- Email: [email protected]
Inhibition of p16 tumor suppressor gene expression via promoter hypermethylation in canine lymphoid tumor cells
ARTICLE IN PRESS Research in Veterinary Science ■■ (2014) ■■–■■
Contents lists available at ScienceDirect
Research in Veterinary Science j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / r v s c
Inhibition of p16 tumor suppressor gene expression via promoter hypermethylation in canine lymphoid tumor cells Aki Fujiwara-Igarashi, Yuko Goto-Koshino, Hiroyuki Mochizuki, Masahiko Sato, Yasuhito Fujino, Koichi Ohno, Hajime Tsujimoto* Department of Veterinary Internal Medicine, Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 1138657, Japan
A R T I C L E
I N F O
Article history: Received 12 June 2013 Accepted 19 April 2014 Keywords: Dog Hypermethylation Lymphoma p16 Tumor suppressor gene
A B S T R A C T
To investigate the epigenetic regulation of the p16 gene in canine lymphoid tumor cells, its methylation status was examined in four canine lymphoid tumor cell lines. In three canine lymphoid tumor cell lines (CLBL-1, GL-1, and UL-1) with low-level p16 mRNA expression, 20 CpG sites in the promoter region of p16 gene were consistently methylated although all of the CpG sites were not methylated in another cell line (CL-1) and normal lymph node cells. The expression level of p16 mRNA in these three cell lines was restored after cultivation in the presence of a methylation inhibitor, 5-Aza-2′-deoxycitidine, indicating inactivation of p16 gene via hypermethylation. This study revealed the inactivation of p16 gene through hypermethylation of its CpG island in a fraction of canine lymphoid tumor cells. © 2014 Published by Elsevier Ltd.
Epigenetic phenomena determine phenotypes without changes in DNA sequences, and operate at the transcriptional and posttranscriptional levels to regulate genes and protein translation. A variety of epigenetic mechanisms including DNA methylation, histone modification, and modulation by regulatory RNA have been reported (Holliday, 1987, 2006). In addition to genetic factors, external factors such as environmental exposure can alter epigenetic status, thereby affecting phenotypes across generations (Holliday, 2006; Stein, 2012). Epigenetic regulatory events, such as changes in DNA methylation and histone modification patterns or altered expression of microRNAs are associated with divergent malignancies in humans (Haluskova, 2010; Santos-Reboucas and Pimentel, 2007). In general, DNA methylation occurs at the 5′ carbon of the cytosine within cytosine–guanine sequence (CpG). Methylated CpG islands, often localized around promoter regions of genes, usually inhibit gene expression by interfering with transcription (Haluskova, 2010; Holliday, 1987). Among genes regulated via DNA methylation, cyclin dependent kinase inhibitor 2A (CDKN2A)/p16 is reported to be heavily methylated at the CpG motif, resulting in silencing of the gene in various tumors in humans (Cheung et al., 2009). p16 is a tumor suppressor gene (Gil and Peters, 2006; Russo et al., 1998) and belongs to inhibitors of the CDK4 family of cell cycle regulatory kinases. By binding to CDK4 and CDK6, P16 blocks the function of cyclin D-CDK
* Corresponding author. Tel.: +81 3 5841 5402; fax: +81 3 5841 5640. E-mail address: [email protected] (H. Tsujimoto).
complexes, thereby preventing the phosphorylation of the retinoblastoma (RB) protein and blocking the release of E2F family transcription factors. As a result, P16 leads cells to G1-phase cell cycle arrest (Gil and Peters, 2006). Complete or partial deletion of p16 has been reported in various hematopoietic tumors, meanwhile, hypermethylation of p16 has been also reported in human patients with hematopoietic malignancies (Drexler, 1998). Similarly, inactivation of p16 mediated by its deletion or DNA methylation has also been detected in canine lymphoid malignancies. In recent studies (Fosmire et al., 2007; Fujiwara-Igarashi et al., 2013), deletion of p16 (or loss of dog chromosome 11) was observed in high-grade T-cell lymphoma but not in other types of lymphomas. In the study by Fosmire et al. (2007), the amount of p16 mRNA before and after cultivation in the presence of 5-Aza-2′deoxycitidine (5-aza-dC) was unchanged except for tumor sample from a 1 T-zone lymphoma. Although involvement of DNA methylation in suppression of p16 gene was suggested, DNA methylation was not evaluated in their study. Our previous study revealed that expression of p16 gene was suppressed in the absence of deletion of p16 locus in several canine lymphoid tumor cell lines, suggesting the presence of its epigenetic regulation (Fujiwara-Igarashi et al., 2013). Methylation of DLC1 gene in dogs with lymphoma was reported (Bryan et al., 2009). This study revealed that hypermethylation of the promoter region was associated with phenotype, but not with silencing of expression or differences in survival. A recent study by Ferraresso et al. (2014) revealed the presence of DNA methylation of tissue factor pathway inhibitor-2 (TFPI-2) gene resulting in its gene silencing in canine diffuse large B-cell lymphoma.
http://dx.doi.org/10.1016/j.rvsc.2014.04.008 0034-5288/© 2014 Published by Elsevier Ltd.
Please cite this article in press as: Aki Fujiwara-Igarashi, et al., Inhibition of p16 tumor suppressor gene expression via promoter hypermethylation in canine lymphoid tumor cells, Research in Veterinary Science (2014), doi: 10.1016/j.rvsc.2014.04.008
ARTICLE IN PRESS A. Fujiwara-Igarashi et al./Research in Veterinary Science ■■ (2014) ■■–■■
2
Table 1 Primer sequences for PCR amplification. Primer name
Primer sequence (5′-3′)
GenBank no.
