- Email: [email protected]
Inhibition of West Nile virus replication in cells stably transfected with vector-based shRNA expression system
Virus Research 135 (2008) 292–297
Contents lists available at ScienceDirect
Virus Research journal homepage: www.elsevier.com/locate/virusres
Inhibition of West Nile virus replication in cells stably transfected with vector-based shRNA expression system S.P. Ong, J.J.H. Chu, M.L. Ng ∗ Flavivirology Laboratory, Department of Microbiology, Yong Loo Lin School of Medicine, 5 Science Drive 2, National University of Singapore, 117597 Singapore, Singapore
a r t i c l e
i n f o
Article history: Received 1 November 2007 Received in revised form 1 April 2008 Accepted 4 April 2008 Available online 2 June 2008 Keywords: RNAi SiRNA West Nile virus
a b s t r a c t In this study, the efficacies of short hairpin RNAs (shRNAs) targeting different regions of West Nile virus (WNV) strain Sarafend genome were investigated. Short hairpin RNAs targeting Capsid, NS2B and NS4B genes were cloned into pSilencerTM 3.1-H1 neo and designated as pshCapsid, pshNS2B and pshNS4B, respectively. Vero cells that were positively transfected were selected for creating stable cell lines expressing shRNAs constitutively. These cells were subjected to West Nile virus at multiplicity of infection (M.O.I.) of 10. The cells stably transfected with pshCapsid gave the best silencing effect among the three stable cell lines (transfected with pshCapsid, pshNS2B and pshNS4B) at both 12- and 24 h p.i. When compared to the non-transfected WNV-infected cells, pshCapsid stably transfected cells showed more than 4 log10 unit reduction in viral transcripts and greater than 3 log10 unit reduction in virus production. Cells stably transfected with pshNS2B did not exhibit as strong an inhibition when compared to the pshCapsid stably transfected cells having only 2 log10 unit reduction in virus titre. The pshNS4B-stably transfected cells did not suppress WNV replication. Hence, from this study, pshCapsid has the potential to be developed into effective antiviral strategy for WNV infection. © 2008 Elsevier B.V. All rights reserved.
1. Introduction West Nile virus (WNV), a mosquito-borne virus with singlestranded positive sense RNA genome, belongs to the family Flaviviridae, genus Flavivirus. It is the aetiological agent of West Nile fever and in some severe cases, fatal meningoencephalitis can occur (Hayes et al., 2005). Currently, there is no specific therapy or vaccines approved for human use to prevent WNV-infection (Bai et al., 2005; Tyler, 2004). The 11-Kb flavivirus genome which encodes for a single polyprotein, is co- and post-translationally processed by viral and cellular proteases to generate 3 structural proteins [capsid (C), premembrane (prM) or membrane (M), and envelope (E)] and 7 non-structural proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B and NS5) (Chambers et al., 1990; Rice et al., 1985) Upon virus infection, the genomic RNA is used to form the complementary minus-strand RNA, which then serves as the template for the synthesis of more plus-strand genomic RNA (Brinton, 2002) and virus replication is in close association with the endoplasmic reticulum [(ER) (Ng and Chu, 2002)].
∗ Corresponding author. Tel.: +65 68743283; fax: +65 67766872. E-mail address: [email protected] (M.L. Ng). 0168-1702/$ – see front matter © 2008 Elsevier B.V. All rights reserved. doi:10.1016/j.virusres.2008.04.014
RNA interference (RNAi) is a biological process whereby RNA molecules regulate the expression of genes. The sequence-specific degradation of mRNA in the cell is activated in the presence of double-stranded RNA (dsRNA). The dsRNA engages with Dicer to undergo cleavage into small ∼22 nucleotide (nt) fragments called small interfering RNA [(siRNA) (Elbashir et al., 2001)]. The antisense stand then serves as a guide sequence to RNA-interfering silencing complex (RISC) to destroy mRNA of complementary sequence, hence achieving post-transcriptional inhibition of the targeted gene (Wadhwa et al., 2004). The potential impact of RNAi on viral infections had been demonstrated both in vitro and in vivo. siRNAs had been shown to be effective against both DNA and RNA viruses with diverse replication strategies. It can act as a prophylactic agent preventing viral infections or lower viral loads through inhibition of viral protein production and transcription of viral genomes (Tan and Yin, 2004). Few studies had made use of RNAi technology to disrupt WNV replication by targeting the UTRs of the viral genome (Deas et al., 2005), envelope (Kumar et al., 2006), capsid and NS5 (Geiss et al., 2005; McCown et al., 2003; Ong et al., 2006) genes in both in vitro and in vivo systems. However, these studies have some pitfalls. These included the risk of production of replication competent virus with the use of a viral vector system (Walther and Stein, 2000), the absence of long term siRNA expression with the use of chemically synthesized siRNA (Manoharan, 2004) or transiently transfected plasmid systems that may be lost after cell divisions (Calos, 1998).
S.P. Ong et al. / Virus Research 135 (2008) 292–297
In our previous study, we had demonstrated the disruption of WNV replication by siRNA produced from a plasmid pSilencerTM 3.0-H1 vector (Ambion, USA) targeting against the viral NS5 (Ong et al., 2006). Although the design and selection of siRNA targeting the NS5 target sites adhered to the multiple guidelines available (UiTei et al., 2004), there may still be room for improvement. Hence, the sensitivity and susceptibility of the WNV to shRNAs designed against various sites in the virus genome were investigated in this study. In addition, an attempt to overcome some of the above problems plasmid-based expression system was used which allowed the option of creating stable cell lines expressing shRNAs under the control of a RNA polymerase III promoter. 2. Materials and methods 2.1. Construction of pSilencer vectors The capsid, NS2B and NS4B gene sequences of WNV (Sarafend) (GenBank; AY688948) were used to locate potential RNAi target sites using the software program siRNA Target Finder provided by Ambion, Austin, Texas, USA (http://www.ambion. com/techlib/misc/siRNA finder.html). The construction of pSilencer vectors was performed as described by Ong et al. (2006). In brief, one target was selected from each of these three gene sequences and oligonucleotides duplexes were designed. They were then cloned into the vector, pSilencerTM 3.1-H1 neo via the BamH I and Hind III at the 5 and 3 restriction sites, respectively. The plasmid contains a G418 antibiotic selection marker to allow selection of positively transfected cells. Sequencing was then carried out to verify the sequences and orientations of the inserts. The constructs targeting against the capsid, NS2B and NS4B genetic sites were designated as pshCapsid, pshNS2B and pshNS4B, respectively (Table 1). The target sequences of these three clones were scrambled using the software program InvivoGen’s siRNA WizardTM hosted by Invitrogen, Carlsbad, California USA at http://www.sirnawizard.com/scrambled.php to generate its corresponding scrambled vector control. They were assigned as pshCapsidscrambled, pshNS2Bscrambled and pshNS4Bscrambled. All the vectors were found to have no similarity to the monkey or human genome.
