- Email: [email protected]
Inhibition of the CD40 Pathway of Monocyte Activation by Triazolopyrimidine
Clinical Immunology Vol. 93, No. 3, December, pp. 232–238, 1999 Article ID clim.1999.4796, available online at http://www.idealibrary.com on
Inhibition of the CD40 Pathway of Monocyte Activation by Triazolopyrimidine Ling Zhou,* Jamila Ismaili,* Patrick Stordeur,* Kris Thielemans,† Michel Goldman,* and Olivier Pradier* *Laboratories of Hematology and Immunology–Transfusion, Universite´ Libre de Bruxelles, B-1070 Brussels, Belgium; and †Laboratory of Experimental Physiology, Vrije Universiteit Brussel, Brussels, Belgium
Blockade of the CD40/CD40L pathway of monocyte/ macrophage activation represents a promising strategy for the treatment of several inflammatory disorders. So far, most pharmacological agents developed for that purpose target CD40L (CD154) expressed on activated T cells. Herein, we provide evidence that triazolopyrimidine, a chemical compound primarily developed for the prevention of arterial thrombosis, strongly inhibits the response of human monocytes to CD40 ligation. First, we found that triazolopyrimidine inhibits the production of IL-12, TNF-a, and IL-6 by monocytes activated by coculture with fibroblasts transfected with the CD40L gene as well as the induction of procoagulant activity at their membrane. This was related to a decreased expression of CD40 on monocytes exposed to triazolopyrimidine, an effect that was already apparent at the mRNA level. Furthermore, the addition of triazolopyrimidine to monocytes cultured with IL-4 and GM-CSF prevented their differentiation into fully competent dendritic cells (DC) as DC differentiated in the presence of triazolopyrimidine expressed less CD40 at their surface and were profoundly deficient in the production of IL-12 upon exposure to CD40L transfectants. We conclude that triazolopyrimidine strongly inhibits the CD40 pathway of monocyte activation at least in part by downregulating the gene expression of CD40. © 1999 Academic Press
Key Words: CD40; monocyte; triazolopyrimidine; dendritic cell; IL-12. 1. INTRODUCTION
CD40 is a glycoprotein of the TNF receptor family which is expressed on several cell types including monocytes and dendritic cells. The engagement of CD40 on these antigen-presenting cells induces activation signals resulting in the synthesis of inflammatory cytokines such as TNF-a and IL-12 and the upregulation of MHC class II and costimulatory molecules including CD80 (B7-1) and CD86 (B7-2) (1, 2). Moreover, CD40 ligation on monocytes induces the expression of tissue factor which is the unique initiator of the coag1521-6616/99 $30.00 Copyright © 1999 by Academic Press All rights of reproduction in any form reserved.
ulation cascade (3). Indeed, the CD40/CD40L pathway was shown to be involved in the pathology of several inflammatory disorders of immune origin, including multiple sclerosis, rheumatoid arthritis, and allograft rejection (4 – 6). Major efforts are therefore made to design biologicals and chemicals able to block this pathway in vivo. Along this line, antibodies against CD154 were found to be efficient in preventing experimental autoimmune encephalomyelitis (7), collageninduced arthritis (8), and graft rejection (9) as well as in a model of atherosclerosis (10). While other agents are being developed to block CD40L on activated T cells, less attention was paid so far to the possibility of interfering with the CD40/CD40L pathway at the monocyte level. In the course of experiments designed to determine the effects on monocytes of triazolopyrimidine, a putative anti-thrombotic drug (11), we found that this compound strongly inhibited the production of inflammatory mediators by human monocytes upon CD40 engagement. This observation led us to determine the effects of triazolopyrimidine on the monocyte expression of CD40 as well as its influence on the differentiation of monocytes into dendritic cells (DC). 2. MATERIALS AND METHODS
2.1. Medium and Reagents Culture medium consisted in RPMI 1640 supplemented with 10% FBS (BioWhittaker Europe, Verviers, Belgium), 20 mM gentamicin, 50 mM 2-ME, and 1% nonessential amino acid (Myoclone, Life Technologies). Recombinant human IFN-g and IL-4 were purchased from Genzyme (Cambridge, MA) and recombinant GM-CSF was obtained from Schering-Plough (Brussels, Belgium). LPS (O127:B4) was from Sigma Chemical (St. Louis, MO). Triazolopyrimidine was a gift from UCB (Brussels, Belgium) and the powder was dissolved in DMSO and further diluted in RPMI. DMSO solution (0.1%) was used in all the experiments as control.
232
TRIAZOLOPYRIMIDINE INHIBITS CD40-MEDIATED MONOCYTE ACTIVATION
2.2. Monocytes and DC Preparations Peripheral blood mononuclear cells (PBMC) were isolated from healthy donors as previously described (3). For purification of monocytes, PBMC were incubated during 1 h at 4°C under continuous rocking agitation. Monocytes were then sedimentated by a short centrifugation at 100 g. The pellet was resuspended in culture medium and then subjected to a new cycle of clumping. The purity of the monocytes (about 80%) was evaluated under a microscope after May– Grunwald–Giemsa staining. Dendritic cells were generated from PBMC as described by Romani et al. (12). Briefly, PBMC were resuspended in culture medium and allowed to adhere in culture flasks. After 2 h at 37°C, nonadherent cells were removed and adherent cells were cultured in medium containing IL-4 (500 U/ml) and GM-CSF (800 U/ml) for 6 days. DC were generated in the presence of 100 mM triazolopyrimidine or 0.1% DMSO added at day 0 of the culture. 2.3. Monocytes and DC Stimulation Monocytes (5 3 10 5/ml) were stimulated during 24 h with LPS (10 ng/ml) or IFN-g (1 ng/ml). CD40 ligation was performed using 3T6 fibroblasts transfected with CD40L cDNA (3T6-CD40L) or untransfected control fibroblasts (3T6) at 5 3 10 4/ml for 72 h. All of the cultures were performed in the presence of DMSO or graded concentrations of triazolopyrimidine (10 to 100 mM). Monocyte-derived DC (5 3 10 5/ml), generated in presence of 100 mM of triazolopyrimidine or 0.1% DMSO, were stimulated with 10 5/ml of 3T6 or 3T6CD40L fibroblasts for 72 h without any further addition of triazolopyrimidine. For bidirectional mixed leukocyte reactions (MLR), 2 3 10 6/ml PBMC from two unrelated donors was mixed in the presence of DMSO-containing medium or graded concentrations of triazolopyrimidine for 18 h. 2.4. Cytokine Assays The supernatants derived from monocytes or DC stimulated by LPS or CD40L ligation were collected, centrifuged to remove any particles, and then immediately frozen at 270°C. The quantity of soluble TNF-a, IL-12 (p40), and IL-6 was then measured using specific ELISA kits (BioSource, Europe, SA) according to the manufacturer’s instructions. 2.5. Procoagulant Activity Measurement After 18 h of culture in the presence of a graded concentration of triazolopyrimidine, samples from