Nucleotide number
p16EXON1-F148 p16EXON1-R242 RPL13A-F RPL13A-R p16EXON1-F28 p16EXON1-R165
GGTCGGAGCCCGATTCA ACGGGGTCGGCACAGTT GCCGGAAGGTTGTAGTCGT GGAGGAAGGCCAGGTAATTC TTYGGGAGTAGTATGGAGTTT CTAAATCRAACTCCRACCCAAAC
AB675384
148–169 242–226 87–105 173–154 28–48 165–143
AJ388525 AB675384
M, methylated; RPL13A, ribosomal protein L13A; U, unmethylated; Y, C or T.
Accordingly, the purpose of this study was to investigate whether suppression of p16 expression was mediated by hypermethylation of the CpG island in canine B-cell and T-cell lymphoid tumor cells. We used four canine lymphoid tumor cell lines, CLBL-1 (Rutgen et al., 2010), GL-1 (Nakaichi et al., 1996), UL-1 (Yamazaki et al., 2008), and CL-1 (Momoi et al., 1997), established from dog patients with multicentric B-cell lymphoma, B-cell acute lymphoblastic leukemia (ALL), renal T-cell lymphoma, and mediastinal T-cell lymphoma, respectively. These cell lines were cultivated as previously described (Fujiwara-Igarashi et al., 2013). Lymph node (LN) cells were obtained from the 10 healthy dogs via fine needle aspiration of popliteal LN as controls. This procedure was conducted in accordance with the guidelines of Animal Care Committee of the Graduate School of Agricultural and Life Sciences, the University of Tokyo (approval number P11-530). Expression analysis of p16 mRNA in canine lymphoid tumor cells was performed by real-time reverse transcription (RT)-PCR using primers (Table 1) as previously described (Fujiwara-Igarashi et al., 2013). The amounts of p16 mRNA in CLBL-1, GL-1, and UL-1 were shown to be lower than that of normal LN cells. The p16 mRNA level in UL-1 was below the detection limit of the real-time PCR assay. The amount of p16 mRNA in CL-1 was much larger than that in normal LN cells (Fig. 1). Bisulfite sequencing method was employed to examine methylation status in the canine lymphoid tumor cell lines. Genomic DNA samples were extracted from the cell lines (QIAmp DNA Mini kit, Qiagen, Germany) and were subjected to bisulfite modification (MethylEasy™ Xceed Rapid DNA Bisulphite Modification Kit,
Human Genetic Signatures, Australia). DNA treated with sodium bisulfite results in the conversion of cytosine to uracil, which is subsequently amplified as thymine. On the contrary, methylated cytosine is not converted to uracil by bisulfite treatment, being amplified as cytosine. Although bisulfite sequencing method can detect methylation status of each CpG site, evaluation of several clones is necessary. In addition, this method did not analyze comprehensively. The CpG island of the p16 gene was determined referring to a criteria reported previously (Gardiner-Garden and Frommer, 1987). The sequence of canine p16 exon 1 was found to be highly homologous to the CpG island of the human p16 gene by Blat software (UCSC Genome Bioinformatics), and to include the putative promoter region by a promoter prediction system (Neural Network Promoter prediction, Berkeley Drosophila Genome Project). Primers for the bisulfite sequence method (Table 1) were designed within the p16 exon 1 to amplify a 94-bp DNA fragment containing 20 pairs of CpG (Fig. 2). Bisulfite-treated DNA of the cell lines were amplified by PCR (AmpliTaq gold 360, AppliedBiosystems, US). The amplified fragments were cloned into a vector (pGEM–T Easy Vector Systems, Promega, US) and the resulting plasmid DNA was extracted (NucleoSpin Plasmid QuickPure, MACHEREYNAGEL, Germany). Ten clones isolated from each cell line were subjected to sequence analysis using BigDye Terminator v3.1 Cycle Sequencing Kit and 3130xl Genetic Analyzer (AppliedBiosystems). All of the 20 CpG sites between the two primers were shown to be consistently methylated in CLBL-1, GL-1, and UL1; whereas none of the CpG sites were methylated in CL-1 and normal LN cells.
Fig. 1. Relative quantity of p16 transcripts in CLBL-1, GL-1, UL-1, and CL-1 and normal LN, and changes of the amount of p16 transcript in after cultivation in the presence of 5-aza-dC. The amount of p16 transcript was quantified in comparison to that of RPL13A as an internal standard. Error bars indicate standard deviations.
Please cite this article in press as: Aki Fujiwara-Igarashi, et al., Inhibition of p16 tumor suppressor gene expression via promoter hypermethylation in canine lymphoid tumor cells, Research in Veterinary Science (2014), doi: 10.1016/j.rvsc.2014.04.008
ARTICLE IN PRESS A. Fujiwara-Igarashi et al./Research in Veterinary Science ■■ (2014) ■■–■■
3
Fig. 2. Structure of exon 1 of canine p16 gene and the CpG sites in the region. (A) Nucleotide sequence of p16 exon 1. p16 exon 1 is 165 bp long and includes 26 CpG sites. CpG sites are underlined. Nucleotides of start codon are framed. (B) Regions of the primers for bisulfite sequence. p16 exon 1 is considered to be a part of the CpG island of canine p16 gene. Black vertical bars represent CpG sites. A gray horizontal bar indicates the region amplified by primers, p16EXON1-F28 and p16EXON1-R165, for bisulfite sequence (nt, 49-142). Arrows represent primers.