293
and non-transfected cells. A P-value of less than or equal to 0.05 indicated significant difference between the two groups of cells. 2.3. Transfections Vero cells were transfected using Lipofectamine (Invitrogen, Carlsbad, California, USA) as were performed as described in Ong et al. (2006). Antibiotic G418 was added at a concentration of 400 g/ml to the wells 48 h after transfection to select for positively transfected cells. The cells were selected for 2 months before experiments were carried out and were continuously grown in selection media. 2.4. Quantification of WNV transcript by RT-PCR The copy number of WNV E protein gene present in the cells were quantified using real-time PCR as described in Ong et al. (2006). Independent T-test (SPSS version 12) was used to compare the mean log10 unit virus transcripts between transfected and non-transfected cells. 2.5. Antibodies for indirect immunofluorescence microscopy and Western blot analysis Primary polyclonal anti-WNV Capsid, NS2B and NS4B antisera derived from rabbit were a kind gift from Emeritus Professor Westaway (Queensland, Australia). Goat anti-rabbit immunoglobulins G (Ig G) conjugated with fluorescein isothiocyanate (FITC) and alkaline phosphatase (Chemicon, Temecula, California, USA) was used in indirect immunofluorescence microscopy and Western blot, respectively. For immunofluorescence microscopy, the cells were stained by primary and secondary antibodies as described by Chu and Ng (2003). Cells were stained for various viral protein(s) and viewed under the microscope as mentioned in Ong et al. (2006). Two hundreds cells were counted from different field of view and the percentages of fluorescing cells were noted. Cell lysates were subjected to SDS-PAGE and Western blotting analysis as stated in Ong et al. (2006). 3. Results
2.2. Cells and viruses Vero cells (African green monkey kidney) and West Nile virus, strain Sarafend were gifts from Emeritus Professor E.G. Westaway (Queensland, Australia). The cells were used throughout all experiments and were proliferated as described by Ong et al. (2006). The passage level of the cell line used was between 25 and 90. The virus was propagated in Vero cells throughout the study and plaque assays were carried out to quantify virus titres as described in Chu and Ng (2003). Independent T-test (SPSS version 12) was used to compare the mean log10 unit virus titre between transfected cells
3.1. Reduction in viral transcripts of WNV shRNA vectors stably transfected cells The sensitivity and susceptibility of WNV to shRNAs designed against various sites in the virus genome were investigated. Cells were transfected with different plasmids and selected for using G418. Stably transfected cells were subjected to WNV infection at the M.O.I. of 10. Real-time PCR was employed to determine the effect of constitutive expression of siRNAs had on the WNV replication (Fig. 1).
Table 1 Target sites selected and used for cloning Target site/start nucleotide
Name of target construct/sequence of bottom strand oligonucleotide (5 -3 )
Name of scrambled vector-control construct/sequence of bottom strand oligonucleotide (5 -3 )
Capsid/313
pshCapsid/AGCTTTTCCAAAAAACAAACAAACAGCGATGAAG TCTCTTGAACTTCATCGCTGTTTGTTTGCG
pshcapsidscrambled/AGCTTTTCCAAAAGCCAATAGACGAAAGAACAAA TCTCTTGAATTTGTTCTTTCGTCTATTGCG
NS2B/4359
pshNS2B/AGCTTTTCCAAAAAAAGTCAACAGATATGTGGAT TCTCTTGAAATCCACATATCTGTTGACTG
pshNS2Bscrambled/AGCTTTTCCAAAAAAGGCACAAGTAGTTTAAAGATA TCTCTTGAATATCTTTAAACTACTTGTGCG
NS4B/7095
pshNS4B/AGCTTTTCCAAAAAATCACGTCAGACTACATCAA TCTCTTGAATTGATGTAGTCTGACGTGA
pshNS4Bscrambled/AGCTTTTCCAAAAAAGCAATACGTCCATCAAATACA TCTCTTGAATGTATTTGATGGACGTATT
Target sequences are indicated in bold.
294
S.P. Ong et al. / Virus Research 135 (2008) 292–297
tein expressed when compared to non-transfected WNV-infected cells at 12- and 24 h p.i., respectively (Fig. 3b). This corroborated with the number of viral transcripts produced where shRNAs produced from the two vectors were capable of producing a persistent silencing effect on WNV replication. Cells stably transfected with pshNS4B and infected with WNV were unable to produce a continuous silencing effect on WNV replication. The percentage of cells stained positive increased from 10% at 12 h p.i. to 85% at 24 h p.i. (Fig. 2k and l). Western blot analysis showed that when compared to the non-transfected and WNV-infected cells, pshNS4B-stably transfected cells had a 4-fold reduction in NS4B protein expression at 12 h p.i. but almost no difference in the amount of viral proteins produced after 24 h of infection (Fig. 3c). This trend observed in the stably transfected cells was similar to that of the transiently transfected cells (not shown). Fig. 1. Number of viral transcripts in cells stably transfected with various vectors. Viral RNA transcripts were harvested from the WNV-infected cells and subjected to real-time PCR analysis. Both pshCapsid and pshNS2B-stably transfected cells have significant lower viral transcripts at both 12- and 24 h p.i. Cells stably transfected with pshNS4B has some reduction in the number of viral transcripts produce at 12 h p.i. but shows no significant inhibition of viral transcripts production at 24 h p.i. Cells transfected with various scrambled vectors show insignificant differences in the amount of viral transcripts when compared to non-transfected WNV-infected cells at both time points. The results are shown as arithmetic means of three independently conducted experiments (±1 S.D.).