233
monocytes stimulated with 3T6, 3T6-CD40L fibroblasts, or LPS and MLR were immediately frozen at 270°C. After two cycles of freezing and thawing, the procoagulant activity (PCA) was measured and interpolated into mU/ml by reference to a standard curve, as previously described (3). 2.6. Flow Cytometry Analysis Monocytes (basal or IFN-g stimulated) or DC were stained for 30 min at 4°C either with anti-CD14 IgG2b mAb (Becton–Dickinson, Mountain View, CA; FITC or PE conjugated) or with anti-CD40 IgG1-FITC (Biosource), anti-CD86 IgG2b-PE (PharMingen, San Diego, CA), anti-HLA-DR IgG2a-PE (Becton–Dickinson), or their corresponding isotypes as controls. After two washes with phosphate buffered saline (PBS), cells were resuspended in PBS containing 5 mg/ml 7-aminoactinomycin D (7-AAD) (Molecular Probes Inc., Eugene, OR) to ascertain viability. Flow cytometric analysis was performed using a FACScan cytometer (Becton–Dickinson). The viable 7-AAD-negative monocytes (CD14 1) or DC (CD14 2) were gated according to forward and side scatter and CD14 expression. 2.7. PCR Analysis of CD40 mRNA Expression Monocytes (5 3 10 6) were preincubated with 100 mM triazolopyrimidine or 0.1% DMSO and then stimulated or not with 1 ng/ml IFN-g. The cultures were stopped at 4 h. Total cellular RNA was extracted by the TriPure Isolation reagent (Boeringher Manheim). After reverse transcription, PCR for CD40 cDNA and b-actin was performed using 28 cycles (94°C for 20 s, 55°C for 20 s, and 72°C for 30 s). The sequences of the primers used for CD40 (synthesized by Gibco, Life Technologies) were sense primer: 59 GTCCATCCAGAACCACCCAC 39, and antisense primer: 39 GGTCAGCCGAAGAAGAGGTT 59. 3. RESULTS AND DISCUSSION
3.1. The Responses of Human Monocytes to CD40 Ligation and LPS Are Differentially Regulated by Triazolopyrimidine As shown in Fig. 1, triazolopyrimidine inhibited in a dose-dependent manner the secretion of IL-6 by human monocytes stimulated by coculture with 3T6 fibroblasts transfected with the CD40L gene (3T6-CD40L) whereas it did not affect IL-6 synthesis in response to LPS. In the absence of triazolopyrimidine, IL-6 levels secreted by monocytes were below 0.01 ng/ml in medium alone or in coculture with control-untransfected fibroblasts and reached 3.37 and 1.5 ng/ml after incubation with LPS (10 ng/ml) and 3T6-CD40L fibroblasts,
234
ZHOU ET AL.
FIG. 1. Triazolopyrimidine differentially regulates monocytes cytokines release and PCA induced by 3T6-CD40L fibroblasts or LPS. Monocytes (5 3 10 5/ml) were cocultured with 3T6, 3T6-CD40L fibroblasts (5 3 10 4/ml), or LPS (10 ng/ml) in the presence or absence of graded doses of triazolopyrimidine (10 –100 mM). Cytokines and PCA levels were presented as percentages of those observed with 3T6-CD40L fibroblasts (}) or LPS (■) without triazolopyrimidine. Data are shown as mean 6 SD of five independent experiments.
respectively (mean of five experiments). Likewise, the induction of IL-12 (p40) synthesis and of PCA was inhibited by triazolopyrimidine in response to CD40 engagement but not LPS stimulation (Fig. 1). IL-12 (p40) levels in the absence of triazolopyrimidine reached 1.4 and 1.3 ng/ml after stimulation with LPS and 3T6-CD40L fibroblasts, respectively (mean of five experiments) whereas basal levels in the absence of stimulation were below 0.003 ng/ml. PCA was absent in basal conditions and reached 10.56 and 3.76 mU/ml after stimulation with LPS and 3T6-CD40L fibroblasts, respectively (mean of five experiments). A maximal inhibition of 90% or more was achieved at doses of 80 –100 mM, while around 50% inhibition was obtained for triazolopyrimidine concentrations of 10 to 20 mM which correspond to plasma concentrations measured in clinical trials (13). TNF-a production was inhibited by triazolopyrimidine in both systems of activation although the effect of the drug was more pronounced when monocytes were stimulated by coculture with 3T6-CD40L fibroblasts.
Taken together, these data indicate that triazolopyrimidine is a potent inhibitor of the CD40 pathway of monocyte activation whereas the LPS activation pathway is resistant to the action of the drug except for the induction of TNF-a synthesis, suggesting that triazolopyrimidine might act at different levels in human monocytes. 3.2. Triazolopyrimidine Downregulates the Expression of CD40 and HLA-DR at the Membrane of Human Monocytes In view of the preferential inhibition by triazolopyrimidine of the CD40-mediated activation pathway, we analyzed by flow cytometry the effect of the drug on the expression of CD40 at the monocyte membrane, both at the basal state after monocyte isolation and upon activation with rIFN-g, which is known to upregulate CD40 expression on monocytes (2). As shown in Fig. 2 and Table 1, triazolopyrimidine inhibited in a dosedependent manner CD40 expression both at the basal
TRIAZOLOPYRIMIDINE INHIBITS CD40-MEDIATED MONOCYTE ACTIVATION
235
FIG. 2. Expression of CD40 and HLA-DR on monocytes is inhibited by triazolopyrimidine at the basal state or after IFN-g stimulation. CD40 and HLA-DR expressed both at the basal state and subsequent to IFN-g stimulation in the presence of DMSO (dotted lines) or triazolopyrimidine (100 mM) (continuous lines) were analyzed by flow cytometry. One of five representative experiments is shown.
236
ZHOU ET AL.