Four canine lymphoid tumor cell lines were cultivated in the presence or absence of 5-aza-dC (Sigma-Aldrich, US) for 3 days. The optimal concentrations of 5-aza-dC for each cell line were different depending on their sensitivity to the agent, and were determined in preliminary experiments. The amounts of p16 mRNA in the cell lines after treatment with 5-aza-dC were compared with those in the cell lines before its treatment using Mann–Whitney U-test. Any P-value less than 0.05 was considered to be significant. After cultivation for 3 days in the presence of 5-aza-dC, the amount of p16 mRNA significantly increased in all of the three cell lines with hypermethylation of its CpG island (CLBL-1, GL-1, and UL-1). The relative quantity of p16 transcript markedly increased by 420- and 560-fold in CLBL-1 after cultivation with 0.3 and 0.4 μM 5-aza-dC, respectively (P = 0.038, P = 0.036). The amount of p16 mRNA increased by 3300- and 14,000-fold in GL-1 after cultivation in the presence of 0.5 and 2.0 μ M 5-aza-dC, respectively (P = 0.038, P = 0.038). In UL-1, though the amount of p16 transcript was below the detection limit before the treatment with 5-aza-dC, it was detectable after cultivation in the presence of 0.25 and 0.5 μM 5-azadC (P = 0.032, P = 0.032). In contrast, no significant change of the amount of p16 mRNA was observed between untreated and 5-azadC-treated cells in CL-1, in which the CpG sites of p16 gene were not methylated (P = 0.095, P = 0.50) (Fig. 1). In veterinary medicine, methylation of DLC1 gene in dogs with lymphoma was reported (Bryan et al., 2009). This study revealed that hypermethylation of the promoter region was associated with phenotype, but not with silencing of expression or differences in survival. On the other hand, association between methylation status and expression of p16 gene was suggested in this study using lymphoma cell lines. In primary samples, various mechanisms can be involved in suppression of gene. The CpG island region covered in this study was 165 bp in length, which is shorter than the definition of a classical CpG island (greater than 200 bp) (Gardiner-Garden and Frommer, 1987). Because of the presence of a gap region in the canine genome data base (Genbank accession no. AAEX02016329.1 and AAEX02016331.1), the genomic information around the exon1 of canine p16 gene was not available. However, according to the recently registered sequence data (GenBank accession no. JN086564.1), the GC-rich region examined in this study was shown to extend to further upstream region by more than 200 bp. Therefore, the region characterized in this study is undoubtedly part of the p16 CpG island. Although enhanced analysis of the number of CpG sites was not be performed, methyla-
tion status can extend to further upstream region equally as the region examined in this study. Of the four canine lymphoid tumor cell lines used in this study, three cell lines, CLBL-1, GL-1, and UL-1, expressed low levels of p16 and also had hypermethylation at the p16 CpG island. p16 expression level markedly increased after cultivation in the presence of a methylation inhibitor, 5-aza-dC, in these three cell lines. On the other hand, the CL-1 cell line expressed high levels of p16 and a hypomethylated CpG island. The expression of p16 did not change in CL-1 upon cultivation with 5-aza-dC. These results indicate that expression of p16 was suppressed by hypermethylation of its CpG island in the three canine lymphoid tumor cell lines, CLBL-1, GL-1, and UL-1. Further, suppression of p16 gene via hypermethylation of CpG island was also detected in 20 of the 68 primary tumor cell samples from lymphoma dogs (Fujiwara-Igarashi et al., 2014). Combined the results on cell lines and primary samples, hypermethylation of CpG island could be one of the mechanisms involved in suppression of p16 gene. With respect to CL-1, hypermethylation was absent and overexpression of p16 gene was considered to be induced by some mechanisms including feedback from some of the cell cycle regulators, and regulation of non-coding RNA (Fujiwara-Igarashi et al., 2013). In human hematopoietic malignancies, methylation of the p16 CpG island was shown in 15–73% of non-Hodgkin lymphoma and 0–40% of ALL (Claus and Lubbert, 2003). Although inactivation of the p16 gene was frequently observed and implicated in tumorigenesis in human hematopoietic malignancies (Drexler, 1998), direct evidence between p16 inactivation and tumorigenesis is difficult to obtain in clinical samples. However, induction of wildtype p16 into p16-deficient human lymphoma cell lines leads to growth retardation and partial differentiation, indicating that p16 deficiency conceivably contributes to the malignant phenotype at least in part (Krug et al., 2002). Mice with targeted disruption of both p16/p19 loci developed lymphomas and lymphoid leukemias with a low penetrance, as well as other tumors (Serrano et al., 1996). Meanwhile, mice with a disruption of both alleles of p16 and an intact p19 have a moderately increased cancer susceptibility (Krimpenfort et al., 2001). Based on these findings in the in vitro and in vivo model systems, it can be considered that inactivation of p16 plays a role in tumorigenesis in canine lymphoid malignancies. In summary, we demonstrated that the inactivation of p16 occurred through hypermethylation of CpG island in the promoter in