Stable cell line expressing shRNA from pshCapsid showed 4.11and 4.58-log10 unit reduction (both P < 0.05) in WNV viral transcripts when compared to the non-transfected WNV-infected cells at 12- and 24 h p.i., respectively. Cells stably transfected with pshNS2B had 4.67- and 4.40-log10 unit reduction (both P < 0.05) in the viral genome copy number at 12- and 24 h p.i., respectively when compared to non-transfected cells. Cells stably transfected with pshNS4B showed 3.81- (P < 0.05) and 0.93- (P > 0.05) log10 unit reduction in viral genome copy number at 12- and 24 h p.i., respectively. Therefore, pshNS4B was able to reduce the number of WNV transcripts at 12 h p.i. but not at 24 h p.i. Cells stably transfected with various scrambled-shRNA-vector controls did not show inhibitory effect on WNV replication. 3.2. Analysis of viral protein expression in vector stably transfected cells Non-transfected and WNV-infected cells had more than 85% of the population stained positive at both 12- (Fig. 2a) and 24 h p.i. (Fig. 2b). Cells stably transfected with pshCapsidscrambled (Fig. 2c and d) or other vector controls containing scrambled-shRNA sequences (not shown) showed similar infection patterns as the wild-type WNV-infection. Cells stably transfected with pshCapsid mock-infected acted as negative controls were all negative (Fig. 2e and f). Similar trends were observed in cells that were transfected with pshNS2B or pshNS4B and mock-infected (not shown). The infected Vero cells that were stably transfected with the pshCapsid exhibited a significant decrease in intensity and frequency of staining in IFA when compared to the cells with just WNV infection. Only 5% of the cell population emitted green fluorescence at 12 h p.i. (Fig. 2g) and this cell line maintained the fluorescence level at less than 10% of the population even at 24 h p.i. (Fig. 2h). These cells also showed a significant reduction in the level of capsid protein expressed when compared to non-transfected WNV infections in Western blot (Fig. 3a). There was an 8- and 12-fold decrease in band intensity at 12- and 24 h p.i., respectively. Similarly, cells stably transfected with pshNS2B and infected with WNV displayed only 3% and 8% of the cell population with positive fluorescence at 12- and 24 h p.i., respectively (Fig. 2i and j). These cells had 4- and 6-fold reductions in the amount of NS2B pro-
3.3. Comparison of virus particles produced in stably transfected cells Cell lines stably transfected with various vector constructs were tested for their ability to limit infectious virus production (Fig. 4). The productivity of progeny virus in cells stably transfected with pshCapsid or pshNS2B was affected. The pshCapsid-stably transfected cells showed 3.27- and 3.67-log10 unit decreased (both P < 0.05) in the number of virus produced at 12- and 24 h p.i., correspondingly. The pshNS2B-stably transfected cells had 2.23- and 2.40-log10 unit reductions (both P < 0.05) in the number of virus particles produced when compared to control cells with only WNV infection at 12- and 24 h p.i., respectively. Cells stably transfected with pshNS4B showed 1.23- (P < 0.05) and 0.49- (P > 0.05) log10 unit decrease in the number of virus particles produced when compared to the non-transfected WNV infection at 12- and 24 h p.i., respectively. 4. Discussion There are several criteria available to guide in the design of siRNA but the precise designed target is still unknown. It was therefore necessary to design several siRNAs against different target sites on the WNV genome before choosing the best knock-down site (Geiss et al., 2005; Hsieh et al., 2004). Previous attempts to interfere with WNV replication targeted the viral UTRs, E protein, Capsid and NS5 sites (Bai et al., 2005; Geiss et al., 2005; Kumar et al., 2006; McCown et al., 2003; Ong et al., 2006). Other target sites on the WNV genome have not been studied. In this study, the different sites of the genome Capsid, NS2B and NS4B were targeted to compare the efficacies of the different shRNAs in reducing WNV production. Although the siRNA WNV CAP (Capsid protein) generated from a plasmid-based vector (McCown et al., 2003) and pshCapsid in this study targeted the same region of the viral genome, it was still worth studying the effects of targeting at a shorter region of the Capsid gene. The pSilencer vector was employed to allow continuous production of shRNAs in cells as the vector backbone contained a selectable marker. This allowed the option of selecting positively transfected cells and creating a stable cell line. The cells were initially transfected transiently with the vector to determine effectiveness of shRNA generated from the plasmid in silencing WNV replication (data not shown) before creating a stable cell line as this can be a lengthy process. Vero cells that were transiently transfected with various vectors (pshCapsid, pshNS2B and pshNS4B) showed different degree of ability to silence WNV replication. Cells transiently transfected with pshCapsid and pshNS2B showed significant but not complete inhibition of virus production (data not shown). The observation is not
S.P. Ong et al. / Virus Research 135 (2008) 292–297
295
Fig. 2. Viral protein expression in vector stably transfected cell. The cells were stained for Capsid protein. Non-transfected WNV-infected cells show more than 85% emitting fluorescence at both 12- (a) and 24 h p.i. (b). pshCapsidscrambled-transfected and WNV-infected cells (c and d) show similar infection pattern as the wild-type WNV infection. pshCapsid-transfected, mock-infected cells (e and f) yield no fluorescence act as negative control. pshCapsid-transfected and WNV-infected cells stained for capsid protein have less than 10% of the cell population emitting fluorescence at both 12- (g) and 24 h p.i. (h). pshNS2B-transfected and WNV-infected cells (i and j) stained for NS2B protein have less than 10% of cell population emitting fluorescence. Ten percent of the pshNS4B-stably transfected and WNV-infected cells emit fluorescence at 12 h p.i. (k) whereas 86% of the cells produce fluorescence at 24 h p.i. (l). The numbers on the immunofluorescence denote the percentage of cells stain positive.
296
S.P. Ong et al. / Virus Research 135 (2008) 292–297
Fig. 4. Plaque assay revealing the log10 unit inhibition of virus particles production in various vectors-transfected cells. Both pshCapsid and pshNS2B-stably transfected cells display significantly lower yield of virus particles at both 12- and 24 h p.i. Cells stably transfected with pshNS4B showed some inhibition in the number of virus progeny produced at 12 h p.i. but not at 24 h p.i. Cells transfected with various vector controls show insignificant differences in the virus titre when compared to the non-transfected WNV-infected cells at both time points. The results are shown as arithmetic means of three independently conducted experiments (±1 S.D.).
Fig. 3. Western blotting of cells stably transfected with vectors. (a) Cell lysates harvested from pshCapsid stably transfected and WNV-infected cells show a 8- and 12-fold reduction in viral capsid protein production at 12- and 24 h p.i., respectively when compared to wild-type WNV infection. (b) Cell lysates harvested from pshNS2B-stably transfected and WNV-infected cells, when compared to nontransfected WNV infected cells, reveal 4- and 6-fold reductions in viral NS2B protein synthesis at 12- and 24 h p.i., respectively. (c) Cell lysates harvested from pshNS4Bstably transfected and WNV-infected cells reveal a 4-fold reduction in NS4B protein production at 12 h p.i. when compared to non-transfected counterparts. Actin is used as the well loading control to ensure equal loading of protein sample.
uncommon in oligonucleotide-based expression systems (Tuschl, 2002). Consideration should be given to the possibility that different cell types vary in their response to the introduction of siRNA vectors (Koromilas et al., 2004). Some postulations could explain this incomplete silencing of virus replication. Firstly, the transfection efficiency was only 50% (data not shown) and the increase in number of fluorescing cells over time could be due to re-infection of cells (accumulating virus proteins/progeny virus) without the vector constructs. Secondly, even though the target site for the siRNA was selected using a computer program based on certain criteria, the siRNAs may have an intrinsic inability to sustain the silencing effect. This could be due to site inaccessibility as a result of secondary structures or presence of other interacting proteins which the computer program did not factor in during the selection. Thirdly, the vector constructs may be unstable over time thus, resulting in the increase in the titre of virus particles after 24 h of infections. To determine if the lack of complete inhibition on virus replication was due to the non-homogenous population of transfected cells, positively transfected cells were selected for using antibiotic G148. These cells in turn would express shRNAs constitutively under the H1 promoter. Similar to the transient study, the stably transfected cells were infected with WNV and analyzed for the amount of viral transcripts, protein expressions and virus production. Cells stably transfected with pshCapsid showed greater inhibition in virus production than cells stably transfected with pshNS2B or pshNS4B (Fig. 4). In addition, there was a further increase of 1 log10 unit reduction in virus titre when compared to the corresponding transiently transfected cells (data not shown). This indicated that pshCapsid was most effective in reducing viral load when compared to the other vectors. Different vectors produced varying silencing effects on WNV replication. This could be due to the secondary structure of the target RNA. There is an inverse relationship between silencing potency and number of nucleotides of the siRNA target site involved in base pairing (Schubert et al., 2005). The Mfold program (hosted at http://www.bioinfo.rpi.edu/applications/mfold/rna/form1.cgi) predicted that only 18% of the nucleotides of pshCapsid target site are involved in base pairing and there is no formation of hairpin structure (results not shown). This may account for the highest potency in silencing WNV replication among the 3 target sites as the activated RISC may be able to attack the site more easily.
