (Fig. 3E). All these results suggest the specific effect of cdc2 kinase on NFATc1

of

localization for the regulation of osteoclast differentiation.

ro

3.4. NFATc1 is directly phosphorylated by cdc2 kinase

-p

Based on the observations that cdc2 inhibitors reduced nocodazole-induced NFATc1 phosphorylation in the cells and several protein kinases could phosphorylate NFATc1 [29, 30],

re

it was presumable that NFATc1 is a novel substrate of cdc2 kinase. To test this hypothesis, a

lP

possible interaction between NFATc1 and GST-CyclinB1/cdc2 complex was assessed. GST-

na

CyclinB1/cdc2 complex purified from baculovirus infected SF9 cells exhibited a significant binding with NFATc1 (Fig. 4A). Moreover, an in vitro kinase assay showed that NFATc1

Jo ur

could be directly phosphorylated by the GST-Cyclin B1/cdc2 fusion protein; kinase activity was eliminated following treatment with roscovitine (Fig. 4B). Next, in order to identify specific cdc2-mediated phosphorylation site(s) on NFATc1, mass spectrometry analysis was performed. Among the ten candidate phosphorylation sites, five different vector constructs containing alanine mutations were established (Fig. 4C). In vitro kinase assay revealed that the mutant 2 construct (MT2) containing S235, S247 and S263 had diminished kinase activity when the respective amino acids were mutated to alanine (Fig. 4D). Moreover, in finding more specific phosphorylation sites, three single point mutants from the 16

Journal Pre-proof

MT2 construct were made and subjected to an in vitro kinase assay (Fig. 4E). Among the three phosphorylation sites in MT2 region, S263 of NFATc1 was revealed to be the most specific site that could be phosphorylated by cdc2 kinase. These results suggest that NFATc1 S263 is directly phosphorylated by cdc2.

of

3.5. NFATc1 S263A mutant delays the cytoplasmic translocation of NFATc1 from the

ro

nucleus

-p

The observation that S263 residue on NFATc1 is the direct phosphorylation site by cdc2

re

was next confirmed by nocodazole treatment of the cells harboring NFATc1 S263A mutant vector. It was found that S263A mutation diminished nocodazole-induced NFATc1

lP

phosphorylation (Fig. 5A). Next, to determine if the phosphorylation of NFATc1 S263 site

na

affected the cytosolic localization of NFATc1, we characterized NFATc1 translocation from nucleus to cytoplasm using the NFAT S263A mutation construct. U2OS cells stably

Jo ur

expressing wild type or S263A NFATc1 were treated with A23187 for 30 min, and incubated in a new fresh medium for the comparison of NFATc1 localizations (Fig. 5B). Nuclear fractionation assay revealed that the abundance of wild type NFATc1 in the nucleus diminished within 45 min, and its phosphorylated form was released to the cytoplasm. Compared to the wild type, however, noticeable amount of NFATc1 S263A mutant still remained in the nucleus even after 45 min of medium change, with the less amount of phosphorylated NFATc1 S263A mutant compared with wild type phospho-NFATc1 in the

17

Journal Pre-proof

cytoplasm (Fig. 5C). Time lapse-images also revealed that the translocation of NFATc1 S263A mutant is delayed compared with that of wild type NFATc1 (Fig. 5D).

3.6. Cdc2 is a negative regulator of osteoclast differentiation To determine if cdc2 regulates osteoclast differentiation, an osteoclast differentiation assay

of

was performed in mouse BMM cells either infected with cdc2 overexpressing lenti-viral

ro

vector or cdc2 gene depleted. Following stimulation with RANKL for 3 days, the cells were

-p

stained with Tartrate-resistant acid phosphatase (TRAP). Knockdown of cdc2 (shCdc2) triggered osteoclast differentiation in the presence of RANKL stimulation, and the number of

re

TRAP-positive multinucleated cells was increased in a dose-dependent manner following

lP

RANKL treatment (Fig. 6A and B). Overexpression of cdc2, however, led to a reduction in osteoclast differentiation, and the number of TRAP-positive cells decreased compared with

Jo ur

na

vector control (Fig. 6C and D).