Please cite this article in press as: Aki Fujiwara-Igarashi, et al., Inhibition of p16 tumor suppressor gene expression via promoter hypermethylation in canine lymphoid tumor cells, Research in Veterinary Science (2014), doi: 10.1016/j.rvsc.2014.04.008
ARTICLE IN PRESS A. Fujiwara-Igarashi et al./Research in Veterinary Science ■■ (2014) ■■–■■
4
three of the four canine lymphoid tumor cell lines. Methylation of the p16 CpG island might be one of the molecular mechanisms associated with tumorigenesis in canine lymphoid tumors. Acknowledgments The authors would like to acknowledge Drs. Kunio Shiota and Jun Ohgane, Laboratory of Cellular Biochemistry, Graduate School of Agricultural and Life Sciences, The University of Tokyo, for technical advice and Dr. Barbara C. Rütgen, Institute of Immunology, Department of Pathobiology, University of Veterinary Medicine Vienna, for providing cell line (CLBL-1). This study was supported by the Japan Society for the Promotion of Science, KAKENHI 24658265. References Bryan, J.N., Jabbes, M., Berent, L.M., Arthur, G.L., Taylor, K.H., Rissetto, K.C., et al., 2009. Hypermethylation of the DLC1 CpG island does not alter gene expression in canine lymphoma. BMC Genetics 10, 73. Cheung, H.H., Lee, T.L., Rennert, O.M., Chan, W.Y., 2009. DNA methylation of cancer genome. Birth Defects Research. Part C, Embryo Today: Reviews 87, 335–350. Claus, R., Lubbert, M., 2003. Epigenetic targets in hematopoietic malignancies. Oncogene 22, 6489–6496. Drexler, H.G., 1998. Review of alterations of the cyclin-dependent kinase inhibitor INK4 family genes p15, p16, p18 and p19 in human leukemia-lymphoma cells. Leukemia 12, 845–859. Ferraresso, S., Bresolin, S., Arico, A., Comazzi, S., Gelain, M.E., Riondato, F., et al., 2014. Epigenetic silencing of TFPI-2 in canine diffuse large B-cell lymphoma. PLoS ONE 9, e92707. Fosmire, S.P., Thomas, R., Jubala, C.M., Wojcieszyn, J.W., Valli, V.E., Getzy, D.M., et al., 2007. Inactivation of the p16 cyclin-dependent kinase inhibitor in high-grade canine non-Hodgkin’s T-cell lymphoma. Veterinary Pathology 44, 467–478. Fujiwara-Igarashi, A., Goto-Koshino, Y., Mochizuki, H., Maeda, S., Fujino, Y., Ohno, K., et al., 2013. Simultaneous inactivation of the p16, p15 and p14 genes encoding cyclin-dependent kinase inhibitors in canine T-lymphoid tumor cells. The Journal of Veterinary Medical Science 75, 733–742.
Fujiwara-Igarashi, A., Goto-Koshino, Y., Sato, M., Maeda, S., Igarashi, H., Takahashi, M., et al., 2014. Prognostic significance of the expression levels of the p16, p15, and p14 genes in dogs with high-grade lymphoma. The Veterinary Journal 199, 236–244. Gardiner-Garden, M., Frommer, M., 1987. CpG islands in vertebrate genomes. Journal of Molecular Biology 196, 261–282. Gil, J., Peters, G., 2006. Regulation of the INK4b-ARF-INK4a tumour suppressor locus: All for one or one for all. Nature Reviews. Molecular Cell Biology 7, 667–677. Haluskova, J., 2010. Epigenetic studies in human diseases. Folia Biologica (Praha) 56, 83–96. Holliday, R., 1987. DNA methylation and epigenetic defects in carcinogenesis. Mutation Research 181, 215–217. Holliday, R., 2006. Epigenetics: A historical overview. Epigenetics 1, 76–80. Krimpenfort, P., Quon, K.C., Mooi, W.J., Loonstra, A., Berns, A., 2001. Loss of p16Ink4a confers susceptibility to metastatic melanoma in mice. Nature 413, 83–86. Krug, U., Ganser, A., Koeffler, H.P., 2002. Tumor suppressor genes in normal and malignant hematopoiesis. Oncogene 21, 3475–3495. Momoi, Y., Okai, Y., Watari, T., Goitsuka, R., Tsujimoto, H., Hasegawa, A., 1997. Establishment and characterization of a canine T-lymphoblastoid cell line derived from malignant lymphoma. Veterinary Immunology and Immunopathology 59, 11–20. Nakaichi, M., Taura, Y., Kanki, M., Mamba, K., Momoi, Y., Tsujimoto, H., et al., 1996. Establishment and characterization of a new canine B-cell leukemia cell line. The Journal of Veterinary Medical Science 58, 469–471. Russo, A.A., Tong, L., Lee, J.O., Jeffrey, P.D., Pavletich, N.P., 1998. Structural basis for inhibition of the cyclin-dependent kinase Cdk6 by the tumour suppressor p16INK4a. Nature 395, 237–243. Rutgen, B.C., Hammer, S.E., Gerner, W., Christian, M., de Arespacochaga, A.G., Willmann, M., et al., 2010. Establishment and characterization of a novel canine B-cell line derived from a spontaneously occurring diffuse large cell lymphoma. Leukemia Research 34, 932–938. Santos-Reboucas, C.B., Pimentel, M.M., 2007. Implication of abnormal epigenetic patterns for human diseases. European Journal of Human Genetics 15, 10–17. Serrano, M., Lee, H., Chin, L., Cordon-Cardo, C., Beach, D., DePinho, R.A., 1996. Role of the INK4a locus in tumor suppression and cell mortality. Cell 85, 27–37. Stein, R.A., 2012. Epigenetics and environmental exposures. Journal of Epidemiology & Community Health 66, 8–13. Yamazaki, J., Baba, K., Goto-Koshino, Y., Setoguchi-Mukai, A., Fujino, Y., Ohno, K., et al., 2008. Quantitative assessment of minimal residual disease (MRD) in canine lymphoma by using real-time polymerase chain reaction. Veterinary Immunology and Immunopathology 126, 321–331.
