Inhibitors of casein kinase 1 block the growth of Leishmania major promastigotes in vitro

International Journal for Parasitology 36 (2006) 1249–1259 www.elsevier.com/locate/ijpara

Inhibitors of casein kinase 1 block the growth of Leishmania major promastigotes in vitro John J. Allocco a,*, Robert Donald a, Tanya Zhong a, Anita Lee b, Yui Sing Tang c, Ronald C. Hendrickson b, Paul Liberator a, Bakela Nare a a

Department of Infectious Disease Research, Merck Research Laboratories, Merck and Co., Inc., P.O. Box 2000 Rahway, NJ 07065-0900, USA b Department of Molecular Profiling, Merck Research Laboratories, Merck and Co., Inc., P.O. Box 2000 Rahway, NJ 07065-0900, USA c Department of Drug Metabolism, Merck Research Laboratories, Merck and Co., Inc., P.O. Box 2000 Rahway, NJ 07065-0900, USA Received 13 March 2006; received in revised form 5 June 2006; accepted 9 June 2006

Abstract Casein kinase 1 (CK1) is a family of multifunctional Ser/Thr protein kinases that are ubiquitous in eukaryotic cells. Recent studies have demonstrated the existence of, and role for, CK1 in protozoan parasites such as Leishmania, Plasmodium and Trypanosoma. The value of protein kinases as potential drug targets in protozoa is evidenced by the successful exploitation of cyclic guanosine monophosphate-dependent protein kinase (PKG) with selective tri-substituted pyrrole and imidazopyridine inhibitors. These compounds exhibit in vivo efficacy against Eimeria tenella in chickens and Toxoplasma gondii in mice. We now report that both of these protein kinase inhibitor classes inhibit the growth of Leishmania major promastigotes and Trypanosoma brucei bloodstream forms in vitro. Genome informatics predicts that neither of these trypanosomatids codes for a PKG orthologue. Biochemical studies have led to the unexpected discovery that an isoform of CK1 represents the primary target of the pyrrole and imidazopyridine kinase inhibitors in these organisms. CK1 from extracts of L. major promastigotes co-fractionated with [3H]imidazopyridine binding activity. Further purification of CK1 activity from L. major and characterization via liquid chromatography coupled tandem mass spectrometry identified CK1 isoform 2 as the specific parasite protein inhibited by imidazopyridines. L. major CK1 isoform 2 expressed as a recombinant protein in Escherichia coli displayed biochemical and inhibition characteristics similar to those of the purified native enzyme. The results described here warrant further evaluation of the activity of these kinase inhibitors against mammalian stage Leishmania parasites in vitro and in animal models of infection, as well as studies to genetically validate CK1 as a therapeutic target in trypanosomatid parasites.  2006 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved. Keywords: Trypanosomatid; Leishmania; Protozoa; Imidazopyridine; Casein kinase 1

1. Introduction Invasion of the vertebrate host by the trypanosomatid protozoan parasites of the genus Leishmania can lead to a variety of disease states, ranging from cutaneous and muco-cutaneous lesions to the fatal visceral form of leishmaniasis. An estimated 350 million people live in areas where the disease is endemic, of which 12 million in Africa, Asia, Europe and the Americas are directly affected

*

Corresponding author. Tel.: +1 732 594 6573; fax: +1 732 594 6708. E-mail address: [email protected] (J.J. Allocco).

(Guerin et al., 2002; Davies et al., 2003). Leishmania is currently considered an emerging infectious disease in parts of the world where it has become closely associated with human immunodeficiency virus-acquired syndrome (Dedet and Pratlong, 2000). Leishmaniasis represents a significant source of morbidity and mortality world-wide. At present, the control of leishmaniasis relies primarily on chemotherapy with pentavalent antimonials, which require long treatment periods and are often toxic (Dedet and Pratlong, 2000; Davies et al., 2003). Unfortunately, therapy with antimonials can no longer be used in certain parts of the world due to the emergence of drug resistance (Sundar et al., 2000). Recent therapeutic alternatives have included

0020-7519/$30.00  2006 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.ijpara.2006.06.013

1250

J.J. Allocco et al. / International Journal for Parasitology 36 (2006) 1249–1259

lipid formulations of amphotericin B (originally developed for the treatment of systemic mycoses), paromomycin (an aminoglycoside for intestinal infections in late-stage clinical trials) and the newly registered lysophospholipid analog miltefosine (reviewed in Croft et al., 2005). However, none of these newer alternatives has a sufficient therapeutic window. Moreover, vaccines as alternatives to chemotherapy against leishmaniasis are not yet available nor are they anticipated in the near future. There is, therefore, a need to discover and develop effective, safe and novel anti-parasitic agents to aid in the treatment and control of leishmaniasis worldwide. One rational approach in the hunt for new anti-leishmanial drugs is to identify and target key intracellular signals that are vital to the organism’s survival within the mammalian host. The phosphorylation of serine, threonine and tyrosine by various protein kinases is a molecular event that regulates vital cellular processes and is amenable to selective targeting with small molecule drugs in a variety of disease conditions (Gross and Anderson, 1998; Knippschild et al., 2005). Casein kinase 1 (CK1), a family of multifunctional Ser/Thr protein kinases, present in all eukaryotic cells, has recently been described in various protozoan organisms (Barik et al., 1997; Knockaert et al., 2000; Calabokis et al., 2002, 2003; Spadafora et al., 2002; Galan-Caridad et al., 2004; Donald et al., 2005). In Leishmania, two constitutively shed ecto-kinases were characterized biochemically and determined to have CK1-like activities (Vieira et al., 2002; Sacerdoti-Sierra and Jaffe, 1997). It has been suggested that these kinases play a role in parasite–host interaction, perhaps by phosphorylating host proteins to facilitate the invasion process. Molecular biological studies in the trypanosomatid parasite Trypanosoma cruzi led to the identification of two cDNAs encoding the CK1 homologues TcCK1.1 and TcCK1.2 (Spadafora et al., 2002). While the molecular and biochemical properties of CK1 isoforms from trypanosomatids show overall similarity to the enzymes from other eukaryotes, the opportunity for selective inhibition of parasite versus host enzyme might exist. In a recent study, CK1 from Leishmania mexicana was identified as the molecular target of the cyclin-dependent protein kinase (CDK) inhibitor purvalanol B (Knockaert et al., 2000). The observation that purvalanol B is a more potent inhibitor of parasite than mammalian (Gray et al., 1998) CK1 activity emphasized the potential for exploitable host–parasite differences in this protein. Selective inhibition of parasite CK1 activity has also been demonstrated in a study describing the cloning, expression and biochemical and pharmacological characterization of two CK1 genes from Toxoplasma gondii (Donald et al., 2005). Several protein kinase inhibitors were evaluated, including purvalanol analogs as well as compounds that inhibit cyclic guanosine monophosphate (cGMP)-dependent protein kinase (PKG) and calmodulin like domain protein kinase (CDPK) (Donald et al., 2002, 2005; Donald and Liberator, 2002; Gurnett et al., 2002; Nare et al., 2002;