S.P. Ong et al. / Virus Research 135 (2008) 292–297
The pshNS2B target site has 27% of the nucleotide involved in base pairing hence, accounting for the slight reduction in the potency of siRNA generated from pshNS2B. More than 63% of the nucleotides forming the pshNS4B target site are involved in complementary base pairing which resulted in the formation of a stem structure. The remainder of the target sequence is made up of a continuous stretch of unpaired nucleotides located in between stem structures hence this may allow limited RISC binding and initiate the degradation of the RNA genome. Even though shRNA generated from pshCapsid vector gave the highest viral silencing power, there was no complete inhibition of virus replication. This may be contributed in part because flaviviruses like WNV replicate in cellular compartments protected by the virus-induced membranes. Thus, may disallow the RISC complex in the cytosol to reach the target viral genome, hence resulting in RNAi resistance which is consistent with our data. In addition, there may also be unstable expression of shRNA from the selected transfected cells (Glanville, 1985), with some cells not expressing the exogenous shRNA to target the virus genome. Studies by Bai and colleagues have shown the siRNAs is still able to offer protection against complications arising from WNV infections in the animal models even though there was no complete inhibition of virus replication. This may be useful in a ring-vaccination anti-WNV campaign. In addition, partial siRNA protection against WNV was observed by Deas et al. (2005) with high concentrations of peptide-linked phosphorodiamidate morpholino oligomers given after infection. Hence, our construct pshCapsid may also offer protection against WNV-induced complications in the animals and human. A suitable animal model can be developed to test the protective effect of pshCapsid. 5. Acknowledgements The authors thank Loy Boon Pheng for technical assistance. S.P. Ong is funded by NUS Research Scholarship and J.J.H. Chu is a Lee Kuan Yew Research Fellow. This work is supported by the Biomedical Research Council (Singapore), Project No. 01/1/21/18/003 and National University of Singapore (R-182-000-055-112). References Bai, F., Wang, T., Pal, U., Bao, F., Gould, L.H., Fikrig, E., 2005. Use of RNA interference to prevent lethal murine West Nile virus infection. J. Infect. Dis. 191, 1148–1154. Brinton, M.A., 2002. The molecular biology of West Nile Virus: a new invader of the western hemisphere. Annu. Rev. Microbiol. 56, 371–402.
297
Calos, M.P., 1998. Stability without a centromere. Proc. Natl. Acad. Sci. U.S.A. 95, 4084–4085. Chambers, T.J., Hahn, C.S., Galler, R., Rice, C.M., 1990. Flavivirus genome organization, expression, and replication. Annu. Rev. Microbiol. 44, 649–688. Chu, J.J.H., Ng, M.L., 2003. The mechanism of cell death during West Nile virus infection is dependent on initial infectious dose. J. Gen. Virol. 84, 3305–3314. Deas, T.S., Binduga-Gajewska, I., Tilgner, M., Ren, P., Stein, D.A., Moulton, H.M., Iversen, P.L., Kauffman, E.B., Kramer, L.D., Shi, P.Y., 2005. Inhibition of flavivirus infections by antisense oligomers specifically suppressing viral translation and RNA replication. J. Virol. 79, 4599–4609. Elbashir, S.M., Martinez, J., Patkaniowska, A., Lendecke, W., Tuschl, T., 2001. Functional anatomy of siRNAs for mediating efficient RNAi in Drosophila melanogaster embryo lysate. EMBO J. 20, 6877–6888. Geiss, B.J., Pierson, T.C., Diamond, M.S., 2005. Actively replicating West Nile virus is resistant to cytoplasmic delivery of siRNA. Virol. J. 2, 53–65. Glanville, N., 1985. Unstable expression and amplification of a transfected oncogene in confluent and subconfluent cells. Mol. Cell Biol. 5, 1456–1464. Hayes, E.B., Sejvar, J.J., Zaki, S.R., Lanciotti, R.S., Bode, A.V., Campbell, G.L., 2005. Virology, pathology, and clinical manifestations of West Nile virus disease. Emerg. Infect. Dis. 11, 1174–1179. Hsieh, A.C., Bo, R., Manola, J., Vazquez, F., Bare, O., Khvorova, A., Scaringe, S., Sellers, W.R., 2004. A library of siRNA duplexes targeting the phosphoinositide 3-kinase pathway: determinants of gene silencing for use in cell-based screens. Nucleic Acids Res. 3, 893–901. Koromilas, A.E., Li, S., Matlashewski, G., 2004. Control of interferon signaling in human papillomavirus infection. Cytokine Growth Factor Rev. 12, 157–170. Kumar, P., Lee, S.K., Shankar, P., Manjunath, N., 2006. A single siRNA suppresses fatal encephalitis induced by two different flaviviruses. PLoS Med. 3, 505–514. Manoharan, M., 2004. RNA interference and chemically modified small interfering RNAs. Curr. Opin. Chem. Biol. 8, 570–579. McCown, M., Diamond, M.S., Pekosz, A., 2003. The utility of siRNA transcripts produced by RNA polymerase I in down regulating viral gene expression and replication of negative- and positive-strand RNA viruses. Virology 313, 514–524. Ng, M.L., Chu, J.J.H., 2002. Interaction of West Nile and Kunjin viruses with cellular components during morphogenesis. Curr. Top. Microbiol. Immunol. 267, 353–372. Ong, S.P., Choo, B.G., Chu, J.J.H., Ng, M.L., 2006. Expression of vector-based small interfering RNA against West Nile virus effectively inhibits virus replication. Antiviral Res. 72, 216–223. Rice, C.M., Lenches, E.M., Eddy, S.R., Shin, S.J., Sheets, R.L., Strauss, J.H., 1985. Nucleotide sequence of yellow fever virus: implications for flavivirus gene expression and evolution. Science 229, 726–733. Schubert, S., Grunweller, A., Erdmann, V.A., Kurreck, J., 2005. Local RNA target structure influences siRNA efficacy: systematic analysis of intentionally designed binding regions. J. Mol. Biol. 348, 883–893. Tan, F.L., Yin, J.Q., 2004. RNAi, a new therapeutic strategy against viral infection. Cell Res. 14, 460–466. Tuschl, T., 2002. Expanding small RNA interference. Nat. Biotechnol. 20, 446–448. Tyler, K.L., 2004. West Nile virus infection in the United States. Arch. Neurol. 61, 1190–1195. Ui-Tei, K., Naito, Y., Takahashi, F., Haraguchi, T., Ohki-Hamazaki, H., Juni, A., Ueda, R., Saigo, K., 2004. Guidelines for the selection of highly effective siRNA sequences for mammalian and chick RNA interference. Nucleic Acids Res. 32, 936–948. Wadhwa, R., Kaul, S.C., Miysgishi, M., Taira, K., 2004. Know-how of RNA interference and its applications in research and therapy. Mutat. Res. 567, 71–84. Walther, W., Stein, U., 2000. Viral vectors for gene transfer: a review of their use in the treatment of human diseases. Drugs 60, 249–271.