Please cite this article in press as: Aki Fujiwara-Igarashi, et al., Inhibition of p16 tumor suppressor gene expression via promoter hypermethylation in canine lymphoid tumor cells, Research in Veterinary Science (2014), doi: 10.1016/j.rvsc.2014.04.008
Contents lists available at ScienceDirect
Research in Veterinary Science j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / r v s c
Inhibition of p16 tumor suppressor gene expression via promoter hypermethylation in canine lymphoid tumor cells Aki Fujiwara-Igarashi, Yuko Goto-Koshino, Hiroyuki Mochizuki, Masahiko Sato, Yasuhito Fujino, Koichi Ohno, Hajime Tsujimoto* Department of Veterinary Internal Medicine, Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 1138657, Japan
A R T I C L E
I N F O
Article history: Received 12 June 2013 Accepted 19 April 2014 Keywords: Dog Hypermethylation Lymphoma p16 Tumor suppressor gene
A B S T R A C T
To investigate the epigenetic regulation of the p16 gene in canine lymphoid tumor cells, its methylation status was examined in four canine lymphoid tumor cell lines. In three canine lymphoid tumor cell lines (CLBL-1, GL-1, and UL-1) with low-level p16 mRNA expression, 20 CpG sites in the promoter region of p16 gene were consistently methylated although all of the CpG sites were not methylated in another cell line (CL-1) and normal lymph node cells. The expression level of p16 mRNA in these three cell lines was restored after cultivation in the presence of a methylation inhibitor, 5-Aza-2′-deoxycitidine, indicating inactivation of p16 gene via hypermethylation. This study revealed the inactivation of p16 gene through hypermethylation of its CpG island in a fraction of canine lymphoid tumor cells. © 2014 Published by Elsevier Ltd.
Epigenetic phenomena determine phenotypes without changes in DNA sequences, and operate at the transcriptional and posttranscriptional levels to regulate genes and protein translation. A variety of epigenetic mechanisms including DNA methylation, histone modification, and modulation by regulatory RNA have been reported (Holliday, 1987, 2006). In addition to genetic factors, external factors such as environmental exposure can alter epigenetic status, thereby affecting phenotypes across generations (Holliday, 2006; Stein, 2012). Epigenetic regulatory events, such as changes in DNA methylation and histone modification patterns or altered expression of microRNAs are associated with divergent malignancies in humans (Haluskova, 2010; Santos-Reboucas and Pimentel, 2007). In general, DNA methylation occurs at the 5′ carbon of the cytosine within cytosine–guanine sequence (CpG). Methylated CpG islands, often localized around promoter regions of genes, usually inhibit gene expression by interfering with transcription (Haluskova, 2010; Holliday, 1987). Among genes regulated via DNA methylation, cyclin dependent kinase inhibitor 2A (CDKN2A)/p16 is reported to be heavily methylated at the CpG motif, resulting in silencing of the gene in various tumors in humans (Cheung et al., 2009). p16 is a tumor suppressor gene (Gil and Peters, 2006; Russo et al., 1998) and belongs to inhibitors of the CDK4 family of cell cycle regulatory kinases. By binding to CDK4 and CDK6, P16 blocks the function of cyclin D-CDK
* Corresponding author. Tel.: +81 3 5841 5402; fax: +81 3 5841 5640. E-mail address: [email protected] (H. Tsujimoto).
complexes, thereby preventing the phosphorylation of the retinoblastoma (RB) protein and blocking the release of E2F family transcription factors. As a result, P16 leads cells to G1-phase cell cycle arrest (Gil and Peters, 2006). Complete or partial deletion of p16 has been reported in various hematopoietic tumors, meanwhile, hypermethylation of p16 has been also reported in human patients with hematopoietic malignancies (Drexler, 1998). Similarly, inactivation of p16 mediated by its deletion or DNA methylation has also been detected in canine lymphoid malignancies. In recent studies (Fosmire et al., 2007; Fujiwara-Igarashi et al., 2013), deletion of p16 (or loss of dog chromosome 11) was observed in high-grade T-cell lymphoma but not in other types of lymphomas. In the study by Fosmire et al. (2007), the amount of p16 mRNA before and after cultivation in the presence of 5-Aza-2′deoxycitidine (5-aza-dC) was unchanged except for tumor sample from a 1 T-zone lymphoma. Although involvement of DNA methylation in suppression of p16 gene was suggested, DNA methylation was not evaluated in their study. Our previous study revealed that expression of p16 gene was suppressed in the absence of deletion of p16 locus in several canine lymphoid tumor cell lines, suggesting the presence of its epigenetic regulation (Fujiwara-Igarashi et al., 2013). Methylation of DLC1 gene in dogs with lymphoma was reported (Bryan et al., 2009). This study revealed that hypermethylation of the promoter region was associated with phenotype, but not with silencing of expression or differences in survival. A recent study by Ferraresso et al. (2014) revealed the presence of DNA methylation of tissue factor pathway inhibitor-2 (TFPI-2) gene resulting in its gene silencing in canine diffuse large B-cell lymphoma.
http://dx.doi.org/10.1016/j.rvsc.2014.04.008 0034-5288/© 2014 Published by Elsevier Ltd.
Please cite this article in press as: Aki Fujiwara-Igarashi, et al., Inhibition of p16 tumor suppressor gene expression via promoter hypermethylation in canine lymphoid tumor cells, Research in Veterinary Science (2014), doi: 10.1016/j.rvsc.2014.04.008
ARTICLE IN PRESS A. Fujiwara-Igarashi et al./Research in Veterinary Science ■■ (2014) ■■–■■
2
Table 1 Primer sequences for PCR amplification. Primer name
Primer sequence (5′-3′)
GenBank no.