TABLE 1 Triazolopyrimidine Inhibits CD40 and HLA-DR Expression on Human Monocytes at Basal State or after IFN-g Stimulation a CD40%
HLA-DR %
CD14 %
CD86 %
TP (mM) b
Basal
IFN-g
Basal
IFN-g
Basal
IFN-g
Basal
IFN-g
10 20 60 100
71.99 46.53 23.14 8.7
86.71 71.07 32.73 17.91
80.83 58.64 14.36 4.15
87.81 74.22 44.75 37.49
97.99 98.34 99.15 98.52
102.98 102.31 105.56 103.48
110.76 118.74 119.53 123.76
112.14 116.73 118.56 125.33
Monocytes were stimulated or not with IFN-g (1 ng/ml) for 24 h in presence of graded doses of triazolopyrimidine and thereafter stained with the relevant mAbs or isotype-matched controls. Data represent mean percentages of median fluorescence intensity (MFI) in three independent experiments; MFI obtained in absence of triazolopyrimidine were used as percentage references (100%). b TP indicates triazolopyrimidine. a
state and upon incubation with rIFN-g. The drug concentrations which were active on this parameter were in the same range as those inhibiting cytokine production and PCA. This effect on CD40 expression was not related to nonspecific toxicity since cell viability remained above 90% as evidenced by 7-AAD staining, even at the highest triazolopyrimidine concentration (not shown). The expression of CD14 and CD86 was not significantly affected by triazolopyrimidine, whereas HLA-DR expression was also inhibited in a dose-dependent manner (Fig. 2, Table 1). 3.3. Triazolopyrimidine Inhibits CD40 mRNA Expression in Human Monocytes The downregulation of CD40 membrane expression by triazolopyrimidine led us to analyze the effect of the drug on the expression of CD40 mRNA in human monocytes, both at the basal state after isolation and upon incubation with rIFN-g. As shown in Fig. 3, triazolopyrimidine clearly inhibited CD40 mRNA accumulation under both conditions, indicating that triazolopyrimidine interferes with CD40 gene expression in human monocytes.
HLA-DR, CD80, and CD86 was not significantly modified by the addition of triazolopyrimidine (not shown). In parallel, we found that DC differentiated in presence of triazolopyrimidine displayed impaired response to CD40 ligation as assessed by IL-12 (p40) production upon coculture with 3T6-CD40L fibroblasts (Table 2). 3.5. Triazolopyrimidine Inhibits the Induction of Monocyte Procoagulant Activity during a Mixed Leukocyte Reaction We previously showed that membrane contacts involving CD40/CD40L interactions are required for the optimal induction of monocyte PCA by T cells (3). For this reason, we studied the effect of triazolopyrimidine on the induction of monocyte PCA during MLR. In the experiment depicted in Fig. 5, the PCA measured after 18 h of MLR reached 4.3 mU/ml, whereas it was below
3.4. DC Differentiated from Monocytes in the Presence of Triazolopyrimidine Express Decreased Levels of CD40 and Display Impaired Responses to CD40 Engagement When monocytes are cultured for 6 days in the presence of IL-4 and GM-CSF, they lose CD14 expression and differentiate into dendritic cells, which express high levels of CD40 on their membrane (14). We found that the addition of triazolopyrimidine during the 6 days of culture with IL-4 and GM-CSF did not prevent the loss of membrane CD14 but resulted in a decreased expression of CD40 at the DC membrane (Fig. 4). The expression of other surface molecules including
FIG. 3. RT-PCR analysis of monocyte CD40 mRNA. Monocytes were cultured for 4 h with or without 1 ng/ml IFN-g in the presence of triazolopyrimidine (100 mM) or 0.1% DMSO. cDNA prepared in both conditions was used for CD40 or b-actin amplification by RTPCR. TP indicates triazolopyrimidine. One of five representative experiments is shown.
TRIAZOLOPYRIMIDINE INHIBITS CD40-MEDIATED MONOCYTE ACTIVATION
237
FIG. 4. Triazolopyrimidine decreases CD40 expression on monocyte-derived DC generated in the presence of IL-4 and GM-CSF. DC generated in the presence of DMSO (dotted line) or triazolopyrimidine (100 mM) (continuous line) were analyzed by flow cytometry for CD14 and CD40 expression. One of five representative experiments is shown.
0.6 mU/ml in the absence of allogeneic stimulation. As shown, triazolopyrimidine suppressed in a dose-dependent manner the induction of PCA in MLR, a maximal inhibition of 85% being obtained at a concentration of 100 mM (Fig. 5). These data indicate that triazolopyrimidine inhibits T-cell-dependent monocyte activation. We suggest that this action of the drug is at least in part related to inhibition of monocyte CD40 expression. The mechanism through which triazolopyrimidine inhibits CD40 expression remains to be clarified. Interestingly, some studies suggested that triazolopyrimidine induces intracellular cAMP elevation and activation of protein kinase A (15, 16). As we found that other cAMP elevating agents such as PGE2 and pentoxifylline also inhibit CD40 expression on monocytes, it might well be that cAMP mediates triazolopyrimidine action. Indeed, CD40 gene expression was recently shown to involve the NF-kB and STAT-1 transcription factors (17), and cAMP elevating agents were previously shown to prevent NF-kB translocation (18).
4. CONCLUDING REMARKS
So far, triazolopyrimidine was developed as a therapeutic agent for coronary disease or to prevent restenosis after percutaneous transluminal coronary angioplasty (19, 20). Its mode of action is unclear although it was shown to antagonize platelet-derived growth factor activity on smooth muscle cells and to inhibit platelet aggregation (21, 22). In the present paper, we show that triazolopyrimidine is a potent inhibitor of the CD40 pathway of monocyte activation, acting at least
TABLE 2 DC Generated in the Presence of Triazolopyrimidine Displayed Impaired IL-12 Production in Response to CD40 Ligation a IL-12 (ng/ml) TP b
Medium
3T6
3T6-CD40L
2 1
0.25 6 0.12 0.31 6 0.15
0.26 6 0.11 0.27 6 0.16
60.37 6 12.34 0.70 6 0.21*
a Monocyte-derived DC (5 3 10 5/ml) generated in the presence of triazolopyrimidine (100 mM) or DMSO (0.1%) were cocultured with (10 5/ml) 3T6 or 3T6-CD40L fibroblasts for 72 h. IL-12 production subsequent to CD40L stimulation was measured by ELISA. Data represent mean 6 SD in three independent experiments. b TP indicates triazolopyrimidine. * P , 0.001 by paired Student’s t test.
FIG. 5. Triazolopyrimidine inhibits the induction of monocyte PCA during MLR. PBMC (2 3 10 6/ml) from two unrelated donors were mixed in the presence or absence of graded doses of triazolopyrimidine (10 –100 mM) for 18 h. PCA levels are expressed as percentages of PCA measured in the absence of triazolopyrimidine. One of two representative experiments is shown.