Contents lists available at ScienceDirect
Virus Research journal homepage: www.elsevier.com/locate/virusres
Inhibition of West Nile virus replication in cells stably transfected with vector-based shRNA expression system S.P. Ong, J.J.H. Chu, M.L. Ng ∗ Flavivirology Laboratory, Department of Microbiology, Yong Loo Lin School of Medicine, 5 Science Drive 2, National University of Singapore, 117597 Singapore, Singapore
a r t i c l e
i n f o
Article history: Received 1 November 2007 Received in revised form 1 April 2008 Accepted 4 April 2008 Available online 2 June 2008 Keywords: RNAi SiRNA West Nile virus
a b s t r a c t In this study, the efficacies of short hairpin RNAs (shRNAs) targeting different regions of West Nile virus (WNV) strain Sarafend genome were investigated. Short hairpin RNAs targeting Capsid, NS2B and NS4B genes were cloned into pSilencerTM 3.1-H1 neo and designated as pshCapsid, pshNS2B and pshNS4B, respectively. Vero cells that were positively transfected were selected for creating stable cell lines expressing shRNAs constitutively. These cells were subjected to West Nile virus at multiplicity of infection (M.O.I.) of 10. The cells stably transfected with pshCapsid gave the best silencing effect among the three stable cell lines (transfected with pshCapsid, pshNS2B and pshNS4B) at both 12- and 24 h p.i. When compared to the non-transfected WNV-infected cells, pshCapsid stably transfected cells showed more than 4 log10 unit reduction in viral transcripts and greater than 3 log10 unit reduction in virus production. Cells stably transfected with pshNS2B did not exhibit as strong an inhibition when compared to the pshCapsid stably transfected cells having only 2 log10 unit reduction in virus titre. The pshNS4B-stably transfected cells did not suppress WNV replication. Hence, from this study, pshCapsid has the potential to be developed into effective antiviral strategy for WNV infection. © 2008 Elsevier B.V. All rights reserved.
1. Introduction West Nile virus (WNV), a mosquito-borne virus with singlestranded positive sense RNA genome, belongs to the family Flaviviridae, genus Flavivirus. It is the aetiological agent of West Nile fever and in some severe cases, fatal meningoencephalitis can occur (Hayes et al., 2005). Currently, there is no specific therapy or vaccines approved for human use to prevent WNV-infection (Bai et al., 2005; Tyler, 2004). The 11-Kb flavivirus genome which encodes for a single polyprotein, is co- and post-translationally processed by viral and cellular proteases to generate 3 structural proteins [capsid (C), premembrane (prM) or membrane (M), and envelope (E)] and 7 non-structural proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B and NS5) (Chambers et al., 1990; Rice et al., 1985) Upon virus infection, the genomic RNA is used to form the complementary minus-strand RNA, which then serves as the template for the synthesis of more plus-strand genomic RNA (Brinton, 2002) and virus replication is in close association with the endoplasmic reticulum [(ER) (Ng and Chu, 2002)].
∗ Corresponding author. Tel.: +65 68743283; fax: +65 67766872. E-mail address: [email protected] (M.L. Ng). 0168-1702/$ – see front matter © 2008 Elsevier B.V. All rights reserved. doi:10.1016/j.virusres.2008.04.014
RNA interference (RNAi) is a biological process whereby RNA molecules regulate the expression of genes. The sequence-specific degradation of mRNA in the cell is activated in the presence of double-stranded RNA (dsRNA). The dsRNA engages with Dicer to undergo cleavage into small ∼22 nucleotide (nt) fragments called small interfering RNA [(siRNA) (Elbashir et al., 2001)]. The antisense stand then serves as a guide sequence to RNA-interfering silencing complex (RISC) to destroy mRNA of complementary sequence, hence achieving post-transcriptional inhibition of the targeted gene (Wadhwa et al., 2004). The potential impact of RNAi on viral infections had been demonstrated both in vitro and in vivo. siRNAs had been shown to be effective against both DNA and RNA viruses with diverse replication strategies. It can act as a prophylactic agent preventing viral infections or lower viral loads through inhibition of viral protein production and transcription of viral genomes (Tan and Yin, 2004). Few studies had made use of RNAi technology to disrupt WNV replication by targeting the UTRs of the viral genome (Deas et al., 2005), envelope (Kumar et al., 2006), capsid and NS5 (Geiss et al., 2005; McCown et al., 2003; Ong et al., 2006) genes in both in vitro and in vivo systems. However, these studies have some pitfalls. These included the risk of production of replication competent virus with the use of a viral vector system (Walther and Stein, 2000), the absence of long term siRNA expression with the use of chemically synthesized siRNA (Manoharan, 2004) or transiently transfected plasmid systems that may be lost after cell divisions (Calos, 1998).
S.P. Ong et al. / Virus Research 135 (2008) 292–297
In our previous study, we had demonstrated the disruption of WNV replication by siRNA produced from a plasmid pSilencerTM 3.0-H1 vector (Ambion, USA) targeting against the viral NS5 (Ong et al., 2006). Although the design and selection of siRNA targeting the NS5 target sites adhered to the multiple guidelines available (UiTei et al., 2004), there may still be room for improvement. Hence, the sensitivity and susceptibility of the WNV to shRNAs designed against various sites in the virus genome were investigated in this study. In addition, an attempt to overcome some of the above problems plasmid-based expression system was used which allowed the option of creating stable cell lines expressing shRNAs under the control of a RNA polymerase III promoter. 2. Materials and methods 2.1. Construction of pSilencer vectors The capsid, NS2B and NS4B gene sequences of WNV (Sarafend) (GenBank; AY688948) were used to locate potential RNAi target sites using the software program siRNA Target Finder provided by Ambion, Austin, Texas, USA (http://www.ambion. com/techlib/misc/siRNA finder.html). The construction of pSilencer vectors was performed as described by Ong et al. (2006). In brief, one target was selected from each of these three gene sequences and oligonucleotides duplexes were designed. They were then cloned into the vector, pSilencerTM 3.1-H1 neo via the BamH I and Hind III at the 5 and 3 restriction sites, respectively. The plasmid contains a G418 antibiotic selection marker to allow selection of positively transfected cells. Sequencing was then carried out to verify the sequences and orientations of the inserts. The constructs targeting against the capsid, NS2B and NS4B genetic sites were designated as pshCapsid, pshNS2B and pshNS4B, respectively (Table 1). The target sequences of these three clones were scrambled using the software program InvivoGen’s siRNA WizardTM hosted by Invitrogen, Carlsbad, California USA at http://www.sirnawizard.com/scrambled.php to generate its corresponding scrambled vector control. They were assigned as pshCapsidscrambled, pshNS2Bscrambled and pshNS4Bscrambled. All the vectors were found to have no similarity to the monkey or human genome.