Nucleotide number
p16EXON1-F148 p16EXON1-R242 RPL13A-F RPL13A-R p16EXON1-F28 p16EXON1-R165
GGTCGGAGCCCGATTCA ACGGGGTCGGCACAGTT GCCGGAAGGTTGTAGTCGT GGAGGAAGGCCAGGTAATTC TTYGGGAGTAGTATGGAGTTT CTAAATCRAACTCCRACCCAAAC
AB675384
148–169 242–226 87–105 173–154 28–48 165–143
AJ388525 AB675384
M, methylated; RPL13A, ribosomal protein L13A; U, unmethylated; Y, C or T.
Accordingly, the purpose of this study was to investigate whether suppression of p16 expression was mediated by hypermethylation of the CpG island in canine B-cell and T-cell lymphoid tumor cells. We used four canine lymphoid tumor cell lines, CLBL-1 (Rutgen et al., 2010), GL-1 (Nakaichi et al., 1996), UL-1 (Yamazaki et al., 2008), and CL-1 (Momoi et al., 1997), established from dog patients with multicentric B-cell lymphoma, B-cell acute lymphoblastic leukemia (ALL), renal T-cell lymphoma, and mediastinal T-cell lymphoma, respectively. These cell lines were cultivated as previously described (Fujiwara-Igarashi et al., 2013). Lymph node (LN) cells were obtained from the 10 healthy dogs via fine needle aspiration of popliteal LN as controls. This procedure was conducted in accordance with the guidelines of Animal Care Committee of the Graduate School of Agricultural and Life Sciences, the University of Tokyo (approval number P11-530). Expression analysis of p16 mRNA in canine lymphoid tumor cells was performed by real-time reverse transcription (RT)-PCR using primers (Table 1) as previously described (Fujiwara-Igarashi et al., 2013). The amounts of p16 mRNA in CLBL-1, GL-1, and UL-1 were shown to be lower than that of normal LN cells. The p16 mRNA level in UL-1 was below the detection limit of the real-time PCR assay. The amount of p16 mRNA in CL-1 was much larger than that in normal LN cells (Fig. 1). Bisulfite sequencing method was employed to examine methylation status in the canine lymphoid tumor cell lines. Genomic DNA samples were extracted from the cell lines (QIAmp DNA Mini kit, Qiagen, Germany) and were subjected to bisulfite modification (MethylEasy™ Xceed Rapid DNA Bisulphite Modification Kit,
Human Genetic Signatures, Australia). DNA treated with sodium bisulfite results in the conversion of cytosine to uracil, which is subsequently amplified as thymine. On the contrary, methylated cytosine is not converted to uracil by bisulfite treatment, being amplified as cytosine. Although bisulfite sequencing method can detect methylation status of each CpG site, evaluation of several clones is necessary. In addition, this method did not analyze comprehensively. The CpG island of the p16 gene was determined referring to a criteria reported previously (Gardiner-Garden and Frommer, 1987). The sequence of canine p16 exon 1 was found to be highly homologous to the CpG island of the human p16 gene by Blat software (UCSC Genome Bioinformatics), and to include the putative promoter region by a promoter prediction system (Neural Network Promoter prediction, Berkeley Drosophila Genome Project). Primers for the bisulfite sequence method (Table 1) were designed within the p16 exon 1 to amplify a 94-bp DNA fragment containing 20 pairs of CpG (Fig. 2). Bisulfite-treated DNA of the cell lines were amplified by PCR (AmpliTaq gold 360, AppliedBiosystems, US). The amplified fragments were cloned into a vector (pGEM–T Easy Vector Systems, Promega, US) and the resulting plasmid DNA was extracted (NucleoSpin Plasmid QuickPure, MACHEREYNAGEL, Germany). Ten clones isolated from each cell line were subjected to sequence analysis using BigDye Terminator v3.1 Cycle Sequencing Kit and 3130xl Genetic Analyzer (AppliedBiosystems). All of the 20 CpG sites between the two primers were shown to be consistently methylated in CLBL-1, GL-1, and UL1; whereas none of the CpG sites were methylated in CL-1 and normal LN cells.
Fig. 1. Relative quantity of p16 transcripts in CLBL-1, GL-1, UL-1, and CL-1 and normal LN, and changes of the amount of p16 transcript in after cultivation in the presence of 5-aza-dC. The amount of p16 transcript was quantified in comparison to that of RPL13A as an internal standard. Error bars indicate standard deviations.
Please cite this article in press as: Aki Fujiwara-Igarashi, et al., Inhibition of p16 tumor suppressor gene expression via promoter hypermethylation in canine lymphoid tumor cells, Research in Veterinary Science (2014), doi: 10.1016/j.rvsc.2014.04.008
ARTICLE IN PRESS A. Fujiwara-Igarashi et al./Research in Veterinary Science ■■ (2014) ■■–■■
3
Fig. 2. Structure of exon 1 of canine p16 gene and the CpG sites in the region. (A) Nucleotide sequence of p16 exon 1. p16 exon 1 is 165 bp long and includes 26 CpG sites. CpG sites are underlined. Nucleotides of start codon are framed. (B) Regions of the primers for bisulfite sequence. p16 exon 1 is considered to be a part of the CpG island of canine p16 gene. Black vertical bars represent CpG sites. A gray horizontal bar indicates the region amplified by primers, p16EXON1-F28 and p16EXON1-R165, for bisulfite sequence (nt, 49-142). Arrows represent primers.