3.7. Cdc2 inhibition by roscovitine regulates osteoclast differentiation in zebrafish model

Teleost fish such as zebrafish (Danio rerio) is a very attractive animal model system to study bone due to rapid generation, external development, and availability for genetic maps [31]. Hence, in examining the effect of cdc2 on osteoclast differentiation in animal model, we used zebrafish scales. Zebrafish bodies were covered by elasmoid scales, like the other 18

Journal Pre-proof

elements of the dermal skeleton [32]. Zebrafish were treated with either DMSO (negative control) or a cdc2 inhibitor, roscovitine for 20 days to induce osteoporosis followed by staining of their scales with TRAP. Using this approach, the Calcium/Phosphorus (Ca/P) ratio, a suitable in vitro biomarker [33], of vertebrate and scales was calculated to measure the induced osteoporosis. Zebrafish scales treated with roscovitine revealed strong TRAP staining (Fig. 7A). Accordingly, mRNA levels of NFATc1 and Cathepsin K (osteoclastic

of

marker) were also elevated following treatment with roscovitine. However, there was no

ro

effect on the osteoblastic marker Col1 2A by roscovitine (Fig. 7B). In fish scales, the Ca2+/P ratio was significantly decreased while no reduction could observed in vertebrae (Fig. 7C).

-p

These results indicate that cdc2 is a negative regulator of RANKL-induced osteoclast

Jo ur

na

lP

re

differentiation as evidenced in Zebrafish scale model as well as in cell system.

19

Journal Pre-proof

4. Discussion Cdc2 is the most prominent mitotic kinase regulated by association with both cyclin and multiple phosphorylations, which are essential for G1/S and G2/M phase transitions [34, 35]. Although the regulation of cdc2-cyclin complexes in cell mitosis is relatively well understood, little is known about the functional regulation of cellular differentiation. The results presented

of

here surprisingly revealed that the expression levels of cdc2, cyclin B1 and cyclin A2 as well as phosphorylation of cdc2 were dynamically regulated during RANKL-induced osteoclast

ro

differentiation in BMM cells (Fig. 1A). NFATc1 is one of the key regulators in RANKL-

-p

induced osteoclast differentiation [36], treatment with the cdc2 inhibitor roscovitine resulting

re

in the reduction of phosphorylation of NFATc1 (Fig. 2B). Additionally, knockdown of cdc2

lP

induces dephosphorylation of NFATc1, but overexpression of HA-cdc2 WT increases NFATc1 phosphorylation (Fig. 2C and D). For this reason, it was expected that cdc2 activity

na

could be related to bone homeostasis. In support of these results, it was recently reported that the CDK inhibitor roscovitine activated raw264.7 cell derived osteoclast differentiation

Jo ur

highlighting the importance of CDKs in regulating osteoclast differentiation [37]. Cytoplasmic NFATs are regulated by Ca2+/calmodulin-dependent signaling. The serine phosphatase calcineurin dephosphorylates NFATs, resulting in the translocation of NFAT proteins to the nucleus [6]. The calcineurin phosphatase inhibitors FK506 and cyclosporine A (CsA) are immunosuppressive drugs that inhibit translocation of NFAT proteins to the nucleus by binding to calcienurin [38, 39]. The results presented here suggest that cdc2 is a novel negative regulator of NFATc1, and that along with other NFAT kinases, phosphorylates 20

Journal Pre-proof

nuclear NFAT leading to its cytoplasmic translocation. In particular, the translocation assay used here reveals that treatment with cdc2 inhibitors (BMI-1026 and roscovitine) effectively inhibited NFATc1 translocation to cytoplasm, while a GSK3 inhibitor inhibited only 42% of NFATc1 translocation, and other MAP kinase inhibitors (eg, inhibitors of Erk, p38, JNK1, and Wee1, respectively) did not inhibit NFATc1 translocation (Fig. 3). Hence, these results support the suggestion that cdc2 might be a new NFATc1 kinase negatively regulating

of

osteoclast differentiation.

ro

NFAT family proteins contain amino-terminal transactivation domain (TAD), regulatory

-p

domain, highly conserved DNA-binding domain and carboxy-terminal domain. The

re

regulatory domain is conserved among NFAT proteins, and contains multiple serine-rich regions (SRRs) and SPXX-repeat motifs that are phosphorylated by several NFAT kinases (eg,

lP

GSK3, CK1, DYRK1 [6, 29, 40]. Here we show that cdc2 directly phosphorylates NFATc1;

na

NFATc1 binds with the GST-cyclin B1/cdc2 complex, resulting in the phosphorylation of NFATc1 (Fig. 4A and B). Next, to identify specific phosphorylation sites on NFATc1 affected