293
and non-transfected cells. A P-value of less than or equal to 0.05 indicated significant difference between the two groups of cells. 2.3. Transfections Vero cells were transfected using Lipofectamine (Invitrogen, Carlsbad, California, USA) as were performed as described in Ong et al. (2006). Antibiotic G418 was added at a concentration of 400 g/ml to the wells 48 h after transfection to select for positively transfected cells. The cells were selected for 2 months before experiments were carried out and were continuously grown in selection media. 2.4. Quantification of WNV transcript by RT-PCR The copy number of WNV E protein gene present in the cells were quantified using real-time PCR as described in Ong et al. (2006). Independent T-test (SPSS version 12) was used to compare the mean log10 unit virus transcripts between transfected and non-transfected cells. 2.5. Antibodies for indirect immunofluorescence microscopy and Western blot analysis Primary polyclonal anti-WNV Capsid, NS2B and NS4B antisera derived from rabbit were a kind gift from Emeritus Professor Westaway (Queensland, Australia). Goat anti-rabbit immunoglobulins G (Ig G) conjugated with fluorescein isothiocyanate (FITC) and alkaline phosphatase (Chemicon, Temecula, California, USA) was used in indirect immunofluorescence microscopy and Western blot, respectively. For immunofluorescence microscopy, the cells were stained by primary and secondary antibodies as described by Chu and Ng (2003). Cells were stained for various viral protein(s) and viewed under the microscope as mentioned in Ong et al. (2006). Two hundreds cells were counted from different field of view and the percentages of fluorescing cells were noted. Cell lysates were subjected to SDS-PAGE and Western blotting analysis as stated in Ong et al. (2006). 3. Results
2.2. Cells and viruses Vero cells (African green monkey kidney) and West Nile virus, strain Sarafend were gifts from Emeritus Professor E.G. Westaway (Queensland, Australia). The cells were used throughout all experiments and were proliferated as described by Ong et al. (2006). The passage level of the cell line used was between 25 and 90. The virus was propagated in Vero cells throughout the study and plaque assays were carried out to quantify virus titres as described in Chu and Ng (2003). Independent T-test (SPSS version 12) was used to compare the mean log10 unit virus titre between transfected cells
3.1. Reduction in viral transcripts of WNV shRNA vectors stably transfected cells The sensitivity and susceptibility of WNV to shRNAs designed against various sites in the virus genome were investigated. Cells were transfected with different plasmids and selected for using G418. Stably transfected cells were subjected to WNV infection at the M.O.I. of 10. Real-time PCR was employed to determine the effect of constitutive expression of siRNAs had on the WNV replication (Fig. 1).
Table 1 Target sites selected and used for cloning Target site/start nucleotide
Name of target construct/sequence of bottom strand oligonucleotide (5 -3 )
Name of scrambled vector-control construct/sequence of bottom strand oligonucleotide (5 -3 )
Capsid/313
pshCapsid/AGCTTTTCCAAAAAACAAACAAACAGCGATGAAG TCTCTTGAACTTCATCGCTGTTTGTTTGCG
pshcapsidscrambled/AGCTTTTCCAAAAGCCAATAGACGAAAGAACAAA TCTCTTGAATTTGTTCTTTCGTCTATTGCG
NS2B/4359
pshNS2B/AGCTTTTCCAAAAAAAGTCAACAGATATGTGGAT TCTCTTGAAATCCACATATCTGTTGACTG
pshNS2Bscrambled/AGCTTTTCCAAAAAAGGCACAAGTAGTTTAAAGATA TCTCTTGAATATCTTTAAACTACTTGTGCG
NS4B/7095
pshNS4B/AGCTTTTCCAAAAAATCACGTCAGACTACATCAA TCTCTTGAATTGATGTAGTCTGACGTGA
pshNS4Bscrambled/AGCTTTTCCAAAAAAGCAATACGTCCATCAAATACA TCTCTTGAATGTATTTGATGGACGTATT
Target sequences are indicated in bold.
294
S.P. Ong et al. / Virus Research 135 (2008) 292–297
tein expressed when compared to non-transfected WNV-infected cells at 12- and 24 h p.i., respectively (Fig. 3b). This corroborated with the number of viral transcripts produced where shRNAs produced from the two vectors were capable of producing a persistent silencing effect on WNV replication. Cells stably transfected with pshNS4B and infected with WNV were unable to produce a continuous silencing effect on WNV replication. The percentage of cells stained positive increased from 10% at 12 h p.i. to 85% at 24 h p.i. (Fig. 2k and l). Western blot analysis showed that when compared to the non-transfected and WNV-infected cells, pshNS4B-stably transfected cells had a 4-fold reduction in NS4B protein expression at 12 h p.i. but almost no difference in the amount of viral proteins produced after 24 h of infection (Fig. 3c). This trend observed in the stably transfected cells was similar to that of the transiently transfected cells (not shown). Fig. 1. Number of viral transcripts in cells stably transfected with various vectors. Viral RNA transcripts were harvested from the WNV-infected cells and subjected to real-time PCR analysis. Both pshCapsid and pshNS2B-stably transfected cells have significant lower viral transcripts at both 12- and 24 h p.i. Cells stably transfected with pshNS4B has some reduction in the number of viral transcripts produce at 12 h p.i. but shows no significant inhibition of viral transcripts production at 24 h p.i. Cells transfected with various scrambled vectors show insignificant differences in the amount of viral transcripts when compared to non-transfected WNV-infected cells at both time points. The results are shown as arithmetic means of three independently conducted experiments (±1 S.D.).