Four canine lymphoid tumor cell lines were cultivated in the presence or absence of 5-aza-dC (Sigma-Aldrich, US) for 3 days. The optimal concentrations of 5-aza-dC for each cell line were different depending on their sensitivity to the agent, and were determined in preliminary experiments. The amounts of p16 mRNA in the cell lines after treatment with 5-aza-dC were compared with those in the cell lines before its treatment using Mann–Whitney U-test. Any P-value less than 0.05 was considered to be significant. After cultivation for 3 days in the presence of 5-aza-dC, the amount of p16 mRNA significantly increased in all of the three cell lines with hypermethylation of its CpG island (CLBL-1, GL-1, and UL-1). The relative quantity of p16 transcript markedly increased by 420- and 560-fold in CLBL-1 after cultivation with 0.3 and 0.4 μM 5-aza-dC, respectively (P = 0.038, P = 0.036). The amount of p16 mRNA increased by 3300- and 14,000-fold in GL-1 after cultivation in the presence of 0.5 and 2.0 μ M 5-aza-dC, respectively (P = 0.038, P = 0.038). In UL-1, though the amount of p16 transcript was below the detection limit before the treatment with 5-aza-dC, it was detectable after cultivation in the presence of 0.25 and 0.5 μM 5-azadC (P = 0.032, P = 0.032). In contrast, no significant change of the amount of p16 mRNA was observed between untreated and 5-azadC-treated cells in CL-1, in which the CpG sites of p16 gene were not methylated (P = 0.095, P = 0.50) (Fig. 1). In veterinary medicine, methylation of DLC1 gene in dogs with lymphoma was reported (Bryan et al., 2009). This study revealed that hypermethylation of the promoter region was associated with phenotype, but not with silencing of expression or differences in survival. On the other hand, association between methylation status and expression of p16 gene was suggested in this study using lymphoma cell lines. In primary samples, various mechanisms can be involved in suppression of gene. The CpG island region covered in this study was 165 bp in length, which is shorter than the definition of a classical CpG island (greater than 200 bp) (Gardiner-Garden and Frommer, 1987). Because of the presence of a gap region in the canine genome data base (Genbank accession no. AAEX02016329.1 and AAEX02016331.1), the genomic information around the exon1 of canine p16 gene was not available. However, according to the recently registered sequence data (GenBank accession no. JN086564.1), the GC-rich region examined in this study was shown to extend to further upstream region by more than 200 bp. Therefore, the region characterized in this study is undoubtedly part of the p16 CpG island. Although enhanced analysis of the number of CpG sites was not be performed, methyla-
tion status can extend to further upstream region equally as the region examined in this study. Of the four canine lymphoid tumor cell lines used in this study, three cell lines, CLBL-1, GL-1, and UL-1, expressed low levels of p16 and also had hypermethylation at the p16 CpG island. p16 expression level markedly increased after cultivation in the presence of a methylation inhibitor, 5-aza-dC, in these three cell lines. On the other hand, the CL-1 cell line expressed high levels of p16 and a hypomethylated CpG island. The expression of p16 did not change in CL-1 upon cultivation with 5-aza-dC. These results indicate that expression of p16 was suppressed by hypermethylation of its CpG island in the three canine lymphoid tumor cell lines, CLBL-1, GL-1, and UL-1. Further, suppression of p16 gene via hypermethylation of CpG island was also detected in 20 of the 68 primary tumor cell samples from lymphoma dogs (Fujiwara-Igarashi et al., 2014). Combined the results on cell lines and primary samples, hypermethylation of CpG island could be one of the mechanisms involved in suppression of p16 gene. With respect to CL-1, hypermethylation was absent and overexpression of p16 gene was considered to be induced by some mechanisms including feedback from some of the cell cycle regulators, and regulation of non-coding RNA (Fujiwara-Igarashi et al., 2013). In human hematopoietic malignancies, methylation of the p16 CpG island was shown in 15–73% of non-Hodgkin lymphoma and 0–40% of ALL (Claus and Lubbert, 2003). Although inactivation of the p16 gene was frequently observed and implicated in tumorigenesis in human hematopoietic malignancies (Drexler, 1998), direct evidence between p16 inactivation and tumorigenesis is difficult to obtain in clinical samples. However, induction of wildtype p16 into p16-deficient human lymphoma cell lines leads to growth retardation and partial differentiation, indicating that p16 deficiency conceivably contributes to the malignant phenotype at least in part (Krug et al., 2002). Mice with targeted disruption of both p16/p19 loci developed lymphomas and lymphoid leukemias with a low penetrance, as well as other tumors (Serrano et al., 1996). Meanwhile, mice with a disruption of both alleles of p16 and an intact p19 have a moderately increased cancer susceptibility (Krimpenfort et al., 2001). Based on these findings in the in vitro and in vivo model systems, it can be considered that inactivation of p16 plays a role in tumorigenesis in canine lymphoid malignancies. In summary, we demonstrated that the inactivation of p16 occurred through hypermethylation of CpG island in the promoter in