238
ZHOU ET AL.
in part by downregulating CD40 mRNA expression in this cell type. This property of triazolopyrimidine might be relevant to its therapeutic use in atheromatous disease since monocytes and CD40/CD40L interactions were shown to be involved in the formation of atherosclerotic plaques (6). Moreover, it suggests new applications of this drug in inflammatory disorders of immune origin such as rheumatoid arthritis or multiple sclerosis. REFERENCES 1. Cella, M., Scheidegger, D., Palmer-Lehmann, K., Lane, P., Lanzavecchia, A., and Alber, G., Ligation of CD40 on dendritic cells triggers production of high levels of interleukin-12 and enhances T cell stimulatory capacity: T–T help via APC activation. J. Exp. Med. 184, 747–752, 1996. 2. Kiener, P. A., Moran-Davis, P., Rankin, B. M., Wahl, A. F., Aruffo, A., and Hollenbaugh, D., Stimulation of CD40 with purified soluble gp39 induces proinflammatory responses in human monocytes. J. Immunol. 155, 4917– 4925, 1995. 3. Pradier, O., Willems, F., Abramowicz, D., Schandene, L., De Boer, M., Thielemans, K., Capel, P., and Goldman, M., CD40 engagement induces monocyte procoagulant activity through an interleukin-10 resistant pathway. Eur. J. Immunol. 26, 3048 – 3054, 1996. 4. Denton, M. D., Reul, R. M., Dharnidharka, V. R., Fang, J. C., Ganz, P., and Briscoe, D. M., Central role for CD40/CD40 ligand (CD154) interactions in transplant rejection. Pediatr. Transplant. 2, 6 –15, 1998. 5. Noelle, R. J., Mackey, M., Foy, T., Buhlmann, J., and Burns, C., CD40 and its ligand in autoimmunity. Ann. N. Y. Acad. Sci. 815, 384 –391, 1997. 6. Laman, J. D., de Smet, B. J., Schoneveld, A., and van Meurs, M., CD40 –CD40L interactions in atherosclerosis. Immunol. Today 18, 272–277, 1997. 7. Laman, J. D., Maassen, C. B., Schellekens, M. M., Visser, L., Kap, M., de Jong, E., van Puijenbroek, M., van Stipdonk, M. J., van Meurs, M., Schwarzler, C., and Gunthert, U., Therapy with antibodies against CD40L (CD154) and CD44-variant isoforms reduces experimental autoimmune encephalomyelitis induced by a proteolipid protein peptide. Mult. Scler. 4, 147–153, 1998. 8. Durie, F. H., Fava, R. A., Foy, T. M., Aruffo, A., Ledbetter, J. A., and Noelle, R. J., Prevention of collagen-induced arthritis with an antibody to gp39, the ligand for CD40. Science 261, 1328 – 1330, 1993. 9. Kirk, A. D., Harlan, D. M., Armstrong, N. N., Davis, T. A., Dong, Y., Gray, G. S., Hong, X., Thomas, D., Fechner, J. H. J., and Knechtle, S. J., CTLA4-Ig and anti-CD40 ligand prevent renal allograft rejection in primates. Proc. Natl. Acad. Sci. USA 94, 8789 – 8794, 1997. 10. Mach, F., Schonbeck, U., Sukhova, G. K., Atkinson, E., and Libby, P., Reduction of atherosclerosis in mice by inhibition of CD40 signalling. Nature 394, 200 –203, 1998. Received July 14, 1999; accepted with revision September 20, 1999
11. Suzuki, Y., Yamaguchi, K., Shimada, S., Kitamura, Y., and Ohnishi, H., Antithrombotic activity and the mechanism of action of trapidil (Rocornal). Prostaglandins Leukot. Med. 9, 685– 695, 1982. 12. Romani, N., Gruner, S., Brang, D., Kampgen, E., Lenz, A., Trockenbacher, B., Konwalinka, G., Fritsch, P. O., Steinman, R. M., and Schuler, G., Proliferating dendritic cell progenitors in human blood. J. Exp. Med. 180, 83–93, 1994. 13. Nieder, J., Claus, P., and Augustin, W., Effects of trapidil on the PGI2 and TXA2 synthesis in human umbilical veins perfused in vitro. Prostaglandins 49, 311–318, 1995. 14. Pickl, W. F., Majdic, O., Kohl, P., Stockl, J., Riedl, E., Scheinecker, C., Bello-Fernandez, C., and Knapp, W., Molecular and functional characteristics of dendritic cells generated from highly purified CD14 1 peripheral blood monocytes. J. Immunol. 157, 3850 –3859, 1996. 15. Bartel, S., Tenor, H., and Krause, E. G., Trapidil derivatives as potent inhibitors of cyclic AMP phosphodiesterase from heart and coronary arteries. Biomed. Biochim. Acta. 44, K31–K35, 1985. 16. Bonisch, D., Weber, A. A., Wittpoth, M., Osinski, M., and Schror, K., Antimitogenic effects of trapidil in coronary artery smooth muscle cells by direct activation of protein kinase A. Mol. Pharmacol. 54, 241–248, 1998. 17. Krzesz, R., Wagner, A. H., Cattaruzza, M., and Hecker, M., Cytokine-inducible CD40 gene expression in vascular smooth muscle cells is mediated by nuclear factor kappaB and signal transducer and activation of transcription-1. FEBS Lett. 453, 191–196, 1999. 18. Parry, G. C., and Mackman, N., Role of cyclic AMP response element-binding protein in cyclic AMP inhibition of NF-kappaB-mediated transcription. J. Immunol. 159, 5450 –5456, 1997. 19. Liu, M. W., Roubin, G. S., Robinson, K. A., Black, A. J., Hearn, J. A., Siegel, R. J., and King, S. B., Trapidil in preventing restenosis after balloon angioplasty in the atherosclerotic rabbit. Circulation 81, 1089 –1093, 1990. 20. Maresta, A., Balducelli, M., Cantini, L., Casari, A., Chioin, R., Fabbri, M., Fontanelli, A., Monici, P. P., Repetto, S., and De Servi, S., Trapidil (triazolopyrimidine), a platelet-derived growth factor antagonist, reduces restenosis after percutaneous transluminal coronary angioplasty. Results of the randomized, double-blind STARC study. Studio Trapidil versus Aspirin nella Restenosi Coronarica. Circulation 90, 2710 – 2715, 1994. 21. Mazurov, A. V., Menshikov, M. Y., Leytin, V. L., Tkachuk, V. A., and Repin, V. S., Decrease of platelet aggregation and spreading via inhibition of the cAMP phosphodiesterase by trapidil. FEBS Lett. 172, 167–171, 1984. 22. Ohnishi, H., Yamaguchi, K., Shimada, S., Suzuki, Y., and Kumagai, A., A new approach to the treatment of atherosclerosis and trapidil as an antagonist to platelet-derived growth factor. Life Sci. 28, 1641–1646, 1981.