Jo ur

by cdc2, we first searched the consensus sequences of CDK1 (Cdc2 homolog) [pS/T]-P-X[K/R/H] motifs in the target gene [41]. Interestingly, NFATc1 has two CDK1 consensus sequences at S235 and S280, however, alanine mutations at either sites had no effect on the phosphorylation of NFATc1 in the presence of cdc2 in an in vitro kinase assay (data not shown). Mass spectrometry analysis suggested that the S263 residue of NFATc1 is the direct phosphorylation site of cdc2 (Fig. 4E). Mutating the S263 residue of NFATc1 to alanine resulted in the decrease of NFATc1 phosphorylation (Fig. 4E and 5A), as well as delayed translocation of NFATc1 to the cytoplasm compared with WT NFATc1 (Fig. 5). Interestingly, 21

Journal Pre-proof

however,

S263A mutation

could

not

completely

block

the

nocodazole-induced

phosphorylation of NFATc1 since there still remained noticeable amount of NFATc1 in the (Fig. 5A). From these results, it might be that although the S263 residue of NFATc1 is the direct phosphorylation site of cdc2 kinase, there could be additional phosphorylation site(s) besides the S263. Our data suggest that cdc2 directly phosphorylates NFATc1 and induces translocation of

of

NFATc1 from the nucleus to the cytoplasm. Furthermore, phosphorylation of NFATc1 affects

ro

osteoclast differentiation. Knockdown of cdc2 led to the increase in osteoclast differentiation,

-p

and conversely, overexpression of cdc2 decreased osteoclast differentiation in mouse BMMs

re

(Fig. 6). And we examined the effect of cdc2 on osteoclast differentiation in zebrafish scale model. Zebrafish has been used as a model not only in physiological, genetic, and

lP

developmental biology studies, but also in bone studies. A Zebrafish skeleton is composed of

na

bone and mineralizing tissues, similar to humans [31, 42]. The fish body is covered by elasmoid scales, a component of their dermal skeleton, making it a useful model to study

Jo ur

bone mineralizing processes [32, 43]. Here, we report that treatment with cdc2 inhibitors increases TRAP-positive staining in zebrafish scales and the levels of nuclear NFATc1 and TRAP mRNA were increased. Furthermore, the Ca/P ratio also decreased in zebrafish scale, but not in vertebrae (Fig. 7). High intakes of dietary phosphorus (P), relative to calcium (Ca) intake are associated with a low calcium:phosphorus (Ca/P) ratio. High level of P intake leads to elevation of serum parathyroid hormone (PTH) concentration which are decreases bone mineral content and density [44]. Prolonged low level of Ca/P ratio cause cause adverse bone related diseases, including arterial calcification, bone loss, osteoporosis [45]. In experiment, 22

Journal Pre-proof

zebrafish were raised in presence of roscotivine for 20 days in water, zebrafish scales were directly affected by roscotivine, but not vertebrae. We guess that the experimental condition is not sufficient to reach vertebrae. NFAT proteins not only regulate bone processes, but are also involved in immune responses, cardiac hypertrophy, and muscle systems; dysregulation of these systems can lead to cancer [29, 46-48]. Roscovitine (Seliciclib or CYC202) is a pharmacological CDK

of

inhibitor that inhibits multiple enzyme targets (eg, cdc2, CDK2, CDK5) being studied for the

ro

treatment of non-small cell lung cancer (NSCLC), Cushing’s disease, leukemia, and chronic

-p

inflammation disorders [49, 50]. However, cancer patients are confronted with an increased

re

risk for bone related diseases due to the direct effects of cancer on the skeleton or to the side effects that come with many cancer specific therapies [51], and the relationship between

lP

cancer and bone related disease has not understood yet. In this regard, although roscovitine

na

has been tested in Phase I and II clinical trials in several human cancers, further study of roscovitine in relation with both cancer and bone destruction would be required. In

Jo ur

conclusion, although NFATc1 can be phosphorylated by several kinases including GSK3, CK1 and DYRK1, we present cdc2 as a novel NFATc1 kinase. Moreover, our data suggest that osteoclast differentiation and osteoporosis could be effectively treated by the combination of therapeutic strategies including the phosphorylation of NFATc1 by cdc2 kinase.