Please cite this article in press as: Aki Fujiwara-Igarashi, et al., Inhibition of p16 tumor suppressor gene expression via promoter hypermethylation in canine lymphoid tumor cells, Research in Veterinary Science (2014), doi: 10.1016/j.rvsc.2014.04.008
ARTICLE IN PRESS A. Fujiwara-Igarashi et al./Research in Veterinary Science ■■ (2014) ■■–■■
4
three of the four canine lymphoid tumor cell lines. Methylation of the p16 CpG island might be one of the molecular mechanisms associated with tumorigenesis in canine lymphoid tumors. Acknowledgments The authors would like to acknowledge Drs. Kunio Shiota and Jun Ohgane, Laboratory of Cellular Biochemistry, Graduate School of Agricultural and Life Sciences, The University of Tokyo, for technical advice and Dr. Barbara C. Rütgen, Institute of Immunology, Department of Pathobiology, University of Veterinary Medicine Vienna, for providing cell line (CLBL-1). This study was supported by the Japan Society for the Promotion of Science, KAKENHI 24658265. References Bryan, J.N., Jabbes, M., Berent, L.M., Arthur, G.L., Taylor, K.H., Rissetto, K.C., et al., 2009. Hypermethylation of the DLC1 CpG island does not alter gene expression in canine lymphoma. BMC Genetics 10, 73. Cheung, H.H., Lee, T.L., Rennert, O.M., Chan, W.Y., 2009. DNA methylation of cancer genome. Birth Defects Research. Part C, Embryo Today: Reviews 87, 335–350. Claus, R., Lubbert, M., 2003. Epigenetic targets in hematopoietic malignancies. Oncogene 22, 6489–6496. Drexler, H.G., 1998. Review of alterations of the cyclin-dependent kinase inhibitor INK4 family genes p15, p16, p18 and p19 in human leukemia-lymphoma cells. Leukemia 12, 845–859. Ferraresso, S., Bresolin, S., Arico, A., Comazzi, S., Gelain, M.E., Riondato, F., et al., 2014. Epigenetic silencing of TFPI-2 in canine diffuse large B-cell lymphoma. PLoS ONE 9, e92707. Fosmire, S.P., Thomas, R., Jubala, C.M., Wojcieszyn, J.W., Valli, V.E., Getzy, D.M., et al., 2007. Inactivation of the p16 cyclin-dependent kinase inhibitor in high-grade canine non-Hodgkin’s T-cell lymphoma. Veterinary Pathology 44, 467–478. Fujiwara-Igarashi, A., Goto-Koshino, Y., Mochizuki, H., Maeda, S., Fujino, Y., Ohno, K., et al., 2013. Simultaneous inactivation of the p16, p15 and p14 genes encoding cyclin-dependent kinase inhibitors in canine T-lymphoid tumor cells. The Journal of Veterinary Medical Science 75, 733–742.
Fujiwara-Igarashi, A., Goto-Koshino, Y., Sato, M., Maeda, S., Igarashi, H., Takahashi, M., et al., 2014. Prognostic significance of the expression levels of the p16, p15, and p14 genes in dogs with high-grade lymphoma. The Veterinary Journal 199, 236–244. Gardiner-Garden, M., Frommer, M., 1987. CpG islands in vertebrate genomes. Journal of Molecular Biology 196, 261–282. Gil, J., Peters, G., 2006. Regulation of the INK4b-ARF-INK4a tumour suppressor locus: All for one or one for all. Nature Reviews. Molecular Cell Biology 7, 667–677. Haluskova, J., 2010. Epigenetic studies in human diseases. Folia Biologica (Praha) 56, 83–96. Holliday, R., 1987. DNA methylation and epigenetic defects in carcinogenesis. Mutation Research 181, 215–217. Holliday, R., 2006. Epigenetics: A historical overview. Epigenetics 1, 76–80. Krimpenfort, P., Quon, K.C., Mooi, W.J., Loonstra, A., Berns, A., 2001. Loss of p16Ink4a confers susceptibility to metastatic melanoma in mice. Nature 413, 83–86. Krug, U., Ganser, A., Koeffler, H.P., 2002. Tumor suppressor genes in normal and malignant hematopoiesis. Oncogene 21, 3475–3495. Momoi, Y., Okai, Y., Watari, T., Goitsuka, R., Tsujimoto, H., Hasegawa, A., 1997. Establishment and characterization of a canine T-lymphoblastoid cell line derived from malignant lymphoma. Veterinary Immunology and Immunopathology 59, 11–20. Nakaichi, M., Taura, Y., Kanki, M., Mamba, K., Momoi, Y., Tsujimoto, H., et al., 1996. Establishment and characterization of a new canine B-cell leukemia cell line. The Journal of Veterinary Medical Science 58, 469–471. Russo, A.A., Tong, L., Lee, J.O., Jeffrey, P.D., Pavletich, N.P., 1998. Structural basis for inhibition of the cyclin-dependent kinase Cdk6 by the tumour suppressor p16INK4a. Nature 395, 237–243. Rutgen, B.C., Hammer, S.E., Gerner, W., Christian, M., de Arespacochaga, A.G., Willmann, M., et al., 2010. Establishment and characterization of a novel canine B-cell line derived from a spontaneously occurring diffuse large cell lymphoma. Leukemia Research 34, 932–938. Santos-Reboucas, C.B., Pimentel, M.M., 2007. Implication of abnormal epigenetic patterns for human diseases. European Journal of Human Genetics 15, 10–17. Serrano, M., Lee, H., Chin, L., Cordon-Cardo, C., Beach, D., DePinho, R.A., 1996. Role of the INK4a locus in tumor suppression and cell mortality. Cell 85, 27–37. Stein, R.A., 2012. Epigenetics and environmental exposures. Journal of Epidemiology & Community Health 66, 8–13. Yamazaki, J., Baba, K., Goto-Koshino, Y., Setoguchi-Mukai, A., Fujino, Y., Ohno, K., et al., 2008. Quantitative assessment of minimal residual disease (MRD) in canine lymphoma by using real-time polymerase chain reaction. Veterinary Immunology and Immunopathology 126, 321–331.
Please cite this article in press as: Aki Fujiwara-Igarashi, et al., Inhibition of p16 tumor suppressor gene expression via promoter hypermethylation in canine lymphoid tumor cells, Research in Veterinary Science (2014), doi: 10.1016/j.rvsc.2014.04.008