Inhibition of the CD40 Pathway of Monocyte Activation by Triazolopyrimidine Ling Zhou,* Jamila Ismaili,* Patrick Stordeur,* Kris Thielemans,† Michel Goldman,* and Olivier Pradier* *Laboratories of Hematology and Immunology–Transfusion, Universite´ Libre de Bruxelles, B-1070 Brussels, Belgium; and †Laboratory of Experimental Physiology, Vrije Universiteit Brussel, Brussels, Belgium
Blockade of the CD40/CD40L pathway of monocyte/ macrophage activation represents a promising strategy for the treatment of several inflammatory disorders. So far, most pharmacological agents developed for that purpose target CD40L (CD154) expressed on activated T cells. Herein, we provide evidence that triazolopyrimidine, a chemical compound primarily developed for the prevention of arterial thrombosis, strongly inhibits the response of human monocytes to CD40 ligation. First, we found that triazolopyrimidine inhibits the production of IL-12, TNF-a, and IL-6 by monocytes activated by coculture with fibroblasts transfected with the CD40L gene as well as the induction of procoagulant activity at their membrane. This was related to a decreased expression of CD40 on monocytes exposed to triazolopyrimidine, an effect that was already apparent at the mRNA level. Furthermore, the addition of triazolopyrimidine to monocytes cultured with IL-4 and GM-CSF prevented their differentiation into fully competent dendritic cells (DC) as DC differentiated in the presence of triazolopyrimidine expressed less CD40 at their surface and were profoundly deficient in the production of IL-12 upon exposure to CD40L transfectants. We conclude that triazolopyrimidine strongly inhibits the CD40 pathway of monocyte activation at least in part by downregulating the gene expression of CD40. © 1999 Academic Press
Key Words: CD40; monocyte; triazolopyrimidine; dendritic cell; IL-12. 1. INTRODUCTION
CD40 is a glycoprotein of the TNF receptor family which is expressed on several cell types including monocytes and dendritic cells. The engagement of CD40 on these antigen-presenting cells induces activation signals resulting in the synthesis of inflammatory cytokines such as TNF-a and IL-12 and the upregulation of MHC class II and costimulatory molecules including CD80 (B7-1) and CD86 (B7-2) (1, 2). Moreover, CD40 ligation on monocytes induces the expression of tissue factor which is the unique initiator of the coag1521-6616/99 $30.00 Copyright © 1999 by Academic Press All rights of reproduction in any form reserved.
ulation cascade (3). Indeed, the CD40/CD40L pathway was shown to be involved in the pathology of several inflammatory disorders of immune origin, including multiple sclerosis, rheumatoid arthritis, and allograft rejection (4 – 6). Major efforts are therefore made to design biologicals and chemicals able to block this pathway in vivo. Along this line, antibodies against CD154 were found to be efficient in preventing experimental autoimmune encephalomyelitis (7), collageninduced arthritis (8), and graft rejection (9) as well as in a model of atherosclerosis (10). While other agents are being developed to block CD40L on activated T cells, less attention was paid so far to the possibility of interfering with the CD40/CD40L pathway at the monocyte level. In the course of experiments designed to determine the effects on monocytes of triazolopyrimidine, a putative anti-thrombotic drug (11), we found that this compound strongly inhibited the production of inflammatory mediators by human monocytes upon CD40 engagement. This observation led us to determine the effects of triazolopyrimidine on the monocyte expression of CD40 as well as its influence on the differentiation of monocytes into dendritic cells (DC). 2. MATERIALS AND METHODS
2.1. Medium and Reagents Culture medium consisted in RPMI 1640 supplemented with 10% FBS (BioWhittaker Europe, Verviers, Belgium), 20 mM gentamicin, 50 mM 2-ME, and 1% nonessential amino acid (Myoclone, Life Technologies). Recombinant human IFN-g and IL-4 were purchased from Genzyme (Cambridge, MA) and recombinant GM-CSF was obtained from Schering-Plough (Brussels, Belgium). LPS (O127:B4) was from Sigma Chemical (St. Louis, MO). Triazolopyrimidine was a gift from UCB (Brussels, Belgium) and the powder was dissolved in DMSO and further diluted in RPMI. DMSO solution (0.1%) was used in all the experiments as control.
232
TRIAZOLOPYRIMIDINE INHIBITS CD40-MEDIATED MONOCYTE ACTIVATION
2.2. Monocytes and DC Preparations Peripheral blood mononuclear cells (PBMC) were isolated from healthy donors as previously described (3). For purification of monocytes, PBMC were incubated during 1 h at 4°C under continuous rocking agitation. Monocytes were then sedimentated by a short centrifugation at 100 g. The pellet was resuspended in culture medium and then subjected to a new cycle of clumping. The purity of the monocytes (about 80%) was evaluated under a microscope after May– Grunwald–Giemsa staining. Dendritic cells were generated from PBMC as described by Romani et al. (12). Briefly, PBMC were resuspended in culture medium and allowed to adhere in culture flasks. After 2 h at 37°C, nonadherent cells were removed and adherent cells were cultured in medium containing IL-4 (500 U/ml) and GM-CSF (800 U/ml) for 6 days. DC were generated in the presence of 100 mM triazolopyrimidine or 0.1% DMSO added at day 0 of the culture. 2.3. Monocytes and DC Stimulation Monocytes (5 3 10 5/ml) were stimulated during 24 h with LPS (10 ng/ml) or IFN-g (1 ng/ml). CD40 ligation was performed using 3T6 fibroblasts transfected with CD40L cDNA (3T6-CD40L) or untransfected control fibroblasts (3T6) at 5 3 10 4/ml for 72 h. All of the cultures were performed in the presence of DMSO or graded concentrations of triazolopyrimidine (10 to 100 mM). Monocyte-derived DC (5 3 10 5/ml), generated in presence of 100 mM of triazolopyrimidine or 0.1% DMSO, were stimulated with 10 5/ml of 3T6 or 3T6CD40L fibroblasts for 72 h without any further addition of triazolopyrimidine. For bidirectional mixed leukocyte reactions (MLR), 2 3 10 6/ml PBMC from two unrelated donors was mixed in the presence of DMSO-containing medium or graded concentrations of triazolopyrimidine for 18 h. 2.4. Cytokine Assays The supernatants derived from monocytes or DC stimulated by LPS or CD40L ligation were collected, centrifuged to remove any particles, and then immediately frozen at 270°C. The quantity of soluble TNF-a, IL-12 (p40), and IL-6 was then measured using specific ELISA kits (BioSource, Europe, SA) according to the manufacturer’s instructions. 2.5. Procoagulant Activity Measurement After 18 h of culture in the presence of a graded concentration of triazolopyrimidine, samples from