Declaration of Competing Interest 23

Journal Pre-proof

The authors declare no conflict of interest.

Acknowledgements This work was supported by a National Research Council of Science & Technology (NST)

of

grant (CAP-16-03-KRIBB to B.Y.K), the Bio and Medical Technology Development Program (NRF-2016R1A2B3011389 to Y.T.K.), and the KRIBB Research Initiative Program.

ro

This work was also supported by the NRF of Korea and the Center for Women In Science,

Jo ur

na

lP

re

under the Program for Returners into R&D.

-p

Engineering and Technology (WISET) Grant funded by the Ministry of Science and ICT

24

Journal Pre-proof

References [1] G.A. Rodan, Bone homeostasis, Proceedings of the National Academy of Sciences of the United States of America 95(23) (1998) 13361-2. [2] L.J. Raggatt, N.C. Partridge, Cellular and molecular mechanisms of bone remodeling, The Journal of biological chemistry 285(33) (2010) 25103-8.

of

[3] J.H. Kim, N. Kim, Regulation of NFATc1 in Osteoclast Differentiation, Journal of bone metabolism 21(4) (2014) 233-41.

ro

[4] H. Takayanagi, The role of NFAT in osteoclast formation, Annals of the New York

-p

Academy of Sciences 1116 (2007) 227-37.

re

[5] F. Macian, NFAT proteins: key regulators of T-cell development and function, Nature

lP

reviews. Immunology 5(6) (2005) 472-84.

[6] P.G. Hogan, L. Chen, J. Nardone, A. Rao, Transcriptional regulation by calcium,

na

calcineurin, and NFAT, Genes & development 17(18) (2003) 2205-32. [7] R.A. Schulz, K.E. Yutzey, Calcineurin signaling and NFAT activation in cardiovascular

Jo ur

and skeletal muscle development, Developmental biology 266(1) (2004) 1-16. [8] J.J. Heit, A.A. Apelqvist, X. Gu, M.M. Winslow, J.R. Neilson, G.R. Crabtree, S.K. Kim, Calcineurin/NFAT signalling regulates pancreatic beta-cell growth and function, Nature 443(7109) (2006) 345-9. [9] V. Horsley, A.O. Aliprantis, L. Polak, L.H. Glimcher, E. Fuchs, NFATc1 balances quiescence and proliferation of skin stem cells, Cell 132(2) (2008) 299-310.

25

Journal Pre-proof

[10] T. Koga, Y. Matsui, M. Asagiri, T. Kodama, B. de Crombrugghe, K. Nakashima, H. Takayanagi, NFAT and Osterix cooperatively regulate bone formation, Nature medicine 11(8) (2005) 880-5. [11] J.R. Arron, M.M. Winslow, A. Polleri, C.P. Chang, H. Wu, X. Gao, J.R. Neilson, L. Chen, J.J. Heit, S.K. Kim, N. Yamasaki, T. Miyakawa, U. Francke, I.A. Graef, G.R. Crabtree, NFAT dysregulation by increased dosage of DSCR1 and DYRK1A on chromosome 21, Nature

of

441(7093) (2006) 595-600.

ro

[12] C.R. Beals, C.M. Sheridan, C.W. Turck, P. Gardner, G.R. Crabtree, Nuclear export of NF-ATc enhanced by glycogen synthase kinase-3, Science 275(5308) (1997) 1930-4.

-p

[13] Y. Gwack, S. Sharma, J. Nardone, B. Tanasa, A. Iuga, S. Srikanth, H. Okamura, D.

re

Bolton, S. Feske, P.G. Hogan, A. Rao, A genome-wide Drosophila RNAi screen identifies

lP

DYRK-family kinases as regulators of NFAT, Nature 441(7093) (2006) 646-50. [14] H. Okamura, C. Garcia-Rodriguez, H. Martinson, J. Qin, D.M. Virshup, A. Rao, A

na

conserved docking motif for CK1 binding controls the nuclear localization of NFAT1,