Stable cell line expressing shRNA from pshCapsid showed 4.11and 4.58-log10 unit reduction (both P < 0.05) in WNV viral transcripts when compared to the non-transfected WNV-infected cells at 12- and 24 h p.i., respectively. Cells stably transfected with pshNS2B had 4.67- and 4.40-log10 unit reduction (both P < 0.05) in the viral genome copy number at 12- and 24 h p.i., respectively when compared to non-transfected cells. Cells stably transfected with pshNS4B showed 3.81- (P < 0.05) and 0.93- (P > 0.05) log10 unit reduction in viral genome copy number at 12- and 24 h p.i., respectively. Therefore, pshNS4B was able to reduce the number of WNV transcripts at 12 h p.i. but not at 24 h p.i. Cells stably transfected with various scrambled-shRNA-vector controls did not show inhibitory effect on WNV replication. 3.2. Analysis of viral protein expression in vector stably transfected cells Non-transfected and WNV-infected cells had more than 85% of the population stained positive at both 12- (Fig. 2a) and 24 h p.i. (Fig. 2b). Cells stably transfected with pshCapsidscrambled (Fig. 2c and d) or other vector controls containing scrambled-shRNA sequences (not shown) showed similar infection patterns as the wild-type WNV-infection. Cells stably transfected with pshCapsid mock-infected acted as negative controls were all negative (Fig. 2e and f). Similar trends were observed in cells that were transfected with pshNS2B or pshNS4B and mock-infected (not shown). The infected Vero cells that were stably transfected with the pshCapsid exhibited a significant decrease in intensity and frequency of staining in IFA when compared to the cells with just WNV infection. Only 5% of the cell population emitted green fluorescence at 12 h p.i. (Fig. 2g) and this cell line maintained the fluorescence level at less than 10% of the population even at 24 h p.i. (Fig. 2h). These cells also showed a significant reduction in the level of capsid protein expressed when compared to non-transfected WNV infections in Western blot (Fig. 3a). There was an 8- and 12-fold decrease in band intensity at 12- and 24 h p.i., respectively. Similarly, cells stably transfected with pshNS2B and infected with WNV displayed only 3% and 8% of the cell population with positive fluorescence at 12- and 24 h p.i., respectively (Fig. 2i and j). These cells had 4- and 6-fold reductions in the amount of NS2B pro-
3.3. Comparison of virus particles produced in stably transfected cells Cell lines stably transfected with various vector constructs were tested for their ability to limit infectious virus production (Fig. 4). The productivity of progeny virus in cells stably transfected with pshCapsid or pshNS2B was affected. The pshCapsid-stably transfected cells showed 3.27- and 3.67-log10 unit decreased (both P < 0.05) in the number of virus produced at 12- and 24 h p.i., correspondingly. The pshNS2B-stably transfected cells had 2.23- and 2.40-log10 unit reductions (both P < 0.05) in the number of virus particles produced when compared to control cells with only WNV infection at 12- and 24 h p.i., respectively. Cells stably transfected with pshNS4B showed 1.23- (P < 0.05) and 0.49- (P > 0.05) log10 unit decrease in the number of virus particles produced when compared to the non-transfected WNV infection at 12- and 24 h p.i., respectively. 4. Discussion There are several criteria available to guide in the design of siRNA but the precise designed target is still unknown. It was therefore necessary to design several siRNAs against different target sites on the WNV genome before choosing the best knock-down site (Geiss et al., 2005; Hsieh et al., 2004). Previous attempts to interfere with WNV replication targeted the viral UTRs, E protein, Capsid and NS5 sites (Bai et al., 2005; Geiss et al., 2005; Kumar et al., 2006; McCown et al., 2003; Ong et al., 2006). Other target sites on the WNV genome have not been studied. In this study, the different sites of the genome Capsid, NS2B and NS4B were targeted to compare the efficacies of the different shRNAs in reducing WNV production. Although the siRNA WNV CAP (Capsid protein) generated from a plasmid-based vector (McCown et al., 2003) and pshCapsid in this study targeted the same region of the viral genome, it was still worth studying the effects of targeting at a shorter region of the Capsid gene. The pSilencer vector was employed to allow continuous production of shRNAs in cells as the vector backbone contained a selectable marker. This allowed the option of selecting positively transfected cells and creating a stable cell line. The cells were initially transfected transiently with the vector to determine effectiveness of shRNA generated from the plasmid in silencing WNV replication (data not shown) before creating a stable cell line as this can be a lengthy process. Vero cells that were transiently transfected with various vectors (pshCapsid, pshNS2B and pshNS4B) showed different degree of ability to silence WNV replication. Cells transiently transfected with pshCapsid and pshNS2B showed significant but not complete inhibition of virus production (data not shown). The observation is not
S.P. Ong et al. / Virus Research 135 (2008) 292–297
295
Fig. 2. Viral protein expression in vector stably transfected cell. The cells were stained for Capsid protein. Non-transfected WNV-infected cells show more than 85% emitting fluorescence at both 12- (a) and 24 h p.i. (b). pshCapsidscrambled-transfected and WNV-infected cells (c and d) show similar infection pattern as the wild-type WNV infection. pshCapsid-transfected, mock-infected cells (e and f) yield no fluorescence act as negative control. pshCapsid-transfected and WNV-infected cells stained for capsid protein have less than 10% of the cell population emitting fluorescence at both 12- (g) and 24 h p.i. (h). pshNS2B-transfected and WNV-infected cells (i and j) stained for NS2B protein have less than 10% of cell population emitting fluorescence. Ten percent of the pshNS4B-stably transfected and WNV-infected cells emit fluorescence at 12 h p.i. (k) whereas 86% of the cells produce fluorescence at 24 h p.i. (l). The numbers on the immunofluorescence denote the percentage of cells stain positive.
296
S.P. Ong et al. / Virus Research 135 (2008) 292–297
Fig. 4. Plaque assay revealing the log10 unit inhibition of virus particles production in various vectors-transfected cells. Both pshCapsid and pshNS2B-stably transfected cells display significantly lower yield of virus particles at both 12- and 24 h p.i. Cells stably transfected with pshNS4B showed some inhibition in the number of virus progeny produced at 12 h p.i. but not at 24 h p.i. Cells transfected with various vector controls show insignificant differences in the virus titre when compared to the non-transfected WNV-infected cells at both time points. The results are shown as arithmetic means of three independently conducted experiments (±1 S.D.).
Fig. 3. Western blotting of cells stably transfected with vectors. (a) Cell lysates harvested from pshCapsid stably transfected and WNV-infected cells show a 8- and 12-fold reduction in viral capsid protein production at 12- and 24 h p.i., respectively when compared to wild-type WNV infection. (b) Cell lysates harvested from pshNS2B-stably transfected and WNV-infected cells, when compared to nontransfected WNV infected cells, reveal 4- and 6-fold reductions in viral NS2B protein synthesis at 12- and 24 h p.i., respectively. (c) Cell lysates harvested from pshNS4Bstably transfected and WNV-infected cells reveal a 4-fold reduction in NS4B protein production at 12 h p.i. when compared to non-transfected counterparts. Actin is used as the well loading control to ensure equal loading of protein sample.
uncommon in oligonucleotide-based expression systems (Tuschl, 2002). Consideration should be given to the possibility that different cell types vary in their response to the introduction of siRNA vectors (Koromilas et al., 2004). Some postulations could explain this incomplete silencing of virus replication. Firstly, the transfection efficiency was only 50% (data not shown) and the increase in number of fluorescing cells over time could be due to re-infection of cells (accumulating virus proteins/progeny virus) without the vector constructs. Secondly, even though the target site for the siRNA was selected using a computer program based on certain criteria, the siRNAs may have an intrinsic inability to sustain the silencing effect. This could be due to site inaccessibility as a result of secondary structures or presence of other interacting proteins which the computer program did not factor in during the selection. Thirdly, the vector constructs may be unstable over time thus, resulting in the increase in the titre of virus particles after 24 h of infections. To determine if the lack of complete inhibition on virus replication was due to the non-homogenous population of transfected cells, positively transfected cells were selected for using antibiotic G148. These cells in turn would express shRNAs constitutively under the H1 promoter. Similar to the transient study, the stably transfected cells were infected with WNV and analyzed for the amount of viral transcripts, protein expressions and virus production. Cells stably transfected with pshCapsid showed greater inhibition in virus production than cells stably transfected with pshNS2B or pshNS4B (Fig. 4). In addition, there was a further increase of 1 log10 unit reduction in virus titre when compared to the corresponding transiently transfected cells (data not shown). This indicated that pshCapsid was most effective in reducing viral load when compared to the other vectors. Different vectors produced varying silencing effects on WNV replication. This could be due to the secondary structure of the target RNA. There is an inverse relationship between silencing potency and number of nucleotides of the siRNA target site involved in base pairing (Schubert et al., 2005). The Mfold program (hosted at http://www.bioinfo.rpi.edu/applications/mfold/rna/form1.cgi) predicted that only 18% of the nucleotides of pshCapsid target site are involved in base pairing and there is no formation of hairpin structure (results not shown). This may account for the highest potency in silencing WNV replication among the 3 target sites as the activated RISC may be able to attack the site more easily.