233
monocytes stimulated with 3T6, 3T6-CD40L fibroblasts, or LPS and MLR were immediately frozen at 270°C. After two cycles of freezing and thawing, the procoagulant activity (PCA) was measured and interpolated into mU/ml by reference to a standard curve, as previously described (3). 2.6. Flow Cytometry Analysis Monocytes (basal or IFN-g stimulated) or DC were stained for 30 min at 4°C either with anti-CD14 IgG2b mAb (Becton–Dickinson, Mountain View, CA; FITC or PE conjugated) or with anti-CD40 IgG1-FITC (Biosource), anti-CD86 IgG2b-PE (PharMingen, San Diego, CA), anti-HLA-DR IgG2a-PE (Becton–Dickinson), or their corresponding isotypes as controls. After two washes with phosphate buffered saline (PBS), cells were resuspended in PBS containing 5 mg/ml 7-aminoactinomycin D (7-AAD) (Molecular Probes Inc., Eugene, OR) to ascertain viability. Flow cytometric analysis was performed using a FACScan cytometer (Becton–Dickinson). The viable 7-AAD-negative monocytes (CD14 1) or DC (CD14 2) were gated according to forward and side scatter and CD14 expression. 2.7. PCR Analysis of CD40 mRNA Expression Monocytes (5 3 10 6) were preincubated with 100 mM triazolopyrimidine or 0.1% DMSO and then stimulated or not with 1 ng/ml IFN-g. The cultures were stopped at 4 h. Total cellular RNA was extracted by the TriPure Isolation reagent (Boeringher Manheim). After reverse transcription, PCR for CD40 cDNA and b-actin was performed using 28 cycles (94°C for 20 s, 55°C for 20 s, and 72°C for 30 s). The sequences of the primers used for CD40 (synthesized by Gibco, Life Technologies) were sense primer: 59 GTCCATCCAGAACCACCCAC 39, and antisense primer: 39 GGTCAGCCGAAGAAGAGGTT 59. 3. RESULTS AND DISCUSSION
3.1. The Responses of Human Monocytes to CD40 Ligation and LPS Are Differentially Regulated by Triazolopyrimidine As shown in Fig. 1, triazolopyrimidine inhibited in a dose-dependent manner the secretion of IL-6 by human monocytes stimulated by coculture with 3T6 fibroblasts transfected with the CD40L gene (3T6-CD40L) whereas it did not affect IL-6 synthesis in response to LPS. In the absence of triazolopyrimidine, IL-6 levels secreted by monocytes were below 0.01 ng/ml in medium alone or in coculture with control-untransfected fibroblasts and reached 3.37 and 1.5 ng/ml after incubation with LPS (10 ng/ml) and 3T6-CD40L fibroblasts,
234
ZHOU ET AL.
FIG. 1. Triazolopyrimidine differentially regulates monocytes cytokines release and PCA induced by 3T6-CD40L fibroblasts or LPS. Monocytes (5 3 10 5/ml) were cocultured with 3T6, 3T6-CD40L fibroblasts (5 3 10 4/ml), or LPS (10 ng/ml) in the presence or absence of graded doses of triazolopyrimidine (10 –100 mM). Cytokines and PCA levels were presented as percentages of those observed with 3T6-CD40L fibroblasts (}) or LPS (■) without triazolopyrimidine. Data are shown as mean 6 SD of five independent experiments.
respectively (mean of five experiments). Likewise, the induction of IL-12 (p40) synthesis and of PCA was inhibited by triazolopyrimidine in response to CD40 engagement but not LPS stimulation (Fig. 1). IL-12 (p40) levels in the absence of triazolopyrimidine reached 1.4 and 1.3 ng/ml after stimulation with LPS and 3T6-CD40L fibroblasts, respectively (mean of five experiments) whereas basal levels in the absence of stimulation were below 0.003 ng/ml. PCA was absent in basal conditions and reached 10.56 and 3.76 mU/ml after stimulation with LPS and 3T6-CD40L fibroblasts, respectively (mean of five experiments). A maximal inhibition of 90% or more was achieved at doses of 80 –100 mM, while around 50% inhibition was obtained for triazolopyrimidine concentrations of 10 to 20 mM which correspond to plasma concentrations measured in clinical trials (13). TNF-a production was inhibited by triazolopyrimidine in both systems of activation although the effect of the drug was more pronounced when monocytes were stimulated by coculture with 3T6-CD40L fibroblasts.
Taken together, these data indicate that triazolopyrimidine is a potent inhibitor of the CD40 pathway of monocyte activation whereas the LPS activation pathway is resistant to the action of the drug except for the induction of TNF-a synthesis, suggesting that triazolopyrimidine might act at different levels in human monocytes. 3.2. Triazolopyrimidine Downregulates the Expression of CD40 and HLA-DR at the Membrane of Human Monocytes In view of the preferential inhibition by triazolopyrimidine of the CD40-mediated activation pathway, we analyzed by flow cytometry the effect of the drug on the expression of CD40 at the monocyte membrane, both at the basal state after monocyte isolation and upon activation with rIFN-g, which is known to upregulate CD40 expression on monocytes (2). As shown in Fig. 2 and Table 1, triazolopyrimidine inhibited in a dosedependent manner CD40 expression both at the basal
TRIAZOLOPYRIMIDINE INHIBITS CD40-MEDIATED MONOCYTE ACTIVATION
235
FIG. 2. Expression of CD40 and HLA-DR on monocytes is inhibited by triazolopyrimidine at the basal state or after IFN-g stimulation. CD40 and HLA-DR expressed both at the basal state and subsequent to IFN-g stimulation in the presence of DMSO (dotted lines) or triazolopyrimidine (100 mM) (continuous lines) were analyzed by flow cytometry. One of five representative experiments is shown.
236
ZHOU ET AL.