Salowe et al., 2002; Wiersma et al., 2004; Biftu et al., 2005; Liang et al., 2005). Compounds initially described as PKG inhibitors have potent activity against recombinant expressed T. gondii CDPK1 and CK1 enzymes. In the present study, we demonstrate that representative pyrrole and imidazopyridine PKG protein kinase inhibitors have potent in vitro activity against Leishmania major promastigotes and bloodstream forms of the related trypanosomatid protozoa Trypanosoma brucei. Orthologs of PKG and CDPK have not been identified in the genomes of kinetoplastid protozoans Leishmania and Trypanosoma (http://www.ebi.ac.uk/parasites/leish.html; http://www. sanger.ac.uk/Projects/T_brucei/). In binding studies using a radiolabeled imidazopyridine ligand to probe a crude promastigote protein extract, L. major CK1 isoform 2 has been identified as the primary high-affinity binding protein. These results predict an essential biochemical function for CK1 in insect stage promastigotes and warrant further evaluation of the activity of these kinase inhibitors against mammalian stage Leishmania parasites in vitro and in animal models of infection. 2. Materials and methods 2.1. Parasite cultures Insect stage promastigotes of L. major (clone CC-1 of LT252 strain) were used in all experiments. Parasites were maintained at 26 C in M199 medium supplemented with 10% FCS, hemin, adenine, biotin and biopterin as previously described (Iovannisci and Ullman, 1983). Trypanosoma brucei bloodstream-forms (Laboratory adapted 221 variant) were cultured (37 C) in HMI-9 medium containing 10% FCS and appropriate supplements (Hirumi et al., 1997). 2.2. Parasite growth inhibition assay Susceptibility of trypanosomatid parasites to test compounds was evaluated using the CellTiter-Glo luminescent cell viability assay kit (Promega). The CellTiterGlo assay is a homogeneous method of determining the number of viable cells in culture based on quantitation of the adenosine 5 0 -triphosphate (ATP) present, an indicator of metabolically active cells. Leishmania major promastigotes (2 · 105/mL) or T. brucei bloodstream form trypomastigotes (1 · 104/mL) were incubated in 100 lL of M199 and HMI-9, respectively, in opaque walled, clear bottom 96-well plates (Corning Incorporated) in the presence of increasing concentrations of test compounds. After 48 h (T. brucei) or 120 h (L. major), culture plates were equilibrated at room temperature for 30 min followed by addition of an equal volume (100 lL) of CellTiter-Glo reagent into each well. The luminescence signal was allowed to stabilize for 10 min and plates were read using a 1450 Microbeta Trilux luminescence detector (PerkinElmer).

J.J. Allocco et al. / International Journal for Parasitology 36 (2006) 1249–1259

2.3. Purification of CK1 activity from L. major Leishmania major promastigotes were harvested from 20 L of M199 medium by centrifugation at 10,000g for 30 min and the resulting pellet (10 mL) was washed in PBS. The final parasite pellet was suspended in 10 mL of cold lysis buffer, which consisted of buffer A (50 mM Hepes, pH 7.2, 10% glycerol, 1 mM dithiothreitol (DTT)) supplemented with 1% NP40 and a protease inhibitor cocktail (Complete tablets, Roche Applied Science). The suspension was sonicated with a Branson Sonifier microtip, centrifuged at 100,000g for 30 min and the supernatant (S100) filtered through a 0.22 lm filter (Millipore). The S100 fraction (355 mg protein) was loaded onto a 5 mL HiTrap S cation-exchange column and purification carried out on a fast protein liquid chromatography (FPLC) system (GE-Pharmacia) maintained at 4 C. Proteins were eluted using a 0–0.5 M NaCl gradient in buffer A (5 mM NaCl/mL) using a flow rate maintained at 2 mL/min. Column fractions (2 mL) were collected and monitored for the presence of CK1 activity using a-casein as substrate in a 33 P 96-well phosphocellulose plate kinase assay (described in Section 2.6). Fractions containing CK1 activity were pooled, concentrated (Amicon Ultra. Unit 15,000 Da MWCO), slowly brought to a final concentration of 1 M (NH4)2SO4, then filtered (0.22 lm pore size). The filtered solution was loaded (8.3 mg) onto a phenyl superose PC 1.6/5 hydrophobic interaction chromatography (HIC) column (GE-Pharmacia) at room temperature. Purification was performed using a SMART FPLC system (GE-Pharmacia). A descending (NH4)2SO4 gradient in buffer A was applied (1–0 M, 20 mM (NH4)2SO4/min) at a flow rate of 0.05 mL/min. Fractions of 100 lL were collected, assayed for CK1 activity and active fractions pooled for the final purification step by affinity chromatography on an a-casein matrix. a-Casein agarose (1 mL, Sigma–Aldrich) equilibrated with cold buffer A containing 120 mM NaCl was combined in a 5 mL tube with 1.5 mL of the pooled active fractions from HiTrapS or HIC chromatography steps. Binding was allowed to proceed for 2.5 h at 4 C on a rotator. The resin–protein mixture was transferred to a 5 mL column and washed with 3 mL of buffer A. Bound proteins were eluted with 1 M arginine in buffer A. Twenty 250 lL fractions were collected and tested for kinase activity. Fractions 1–6 were run on SDS–PAGE for Coomassie staining and Western blot analysis. 2.4. Expression and purification of recombinant CK1 from L. major A PCR fragment corresponding to the L. major CK1 isoform 2 (LmCK1-2) open reading frame was amplified from L. major genomic DNA with Herculase Taq polymerase (Stratagene). DNA was prepared from a cell pellet derived from 20 mL of cultured promastigotes, using a standard bacteriophage lambda DNA extraction procedure involving proteinase K–SDS digestion, phenol/chloroform