Jo ur

Molecular and cellular biology 24(10) (2004) 4184-95. [15] U. Sankar, K. Patel, T.J. Rosol, M.C. Ostrowski, RANKL coordinates cell cycle withdrawal and differentiation in osteoclasts through the cyclin-dependent kinase inhibitors p27KIP1 and p21CIP1, Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research 19(8) (2004) 1339-48. [16] T. Ogasawara, M. Katagiri, A. Yamamoto, K. Hoshi, T. Takato, K. Nakamura, S. Tanaka, H. Okayama, H. Kawaguchi, Osteoclast differentiation by RANKL requires NF-kappaBmediated downregulation of cyclin-dependent kinase 6 (Cdk6), Journal of bone and mineral 26

Journal Pre-proof

research : the official journal of the American Society for Bone and Mineral Research 19(7) (2004) 1128-36. [17] M.G. Lee, P. Nurse, Complementation used to clone a human homologue of the fission yeast cell cycle control gene cdc2, Nature 327(6117) (1987) 31-5. [18] N.J. Wells, N. Watanabe, T. Tokusumi, W. Jiang, M.A. Verdecia, T. Hunter, The Cterminal domain of the Cdc2 inhibitory kinase Myt1 interacts with Cdc2 complexes and is

of

required for inhibition of G(2)/M progression, Journal of cell science 112 ( Pt 19) (1999)

ro

3361-71.

[19] D. Desai, H.C. Wessling, R.P. Fisher, D.O. Morgan, Effects of phosphorylation by CAK

-p

on cyclin binding by CDC2 and CDK2, Molecular and cellular biology 15(1) (1995) 345-50.

re

[20] T.A. Masuda, H. Inoue, K. Nishida, H. Sonoda, Y. Yoshikawa, Y. Kakeji, T. Utsunomiya,

lP

M. Mori, Cyclin-dependent kinase 1 gene expression is associated with poor prognosis in gastric carcinoma, Clinical cancer research : an official journal of the American Association

na

for Cancer Research 9(15) (2003) 5693-8.

Jo ur

[21] G.R. Rosania, J. Merlie, Jr., N. Gray, Y.T. Chang, P.G. Schultz, R. Heald, A cyclindependent kinase inhibitor inducing cancer cell differentiation: biochemical identification using Xenopus egg extracts, Proceedings of the National Academy of Sciences of the United States of America 96(9) (1999) 4797-802. [22] K.S. Lee, Y.L. Yuan, R. Kuriyama, R.L. Erikson, Plk is an M-phase-specific protein kinase and interacts with a kinesin-like protein, CHO1/MKLP-1, Molecular and cellular biology 15(12) (1995) 7143-51.

27

Journal Pre-proof

[23] S. van den Heuvel, E. Harlow, Distinct roles for cyclin-dependent kinases in cell cycle control, Science 262(5142) (1993) 2050-4. [24] N.K. Soung, J.E. Park, L.R. Yu, K.H. Lee, J.M. Lee, J.K. Bang, T.D. Veenstra, K. Rhee, K.S. Lee, Plk1-dependent and -independent roles of an ODF2 splice variant, hCenexin1, at the centrosome of somatic cells, Developmental cell 16(4) (2009) 539-50. [25] N.K. Soung, Y.H. Kang, K. Kim, K. Kamijo, H. Yoon, Y.S. Seong, Y.L. Kuo, T. Miki,

of

S.R. Kim, R. Kuriyama, C.Z. Giam, C.H. Ahn, K.S. Lee, Requirement of hCenexin for proper

ro

mitotic functions of polo-like kinase 1 at the centrosomes, Molecular and cellular biology 26(22) (2006) 8316-35.

re

Developmental cell 14(2) (2008) 159-69.

-p

[26] A. Besson, S.F. Dowdy, J.M. Roberts, CDK inhibitors: cell cycle regulators and beyond,

lP

[27] T. Ishidate, A. Elewa, S. Kim, C.C. Mello, M. Shirayama, Divide and differentiate: CDK/Cyclins and the art of development, Cell cycle 13(9) (2014) 1384-91.

na

[28] O. Gavet, J. Pines, Progressive activation of CyclinB1-Cdk1 coordinates entry to mitosis,

Jo ur

Developmental cell 18(4) (2010) 533-43.