TABLE 1 Triazolopyrimidine Inhibits CD40 and HLA-DR Expression on Human Monocytes at Basal State or after IFN-g Stimulation a CD40%
HLA-DR %
CD14 %
CD86 %
TP (mM) b
Basal
IFN-g
Basal
IFN-g
Basal
IFN-g
Basal
IFN-g
10 20 60 100
71.99 46.53 23.14 8.7
86.71 71.07 32.73 17.91
80.83 58.64 14.36 4.15
87.81 74.22 44.75 37.49
97.99 98.34 99.15 98.52
102.98 102.31 105.56 103.48
110.76 118.74 119.53 123.76
112.14 116.73 118.56 125.33
Monocytes were stimulated or not with IFN-g (1 ng/ml) for 24 h in presence of graded doses of triazolopyrimidine and thereafter stained with the relevant mAbs or isotype-matched controls. Data represent mean percentages of median fluorescence intensity (MFI) in three independent experiments; MFI obtained in absence of triazolopyrimidine were used as percentage references (100%). b TP indicates triazolopyrimidine. a
state and upon incubation with rIFN-g. The drug concentrations which were active on this parameter were in the same range as those inhibiting cytokine production and PCA. This effect on CD40 expression was not related to nonspecific toxicity since cell viability remained above 90% as evidenced by 7-AAD staining, even at the highest triazolopyrimidine concentration (not shown). The expression of CD14 and CD86 was not significantly affected by triazolopyrimidine, whereas HLA-DR expression was also inhibited in a dose-dependent manner (Fig. 2, Table 1). 3.3. Triazolopyrimidine Inhibits CD40 mRNA Expression in Human Monocytes The downregulation of CD40 membrane expression by triazolopyrimidine led us to analyze the effect of the drug on the expression of CD40 mRNA in human monocytes, both at the basal state after isolation and upon incubation with rIFN-g. As shown in Fig. 3, triazolopyrimidine clearly inhibited CD40 mRNA accumulation under both conditions, indicating that triazolopyrimidine interferes with CD40 gene expression in human monocytes.
HLA-DR, CD80, and CD86 was not significantly modified by the addition of triazolopyrimidine (not shown). In parallel, we found that DC differentiated in presence of triazolopyrimidine displayed impaired response to CD40 ligation as assessed by IL-12 (p40) production upon coculture with 3T6-CD40L fibroblasts (Table 2). 3.5. Triazolopyrimidine Inhibits the Induction of Monocyte Procoagulant Activity during a Mixed Leukocyte Reaction We previously showed that membrane contacts involving CD40/CD40L interactions are required for the optimal induction of monocyte PCA by T cells (3). For this reason, we studied the effect of triazolopyrimidine on the induction of monocyte PCA during MLR. In the experiment depicted in Fig. 5, the PCA measured after 18 h of MLR reached 4.3 mU/ml, whereas it was below
3.4. DC Differentiated from Monocytes in the Presence of Triazolopyrimidine Express Decreased Levels of CD40 and Display Impaired Responses to CD40 Engagement When monocytes are cultured for 6 days in the presence of IL-4 and GM-CSF, they lose CD14 expression and differentiate into dendritic cells, which express high levels of CD40 on their membrane (14). We found that the addition of triazolopyrimidine during the 6 days of culture with IL-4 and GM-CSF did not prevent the loss of membrane CD14 but resulted in a decreased expression of CD40 at the DC membrane (Fig. 4). The expression of other surface molecules including
FIG. 3. RT-PCR analysis of monocyte CD40 mRNA. Monocytes were cultured for 4 h with or without 1 ng/ml IFN-g in the presence of triazolopyrimidine (100 mM) or 0.1% DMSO. cDNA prepared in both conditions was used for CD40 or b-actin amplification by RTPCR. TP indicates triazolopyrimidine. One of five representative experiments is shown.
TRIAZOLOPYRIMIDINE INHIBITS CD40-MEDIATED MONOCYTE ACTIVATION
237
FIG. 4. Triazolopyrimidine decreases CD40 expression on monocyte-derived DC generated in the presence of IL-4 and GM-CSF. DC generated in the presence of DMSO (dotted line) or triazolopyrimidine (100 mM) (continuous line) were analyzed by flow cytometry for CD14 and CD40 expression. One of five representative experiments is shown.
0.6 mU/ml in the absence of allogeneic stimulation. As shown, triazolopyrimidine suppressed in a dose-dependent manner the induction of PCA in MLR, a maximal inhibition of 85% being obtained at a concentration of 100 mM (Fig. 5). These data indicate that triazolopyrimidine inhibits T-cell-dependent monocyte activation. We suggest that this action of the drug is at least in part related to inhibition of monocyte CD40 expression. The mechanism through which triazolopyrimidine inhibits CD40 expression remains to be clarified. Interestingly, some studies suggested that triazolopyrimidine induces intracellular cAMP elevation and activation of protein kinase A (15, 16). As we found that other cAMP elevating agents such as PGE2 and pentoxifylline also inhibit CD40 expression on monocytes, it might well be that cAMP mediates triazolopyrimidine action. Indeed, CD40 gene expression was recently shown to involve the NF-kB and STAT-1 transcription factors (17), and cAMP elevating agents were previously shown to prevent NF-kB translocation (18).
4. CONCLUDING REMARKS
So far, triazolopyrimidine was developed as a therapeutic agent for coronary disease or to prevent restenosis after percutaneous transluminal coronary angioplasty (19, 20). Its mode of action is unclear although it was shown to antagonize platelet-derived growth factor activity on smooth muscle cells and to inhibit platelet aggregation (21, 22). In the present paper, we show that triazolopyrimidine is a potent inhibitor of the CD40 pathway of monocyte activation, acting at least
TABLE 2 DC Generated in the Presence of Triazolopyrimidine Displayed Impaired IL-12 Production in Response to CD40 Ligation a IL-12 (ng/ml) TP b
Medium
3T6
3T6-CD40L
2 1
0.25 6 0.12 0.31 6 0.15
0.26 6 0.11 0.27 6 0.16
60.37 6 12.34 0.70 6 0.21*
a Monocyte-derived DC (5 3 10 5/ml) generated in the presence of triazolopyrimidine (100 mM) or DMSO (0.1%) were cocultured with (10 5/ml) 3T6 or 3T6-CD40L fibroblasts for 72 h. IL-12 production subsequent to CD40L stimulation was measured by ELISA. Data represent mean 6 SD in three independent experiments. b TP indicates triazolopyrimidine. * P , 0.001 by paired Student’s t test.
FIG. 5. Triazolopyrimidine inhibits the induction of monocyte PCA during MLR. PBMC (2 3 10 6/ml) from two unrelated donors were mixed in the presence or absence of graded doses of triazolopyrimidine (10 –100 mM) for 18 h. PCA levels are expressed as percentages of PCA measured in the absence of triazolopyrimidine. One of two representative experiments is shown.