1251

extraction and ethanol precipitation. The following primers were used (sense, ATGAACGTGGAACTGCGCGTCG GCAAC; antisense, CACTACTGCTGCTCTGGCGCA CCCGATTC). The PCR product was cloned into the TOPO PCR4 vector (Invitrogen) and integrity confirmed by DNA sequence analysis. An N-terminal FLAG-epitope tag was appended with another round of PCR amplification with KOD polymerase (Novagen) using a modified sense primer (ATGGACTACAAAGACGATGACGA CAAGAACGTGGAACTGCGCGTCGGCAA). The purified product was blunt-ligated into the pETBlue-1 expression vector (Novagen) and the resulting plasmid recombinant transformed into Escherichia coli strain BL21 Rosetta-Gami (Novagen). One liter cultures (OD600  0.5) were induced with isopropyl-b-D-thiogalactopyranoside (500 lM) at 30 C for 5 h and cell pellets frozen for later use. For purification, the E. coli cell pellet from 1 L of induced culture was suspended in 40 mL of chilled buffer A supplemented with protease inhibitor cocktail (Complete tablets, Roche Applied Science) and 40 lg/mL soybean trypsin inhibitor. The suspension was sonicated and an S100 lysate prepared by ultracentrifugation at 100,000g. The supernatant (30 mL) was filtered through a 0.22 lm syringe filter (Millipore) and purified on a cation exchange column (HiTrapS, GE-Pharmacia) as described for the native enzyme. Pooled active fractions were batch-adsorbed onto anti-FLAG-agarose beads (1 mL, Sigma) with gentle mixing. The mixture poured into a disposable column, washed with 5 mL Hepes buffer (10 mM pH 7.4, 10% glycerol, 1 mM DTT) and bound protein was eluted with 0.5 mg/mL FLAG peptide in Hepes buffer. Eluted protein was washed in peptide-free buffer by three rounds of spin filtration in an Amicon ultra centrifugal filter device, using 5 mL volumes of buffer each time (Millipore, 5000 Da MWCO). This material was used for enzyme assays. For precise protein quantitation a trichloroacetic acid–sodium deoxycholate precipitation was used to remove residual FLAG peptide (Brown et al., 1989). Protein concentration was measured with a micro-bicinchoninic acid reagent (Pierce). 2.5. Synthesis of radiolabeled imidazopyridine The synthesis of 4-[2-(4-fluorophenyl)-5-(1-methylpiperidine-4-yl)-1H-pyrrol-3-yl]pyridine (compound 1), 2(4-[7[(dimethylamino)methyl]-2-(4-fluorophenyl)imidazol[1,2-a]pyridine-3-yl]pyridine-2-amine) (compound 2) and other related compounds has been described (Liang et al., 2005; Biftu et al., 2005, 2006). For synthesis of a radiolabeled imidazopyridine, a solution of bromo-compound 2(4-[2-(3bromo-4-fluorophenyl)-7-(1-methylpiperidin-4-yl)imidazo[1,2-a]pyridin-3-yl]pyrimidin-2-amine; 8 mg, 0.016 mmol) in 0.8 mL of anhydrous dimethylformamide was de-gassed on dry ice/acetone in the presence of 5 mg 10% Pd/C and 3 mg of 5% Pd/CaCO3 (both from Sigma–Aldrich). The mixture was stirred on ice for 2 h under 120 mmHg of

1252

J.J. Allocco et al. / International Journal for Parasitology 36 (2006) 1249–1259

carrier-free tritium gas (1.2 Ci, American Radiochemical Chemicals). Any un-reacted tritium gas was removed, the catalyst was filtered through a syringe-less filter device (Whatman Autovial, 0.45 lm polytetrafluoroethylene) and the solvent and labile tritium were concentrated to near dryness. The dried residue was suspended in 2 mL of ethanol and the radiolabeled product was purified by HPLC (Zorbax, SBCN HPLC column, 9.4 mm · 25 cm, CH3CN/ H2O/TFA, 15:85:0.1 to 20:80:0.1 in 25 min). Tritiated compound 2 eluted with a retention time of 15 min and was assayed by analytical HPLC column, Zorbax SBCN column at CH3CN/H2O/TFA, 17:83:0.1. The compound was 99% radiochemically pure and had a specific activity of 15 Ci/mmol with a total radiochemical yield of 260 mCi. 2.6. Protein kinase activity and ligand binding assays CK1 activity was measured using 96-well phosphocellulose plates (MAPHNOB, Millipore) which trap [33P]phosphorylated peptides or protein substrates (Donald and Liberator, 2002). Enzyme assay reactions were performed using 40 lL of 25 mM Hepes, pH 7.4, 16 mM MgCl2 buffer containing 5 mM glycerophosphate, 1 mM DTT, 80 lg/ mL a-casein substrate, 400 lg/mL BSA, 1 lM ATP and 5 nM [c-33P]ATP (3000 Ci/mmol, NEN/DuPont). Reactions were allowed to proceed for 45 min after addition of enzyme. The reaction was stopped by addition of 45 lL of 50 lM phosphoric acid and the phosphorylated peptide substrate was captured onto 96-well phosphocellulose plates by vacuum filtration. The plates were washed three times with 200 lL each of 75 mM phosphoric acid and allowed to dry. Scintillation fluid (100 lL) was added to each well, the plate was sealed and then counted in a 1450 Microbeta scintillation counter (Perkin-Elmer). CK1 substrate specificity and compound inhibition assays were performed using the native LmCK1 preparation following HiTrapS and HIC column chromatographic steps. Substrate specificity assays were performed as previously described (Donald et al., 2005). Partially dephosphorylated a-casein and kemptide (LRRASLG-OH) substrates were obtained from Sigma. The CK2 (RRADDSDDDDDOH), Syntide-2 (PLARTLSVAGLPGKK-OH) and CaM kinase II substrates (281–291, MHKNETVECLK-NH2) were purchased from EMD Biosciences (Calbiochem). The CK1 phosphopeptide substrate (KRRRALS(p)VAS LPGL-OH) was synthesized by Anaspec. Binding assays were performed following analytical fractionation of a L. major S100 fraction using a 5 ml HiTrap S column. Column fractions following NaCl gradient elution (0–500 mM using four column volumes) were collected for assay. Twenty microlitres of each column fraction was assayed in a total volume of 100 lL. Binding reactions contained 20 mM Hepes, pH 7.4, 1 mM MgCl2, 0.1 mg/mL BSA and 400 nM [3H]compound 2 (15 Ci/ mmol). A duplicate reaction contained 10 lM unlabeled ligand competitor to test for specificity. Reactions were incubated at room temperature for 30 min and a 50 lL

sample of the reaction mix was loaded onto a 96-well filter block (Edge BioSystems) containing a G-25 sephadex-like resin. The unit was spun at 1500 rpm for 2 min. Proteins and large molecules elute in the filtrate while small molecules and unbound compound are retained. The filtrate was collected in 96-well plates to which 150 lL of scintillation cocktail was added and the plates counted for 1 min in a 1450 Microbeta Trilux Detector (Perkin-Elmer). 2.7. Gel electrophoresis and protein identification by mass spectrometry For Western blot analysis, proteins were separated by Tris/glycine SDS–PAGE, transferred onto nitrocellulose membranes and probed with an anti-peptide antibody raised against a conserved internal peptide (HQHIP YREGKNLTGTARYAS) of CK1 as previously described (Donald et al., 2005). For protein identification by mass spectrometry, gels were stained with GelCode Colloidal Commassie blue stain (Pierce) or a mass spectrometry compatible silver stain (Shevchenko et al., 1996). Briefly, gels were fixed for 1 h in 50% methanol, 5% acetic acid, washed for 1 h in 50% ethanol and reduced for 2 min in 0.02% sodium thiosulfate. Gels were washed for 1 min in water, stained for 20 min with 0.2% silver nitrate in 0.075% formaldehyde and developed with 3% sodium carbonate in 0.05% formaldehyde, 0.04% sodium thiosulfate solution until protein bands were visible. The development reaction was stopped with 5% acetic acid. Bands of interest were excised, diced into 1 mm2 pieces, combined into ethanol washed and siliconized 0.5 mL Eppendorf tubes (Sigma– Aldrich) and destained in 50% methanol, 5% acetic acid overnight. In-gel digestion was carried out as described (Shevchenko et al., 1996). Briefly, gel bands were reduced in a 10 mM DTT solution for 30 min at room temperature, followed by alkylation in 50 mM iodoacetamide for 30 min at room temperature. Gel bands were then washed by a series of dehydration and re-hydration steps using acetonitrile and 100 mM ammonium bicarbonate. The gel pieces were re-hydrated in a 20 ng/lL sequencing grade modified trypsin (Promega) solution for 10 min. The trypsin solution was removed, replaced with 50 mM ammonium bicarbonate and the digestion was allowed to proceed overnight at 37 C. The peptides were extracted with a solution of 5% formic acid in 50% acetonitrile, lyophilized and suspended in 20 lL of 0.1 M acetic acid solution for l liquid chromatography coupled tandem mass spectrometry (lLC–MS/ MS) analysis. Digested peptides were loaded on a 75 lm i.d. fused silica column packed with Jupiter C18, run on Deca XP Plus ion trap MS system (Thermo Finnigan) in standard data dependent acquisition mode using one full scan MS followed by four MS/MS scans for the most abundant ions in each full scan. The HPLC gradient was a 0–90% (linear) acetonitrile for 45 min on an HP 1100 separation system (Agilent Technologies). Peptide spectra were submitted to SEQUEST (Merck & Co.) in order to search against a