[29] M.R. Muller, A. Rao, NFAT, immunity and cancer: a transcription factor comes of age, Nature reviews. Immunology 10(9) (2010) 645-56. [30] J. Zhang, H. Feng, J. Zhao, E.R. Feldman, S.Y. Chen, W. Yuan, C. Huang, O. Akbari, S.A. Tibbetts, P. Feng, IkappaB Kinase epsilon Is an NFATc1 Kinase that Inhibits T Cell Immune Response, Cell reports 16(2) (2016) 405-418. [31] E.W. Mackay, A. Apschner, S. Schulte-Merker, A bone to pick with zebrafish, BoneKEy reports 2 (2013) 445. 28

Journal Pre-proof

[32] S. Pasqualetti, G. Banfi, M. Mariotti, The zebrafish scale as model to study the bone mineralization process, Journal of molecular histology 43(5) (2012) 589-95. [33] N. Kourkoumelis, I. Balatsoukas, M. Tzaphlidou, Ca/P concentration ratio at different sites of normal and osteoporotic rabbit bones evaluated by Auger and energy dispersive X-ray spectroscopy, Journal of biological physics 38(2) (2012) 279-91. [34] M.J. Solomon, T. Lee, M.W. Kirschner, Role of phosphorylation in p34cdc2 activation:

of

identification of an activating kinase, Molecular biology of the cell 3(1) (1992) 13-27.

ro

[35] M. Doree, T. Hunt, From Cdc2 to Cdk1: when did the cell cycle kinase join its cyclin partner?, Journal of cell science 115(Pt 12) (2002) 2461-4.

-p

[36] K. Matsuo, D.L. Galson, C. Zhao, L. Peng, C. Laplace, K.Z. Wang, M.A. Bachler, H.

re

Amano, H. Aburatani, H. Ishikawa, E.F. Wagner, Nuclear factor of activated T-cells (NFAT)

279(25) (2004) 26475-80.

lP

rescues osteoclastogenesis in precursors lacking c-Fos, The Journal of biological chemistry

na

[37] Y. Akiba, A. Mizuta, Y. Kakihara, J. Nakata, J. Nihara, I. Saito, H. Egusa, M. Saeki, The

Jo ur

inhibitors of cyclin-dependent kinases and GSK-3beta enhance osteoclastogenesis, Biochemistry and biophysics reports 5 (2016) 253-258. [38] F.J. Dumont, FK506, an immunosuppressant targeting calcineurin function, Current medicinal chemistry 7(7) (2000) 731-48. [39] D. Tedesco, L. Haragsim, Cyclosporine: a review, Journal of transplantation 2012 (2012) 230386. [40] J. Shou, J. Jing, J. Xie, L. You, Z. Jing, J. Yao, W. Han, H. Pan, Nuclear factor of activated T cells in cancer development and treatment, Cancer letters 361(2) (2015) 174-84. 29

Journal Pre-proof

[41] L.J. Holt, B.B. Tuch, J. Villen, A.D. Johnson, S.P. Gygi, D.O. Morgan, Global analysis of Cdk1 substrate phosphorylation sites provides insights into evolution, Science 325(5948) (2009) 1682-6. [42] M. Mariotti, M. Carnovali, G. Banfi, Danio rerio: the Janus of the bone from embryo to scale, Clinical cases in mineral and bone metabolism : the official journal of the Italian Society of Osteoporosis, Mineral Metabolism, and Skeletal Diseases 12(2) (2015) 188-94.

of

[43] J.Y. Sire, F. Allizard, O. Babiar, J. Bourguignon, A. Quilhac, Scale development in

ro

zebrafish (Danio rerio), Journal of anatomy 190 ( Pt 4) (1997) 545-61. [44] V.E. Kemi, M.U. Karkkainen, H.J. Rita, M.M. Laaksonen, T.A. Outila, C.J. Lamberg-

-p

Allardt, Low calcium:phosphorus ratio in habitual diets affects serum parathyroid hormone

re

concentration and calcium metabolism in healthy women with adequate calcium intake, The

lP

British journal of nutrition 103(4) (2010) 561-8.

[45] R. Adatorwovor, K. Roggenkamp, J.J. Anderson, Intakes of Calcium and Phosphorus

na

and Calculated Calcium-to-Phosphorus Ratios of Older Adults: NHANES 2005-2006 Data,

Jo ur

Nutrients 7(11) (2015) 9633-9.