S.P. Ong et al. / Virus Research 135 (2008) 292–297
The pshNS2B target site has 27% of the nucleotide involved in base pairing hence, accounting for the slight reduction in the potency of siRNA generated from pshNS2B. More than 63% of the nucleotides forming the pshNS4B target site are involved in complementary base pairing which resulted in the formation of a stem structure. The remainder of the target sequence is made up of a continuous stretch of unpaired nucleotides located in between stem structures hence this may allow limited RISC binding and initiate the degradation of the RNA genome. Even though shRNA generated from pshCapsid vector gave the highest viral silencing power, there was no complete inhibition of virus replication. This may be contributed in part because flaviviruses like WNV replicate in cellular compartments protected by the virus-induced membranes. Thus, may disallow the RISC complex in the cytosol to reach the target viral genome, hence resulting in RNAi resistance which is consistent with our data. In addition, there may also be unstable expression of shRNA from the selected transfected cells (Glanville, 1985), with some cells not expressing the exogenous shRNA to target the virus genome. Studies by Bai and colleagues have shown the siRNAs is still able to offer protection against complications arising from WNV infections in the animal models even though there was no complete inhibition of virus replication. This may be useful in a ring-vaccination anti-WNV campaign. In addition, partial siRNA protection against WNV was observed by Deas et al. (2005) with high concentrations of peptide-linked phosphorodiamidate morpholino oligomers given after infection. Hence, our construct pshCapsid may also offer protection against WNV-induced complications in the animals and human. A suitable animal model can be developed to test the protective effect of pshCapsid. 5. Acknowledgements The authors thank Loy Boon Pheng for technical assistance. S.P. Ong is funded by NUS Research Scholarship and J.J.H. Chu is a Lee Kuan Yew Research Fellow. This work is supported by the Biomedical Research Council (Singapore), Project No. 01/1/21/18/003 and National University of Singapore (R-182-000-055-112). References Bai, F., Wang, T., Pal, U., Bao, F., Gould, L.H., Fikrig, E., 2005. Use of RNA interference to prevent lethal murine West Nile virus infection. J. Infect. Dis. 191, 1148–1154. Brinton, M.A., 2002. The molecular biology of West Nile Virus: a new invader of the western hemisphere. Annu. Rev. Microbiol. 56, 371–402.
297
Calos, M.P., 1998. Stability without a centromere. Proc. Natl. Acad. Sci. U.S.A. 95, 4084–4085. Chambers, T.J., Hahn, C.S., Galler, R., Rice, C.M., 1990. Flavivirus genome organization, expression, and replication. Annu. Rev. Microbiol. 44, 649–688. Chu, J.J.H., Ng, M.L., 2003. The mechanism of cell death during West Nile virus infection is dependent on initial infectious dose. J. Gen. Virol. 84, 3305–3314. Deas, T.S., Binduga-Gajewska, I., Tilgner, M., Ren, P., Stein, D.A., Moulton, H.M., Iversen, P.L., Kauffman, E.B., Kramer, L.D., Shi, P.Y., 2005. Inhibition of flavivirus infections by antisense oligomers specifically suppressing viral translation and RNA replication. J. Virol. 79, 4599–4609. Elbashir, S.M., Martinez, J., Patkaniowska, A., Lendecke, W., Tuschl, T., 2001. Functional anatomy of siRNAs for mediating efficient RNAi in Drosophila melanogaster embryo lysate. EMBO J. 20, 6877–6888. Geiss, B.J., Pierson, T.C., Diamond, M.S., 2005. Actively replicating West Nile virus is resistant to cytoplasmic delivery of siRNA. Virol. J. 2, 53–65. Glanville, N., 1985. Unstable expression and amplification of a transfected oncogene in confluent and subconfluent cells. Mol. Cell Biol. 5, 1456–1464. Hayes, E.B., Sejvar, J.J., Zaki, S.R., Lanciotti, R.S., Bode, A.V., Campbell, G.L., 2005. Virology, pathology, and clinical manifestations of West Nile virus disease. Emerg. Infect. Dis. 11, 1174–1179. Hsieh, A.C., Bo, R., Manola, J., Vazquez, F., Bare, O., Khvorova, A., Scaringe, S., Sellers, W.R., 2004. A library of siRNA duplexes targeting the phosphoinositide 3-kinase pathway: determinants of gene silencing for use in cell-based screens. Nucleic Acids Res. 3, 893–901. Koromilas, A.E., Li, S., Matlashewski, G., 2004. Control of interferon signaling in human papillomavirus infection. Cytokine Growth Factor Rev. 12, 157–170. Kumar, P., Lee, S.K., Shankar, P., Manjunath, N., 2006. A single siRNA suppresses fatal encephalitis induced by two different flaviviruses. PLoS Med. 3, 505–514. Manoharan, M., 2004. RNA interference and chemically modified small interfering RNAs. Curr. Opin. Chem. Biol. 8, 570–579. McCown, M., Diamond, M.S., Pekosz, A., 2003. The utility of siRNA transcripts produced by RNA polymerase I in down regulating viral gene expression and replication of negative- and positive-strand RNA viruses. Virology 313, 514–524. Ng, M.L., Chu, J.J.H., 2002. Interaction of West Nile and Kunjin viruses with cellular components during morphogenesis. Curr. Top. Microbiol. Immunol. 267, 353–372. Ong, S.P., Choo, B.G., Chu, J.J.H., Ng, M.L., 2006. Expression of vector-based small interfering RNA against West Nile virus effectively inhibits virus replication. Antiviral Res. 72, 216–223. Rice, C.M., Lenches, E.M., Eddy, S.R., Shin, S.J., Sheets, R.L., Strauss, J.H., 1985. Nucleotide sequence of yellow fever virus: implications for flavivirus gene expression and evolution. Science 229, 726–733. Schubert, S., Grunweller, A., Erdmann, V.A., Kurreck, J., 2005. Local RNA target structure influences siRNA efficacy: systematic analysis of intentionally designed binding regions. J. Mol. Biol. 348, 883–893. Tan, F.L., Yin, J.Q., 2004. RNAi, a new therapeutic strategy against viral infection. Cell Res. 14, 460–466. Tuschl, T., 2002. Expanding small RNA interference. Nat. Biotechnol. 20, 446–448. Tyler, K.L., 2004. West Nile virus infection in the United States. Arch. Neurol. 61, 1190–1195. Ui-Tei, K., Naito, Y., Takahashi, F., Haraguchi, T., Ohki-Hamazaki, H., Juni, A., Ueda, R., Saigo, K., 2004. Guidelines for the selection of highly effective siRNA sequences for mammalian and chick RNA interference. Nucleic Acids Res. 32, 936–948. Wadhwa, R., Kaul, S.C., Miysgishi, M., Taira, K., 2004. Know-how of RNA interference and its applications in research and therapy. Mutat. Res. 567, 71–84. Walther, W., Stein, U., 2000. Viral vectors for gene transfer: a review of their use in the treatment of human diseases. Drugs 60, 249–271.