J.J. Allocco et al. / International Journal for Parasitology 36 (2006) 1249–1259

non-redundant protein sequence database. Spectra from positive peptide identification hits were manually verified. 3. Results 3.1. Inhibition of parasite growth in vitro Inhibitors of parasite cGMP-dependent protein kinase (PKG) have potent in vitro and in vivo activity against Apicomplexan protozoan parasites (Donald et al., 2002, 2005; Donald and Liberator, 2002; Gurnett et al., 2002; Nare et al., 2002; Biftu et al., 2005, 2006). Such inhibitors include trisubstituted pyrroles (typified by compounds 1 and 3 in Table 1) and, more recently, trisubstituted imidazopyridines (compounds 2 and 4). These two structural classes of protein kinase inhibitors were evaluated for activity against tyrpanosomatid protozoan parasites grown in vitro. In whole cell growth inhibition assays, both L. major and T. brucei parasites were found to be sensitive to the tri-substituted pyrroles and imidazopyridines with low micromolar IC50 values (Table 1). Consistent with their relative antiparasitic activity against the Apicomplexan parasites, compound 1 is less potent than the two imidazopyridines. However, reversal of the 4-pyridyl and 4-fluorophenyl groups in tri-substituted pyrrole compound 1 (to give compound 3) improved whole cell antiprotozoal activity fourfold against both L. major and T. brucei. The activity of the reverse polarity pyrrole (compound 3) is

1253

comparable with both imidazopyridine compounds. In general, the compounds are three to sevenfold more potent against L. major promastigotes than T. brucei trypomastigotes, perhaps reflecting differences in culture conditions, growth rates or sensitivity at the primary protein kinase target(s). Parasites retain flagella-dependent motion at compound concentrations greater than the IC50, suggesting that the compounds are probably static in their activity against these trypanosomatids. Compounds 1 and 2 are also cytostatic against coccidians (Nare et al., 2002). None of the compounds displayed significant toxicity in HeLa cell viability assays at levels up to 50 lg/mL (equivalent to at least 70· the IC50 values, data not shown). 3.2. Purification and characterization of CK1 from L. major PKG has been validated as the primary molecular target of compound 1 (Donald et al., 2002) and compound 4 (Donald et al., 2006) in T. gondii. In contrast, there are no clear PKG orthologues in the L. major (http://www. ebi.ac.uk/parasites/leish.html) or T. brucei genomes (http://www.sanger.ac.uk/Projects/T_brucei/). Recent evidence suggested casein kinases could be secondary targets (Donald et al., 2005, 2006). Therefore, native casein kinase activity was purified from L. major to determine whether CK1 is the biochemical target(s) of pyrrole and imidazopyridine activity in trypanosomatid protozoa. An S100 protein fraction from L. major promastigotes was fraction-

Table 1 Inhibition of trypanosomatid parasite growth in vitro and Leishmania major CK1 activity Compound ID

L. majora (lM)

T. bruceib (lM)

nLmCK1 (nM)

rLmCK1 (nM)

2.1

10

40

42

N

1 N

N

F

CH3

F N

2

N N

N

CH3

0.5

3.3

9

9

0.6

2.7

7

8

0.2

0.56

8

6

N NH2

F

3 N

N

N

CH3

F N

4

N N

H3C N CH3

N NH2

The whole cell activity of four protein kinase inhibitors was measured against Leishmania major promastigotesa and Trypanosoma brucei trypomastigotesb cultured in vitro (inhibition of growth by 50%  IC50). Inhibition of native (nLmCK1) and recombinant (rLmCK1) L. major casein kinase 1 activity is also presented as an IC50 value.

J.J. Allocco et al. / International Journal for Parasitology 36 (2006) 1249–1259

140

40

70

20

35 0

0 10

15 20 25 30 Fraction Number

35

140 Kinase Activity (CPM x 10-3)

0

100

750

80

600 450 No Inhibitor + Imidazopyridine

40

300

20

150

5

10

15

20

60 40 20

5

10 15 Fraction Number

100

20

1000 HiTrapS - Recombinant LmCK1

0 0

No Inhibitor + Imidazopyridine

80

0

D

1100 900

0

α-casein -casein- Native – Native CK1 CK1

0

120

60

200

100

40

B

HIC - Native LmCK1

400

120

25

Kinase Activity (CPM x 10-3)

B

5

600

(NH4)2SO4 (mM)

0

800

C

80

800

60

600

40

400 No Inhibitor + Imidazopyridine

20

NaCl (mM)

80

1000

aCl

28 0

160

To establish the absolute identity of the 40 kDa protein in the biochemical fraction with compound 2 sensitive CK1 enzyme and [3H]compound 2 ligand binding activities, the

1MN

A

3.3. Identification of CK1 by mass spectrometry

1MA rg

560 HiTrapS - Native LmCKI

ered a single peak of compound 2 sensitive CK1 activity. The purification of native L. major CK1 activity is summarized in Table 2. Fractions eluted from the casein affinity matrix with compound 2 sensitive CK1 activity were resolved by SDS–PAGE. A prominent 40 kDa molecular weight protein was evident upon Coomassie staining in those fractions with CK1 enzyme activity (Fig. 2A, lanes 6–8). The identity of this protein as an L. major CK1 isoform is supported by immunoreactivity with antisera to an internally conserved peptide designed to recognize most CK1 proteins (Fig. 2B).