[46] G.R. Crabtree, E.N. Olson, NFAT signaling: choreographing the social lives of cells, Cell 109 Suppl (2002) S67-79.

[47] J.D. Molkentin, Calcineurin-NFAT signaling regulates the cardiac hypertrophic response in coordination with the MAPKs, Cardiovascular research 63(3) (2004) 467-75. [48] S.J. Swoap, R.B. Hunter, E.J. Stevenson, H.M. Felton, N.V. Kansagra, J.M. Lang, K.A. Esser, S.C. Kandarian, The calcineurin-NFAT pathway and muscle fiber-type gene expression, American journal of physiology. Cell physiology 279(4) (2000) C915-24. 30

Journal Pre-proof

[49] J. Cicenas, K. Kalyan, A. Sorokinas, E. Stankunas, J. Levy, I. Meskinyte, V. Stankevicius, A. Kaupinis, M. Valius, Roscovitine in cancer and other diseases, Annals of translational medicine 3(10) (2015) 135. [50] D. Cuevas-Ramos, D.S.T. Lim, M. Fleseriu, Update on medical treatment for Cushing's disease, Clinical diabetes and endocrinology 2 (2016) 16. [51] T.A. Guise, Bone loss and fracture risk associated with cancer therapy, The oncologist

Jo ur

na

lP

re

-p

ro

of

11(10) (2006) 1121-31.

31

Journal Pre-proof

Figure legends Figure 1. Expression and activation of cdc2 kinase complex during osteoclast differentiation in response to RANKL. Mouse bone marrow macrophage cells (BMMs) were exposed to MCSF (30 ng/ml) for 3 days, followed by incubation with M-CSF and RANKL (25 ng/ml) for another 3 days. Total cell lysates were prepared at the indicated times after the treatment for

of

subsequent experiments. (A) western blotting analysis of NFATc1 status and cdc2/cyclin complex. (B) PCR analysis for mRNA expression of cdc2/cyclin complex and NFATc1. (C)

ro

In vitro kinase assay of cdc2 using histone H1 as a substrate, and (D) graphical representation

-p

of the autoradiogram of the kinase assay. (E) mRNA expression of the indicated genes was

re

analyzed by real time PCR.

lP

Figure 2. Cdc2 activity is required for NFATc1 phosphorylation. (A) GFP-NFATc1 cells were exposed to 200 ng/ml nocodazole, 50 ng/ml cytochalashin D, 20 nM Taxol, and 20 μM

na

Etoposide for 16 h, and (B) pretreated with nocodazole for 16h, and roscovitine for indicated

Jo ur

times before harvesting. (C) GFP-NFATc1 cells were infected with cyclin B1 and A2 shRNA using a lenti-virus system, before exposure to 200 ng/ml nocodazole for 16h. Roscovitine (Ro(C) 200 μM was added for 30 min before harvesting. (D) GFP NFAT cells transfected with 1μg cdc2 WT or dominant negative form (DN) and 1 μg cyclin A2 or Cyclin B1 for 24 h. Total cell lysates were extracted and subjected to western blotting using the indicated antibodies. Figure 3. Regulation of the subcellular translocation of NFATc1 in response to cdc2 inhibitors. (A) Cells released for 2 h after nocodozaole treatment with or without salubrinal (eIF2α 32

Journal Pre-proof

phosphatase inhibitor), FK506 and cantharidin (PP1ase inhibitor). (B) Schedule of cytoplasmic translocation assay with NFATc1 kinase inhibitors. (C and D) GFP-NFATc1 cells were treated with 5 μM A23187 for 30 min, then the media were replaced with fresh media containing DMSO (control) or 10 μM PD98059 (ERK inhibitor), 20 μM SB203580 (p38 inhibitor), 10 μM SN600125 (JNK inhibitor Ⅱ), 10 μM GSK3 inhibitor Ⅱ, 5 μM PD166285 (Wee1 inhibitor) for 4 h, 2 5μM Roscovitine, and 500 nM BMI-1026 for 4 h. Subcellular

of

translocation was visualized and the results are presented as the percentage of cells with

ro

nuclear NFATc1. Scale bar, 50μM. (E) GFP-NFATc1 cells were pretreated with nocodazole for 16 h, 5 μM A23187 for 30 min, followed by replacement of media with fresh media