238
ZHOU ET AL.
in part by downregulating CD40 mRNA expression in this cell type. This property of triazolopyrimidine might be relevant to its therapeutic use in atheromatous disease since monocytes and CD40/CD40L interactions were shown to be involved in the formation of atherosclerotic plaques (6). Moreover, it suggests new applications of this drug in inflammatory disorders of immune origin such as rheumatoid arthritis or multiple sclerosis. REFERENCES 1. Cella, M., Scheidegger, D., Palmer-Lehmann, K., Lane, P., Lanzavecchia, A., and Alber, G., Ligation of CD40 on dendritic cells triggers production of high levels of interleukin-12 and enhances T cell stimulatory capacity: T–T help via APC activation. J. Exp. Med. 184, 747–752, 1996. 2. Kiener, P. A., Moran-Davis, P., Rankin, B. M., Wahl, A. F., Aruffo, A., and Hollenbaugh, D., Stimulation of CD40 with purified soluble gp39 induces proinflammatory responses in human monocytes. J. Immunol. 155, 4917– 4925, 1995. 3. Pradier, O., Willems, F., Abramowicz, D., Schandene, L., De Boer, M., Thielemans, K., Capel, P., and Goldman, M., CD40 engagement induces monocyte procoagulant activity through an interleukin-10 resistant pathway. Eur. J. Immunol. 26, 3048 – 3054, 1996. 4. Denton, M. D., Reul, R. M., Dharnidharka, V. R., Fang, J. C., Ganz, P., and Briscoe, D. M., Central role for CD40/CD40 ligand (CD154) interactions in transplant rejection. Pediatr. Transplant. 2, 6 –15, 1998. 5. Noelle, R. J., Mackey, M., Foy, T., Buhlmann, J., and Burns, C., CD40 and its ligand in autoimmunity. Ann. N. Y. Acad. Sci. 815, 384 –391, 1997. 6. Laman, J. D., de Smet, B. J., Schoneveld, A., and van Meurs, M., CD40 –CD40L interactions in atherosclerosis. Immunol. Today 18, 272–277, 1997. 7. Laman, J. D., Maassen, C. B., Schellekens, M. M., Visser, L., Kap, M., de Jong, E., van Puijenbroek, M., van Stipdonk, M. J., van Meurs, M., Schwarzler, C., and Gunthert, U., Therapy with antibodies against CD40L (CD154) and CD44-variant isoforms reduces experimental autoimmune encephalomyelitis induced by a proteolipid protein peptide. Mult. Scler. 4, 147–153, 1998. 8. Durie, F. H., Fava, R. A., Foy, T. M., Aruffo, A., Ledbetter, J. A., and Noelle, R. J., Prevention of collagen-induced arthritis with an antibody to gp39, the ligand for CD40. Science 261, 1328 – 1330, 1993. 9. Kirk, A. D., Harlan, D. M., Armstrong, N. N., Davis, T. A., Dong, Y., Gray, G. S., Hong, X., Thomas, D., Fechner, J. H. J., and Knechtle, S. J., CTLA4-Ig and anti-CD40 ligand prevent renal allograft rejection in primates. Proc. Natl. Acad. Sci. USA 94, 8789 – 8794, 1997. 10. Mach, F., Schonbeck, U., Sukhova, G. K., Atkinson, E., and Libby, P., Reduction of atherosclerosis in mice by inhibition of CD40 signalling. Nature 394, 200 –203, 1998. Received July 14, 1999; accepted with revision September 20, 1999
11. Suzuki, Y., Yamaguchi, K., Shimada, S., Kitamura, Y., and Ohnishi, H., Antithrombotic activity and the mechanism of action of trapidil (Rocornal). Prostaglandins Leukot. Med. 9, 685– 695, 1982. 12. Romani, N., Gruner, S., Brang, D., Kampgen, E., Lenz, A., Trockenbacher, B., Konwalinka, G., Fritsch, P. O., Steinman, R. M., and Schuler, G., Proliferating dendritic cell progenitors in human blood. J. Exp. Med. 180, 83–93, 1994. 13. Nieder, J., Claus, P., and Augustin, W., Effects of trapidil on the PGI2 and TXA2 synthesis in human umbilical veins perfused in vitro. Prostaglandins 49, 311–318, 1995. 14. Pickl, W. F., Majdic, O., Kohl, P., Stockl, J., Riedl, E., Scheinecker, C., Bello-Fernandez, C., and Knapp, W., Molecular and functional characteristics of dendritic cells generated from highly purified CD14 1 peripheral blood monocytes. J. Immunol. 157, 3850 –3859, 1996. 15. Bartel, S., Tenor, H., and Krause, E. G., Trapidil derivatives as potent inhibitors of cyclic AMP phosphodiesterase from heart and coronary arteries. Biomed. Biochim. Acta. 44, K31–K35, 1985. 16. Bonisch, D., Weber, A. A., Wittpoth, M., Osinski, M., and Schror, K., Antimitogenic effects of trapidil in coronary artery smooth muscle cells by direct activation of protein kinase A. Mol. Pharmacol. 54, 241–248, 1998. 17. Krzesz, R., Wagner, A. H., Cattaruzza, M., and Hecker, M., Cytokine-inducible CD40 gene expression in vascular smooth muscle cells is mediated by nuclear factor kappaB and signal transducer and activation of transcription-1. FEBS Lett. 453, 191–196, 1999. 18. Parry, G. C., and Mackman, N., Role of cyclic AMP response element-binding protein in cyclic AMP inhibition of NF-kappaB-mediated transcription. J. Immunol. 159, 5450 –5456, 1997. 19. Liu, M. W., Roubin, G. S., Robinson, K. A., Black, A. J., Hearn, J. A., Siegel, R. J., and King, S. B., Trapidil in preventing restenosis after balloon angioplasty in the atherosclerotic rabbit. Circulation 81, 1089 –1093, 1990. 20. Maresta, A., Balducelli, M., Cantini, L., Casari, A., Chioin, R., Fabbri, M., Fontanelli, A., Monici, P. P., Repetto, S., and De Servi, S., Trapidil (triazolopyrimidine), a platelet-derived growth factor antagonist, reduces restenosis after percutaneous transluminal coronary angioplasty. Results of the randomized, double-blind STARC study. Studio Trapidil versus Aspirin nella Restenosi Coronarica. Circulation 90, 2710 – 2715, 1994. 21. Mazurov, A. V., Menshikov, M. Y., Leytin, V. L., Tkachuk, V. A., and Repin, V. S., Decrease of platelet aggregation and spreading via inhibition of the cAMP phosphodiesterase by trapidil. FEBS Lett. 172, 167–171, 1984. 22. Ohnishi, H., Yamaguchi, K., Shimada, S., Suzuki, Y., and Kumagai, A., A new approach to the treatment of atherosclerosis and trapidil as an antagonist to platelet-derived growth factor. Life Sci. 28, 1641–1646, 1981.