Kinase Activity (CPM x 10-3)

320

-3

Kinase Activity (CPM x 10 )

A

Compound Binding (CPM)

ated by HiTrap S cation exchange chromatography and activity was tracked using both [3H]compound 2 ligand binding and casein kinase activity assays in parallel. A single major peak of CK1 activity (fractions 15–22) eluting at 250–300 mM NaCl was identified which was completely coincident with binding to [3H]compound 2 (Fig. 1A). The CK1 activity in these fractions was inhibited when assayed in the presence of 250 nM compound 2 (data not shown). In subsequent preparative purification steps, CK1 activity was followed by monitoring phosphotransferase activity in the presence and absence of 250 nM of compound 2 (Fig. 1). Active fractions from the HiTrap S column were pooled and further purified by hydrophobic interaction chromatography. A single peak of compound 2 sensitive CK1 activity (fractions 13–19) was obtained (Fig. 1B). A third chromatographic step, affinity purification on an a-casein affinity column (Fig. 1C), also uncov-

NaCl (mM)

1254

200 0

0 0

5

10 15

Fraction Number

20 25

30 35 40

Fraction Number

Fig. 1. Biochemical purification of Leishmania major casein kinase 1 (CK1). Soluble crude extracts (S100) from L. major promastigotes were fractionated on an analytical HiTrap S column (A). Following elution with a NaCl gradient (blue line), fractions were characterized both with a CK1 catalytic assay (black circles) using the a-casein substrate as well as a [3H]compound 2 binding assay (red triangles). CK1 enzymatic activity and [3H]compound 2 binding activity co-elute both on an analytical (as shown in panel A) and a preparative HiTrap S scale (not shown). Further preparative purification of L. major CK1 was monitored using the casein kinase activity assay. Active fractions from a preparative HiTrap S chromatographic step were pooled and further purified by hydrophobic interaction (B) and a-casein affinity (C) chromatographies. HiTrapS purification of recombinant LmCK1-2 expressed in Escherichia coli is also shown (D). CK1 activity was determined in the absence (filled circles) or presence (filled triangles) of 250 nM compound 2. Table 2 Purification of native Leishmania major CK1 Biochemical fraction (chromatographic step)

Total protein (mg)

Specific activity (cpm/min/mg)

Fold purification

Crude S100 HiTrapS HIC a-Casein

355 8.3 0.9 0.2

0.01 36.99 1195.27 28032.38

– 1 32.31 757.84

J.J. Allocco et al. / International Journal for Parasitology 36 (2006) 1249–1259

A 97 66 45 30 20 14

Lanes: 1

2

3

4

5

6

7

8

B 120 100 80 60 50 40 30 20

Lanes: 1

2

3

4

5

6

7

8

Fig. 2. SDS–PAGE and Western blot analysis of casein kinase 1 (CK1) purified from Leishmania major. Samples were separated on SDS–PAGE gels and stained with Coomassie blue (A) or transferred onto nitrocellulose and probed with antisera to an internal CK1 peptide sequence (B). Samples are as follows: soluble L. major protein lysate (lane 1); pooled active fractions from the HiTrapS cation exchange column (lane 2); fractions 1–6 from the a-casein affinity purification (lanes 3–8). Migration of protein molecular weight standards is indicated.

band was excised from SDS–PAGE gels and subjected to mass spectrometry analysis. Two CK1 sequences with predicted molecular weights of 37.13 kDa (LmCK1 isoform 1, LmCK1-1, AAF35364) and 39.92 kDa (LmCK1 isoform 2, LmCK1-2, AAF35365) are annotated in the Leishmania genome database (http://www.ebi.ac.uk/parasites/leish. html). The LmCK1-1 and LmCK1-2 isoforms are approximately 60% identical, differing primarily at the C-terminal end where LmCK1-2 has a 26 amino acid extension. Eleven of the 15 peptide sequences identified by mass spectrometry selectively map to the deduced amino acid sequence for isoform 2 of LmCK1. The remaining four CK1 peptides are identical to sequence that is common in both LmCK11 and LmCK1-2 isoforms (Fig. 3), as well as CK1 proteins from other organisms (e.g., Drosophila melanogaster CK1). The lack of any peptide sequences that map selectively to LmCK1-1 minimizes the likelihood that this isoform is a component of the purified biochemical preparation. 3.4. Leishmania major CK1 substrate specificity and inhibitor studies To further characterize the biochemical properties of L. major CK1, a variety of peptides and casein protein were

1255

tested for their ability to serve as phosphorylation substrates for the enzyme (Table 3). Native LmCK1 activity showed a strong preference for the phosphorylated CK1specific peptide (KRRRALS(p)VASLPGL) with a Km of 27 lM and a Vmax of 0.58 nmol/min/mg. Two other peptide substrates, syntide 2 and kemptide, exhibited Vmax values four to fivefold lower, 0.15 and 0.11 nmol/min/mg, respectively. The CDPK and CK2-specific peptide substrates were not phosphorylated. In addition, a-casein proved to be an excellent substrate with a Vmax of 0.27 nmol/min/mg and a Km of 4 lM. These data are consistent with the identity of the purified protein as being CK1. The LmCK1-2 gene was amplified from L. major genomic DNA and expressed in E. coli for comparative evaluation of activity with the native protein purified from cultured promastigotes. Purification of recombinant FLAG-tagged LmCK1-2 from E. coli lysates by cation exchange chromatography produced a profile similar to that obtained with native material (Fig. 1D). Overall recovery of recombinant LmCK1-2 from E. coli was 200 lg/L of culture after a final affinity step using FLAG-agarose beads. Like the purified native LmCK1 protein, recombinant LmCK1-2 migrated as a 40 kDa band on SDS–PAGE and was recognized immunologically with the CK1 antipeptide antiserum (not shown). Like the native enzyme, the purified recombinant enzyme is twofold more active with the CK1 phosphopeptide substrate than with a-casein (Table 3). Other peptide substrates tested showed little (e.g., kemptide) or no activity. The relative sensitivity of native and recombinant LmCK1-2 activity to the pyrrole and imidazopyridine inhibitors is indistinguishable from one another (Table 1). This observation helps to further strengthen the conclusion that the protein purified from L. major is CK1 isoform 2. Of the four compounds, the activity of both the native and recombinant expressed enzymes is least sensitive to compound 1, with IC50 values of 40 and 42 nM, respectively. The stereoisomer of compound 1 (compound 3) and both of the imidazopyridines are considerably more potent (IC50 values range from 6 to 9 nM). This is also consistent with the relative potency of these compounds in the whole cell parasite growth assays. 4. Discussion Pyrroles and related heterocycles have previously been described as protein kinase inhibitors in a program targeting human p38 kinase for the control of inflammatory disorders (de Laszlo et al., 1998; Gum et al., 1998; Lisnock et al., 1998). More recently, the trisubstituted pyrrole, 4[2-(4-fluorophenyl)-5-(1-methylpiperidine-4-yl)-1H-pyrrol3-yl]pyridine (i.e., compound 1), was shown to have broadspectrum antiprotozoal activity against apicomplexan parasites both in vitro and in vivo (Gurnett et al., 2002; Donald and Liberator, 2002; Donald et al., 2002, 2005; Nare et al., 2002; Salowe et al., 2002; Wiersma et al., 2004; Biftu et al., 2005; Liang et al., 2005). The principle molecular tar-

1256

J.J. Allocco et al. / International Journal for Parasitology 36 (2006) 1249–1259

Fig. 3. Liquid chromatography coupled tandem mass spectrometry peptide sequences from the purified [3H]compound 2 binding protein align with the predicted open reading frame of Leishmania major casein kinase 1 (LmCK1) isoform 2. Protein sequence alignment of LmCK1-1 (AAF35364) and LmCK1-2 (AAF35365) isoforms retrieved from the Leishmania major genome database (http://www.ebi.ac.uk/parasites/leish.html) with human isoform CK1e (gi:23199991). Amino acid sequence identity for all three entries is marked with an asterisk. Amino acid sequences in red correspond to peptides identified from mass spectrometry that only align with LmCK1 isoform 2. Those in blue are common to both isoform 1 and isoform 2. No peptide sequences unique to CK1 isoform 1 were identified. Peptide sequences were identified using automated database searching. The antisera used in this study for Western blot analysis was raised against the boxed peptide epitope and due to sequence identity should recognize both L. major CK-1 isoforms.