-p

containing DMSO or the indicated NFATc1 kinase inhibitors for 1 h. Total cell lysates were

re

extracted and subjected to western blotting using NFATc1 antibody.

lP

Figure 4. Direct phosphorylation of NFATc1 by cdc2 kinase as assessed using an in vitro

na

kinase assay. (A) Purified cdc2/GST-cyclin B1 proteins bind to NFATc1 from GFPNFATc1-expressing cell lysates using a GST pull-down assay. (B) In vitro kinase assay of

Jo ur

NFATc1 with Cdc2/GST-CyclinB1. Recombinant Cdc2/GST-Cyclin B1 complex prepared from baculovirus-infected SF9 cells. Proteins were subjected to coomassie blue staining (CBB) or immunoblotting (IB) to detect total NFATc1 and autoradiography to detect phosphorylated NFATc1. (C) Scheme of Mass spectrometry results of NFATc1 phosphorylation candidates by cdc2 inhibition. (D and E) in vitro kinase assay of cdc2/GSTCyclin B1 complex with recombinant proteins of NFATc1 having an alanine mutation of NFATc1 phosphorylation residues.

33

Journal Pre-proof

Figure 5. Effect of NFATc1 S263 mutation on subcellular translocation. (A) Cells expressing GFP-NFATc1 WT or S263A infected by lenti-virus system were incubated with nocodazole for 16 h; cell lysates were then collected and subjected to western blotting using an antiNFATc1 antibody. (B) Schedule of translocation assay of NFATc1 WT or S263A using fractionation assay. GFP-NFATc1 WT or S263A-expressing cells were treated with 5 μM A23187 for 30 min, replaced with fresh media followed by harvesting of cell lysates at the

of

indicated time points. Cell lysates were fractionated into nuclear and cytoplasmic fractions,

ro

followed by (C) western blotting analysis and assessment of the intensity of NFATc1 in the nucleus. (D) Time-lapse imaging of GFP-NFATc1 translocation was initiated immediately

re

-p

following media replacement after treatment with A23187 to 48 min. Scale bar, 20 μm Figure 6. Regulation of cdc2 in RANKL-induced osteoclast differentiation. BMMs were

lP

infected with (A and B) lenti-viruses pLKO1-shLuc, pLKO1-shCdc2, (C and D) pLenti

na

(empty vector) or pLenti-cdc2. BMM cells were infected with each Cdc2 construct during RANKL- – induced osteoclast differentiation. Whole protein lysates were prepared and

Jo ur

subjected to (A and C) western blot analysis with specific antibodies, or (B and D) 4 days after indicated doses of RANKL stimulation (50ng/ml) for 36 h, cells were fixed and subjected to TRAP staining (left), and the number of TRAP-positive, multinucleated osteoclasts were counted (right). Scale bar, 100 μm. *P < 0.05. Figure 7. Effect of the cdc2 inhibitor roscovitine in zebrafish. Zebrafish was incubated with DMSO or 20 μM roscovitine for 20 days (n=6). (A) Scales were stained with TRAP and (B) the mRNA level of NFATc1, Cathepsin K, and Col1 A2 were measured. (C)

34

Journal Pre-proof

Calcium/Phosphorous (Ca/P) ratios were calculated in the scales and vertebrae in zebrafish

Jo ur

na

lP

re

-p

ro

of

by inductively coupled plasma mass spectrometry. Scale bar, 200 μm. *P < 0.05.

35

Journal Pre-proof

Highlights



Mitotic kinase cdc2 has a close causality with NFATc1 cellular location during RANKL-induced osteoclast differentiation. After treatment of cdc2 inhibitors such as Roscovitine and BMI-1026, cytoplasmic

of





ro

NFATc1 level was elevated in the cells.

NFATc1 is a novel substrate of Cdc2, which induced phosphorylation at serine 263

re

Cdc2 phosphorylates NFATc1 directly, thereby regulating the intracellular location of

lP

NFATc1, which negatively affects osteoclast differentiation using mouse bone

na

marrow induced macrophages (BMMs) and zebrafish scales.

Jo ur



-p

residues on NFATc1 and relocating NFATc1 from the nucleus to the cytoplasm.

36

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7