Table 3 Kinetic parameters of partially purified native and pure recombinant Leishmania major CK1-2 Substrate

a-Casein CK1 phosphopeptide Kemptide Syntide 2 CaMKII CK2

nLmCK1-2

rLmCK1-2

Vmax(app)

Km(app)

Vmax(app)

Km(app)

0.27 0.58 0.11 0.15 IA IA

4 27 19 88 IA IA

5 11 0.1 IA IA IA

2 42 60 IA IA IA

Values for Vmax(app) (nmol/min/mg protein) and Km(app) (lM) were calculated using curve-fitting software (Graphpad Prism). ‘IA’ is inactive.

get of compound 1 and related compounds in apicomplexan protozoa is PKG. To improve upon the inhibitory activity against parasite PKG, a synthetic medicinal chemistry

effort focused on the alternative imidazopyridine scaffold was initiated and led to the synthesis of more potent analogues such as 2,4-[7-(dimethylamino)methyl]-2-(4-fluorophenyl)imidazol[1,2-a]pyridine-3-yl]pyrimidin-2-amide (Compound 2, Biftu et al., 2006). PKG is absent in kinetoplastid parasites such as Leishmania and Trypanosoma, leading to the speculation that both tri-substituted pyrrole and imidazopyridine kinase inhibitors might not have antiparasitic activity against trypanosomatids. To the contrary, we demonstrate in the present study that both compound 1 and compound 2 inhibit the growth of L. major promastigotes and T. brucei bloodstream forms in vitro. The in vitro activity of pyrrole and imidazopyridine inhibitors is comparable to or better than that of some compounds currently used for the treatment of human leishmaniasis (Croft et al., 2005).

J.J. Allocco et al. / International Journal for Parasitology 36 (2006) 1249–1259

We have recently reported that compound 1 and compound 2 inhibit the activity of secondary protein kinases in apicomplexan parasites, including calmodulin-like domain protein kinase and CK1 (Donald et al., 2006). We therefore sought to identify whether either of these secondary kinases or an unrelated protein kinase was the molecular target of these inhibitors in trypanosomatids. Biochemical fractionation of crude lysates prepared from L. major promastigotes yielded a single peak of [3H]imidazopyridine binding activity which was coincident with CK1 catalytic activity. Co-purification of ligand binding activity with CK1 catalytic activity suggests that CK1 is the primary molecular target of this class of inhibitors in L. major promastigotes. There is precedence for CK1 as a potential therapeutic target in protozoa. The CDK inhibitor purvalanol B blocks parasite growth in vitro and has been used to affinity purify CK1 from crude lysates, including those derived from Plasmodium, Toxoplasma, Trypanosoma and Leishmania parasites (Knockaert et al., 2000). Results from our present study show that the catalytic activity of both native and recombinant L. major CK1 isoform 2 (LmCK1-2) is very sensitive to compound 1 and compound 2, consistent with the hypothesis that this isoform is responsible, at least in part, for the efficacy of these compounds against trypanosomatid protozoans. Both compounds are considerably less potent as inhibitors of vertebrate (rat) CK1 activity (Donald et al., 2005, 2006). LmCK1-2 displays structural and enzymatic properties that are characteristic of eukaryotic CK1 enzymes (Knippschild et al., 2005). Within the catalytic domain, LmCK1-2 has significant amino acid sequence identity (>70% identity) with CK1 orthologs from other protozoan parasites (Donald et al., 2005) and with human CK1 (Fig. 3). In contrast, there is considerable divergence at the C-terminal end of the respective proteins. The molecular weight of LmCK1-2 (40 kDa) is within the range that is typical of CK1 isoforms from a variety of organisms (37– 51 kDa). Although the data described in this manuscript is consistent with the conclusion that CK1 is the primary target of the pyrrole and imidazopyridine inhibitors, formal proof of this will require additional studies such as ligand-residue interaction analysis to define the precise nature of the compound binding site and the role of conserved amino acid residues. Unfortunately, CK1 enzymes do not exhibit a high degree of homology with the catalytic domains of PKG and CDPK1, where extensive mutational analysis has been performed and the role of critical compound binding residues has been defined (Donald et al., 2002, 2006). While the current biochemical data suggest strongly that L. major CK1-2 is a major target of imidazopyridines and tri-substituted pyrroles, database searches revealed the presence of a second CK1 sequence (LmCK1-1) coding for a somewhat shorter protein (37 kDa) exhibiting significant sequence identity to LmCK1-2 within the catalytic domain. We were unable to detect a protein product corresponding to LmCK1-1 in our biochemical and immunolog-

1257

ical analyses. The peptide antigen used to generate the antibody used for Western blotting in our studies is conserved in all CK1 proteins (identical sequence in the two L. major CK1 isoforms, Fig. 3). However, the antisera did not detect an LmCK1-1 protein product either in L. major crude extracts or in any of the semi-purified biochemical fractions, leading us to conclude that expression of this second isoform is negligible in L. major promastigotes. By analogy, differential expression of two CK isoforms in T. gondii has been reported. The higher molecular weight TgCKa protein (49 kDa) is not expressed in tachyzoites while TgCKb (38 kDa) is readily detectable (Donald et al., 2005). The catalytic activities of the two TgCK isoforms are differentially sensitive to the trisubstituted pyrroles. Recombinant TgCKa is sensitive to compound 1, while TgCKb is not. TgCKb expressed in T. gondii tachyzoites is localized to the plasma membrane, a process mediated by the rather large C-terminal extension that TgCKa does not contain. The primary sequence of the two LmCK1 isoforms also differs significantly at the C-terminal ends and may ultimately direct their differential subcellular distribution in a similar fashion. In the related trypanosomatid protozoa T. cruzi, two CK1 isoforms have also been identified. Expression of the larger TcCK1.2 isoform (37 kDa) is more robust than that of the much smaller TcCK1.1 (16 kDa) protein (Spadafora et al., 2002). The finding of LmCK1-2 as a biochemical target of the anti-parasitic activity of the pyrrole and imidazopyridine class of kinase inhibitors, implicates this protein in cellular processes that are vital for the survival of Leishmania promastigotes in culture. CK1 isoforms are known to phosphorylate and potentially regulate a broad range of protein substrates including cytoskeletal proteins, adhesion factors, receptors and membrane transporters (Knippschild et al., 2005). Like many eukaryotic cells, in response to environmental changes Leishmania promastigotes release exo-kinases that include casein kinase-like activity (Sacerdoti-Sierra and Jaffe, 1997). Released Leishmania exo-kinases phosphorylate C3, C5 and C9 proteins of human complement (Hermoso et al., 1991). Both the classical and alternative system of human complement are inactivated by C3 phosphorylation leading to the hypothesis that shed exo-kinase activity may play a role in parasite survival within the host. However optimal conditions for the release of CK1 from promastigotes are consistent with the local environment in the insect vector (Vieira et al., 2002). Exo-kinase release from promastigotes is substantially reduced at pH 5.5, conditions that correspond to the mammalian macrophage. Formal demonstration of CK1 expression in and release from axenic amastigotes awaits further investigation. Both trisubstituted pyrrole and imidazopyridine protein kinase inhibitors have potent in vitro activity against the trypanosomatid protozoan parasites L. major and T. brucei. Biochemical purification studies suggest that casein kinase 1 isoform 2 from L. major promastigotes is the primary high affinity intracellular target of these inhibitors.

1258

J.J. Allocco et al. / International Journal for Parasitology 36 (2006) 1249–1259

These results predict an essential biochemical function for CK1 in the insect stage promastigotes. Expression profiling studies using cDNA arrays demonstrate that CK1 expression is not restricted to this developmental stage (Almeida et al., 2004). While the LmCK1-2 isoform was not followed in this array study, expression of an alternative CK1 isoform is prominent in procyclic, metacyclic and amastigote populations of L. major. Studies to quantify LmCK1-2 expression in developmental stages of Leishmania that reside in the mammalian host and to demonstrate that the viability of these parasites is sensitive to the pyrrole and imidazopyridine kinase inhibitors are required. Of note, we report here that the viability of bloodstream forms of the related trypanosomatid T. brucei is sensitive to both classes of kinase inhibitors. Finally a demonstration of antiparasitic efficacy in an appropriate animal model(s) of infection is necessary before the potential of this enzyme as a chemotherapeutic target can be fully realized. The results presented in this manuscript justify this next round of experimental inquiry. Acknowledgements We thank Tesfaye Biftu for providing all trisubstituted pyrrole and imidazopyridine compounds used in this study, Zachary Mackey for advice on culturing trypanosomes, Robert Myers for his critical review of the manuscript, and Lex Van der Ploeg and Stephen Beverley for providing parasites. References Almeida, R., Gilmartin, B.J., McCann, S.H., Norrish, A., Ivens, A.C., Lawson, D., Levick, M.P., Smith, D.F., Dyall, S.D., Vetrie, D., Freeman, T.C., Coulson, R.M., Sampaio, I., Schneider, H., Blackwell, J.M., 2004. Expression profiling of the Leishmania life cycle: cDNA arrays identify developmentally regulated genes present but not annotated in the genome. Mol. Biochem. Parasitol. 136, 87–100. Barik, S., Taylor, R.E., Chakrabarti, D., 1997. Identification, cloning, and mutational analysis of the casein kinase 1 cDNA of the malaria parasite, Plasmodium falciparum. Stage-specific expression of the gene. J. Biol. Chem. 272, 26132–26138. Biftu, T., Feng, D., Fisher, M., Liang, G.B., Qian, X., Scribner, A., Dennis, R., Lee, S., Liberator, P.A., Brown, C., Gurnett, A., Leavitt, P.S., Mathew, J., Misura, A., Samaras, S., Tamas, T., Thompson, D., Sina, J.F., McNulty, K.A., McKnight, C.G., Schmatz, D.M., Wyvratt, M., 2006. Synthesis and SAR studies of very potent imidazopyridine antiprotozoal agents. Bioorg. Med. Chem. Lett. 16, 2479–2483. Biftu, T., Feng, D., Ponpipom, M., Girotra, N., Liang, G.B., Qian, X., Bugianesi, R., Simeone, J., Chang, L., Gurnett, A., Liberator, P., Dulski, P., Leavitt, P.S., Crumley, T., Misura, A., Murphy, T., Rattray, S., Samaras, S., Tamas, T., Mathew, J., Brown, C., Thompson, D., Schmatz, D., Fisher, M., Wyvratt, M., 2005. Synthesis and SAR of 2,3-diarylpyrrole inhibitors of parasite cGMP-dependent protein kinase as novel anticoccidial agents. Bioorg. Med. Chem. Lett. 15, 3296–3301. Brown, R.E., Jarvis, K.L., Hyland, K.J., 1989. Protein measurement using bicinchoninic acid: elimination of interfering substances. Anal. Biochem. 180, 136–139. Calabokis, M., Kurz, L., Wilkesman, J., Galan-Caridad, J.M., Moller, C., Gonzatti, M.I., Bubis, J., 2002. Biochemical and enzymatic character-

ization of a partially purified casein kinase-1 like activity from Trypanosoma cruzi. Parasitol. Int. 51, 25–39. Calabokis, M., Kurz, L., Gonzatti, M.I., Bubis, J., 2003. Protein kinase CK1 from Trypanosoma cruzi. J. Protein Chem. 22, 591–599. Croft, S.L., Barrett, M.P., Urbina, J.A., 2005. Chemotherapy of trypanosomiases and leishmaniasis. Trends Parasitol. 21, 508–512. Davies, C.R., Kaye, P., Croft, S.L., Sundar, S., 2003. Leishmaniasis: new approaches to disease control. Br. Med. J. 326, 377–382. de Laszlo, S.E., Visco, D., Agarwal, L., Chang, L., Chin, J., Croft, G., Forsyth, A., Fletcher, D., Frantz, B., Hacker, C., Hanlon, W., Harper, C., Kostura, M., Li, B., Luell, S., MacCoss, M., Mantlo, N., O’Neill, E.A., Orevillo, C., Pang, M., Parsons, J., Rolando, A., Sahly, Y., Sidler, K., Widmer, W.R., O’Keefe, S.J., 1998. Pyrroles and other heterocycles as inhibitors of P38 kinase. Bioorg. Med. Chem. Lett. 8, 2689–2694. Dedet, J.P., Pratlong, F., 2000. Leishmania, Trypanosoma and monoxenous trypanosomatids as emerging opportunistic agents. J. Euk. Micro. 47, 37–39. Donald, R.G., Allocco, J., Singh, S.B., Nare, B., Salowe, S.P., Wiltsie, J., Liberator, P.A., 2002. Toxoplasma gondii cyclic GMP-dependent kinase: chemotherapeutic targeting of an essential parasite protein kinase. Euk. Cell 1, 317–328. Donald, R.G., Liberator, P.A., 2002. Molecular characterization of a coccidian parasite cGMP dependent protein kinase. Mol. Biochem. Parasitol. 120, 165–175. Donald, R.G., Zhong, T., Meijer, L., Liberator, P.A., 2005. Characterization of two T. gondii CK1 isoforms. Mol. Biochem. Parasitol. 141, 15–27. Donald, R.G.K., Zhong, T., Nare, B., Dan, Y., Liberator, P.A., 2006. Identification of secondary targets of a potent anti-parasitic inhibitor of coccidian cGMP-dependent protein kinase. Mol. Biochem. Parasitol. 149, 86–98. Galan-Caridad, J.M., Calabokis, M., Uzcanga, G., Aponte, F., Bubis, J., 2004. Identification of casein kinase 1, casein kinase 2, and cAMPdependent protein kinase-like activities in Trypanosoma evansi. Mem. Inst. Oswaldo Cruz. 99, 845–854. Gray, G.S., Wodicka, L., Thunnissen, A.M.W.H., Norman, T.C., Kwon, S., Espinoza, F.H., Morgan, D.O., Barnes, G., LeClerc, S., Meijer, L., Kim, S.H., Lockhart, D.J., Schultz, P.G., 1998. Exploiting chemical libraries, structure, and genomics in the search for kinase inhibitors. Science 281, 533–538. Gross, S.D., Anderson, R.A., 1998. Casein kinase I: spatial organization and positioning of a multifunctional protein kinase family. Cell Signal. 10, 699–711. Guerin, P.J., Oliaro, P., Sundar, S., Boelaert, M., Croft, S.L., Desjeux, P., Wasunna, M.K., Bryceson, A.D., 2002. Visceral leishmaniasis: current status of control, diagnosis, and treatment, and a proposed research and development agenda. Lancet Infect. Dis. 2, 494–501. Gum, R.J., McLaughlin, M.M., Kumar, S., Wang, Z., Bower, M.J., Lee, J.C., Adams, J.L., Livi, G.P., Goldsmith, E.J., Young, P.R., 1998. Acquisition of sensitivity of stress-activated protein kinases to the p38 inhibitor, SB 203580, by alteration of one or more amino acids within the ATP binding pocket. J. Biol. Chem. 273, 15605–15610. Gurnett, A.M., Liberator, P.A., Dulski, P.M., Salowe, S.P., Donald, R.G.K., Anderson, J.W., Wiltsie, J., Diaz, C.A., Harris, G., Chang, B., Darkin-Rattray, S.J., Nare, B., Crumley, T., Blum, P.S., Misura, A.S., Tamas, T., Sardana, M.K., Yuan, J., Biftu, T., Schmatz, D.M., 2002. Purification and molecular characterization of cGMP dependent protein kinase from Apicomplexan parasites. A novel chemotherapeutic target. J. Biol. Chem. 277, 15913–15922. Hermoso, T., Fishelson, Z., Becker, S.I., Hirschberg, K., Jaffe, C.L., 1991. Leishmanial protein kinases phosphorylate components of the complement system. EMBO J. 10, 4061–4067. Hirumi, H., Martin, S., Hirumi, K., Inoue, N., Kanbara, H., Saito, A., Suzuki, N., 1997. Short communication: cultivation of bloodstream forms of Trypanosoma brucei and T. evansi in a serum-free medium. Trop. Med. Int. Health 2, 240–244.

J.J. Allocco et al. / International Journal for Parasitology 36 (2006) 1249–1259 Iovannisci, D.M., Ullman, B., 1983. High-efficiency plating method for Leishmania promastigotes in semi defined or completely defined medium. J. Parasitol. 69, 633–636. Knippschild, U., Gocht, A., Wolff, S., Huber, N., Lohler, J., Stoter, M., 2005. The casein kinase 1 family: participation in multiple cellular processes in eukaryotes. Cell Signal. 17, 675–689. Knockaert, M., Gray, N., Damiens, E., Chang, Y.T., Grellier, P., Grant, K., Fergusson, D., Mottram, J., Soete, M., Dubremetz, J.F., Le Roch, K., Doerig, C., Schultz, P., Meijer, L., 2000. Intracellular targets of cyclin-dependent kinase inhibitors: identification by affinity chromatography using immobilized inhibitors. Chem. Biol. 7, 411–422. Liang, G.B., Qian, X., Biftu, T.F.D., Fisher, M., Crumley, T., DarkinRattray, S.J., Dulski, P.M., Gurnett, A., Leavitt, P.S., Liberator, P.A., Misura, A.S., Samaras, S., Tamas, T., Schmatz, D.M., Wyvratt, M., 2005. Hydroxylated N-alkyl-4-piperidinyl-2,3-diarylpyrrole derivatives as potent broad-spectrum anticoccidial agents. Bioorg. Med. Chem. Lett. 15, 4570–4573. Lisnock, J., Tebben, A., Frantz, B., O’Neill, E.A., Croft, G., O’Keefe, S.J., Li, B., Hacker, C., de Laszlo, S., Smith, A., Libby, B., Liverton, N., Hermes, J., LoGrasso, P., 1998. Molecular basis for p38 protein kinase inhibitor specificity. Biochemistry 37, 16573–16581. Nare, B., Allocco, J.J., Liberator, P.A., Donald, R.G.K., 2002. Evaluation of a cyclic GMP-dependent protein kinase inhibitor in treatment of murine toxoplasmosis: gamma interferon is required for efficacy. Antimicrob. Agents Chemother. 46, 300–307.

1259

Sacerdoti-Sierra, N., Jaffe, C.L., 1997. Release of ecto-protein kinases by the protozoan parasite Leishmania major. J. Biol. Chem. 272, 30760– 30765. Salowe, S.P., Wiltsie, J., Liberator, P.A., Donald, R.G.K., 2002. The role of a parasite-specific allosteric site in the distinctive activation behavior of Eimeria tenella cGMP-dependent protein kinase. Biochemistry 41, 4385–4391. Shevchenko, A., Wilm, M., Vorm, O., Mann, M., 1996. Mass spectrometric sequencing of proteins from silver-stained polyacrylamide gels. Anal. Chem. 68, 850–858. Spadafora, C., Repetto, Y., Torres, C., Pino, L., Robello, C., Morello, A., Gamarro, F., Castanys, S., 2002. Two casein kinase 1 isoforms are differentially expressed in Trypanosoma cruzi. Mol. Biochem. Parasitol. 124, 23–36. Sundar, S., More, D.K., Singh, M.K., Singh, V.P., Sharma, S., Makharia, A., 2000. Failure of pentavalent antimony in visceral leishmaniasis in India: report from the center of the Indian epidemic. Clin. Infect. Dis. 31, 1104–1107. Vieira, L.L., Sacerdoti-Sierra, N., Jaffe, C.L., 2002. Effect of pH and temperature on protein kinase release by Leishmania donovani. Int. J. Parasitol. 32, 1085–1093. Wiersma, H.I., Galuska, S.E., Tomley, F.M., Sibley, L.D., Liberator, P.A., Donald, R.G.K., 2004. A role for coccidian cGMP-dependent protein kinase in motility and invasion. Int. J. Parasitol. 34, 369– 380.